SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-b6bb63ce/inputs/seq.fa: 1 curr_seq: _CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CUCCUCUGACUGUAACCACGUAUACGCGCUUGCCCCUUAGUCAUACGAACUGAUUCAAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..................(((((...................)))))....((.....))_ nucl1: 22, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 21, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 20, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 52, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 51, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 59 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 172.530323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 172.530323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.948076 (E_RNA) where: Base-Base interactions energy: -11.102 where: short stacking energy: -11.102 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 417.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -392.313575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.313575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.500783 (E_RNA) where: Base-Base interactions energy: -230.200 where: short stacking energy: -107.977 Base-Backbone interact. energy: 1.011 local terms energy: -165.312396 where: bonds (distance) C4'-P energy: -37.795 bonds (distance) P-C4' energy: -39.748 flat angles C4'-P-C4' energy: -35.423 flat angles P-C4'-P energy: -26.212 tors. eta vs tors. theta energy: -26.133 Dist. restrs. and SS energy: 2.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -430.338162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.338162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.338162 (E_RNA) where: Base-Base interactions energy: -254.017 where: short stacking energy: -134.934 Base-Backbone interact. energy: -0.481 local terms energy: -175.839618 where: bonds (distance) C4'-P energy: -36.885 bonds (distance) P-C4' energy: -41.043 flat angles C4'-P-C4' energy: -36.069 flat angles P-C4'-P energy: -26.729 tors. eta vs tors. theta energy: -35.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -342.491291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.491291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.126275 (E_RNA) where: Base-Base interactions energy: -188.792 where: short stacking energy: -113.247 Base-Backbone interact. energy: -0.719 local terms energy: -154.615518 where: bonds (distance) C4'-P energy: -42.554 bonds (distance) P-C4' energy: -40.077 flat angles C4'-P-C4' energy: -36.816 flat angles P-C4'-P energy: -21.141 tors. eta vs tors. theta energy: -14.027 Dist. restrs. and SS energy: 1.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -317.116823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.116823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.562718 (E_RNA) where: Base-Base interactions energy: -179.087 where: short stacking energy: -122.283 Base-Backbone interact. energy: -1.143 local terms energy: -144.332495 where: bonds (distance) C4'-P energy: -38.090 bonds (distance) P-C4' energy: -31.806 flat angles C4'-P-C4' energy: -32.948 flat angles P-C4'-P energy: -16.598 tors. eta vs tors. theta energy: -24.890 Dist. restrs. and SS energy: 7.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -321.155357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.155357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.399193 (E_RNA) where: Base-Base interactions energy: -190.709 where: short stacking energy: -105.455 Base-Backbone interact. energy: 1.515 local terms energy: -134.206127 where: bonds (distance) C4'-P energy: -29.963 bonds (distance) P-C4' energy: -35.159 flat angles C4'-P-C4' energy: -27.055 flat angles P-C4'-P energy: -20.215 tors. eta vs tors. theta energy: -21.814 Dist. restrs. and SS energy: 2.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -308.059543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.059543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.255267 (E_RNA) where: Base-Base interactions energy: -168.062 where: short stacking energy: -89.551 Base-Backbone interact. energy: 0.387 local terms energy: -141.580204 where: bonds (distance) C4'-P energy: -39.770 bonds (distance) P-C4' energy: -33.305 flat angles C4'-P-C4' energy: -32.762 flat angles P-C4'-P energy: -24.938 tors. eta vs tors. theta energy: -10.805 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -308.553892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.553892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.559699 (E_RNA) where: Base-Base interactions energy: -170.855 where: short stacking energy: -82.397 Base-Backbone interact. energy: -0.539 local terms energy: -138.165749 where: bonds (distance) C4'-P energy: -28.070 bonds (distance) P-C4' energy: -36.705 flat angles C4'-P-C4' energy: -31.674 flat angles P-C4'-P energy: -21.730 tors. eta vs tors. theta energy: -19.987 Dist. restrs. and SS energy: 1.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -259.270672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.270672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.377509 (E_RNA) where: Base-Base interactions energy: -144.644 where: short stacking energy: -68.861 Base-Backbone interact. energy: -0.556 local terms energy: -116.177731 where: bonds (distance) C4'-P energy: -32.689 bonds (distance) P-C4' energy: -30.788 flat angles C4'-P-C4' energy: -27.077 flat angles P-C4'-P energy: -14.112 tors. eta vs tors. theta energy: -11.512 Dist. restrs. and SS energy: 2.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -208.152385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.152385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.773568 (E_RNA) where: Base-Base interactions energy: -101.499 where: short stacking energy: -58.968 Base-Backbone interact. energy: -0.282 local terms energy: -113.992587 where: bonds (distance) C4'-P energy: -38.293 bonds (distance) P-C4' energy: -30.308 flat angles C4'-P-C4' energy: -32.388 flat angles P-C4'-P energy: -10.852 tors. eta vs tors. theta energy: -2.152 Dist. restrs. and SS energy: 7.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -253.571453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.571453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.261286 (E_RNA) where: Base-Base interactions energy: -141.784 where: short stacking energy: -65.239 Base-Backbone interact. energy: 0.318 local terms energy: -112.795225 where: bonds (distance) C4'-P energy: -24.427 bonds (distance) P-C4' energy: -30.301 flat angles C4'-P-C4' energy: -32.075 flat angles P-C4'-P energy: -21.003 tors. eta vs tors. theta energy: -4.991 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -452.137814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.137814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.179839 (E_RNA) where: Base-Base interactions energy: -280.968 where: short stacking energy: -131.956 Base-Backbone interact. energy: -1.478 local terms energy: -173.733346 where: bonds (distance) C4'-P energy: -34.650 bonds (distance) P-C4' energy: -38.715 flat angles C4'-P-C4' energy: -29.989 flat angles P-C4'-P energy: -31.194 tors. eta vs tors. theta energy: -39.186 Dist. restrs. and SS energy: 4.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -493.974291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.974291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.239543 (E_RNA) where: Base-Base interactions energy: -315.093 where: short stacking energy: -151.053 Base-Backbone interact. energy: -0.034 local terms energy: -179.112550 where: bonds (distance) C4'-P energy: -35.789 bonds (distance) P-C4' energy: -44.546 flat angles C4'-P-C4' energy: -40.482 flat angles P-C4'-P energy: -15.649 tors. eta vs tors. theta energy: -42.645 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -408.719649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.719649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.184154 (E_RNA) where: Base-Base interactions energy: -245.842 where: short stacking energy: -128.479 Base-Backbone interact. energy: -0.968 local terms energy: -162.374586 where: bonds (distance) C4'-P energy: -37.908 bonds (distance) P-C4' energy: -40.673 flat angles C4'-P-C4' energy: -33.493 flat angles P-C4'-P energy: -21.728 tors. eta vs tors. theta energy: -28.574 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -368.329980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.329980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.943502 (E_RNA) where: Base-Base interactions energy: -205.982 where: short stacking energy: -116.968 Base-Backbone interact. energy: -0.564 local terms energy: -162.397648 where: bonds (distance) C4'-P energy: -37.467 bonds (distance) P-C4' energy: -41.441 flat angles C4'-P-C4' energy: -26.693 flat angles P-C4'-P energy: -27.743 tors. eta vs tors. theta energy: -29.054 Dist. restrs. and SS energy: 0.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -397.551035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.551035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.891187 (E_RNA) where: Base-Base interactions energy: -235.040 where: short stacking energy: -110.878 Base-Backbone interact. energy: -0.294 local terms energy: -164.556999 where: bonds (distance) C4'-P energy: -40.637 bonds (distance) P-C4' energy: -41.870 flat angles C4'-P-C4' energy: -33.130 flat angles P-C4'-P energy: -27.841 tors. eta vs tors. theta energy: -21.079 Dist. restrs. and SS energy: 2.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -391.513272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.513272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.635307 (E_RNA) where: Base-Base interactions energy: -219.391 where: short stacking energy: -112.325 Base-Backbone interact. energy: -0.605 local terms energy: -171.639754 where: bonds (distance) C4'-P energy: -30.463 bonds (distance) P-C4' energy: -35.710 flat angles C4'-P-C4' energy: -45.637 flat angles P-C4'-P energy: -24.723 tors. eta vs tors. theta energy: -35.108 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -321.000975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.000975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.557284 (E_RNA) where: Base-Base interactions energy: -192.459 where: short stacking energy: -90.877 Base-Backbone interact. energy: 0.068 local terms energy: -132.167022 where: bonds (distance) C4'-P energy: -24.103 bonds (distance) P-C4' energy: -40.905 flat angles C4'-P-C4' energy: -30.202 flat angles P-C4'-P energy: -19.783 tors. eta vs tors. theta energy: -17.175 Dist. restrs. and SS energy: 3.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -248.738873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.738873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.996952 (E_RNA) where: Base-Base interactions energy: -155.410 where: short stacking energy: -65.689 Base-Backbone interact. energy: 5.142 local terms energy: -102.728148 where: bonds (distance) C4'-P energy: -22.234 bonds (distance) P-C4' energy: -37.144 flat angles C4'-P-C4' energy: -33.589 flat angles P-C4'-P energy: -8.873 tors. eta vs tors. theta energy: -0.888 Dist. restrs. and SS energy: 4.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -235.031322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.031322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.158702 (E_RNA) where: Base-Base interactions energy: -118.427 where: short stacking energy: -53.718 Base-Backbone interact. energy: 1.035 local terms energy: -119.766609 where: bonds (distance) C4'-P energy: -33.411 bonds (distance) P-C4' energy: -28.428 flat angles C4'-P-C4' energy: -39.818 flat angles P-C4'-P energy: -14.950 tors. eta vs tors. theta energy: -3.159 Dist. restrs. and SS energy: 2.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -258.674641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.674641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.306848 (E_RNA) where: Base-Base interactions energy: -144.739 where: short stacking energy: -68.160 Base-Backbone interact. energy: -1.529 local terms energy: -115.038346 where: bonds (distance) C4'-P energy: -36.938 bonds (distance) P-C4' energy: -26.765 flat angles C4'-P-C4' energy: -29.455 flat angles P-C4'-P energy: -20.321 tors. eta vs tors. theta energy: -1.558 Dist. restrs. and SS energy: 2.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -512.627046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.627046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.698676 (E_RNA) where: Base-Base interactions energy: -328.667 where: short stacking energy: -137.192 Base-Backbone interact. energy: -0.616 local terms energy: -183.416082 where: bonds (distance) C4'-P energy: -42.248 bonds (distance) P-C4' energy: -32.773 flat angles C4'-P-C4' energy: -44.693 flat angles P-C4'-P energy: -24.546 tors. eta vs tors. theta energy: -39.157 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -454.958503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.958503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.130963 (E_RNA) where: Base-Base interactions energy: -271.483 where: short stacking energy: -148.826 Base-Backbone interact. energy: -0.294 local terms energy: -189.353488 where: bonds (distance) C4'-P energy: -43.877 bonds (distance) P-C4' energy: -38.359 flat angles C4'-P-C4' energy: -39.146 flat angles P-C4'-P energy: -25.228 tors. eta vs tors. theta energy: -42.744 Dist. restrs. and SS energy: 6.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -424.069187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.069187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.452643 (E_RNA) where: Base-Base interactions energy: -241.098 where: short stacking energy: -154.784 Base-Backbone interact. energy: -1.411 local terms energy: -181.944013 where: bonds (distance) C4'-P energy: -36.892 bonds (distance) P-C4' energy: -38.693 flat angles C4'-P-C4' energy: -40.992 flat angles P-C4'-P energy: -25.074 tors. eta vs tors. theta energy: -40.293 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -390.072720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.072720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.076214 (E_RNA) where: Base-Base interactions energy: -228.647 where: short stacking energy: -108.758 Base-Backbone interact. energy: -0.800 local terms energy: -160.629131 where: bonds (distance) C4'-P energy: -30.947 bonds (distance) P-C4' energy: -45.256 flat angles C4'-P-C4' energy: -24.017 flat angles P-C4'-P energy: -31.692 tors. eta vs tors. theta energy: -28.717 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -405.632689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.632689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.820736 (E_RNA) where: Base-Base interactions energy: -254.228 where: short stacking energy: -113.767 Base-Backbone interact. energy: -1.138 local terms energy: -152.454416 where: bonds (distance) C4'-P energy: -34.178 bonds (distance) P-C4' energy: -36.160 flat angles C4'-P-C4' energy: -35.241 flat angles P-C4'-P energy: -20.096 tors. eta vs tors. theta energy: -26.779 Dist. restrs. and SS energy: 2.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -338.980013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.980013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.002814 (E_RNA) where: Base-Base interactions energy: -186.215 where: short stacking energy: -109.907 Base-Backbone interact. energy: -0.522 local terms energy: -152.265915 where: bonds (distance) C4'-P energy: -34.339 bonds (distance) P-C4' energy: -37.705 flat angles C4'-P-C4' energy: -38.926 flat angles P-C4'-P energy: -19.900 tors. eta vs tors. theta energy: -21.397 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -328.888721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.888721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.092527 (E_RNA) where: Base-Base interactions energy: -191.793 where: short stacking energy: -96.351 Base-Backbone interact. energy: -2.750 local terms energy: -134.549704 where: bonds (distance) C4'-P energy: -28.323 bonds (distance) P-C4' energy: -39.449 flat angles C4'-P-C4' energy: -33.081 flat angles P-C4'-P energy: -14.666 tors. eta vs tors. theta energy: -19.031 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -306.806987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.806987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.136710 (E_RNA) where: Base-Base interactions energy: -172.431 where: short stacking energy: -87.358 Base-Backbone interact. energy: 0.060 local terms energy: -134.766246 where: bonds (distance) C4'-P energy: -36.678 bonds (distance) P-C4' energy: -33.510 flat angles C4'-P-C4' energy: -32.562 flat angles P-C4'-P energy: -24.863 tors. eta vs tors. theta energy: -7.153 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -287.652559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.652559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.291968 (E_RNA) where: Base-Base interactions energy: -152.904 where: short stacking energy: -86.782 Base-Backbone interact. energy: -0.708 local terms energy: -134.679814 where: bonds (distance) C4'-P energy: -35.069 bonds (distance) P-C4' energy: -24.333 flat angles C4'-P-C4' energy: -40.083 flat angles P-C4'-P energy: -18.385 tors. eta vs tors. theta energy: -16.811 Dist. restrs. and SS energy: 0.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -218.794104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.794104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.363213 (E_RNA) where: Base-Base interactions energy: -109.645 where: short stacking energy: -51.434 Base-Backbone interact. energy: -0.252 local terms energy: -110.466661 where: bonds (distance) C4'-P energy: -31.093 bonds (distance) P-C4' energy: -33.027 flat angles C4'-P-C4' energy: -27.150 flat angles P-C4'-P energy: -21.032 tors. eta vs tors. theta energy: 1.835 Dist. restrs. and SS energy: 1.569 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -538.210942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.210942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.558447 (E_RNA) where: Base-Base interactions energy: -353.804 where: short stacking energy: -145.074 Base-Backbone interact. energy: -0.694 local terms energy: -184.059909 where: bonds (distance) C4'-P energy: -39.981 bonds (distance) P-C4' energy: -42.067 flat angles C4'-P-C4' energy: -40.385 flat angles P-C4'-P energy: -23.707 tors. eta vs tors. theta energy: -37.919 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -463.183016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.183016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.939302 (E_RNA) where: Base-Base interactions energy: -309.292 where: short stacking energy: -149.622 Base-Backbone interact. energy: -0.898 local terms energy: -158.749980 where: bonds (distance) C4'-P energy: -25.140 bonds (distance) P-C4' energy: -37.087 flat angles C4'-P-C4' energy: -39.635 flat angles P-C4'-P energy: -18.551 tors. eta vs tors. theta energy: -38.336 Dist. restrs. and SS energy: 5.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -459.194962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.194962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.673573 (E_RNA) where: Base-Base interactions energy: -279.299 where: short stacking energy: -136.124 Base-Backbone interact. energy: -0.454 local terms energy: -179.921069 where: bonds (distance) C4'-P energy: -36.728 bonds (distance) P-C4' energy: -36.121 flat angles C4'-P-C4' energy: -37.244 flat angles P-C4'-P energy: -32.836 tors. eta vs tors. theta energy: -36.992 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -426.715948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.715948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.866609 (E_RNA) where: Base-Base interactions energy: -275.712 where: short stacking energy: -114.063 Base-Backbone interact. energy: -0.238 local terms energy: -152.916475 where: bonds (distance) C4'-P energy: -28.654 bonds (distance) P-C4' energy: -39.805 flat angles C4'-P-C4' energy: -41.389 flat angles P-C4'-P energy: -22.378 tors. eta vs tors. theta energy: -20.691 Dist. restrs. and SS energy: 2.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -403.580001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.580001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.633711 (E_RNA) where: Base-Base interactions energy: -250.733 where: short stacking energy: -118.959 Base-Backbone interact. energy: -0.516 local terms energy: -152.385079 where: bonds (distance) C4'-P energy: -25.600 bonds (distance) P-C4' energy: -44.446 flat angles C4'-P-C4' energy: -37.357 flat angles P-C4'-P energy: -18.633 tors. eta vs tors. theta energy: -26.349 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -403.889488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.889488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.973577 (E_RNA) where: Base-Base interactions energy: -243.578 where: short stacking energy: -106.526 Base-Backbone interact. energy: -0.376 local terms energy: -160.019646 where: bonds (distance) C4'-P energy: -38.540 bonds (distance) P-C4' energy: -36.975 flat angles C4'-P-C4' energy: -39.028 flat angles P-C4'-P energy: -20.534 tors. eta vs tors. theta energy: -24.942 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -353.345049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.345049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.706286 (E_RNA) where: Base-Base interactions energy: -212.108 where: short stacking energy: -99.372 Base-Backbone interact. energy: -0.665 local terms energy: -140.933580 where: bonds (distance) C4'-P energy: -34.565 bonds (distance) P-C4' energy: -36.093 flat angles C4'-P-C4' energy: -28.828 flat angles P-C4'-P energy: -21.870 tors. eta vs tors. theta energy: -19.577 Dist. restrs. and SS energy: 0.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -294.140981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.140981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.412055 (E_RNA) where: Base-Base interactions energy: -151.059 where: short stacking energy: -80.553 Base-Backbone interact. energy: -0.576 local terms energy: -144.776439 where: bonds (distance) C4'-P energy: -34.155 bonds (distance) P-C4' energy: -40.067 flat angles C4'-P-C4' energy: -28.224 flat angles P-C4'-P energy: -22.324 tors. eta vs tors. theta energy: -20.006 Dist. restrs. and SS energy: 2.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -291.635503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.635503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.411451 (E_RNA) where: Base-Base interactions energy: -159.065 where: short stacking energy: -84.167 Base-Backbone interact. energy: -0.187 local terms energy: -133.160153 where: bonds (distance) C4'-P energy: -30.740 bonds (distance) P-C4' energy: -31.836 flat angles C4'-P-C4' energy: -33.092 flat angles P-C4'-P energy: -21.716 tors. eta vs tors. theta energy: -15.776 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -241.300076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.300076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.679312 (E_RNA) where: Base-Base interactions energy: -128.309 where: short stacking energy: -71.540 Base-Backbone interact. energy: -0.432 local terms energy: -113.937873 where: bonds (distance) C4'-P energy: -34.652 bonds (distance) P-C4' energy: -26.043 flat angles C4'-P-C4' energy: -28.770 flat angles P-C4'-P energy: -15.878 tors. eta vs tors. theta energy: -8.595 Dist. restrs. and SS energy: 1.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -536.377126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.377126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.428197 (E_RNA) where: Base-Base interactions energy: -347.515 where: short stacking energy: -136.621 Base-Backbone interact. energy: -0.938 local terms energy: -187.975266 where: bonds (distance) C4'-P energy: -40.939 bonds (distance) P-C4' energy: -40.866 flat angles C4'-P-C4' energy: -41.704 flat angles P-C4'-P energy: -30.832 tors. eta vs tors. theta energy: -33.634 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -467.161708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.161708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.645732 (E_RNA) where: Base-Base interactions energy: -295.906 where: short stacking energy: -134.617 Base-Backbone interact. energy: 2.534 local terms energy: -182.273470 where: bonds (distance) C4'-P energy: -40.947 bonds (distance) P-C4' energy: -44.123 flat angles C4'-P-C4' energy: -32.290 flat angles P-C4'-P energy: -31.250 tors. eta vs tors. theta energy: -33.662 Dist. restrs. and SS energy: 8.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -464.130916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.130916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.799395 (E_RNA) where: Base-Base interactions energy: -297.439 where: short stacking energy: -128.506 Base-Backbone interact. energy: -1.808 local terms energy: -166.552777 where: bonds (distance) C4'-P energy: -29.036 bonds (distance) P-C4' energy: -39.209 flat angles C4'-P-C4' energy: -36.461 flat angles P-C4'-P energy: -31.592 tors. eta vs tors. theta energy: -30.254 Dist. restrs. and SS energy: 1.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -433.017976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.017976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.176964 (E_RNA) where: Base-Base interactions energy: -267.643 where: short stacking energy: -131.136 Base-Backbone interact. energy: -0.481 local terms energy: -165.053105 where: bonds (distance) C4'-P energy: -34.268 bonds (distance) P-C4' energy: -38.113 flat angles C4'-P-C4' energy: -36.999 flat angles P-C4'-P energy: -23.799 tors. eta vs tors. theta energy: -31.875 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -409.177773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.177773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.310429 (E_RNA) where: Base-Base interactions energy: -260.195 where: short stacking energy: -113.582 Base-Backbone interact. energy: -0.069 local terms energy: -149.046334 where: bonds (distance) C4'-P energy: -33.431 bonds (distance) P-C4' energy: -30.683 flat angles C4'-P-C4' energy: -28.928 flat angles P-C4'-P energy: -29.076 tors. eta vs tors. theta energy: -26.929 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -414.102119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.102119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.486999 (E_RNA) where: Base-Base interactions energy: -243.529 where: short stacking energy: -136.552 Base-Backbone interact. energy: -1.037 local terms energy: -169.921173 where: bonds (distance) C4'-P energy: -32.796 bonds (distance) P-C4' energy: -31.805 flat angles C4'-P-C4' energy: -38.476 flat angles P-C4'-P energy: -29.494 tors. eta vs tors. theta energy: -37.350 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -351.636744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.636744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.814368 (E_RNA) where: Base-Base interactions energy: -203.336 where: short stacking energy: -99.676 Base-Backbone interact. energy: -0.687 local terms energy: -147.790937 where: bonds (distance) C4'-P energy: -31.190 bonds (distance) P-C4' energy: -41.765 flat angles C4'-P-C4' energy: -20.493 flat angles P-C4'-P energy: -27.554 tors. eta vs tors. theta energy: -26.788 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -329.889188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.889188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.929909 (E_RNA) where: Base-Base interactions energy: -203.174 where: short stacking energy: -87.442 Base-Backbone interact. energy: 1.017 local terms energy: -128.772997 where: bonds (distance) C4'-P energy: -30.168 bonds (distance) P-C4' energy: -34.802 flat angles C4'-P-C4' energy: -27.667 flat angles P-C4'-P energy: -24.935 tors. eta vs tors. theta energy: -11.201 Dist. restrs. and SS energy: 1.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -315.436080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.436080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.738317 (E_RNA) where: Base-Base interactions energy: -159.856 where: short stacking energy: -83.592 Base-Backbone interact. energy: -0.383 local terms energy: -155.499353 where: bonds (distance) C4'-P energy: -33.776 bonds (distance) P-C4' energy: -37.675 flat angles C4'-P-C4' energy: -41.074 flat angles P-C4'-P energy: -22.631 tors. eta vs tors. theta energy: -20.343 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -269.275210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.275210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.314244 (E_RNA) where: Base-Base interactions energy: -149.516 where: short stacking energy: -71.598 Base-Backbone interact. energy: -2.003 local terms energy: -117.795238 where: bonds (distance) C4'-P energy: -32.346 bonds (distance) P-C4' energy: -31.484 flat angles C4'-P-C4' energy: -27.724 flat angles P-C4'-P energy: -13.798 tors. eta vs tors. theta energy: -12.444 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -547.446257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.446257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.446257 (E_RNA) where: Base-Base interactions energy: -366.848 where: short stacking energy: -140.995 Base-Backbone interact. energy: 0.799 local terms energy: -181.396939 where: bonds (distance) C4'-P energy: -33.428 bonds (distance) P-C4' energy: -36.896 flat angles C4'-P-C4' energy: -44.273 flat angles P-C4'-P energy: -29.507 tors. eta vs tors. theta energy: -37.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -472.664777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.664777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.242773 (E_RNA) where: Base-Base interactions energy: -301.980 where: short stacking energy: -126.265 Base-Backbone interact. energy: -0.616 local terms energy: -179.646092 where: bonds (distance) C4'-P energy: -38.151 bonds (distance) P-C4' energy: -43.919 flat angles C4'-P-C4' energy: -41.738 flat angles P-C4'-P energy: -25.650 tors. eta vs tors. theta energy: -30.188 Dist. restrs. and SS energy: 9.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -466.062520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.062520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.575995 (E_RNA) where: Base-Base interactions energy: -300.810 where: short stacking energy: -135.750 Base-Backbone interact. energy: -0.818 local terms energy: -165.948319 where: bonds (distance) C4'-P energy: -31.952 bonds (distance) P-C4' energy: -43.303 flat angles C4'-P-C4' energy: -39.652 flat angles P-C4'-P energy: -23.128 tors. eta vs tors. theta energy: -27.913 Dist. restrs. and SS energy: 1.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -418.160871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.160871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.244058 (E_RNA) where: Base-Base interactions energy: -249.067 where: short stacking energy: -130.913 Base-Backbone interact. energy: -0.343 local terms energy: -168.834242 where: bonds (distance) C4'-P energy: -28.165 bonds (distance) P-C4' energy: -39.115 flat angles C4'-P-C4' energy: -40.071 flat angles P-C4'-P energy: -27.168 tors. eta vs tors. theta energy: -34.315 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -444.143145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.143145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.314803 (E_RNA) where: Base-Base interactions energy: -267.500 where: short stacking energy: -137.864 Base-Backbone interact. energy: 0.574 local terms energy: -177.389220 where: bonds (distance) C4'-P energy: -35.915 bonds (distance) P-C4' energy: -38.293 flat angles C4'-P-C4' energy: -43.500 flat angles P-C4'-P energy: -19.318 tors. eta vs tors. theta energy: -40.363 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -368.225243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.225243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.438745 (E_RNA) where: Base-Base interactions energy: -224.702 where: short stacking energy: -114.722 Base-Backbone interact. energy: -0.641 local terms energy: -143.095183 where: bonds (distance) C4'-P energy: -19.087 bonds (distance) P-C4' energy: -42.198 flat angles C4'-P-C4' energy: -33.899 flat angles P-C4'-P energy: -21.370 tors. eta vs tors. theta energy: -26.541 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -389.065361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.065361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.598874 (E_RNA) where: Base-Base interactions energy: -235.772 where: short stacking energy: -113.586 Base-Backbone interact. energy: -1.038 local terms energy: -152.789219 where: bonds (distance) C4'-P energy: -37.842 bonds (distance) P-C4' energy: -27.587 flat angles C4'-P-C4' energy: -38.312 flat angles P-C4'-P energy: -19.688 tors. eta vs tors. theta energy: -29.360 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -345.170688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.170688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.741726 (E_RNA) where: Base-Base interactions energy: -195.559 where: short stacking energy: -104.021 Base-Backbone interact. energy: 0.016 local terms energy: -152.199005 where: bonds (distance) C4'-P energy: -34.732 bonds (distance) P-C4' energy: -33.040 flat angles C4'-P-C4' energy: -37.436 flat angles P-C4'-P energy: -25.771 tors. eta vs tors. theta energy: -21.221 Dist. restrs. and SS energy: 2.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -301.224493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.224493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.566363 (E_RNA) where: Base-Base interactions energy: -157.905 where: short stacking energy: -86.478 Base-Backbone interact. energy: -0.473 local terms energy: -143.188683 where: bonds (distance) C4'-P energy: -38.510 bonds (distance) P-C4' energy: -35.732 flat angles C4'-P-C4' energy: -30.996 flat angles P-C4'-P energy: -23.144 tors. eta vs tors. theta energy: -14.806 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -267.472516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.472516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.435366 (E_RNA) where: Base-Base interactions energy: -145.470 where: short stacking energy: -64.357 Base-Backbone interact. energy: -0.257 local terms energy: -122.707770 where: bonds (distance) C4'-P energy: -38.698 bonds (distance) P-C4' energy: -32.643 flat angles C4'-P-C4' energy: -37.811 flat angles P-C4'-P energy: -11.994 tors. eta vs tors. theta energy: -1.562 Dist. restrs. and SS energy: 0.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -552.991542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.991542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.223210 (E_RNA) where: Base-Base interactions energy: -364.788 where: short stacking energy: -147.393 Base-Backbone interact. energy: 3.336 local terms energy: -191.771457 where: bonds (distance) C4'-P energy: -43.297 bonds (distance) P-C4' energy: -37.515 flat angles C4'-P-C4' energy: -44.585 flat angles P-C4'-P energy: -26.207 tors. eta vs tors. theta energy: -40.168 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -443.487992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.487992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.442392 (E_RNA) where: Base-Base interactions energy: -279.942 where: short stacking energy: -124.277 Base-Backbone interact. energy: -2.609 local terms energy: -172.892067 where: bonds (distance) C4'-P energy: -31.577 bonds (distance) P-C4' energy: -39.445 flat angles C4'-P-C4' energy: -38.168 flat angles P-C4'-P energy: -31.153 tors. eta vs tors. theta energy: -32.550 Dist. restrs. and SS energy: 11.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -481.822490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.822490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.691384 (E_RNA) where: Base-Base interactions energy: -319.585 where: short stacking energy: -142.714 Base-Backbone interact. energy: -1.147 local terms energy: -162.959991 where: bonds (distance) C4'-P energy: -25.340 bonds (distance) P-C4' energy: -43.000 flat angles C4'-P-C4' energy: -35.143 flat angles P-C4'-P energy: -27.302 tors. eta vs tors. theta energy: -32.175 Dist. restrs. and SS energy: 1.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -412.936504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.936504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.082425 (E_RNA) where: Base-Base interactions energy: -237.998 where: short stacking energy: -119.704 Base-Backbone interact. energy: -1.033 local terms energy: -174.051422 where: bonds (distance) C4'-P energy: -39.637 bonds (distance) P-C4' energy: -40.726 flat angles C4'-P-C4' energy: -32.569 flat angles P-C4'-P energy: -29.014 tors. eta vs tors. theta energy: -32.104 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -415.944415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.944415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.061165 (E_RNA) where: Base-Base interactions energy: -277.293 where: short stacking energy: -114.917 Base-Backbone interact. energy: 1.845 local terms energy: -140.613148 where: bonds (distance) C4'-P energy: -39.197 bonds (distance) P-C4' energy: -34.145 flat angles C4'-P-C4' energy: -31.170 flat angles P-C4'-P energy: -15.504 tors. eta vs tors. theta energy: -20.598 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -376.825101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.825101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.544183 (E_RNA) where: Base-Base interactions energy: -233.091 where: short stacking energy: -96.587 Base-Backbone interact. energy: 0.084 local terms energy: -144.537304 where: bonds (distance) C4'-P energy: -38.070 bonds (distance) P-C4' energy: -35.924 flat angles C4'-P-C4' energy: -35.387 flat angles P-C4'-P energy: -15.697 tors. eta vs tors. theta energy: -19.460 Dist. restrs. and SS energy: 0.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -399.070532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.070532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.505851 (E_RNA) where: Base-Base interactions energy: -248.204 where: short stacking energy: -116.915 Base-Backbone interact. energy: 0.973 local terms energy: -152.274630 where: bonds (distance) C4'-P energy: -37.641 bonds (distance) P-C4' energy: -32.163 flat angles C4'-P-C4' energy: -35.183 flat angles P-C4'-P energy: -22.167 tors. eta vs tors. theta energy: -25.121 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -333.399690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.399690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.063360 (E_RNA) where: Base-Base interactions energy: -180.357 where: short stacking energy: -82.584 Base-Backbone interact. energy: 0.103 local terms energy: -153.808599 where: bonds (distance) C4'-P energy: -38.769 bonds (distance) P-C4' energy: -42.990 flat angles C4'-P-C4' energy: -32.501 flat angles P-C4'-P energy: -20.753 tors. eta vs tors. theta energy: -18.795 Dist. restrs. and SS energy: 0.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -290.124231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.124231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.503771 (E_RNA) where: Base-Base interactions energy: -163.224 where: short stacking energy: -67.171 Base-Backbone interact. energy: -0.578 local terms energy: -126.702033 where: bonds (distance) C4'-P energy: -33.276 bonds (distance) P-C4' energy: -31.566 flat angles C4'-P-C4' energy: -34.185 flat angles P-C4'-P energy: -15.443 tors. eta vs tors. theta energy: -12.231 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -260.728009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.728009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.323481 (E_RNA) where: Base-Base interactions energy: -149.223 where: short stacking energy: -64.992 Base-Backbone interact. energy: -1.005 local terms energy: -111.095812 where: bonds (distance) C4'-P energy: -38.671 bonds (distance) P-C4' energy: -27.153 flat angles C4'-P-C4' energy: -22.213 flat angles P-C4'-P energy: -18.971 tors. eta vs tors. theta energy: -4.088 Dist. restrs. and SS energy: 0.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -540.933280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.933280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.256536 (E_RNA) where: Base-Base interactions energy: -358.439 where: short stacking energy: -151.619 Base-Backbone interact. energy: -0.674 local terms energy: -182.143884 where: bonds (distance) C4'-P energy: -39.614 bonds (distance) P-C4' energy: -40.765 flat angles C4'-P-C4' energy: -42.277 flat angles P-C4'-P energy: -25.064 tors. eta vs tors. theta energy: -34.424 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -483.720936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.720936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.972560 (E_RNA) where: Base-Base interactions energy: -320.099 where: short stacking energy: -140.117 Base-Backbone interact. energy: -1.265 local terms energy: -162.609412 where: bonds (distance) C4'-P energy: -33.187 bonds (distance) P-C4' energy: -44.802 flat angles C4'-P-C4' energy: -38.785 flat angles P-C4'-P energy: -20.295 tors. eta vs tors. theta energy: -25.541 Dist. restrs. and SS energy: 0.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -437.931057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.931057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.280375 (E_RNA) where: Base-Base interactions energy: -260.594 where: short stacking energy: -120.783 Base-Backbone interact. energy: -0.473 local terms energy: -186.213358 where: bonds (distance) C4'-P energy: -41.963 bonds (distance) P-C4' energy: -37.468 flat angles C4'-P-C4' energy: -43.204 flat angles P-C4'-P energy: -25.293 tors. eta vs tors. theta energy: -38.287 Dist. restrs. and SS energy: 9.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -462.339337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.339337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.380623 (E_RNA) where: Base-Base interactions energy: -272.343 where: short stacking energy: -148.079 Base-Backbone interact. energy: -0.422 local terms energy: -189.614951 where: bonds (distance) C4'-P energy: -39.260 bonds (distance) P-C4' energy: -35.714 flat angles C4'-P-C4' energy: -46.142 flat angles P-C4'-P energy: -23.454 tors. eta vs tors. theta energy: -45.045 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -406.063604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.063604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.149220 (E_RNA) where: Base-Base interactions energy: -239.211 where: short stacking energy: -113.499 Base-Backbone interact. energy: -0.845 local terms energy: -166.093148 where: bonds (distance) C4'-P energy: -40.565 bonds (distance) P-C4' energy: -31.246 flat angles C4'-P-C4' energy: -45.568 flat angles P-C4'-P energy: -26.600 tors. eta vs tors. theta energy: -22.115 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -427.081444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.081444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.618620 (E_RNA) where: Base-Base interactions energy: -259.516 where: short stacking energy: -127.437 Base-Backbone interact. energy: -0.136 local terms energy: -167.966677 where: bonds (distance) C4'-P energy: -31.627 bonds (distance) P-C4' energy: -36.148 flat angles C4'-P-C4' energy: -38.207 flat angles P-C4'-P energy: -23.617 tors. eta vs tors. theta energy: -38.368 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -341.082436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.082436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.257008 (E_RNA) where: Base-Base interactions energy: -206.225 where: short stacking energy: -108.726 Base-Backbone interact. energy: -1.274 local terms energy: -133.758172 where: bonds (distance) C4'-P energy: -26.523 bonds (distance) P-C4' energy: -39.078 flat angles C4'-P-C4' energy: -25.454 flat angles P-C4'-P energy: -22.461 tors. eta vs tors. theta energy: -20.243 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -300.462787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.462787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.518269 (E_RNA) where: Base-Base interactions energy: -168.661 where: short stacking energy: -80.915 Base-Backbone interact. energy: -1.336 local terms energy: -130.521459 where: bonds (distance) C4'-P energy: -35.059 bonds (distance) P-C4' energy: -44.876 flat angles C4'-P-C4' energy: -27.564 flat angles P-C4'-P energy: -12.181 tors. eta vs tors. theta energy: -10.842 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -317.937792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.937792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.143321 (E_RNA) where: Base-Base interactions energy: -187.855 where: short stacking energy: -99.926 Base-Backbone interact. energy: -1.264 local terms energy: -129.024831 where: bonds (distance) C4'-P energy: -30.550 bonds (distance) P-C4' energy: -37.047 flat angles C4'-P-C4' energy: -24.067 flat angles P-C4'-P energy: -16.212 tors. eta vs tors. theta energy: -21.150 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -282.860270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.860270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.286788 (E_RNA) where: Base-Base interactions energy: -158.464 where: short stacking energy: -81.320 Base-Backbone interact. energy: -0.513 local terms energy: -129.309671 where: bonds (distance) C4'-P energy: -36.718 bonds (distance) P-C4' energy: -33.928 flat angles C4'-P-C4' energy: -33.646 flat angles P-C4'-P energy: -10.782 tors. eta vs tors. theta energy: -14.235 Dist. restrs. and SS energy: 5.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -544.103201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.103201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.278520 (E_RNA) where: Base-Base interactions energy: -356.702 where: short stacking energy: -159.088 Base-Backbone interact. energy: -1.564 local terms energy: -186.012609 where: bonds (distance) C4'-P energy: -28.103 bonds (distance) P-C4' energy: -40.733 flat angles C4'-P-C4' energy: -42.669 flat angles P-C4'-P energy: -28.234 tors. eta vs tors. theta energy: -46.273 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -516.093748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.093748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.528793 (E_RNA) where: Base-Base interactions energy: -338.924 where: short stacking energy: -147.879 Base-Backbone interact. energy: -0.492 local terms energy: -177.112711 where: bonds (distance) C4'-P energy: -39.941 bonds (distance) P-C4' energy: -44.337 flat angles C4'-P-C4' energy: -35.682 flat angles P-C4'-P energy: -25.713 tors. eta vs tors. theta energy: -31.441 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -443.307608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.307608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.576325 (E_RNA) where: Base-Base interactions energy: -274.107 where: short stacking energy: -136.594 Base-Backbone interact. energy: 0.932 local terms energy: -170.401587 where: bonds (distance) C4'-P energy: -37.836 bonds (distance) P-C4' energy: -38.449 flat angles C4'-P-C4' energy: -42.990 flat angles P-C4'-P energy: -19.081 tors. eta vs tors. theta energy: -32.045 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -398.754723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.754723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.703142 (E_RNA) where: Base-Base interactions energy: -237.758 where: short stacking energy: -99.571 Base-Backbone interact. energy: -1.970 local terms energy: -164.975055 where: bonds (distance) C4'-P energy: -37.770 bonds (distance) P-C4' energy: -40.844 flat angles C4'-P-C4' energy: -41.223 flat angles P-C4'-P energy: -19.562 tors. eta vs tors. theta energy: -25.575 Dist. restrs. and SS energy: 5.948 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -474.322124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.322124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.589828 (E_RNA) where: Base-Base interactions energy: -293.427 where: short stacking energy: -154.435 Base-Backbone interact. energy: -0.849 local terms energy: -180.314405 where: bonds (distance) C4'-P energy: -31.940 bonds (distance) P-C4' energy: -38.586 flat angles C4'-P-C4' energy: -39.318 flat angles P-C4'-P energy: -25.201 tors. eta vs tors. theta energy: -45.269 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -470.458856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.458856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.559171 (E_RNA) where: Base-Base interactions energy: -307.180 where: short stacking energy: -132.585 Base-Backbone interact. energy: -0.520 local terms energy: -162.858726 where: bonds (distance) C4'-P energy: -39.878 bonds (distance) P-C4' energy: -39.718 flat angles C4'-P-C4' energy: -23.888 flat angles P-C4'-P energy: -22.189 tors. eta vs tors. theta energy: -37.187 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -343.318162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.318162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.607889 (E_RNA) where: Base-Base interactions energy: -205.513 where: short stacking energy: -105.017 Base-Backbone interact. energy: -0.909 local terms energy: -137.186154 where: bonds (distance) C4'-P energy: -29.079 bonds (distance) P-C4' energy: -38.007 flat angles C4'-P-C4' energy: -34.566 flat angles P-C4'-P energy: -17.397 tors. eta vs tors. theta energy: -18.138 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -321.634643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.634643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.891709 (E_RNA) where: Base-Base interactions energy: -174.028 where: short stacking energy: -98.217 Base-Backbone interact. energy: 0.396 local terms energy: -148.259421 where: bonds (distance) C4'-P energy: -42.233 bonds (distance) P-C4' energy: -25.536 flat angles C4'-P-C4' energy: -36.804 flat angles P-C4'-P energy: -19.098 tors. eta vs tors. theta energy: -24.588 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -269.512894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.512894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.090289 (E_RNA) where: Base-Base interactions energy: -158.193 where: short stacking energy: -66.690 Base-Backbone interact. energy: 1.313 local terms energy: -114.210559 where: bonds (distance) C4'-P energy: -29.349 bonds (distance) P-C4' energy: -28.257 flat angles C4'-P-C4' energy: -25.867 flat angles P-C4'-P energy: -20.193 tors. eta vs tors. theta energy: -10.545 Dist. restrs. and SS energy: 1.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -256.527764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.527764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.897936 (E_RNA) where: Base-Base interactions energy: -134.933 where: short stacking energy: -62.720 Base-Backbone interact. energy: 0.097 local terms energy: -122.061967 where: bonds (distance) C4'-P energy: -36.874 bonds (distance) P-C4' energy: -27.659 flat angles C4'-P-C4' energy: -29.576 flat angles P-C4'-P energy: -20.004 tors. eta vs tors. theta energy: -7.949 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -552.374978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.374978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.397932 (E_RNA) where: Base-Base interactions energy: -347.734 where: short stacking energy: -175.645 Base-Backbone interact. energy: -0.441 local terms energy: -204.222094 where: bonds (distance) C4'-P energy: -38.578 bonds (distance) P-C4' energy: -42.313 flat angles C4'-P-C4' energy: -47.058 flat angles P-C4'-P energy: -25.144 tors. eta vs tors. theta energy: -51.130 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -496.263013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.263013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.462383 (E_RNA) where: Base-Base interactions energy: -315.035 where: short stacking energy: -163.391 Base-Backbone interact. energy: 1.601 local terms energy: -183.028628 where: bonds (distance) C4'-P energy: -40.197 bonds (distance) P-C4' energy: -38.635 flat angles C4'-P-C4' energy: -43.511 flat angles P-C4'-P energy: -23.640 tors. eta vs tors. theta energy: -37.046 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -504.273126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.273126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.578240 (E_RNA) where: Base-Base interactions energy: -329.048 where: short stacking energy: -140.141 Base-Backbone interact. energy: 2.315 local terms energy: -177.845644 where: bonds (distance) C4'-P energy: -37.583 bonds (distance) P-C4' energy: -37.457 flat angles C4'-P-C4' energy: -42.627 flat angles P-C4'-P energy: -26.168 tors. eta vs tors. theta energy: -34.010 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -488.816029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.816029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.142128 (E_RNA) where: Base-Base interactions energy: -301.559 where: short stacking energy: -132.357 Base-Backbone interact. energy: 0.877 local terms energy: -188.460158 where: bonds (distance) C4'-P energy: -39.762 bonds (distance) P-C4' energy: -39.446 flat angles C4'-P-C4' energy: -40.753 flat angles P-C4'-P energy: -30.977 tors. eta vs tors. theta energy: -37.522 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -378.751969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.751969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.946692 (E_RNA) where: Base-Base interactions energy: -242.558 where: short stacking energy: -101.636 Base-Backbone interact. energy: -1.441 local terms energy: -137.947827 where: bonds (distance) C4'-P energy: -34.495 bonds (distance) P-C4' energy: -35.006 flat angles C4'-P-C4' energy: -26.831 flat angles P-C4'-P energy: -22.718 tors. eta vs tors. theta energy: -18.897 Dist. restrs. and SS energy: 3.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -454.818221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.818221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.982920 (E_RNA) where: Base-Base interactions energy: -296.639 where: short stacking energy: -128.479 Base-Backbone interact. energy: -0.406 local terms energy: -157.938607 where: bonds (distance) C4'-P energy: -24.586 bonds (distance) P-C4' energy: -44.119 flat angles C4'-P-C4' energy: -36.597 flat angles P-C4'-P energy: -23.252 tors. eta vs tors. theta energy: -29.385 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -330.962732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.962732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.004416 (E_RNA) where: Base-Base interactions energy: -174.270 where: short stacking energy: -80.965 Base-Backbone interact. energy: -0.613 local terms energy: -156.121484 where: bonds (distance) C4'-P energy: -37.755 bonds (distance) P-C4' energy: -34.971 flat angles C4'-P-C4' energy: -35.228 flat angles P-C4'-P energy: -29.898 tors. eta vs tors. theta energy: -18.270 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -333.756411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.756411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.011776 (E_RNA) where: Base-Base interactions energy: -186.226 where: short stacking energy: -72.187 Base-Backbone interact. energy: -2.983 local terms energy: -144.802821 where: bonds (distance) C4'-P energy: -34.994 bonds (distance) P-C4' energy: -41.853 flat angles C4'-P-C4' energy: -34.603 flat angles P-C4'-P energy: -21.064 tors. eta vs tors. theta energy: -12.289 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -302.527871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.527871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.934737 (E_RNA) where: Base-Base interactions energy: -175.228 where: short stacking energy: -83.102 Base-Backbone interact. energy: -0.594 local terms energy: -127.113456 where: bonds (distance) C4'-P energy: -25.535 bonds (distance) P-C4' energy: -34.068 flat angles C4'-P-C4' energy: -30.869 flat angles P-C4'-P energy: -24.710 tors. eta vs tors. theta energy: -11.930 Dist. restrs. and SS energy: 0.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -245.148972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.148972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.565849 (E_RNA) where: Base-Base interactions energy: -134.141 where: short stacking energy: -67.437 Base-Backbone interact. energy: 0.494 local terms energy: -116.918931 where: bonds (distance) C4'-P energy: -32.800 bonds (distance) P-C4' energy: -29.433 flat angles C4'-P-C4' energy: -31.974 flat angles P-C4'-P energy: -17.228 tors. eta vs tors. theta energy: -5.484 Dist. restrs. and SS energy: 5.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -535.682040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.682040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.690018 (E_RNA) where: Base-Base interactions energy: -345.346 where: short stacking energy: -153.459 Base-Backbone interact. energy: 0.302 local terms energy: -190.646125 where: bonds (distance) C4'-P energy: -41.368 bonds (distance) P-C4' energy: -44.438 flat angles C4'-P-C4' energy: -39.631 flat angles P-C4'-P energy: -23.677 tors. eta vs tors. theta energy: -41.533 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -502.059072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.059072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.218503 (E_RNA) where: Base-Base interactions energy: -302.699 where: short stacking energy: -153.264 Base-Backbone interact. energy: -0.437 local terms energy: -199.082628 where: bonds (distance) C4'-P energy: -43.240 bonds (distance) P-C4' energy: -44.027 flat angles C4'-P-C4' energy: -36.356 flat angles P-C4'-P energy: -34.097 tors. eta vs tors. theta energy: -41.362 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -509.725627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.725627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.210655 (E_RNA) where: Base-Base interactions energy: -325.205 where: short stacking energy: -142.883 Base-Backbone interact. energy: -1.692 local terms energy: -183.312895 where: bonds (distance) C4'-P energy: -37.073 bonds (distance) P-C4' energy: -35.090 flat angles C4'-P-C4' energy: -44.614 flat angles P-C4'-P energy: -32.325 tors. eta vs tors. theta energy: -34.211 Dist. restrs. and SS energy: 0.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -487.795462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.795462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.090021 (E_RNA) where: Base-Base interactions energy: -315.692 where: short stacking energy: -130.590 Base-Backbone interact. energy: -1.662 local terms energy: -170.736164 where: bonds (distance) C4'-P energy: -43.098 bonds (distance) P-C4' energy: -41.327 flat angles C4'-P-C4' energy: -34.698 flat angles P-C4'-P energy: -16.653 tors. eta vs tors. theta energy: -34.960 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -454.875103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.875103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.974443 (E_RNA) where: Base-Base interactions energy: -286.015 where: short stacking energy: -120.700 Base-Backbone interact. energy: -0.150 local terms energy: -168.808869 where: bonds (distance) C4'-P energy: -35.319 bonds (distance) P-C4' energy: -43.328 flat angles C4'-P-C4' energy: -35.628 flat angles P-C4'-P energy: -18.190 tors. eta vs tors. theta energy: -36.344 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -322.232305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.232305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.371736 (E_RNA) where: Base-Base interactions energy: -194.249 where: short stacking energy: -90.007 Base-Backbone interact. energy: -0.460 local terms energy: -131.663681 where: bonds (distance) C4'-P energy: -28.581 bonds (distance) P-C4' energy: -33.819 flat angles C4'-P-C4' energy: -37.192 flat angles P-C4'-P energy: -17.751 tors. eta vs tors. theta energy: -14.321 Dist. restrs. and SS energy: 4.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -377.442232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.442232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.578379 (E_RNA) where: Base-Base interactions energy: -220.749 where: short stacking energy: -102.876 Base-Backbone interact. energy: -0.869 local terms energy: -155.960823 where: bonds (distance) C4'-P energy: -31.069 bonds (distance) P-C4' energy: -38.359 flat angles C4'-P-C4' energy: -35.059 flat angles P-C4'-P energy: -24.386 tors. eta vs tors. theta energy: -27.088 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -338.811921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.811921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.538410 (E_RNA) where: Base-Base interactions energy: -183.735 where: short stacking energy: -90.111 Base-Backbone interact. energy: -0.179 local terms energy: -155.624100 where: bonds (distance) C4'-P energy: -37.359 bonds (distance) P-C4' energy: -37.774 flat angles C4'-P-C4' energy: -39.552 flat angles P-C4'-P energy: -25.102 tors. eta vs tors. theta energy: -15.837 Dist. restrs. and SS energy: 0.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -261.180793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.180793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.884575 (E_RNA) where: Base-Base interactions energy: -139.810 where: short stacking energy: -71.485 Base-Backbone interact. energy: -0.511 local terms energy: -124.562868 where: bonds (distance) C4'-P energy: -33.722 bonds (distance) P-C4' energy: -26.594 flat angles C4'-P-C4' energy: -39.116 flat angles P-C4'-P energy: -11.919 tors. eta vs tors. theta energy: -13.213 Dist. restrs. and SS energy: 3.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -265.378082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.378082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.851475 (E_RNA) where: Base-Base interactions energy: -147.410 where: short stacking energy: -81.377 Base-Backbone interact. energy: -0.411 local terms energy: -120.029940 where: bonds (distance) C4'-P energy: -32.389 bonds (distance) P-C4' energy: -31.109 flat angles C4'-P-C4' energy: -34.791 flat angles P-C4'-P energy: -12.560 tors. eta vs tors. theta energy: -9.181 Dist. restrs. and SS energy: 2.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -553.898644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.898644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.987647 (E_RNA) where: Base-Base interactions energy: -351.295 where: short stacking energy: -173.459 Base-Backbone interact. energy: -0.472 local terms energy: -202.220455 where: bonds (distance) C4'-P energy: -37.859 bonds (distance) P-C4' energy: -40.503 flat angles C4'-P-C4' energy: -43.220 flat angles P-C4'-P energy: -29.478 tors. eta vs tors. theta energy: -51.160 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -492.131611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.131611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.245744 (E_RNA) where: Base-Base interactions energy: -310.873 where: short stacking energy: -158.041 Base-Backbone interact. energy: -0.534 local terms energy: -180.839010 where: bonds (distance) C4'-P energy: -36.518 bonds (distance) P-C4' energy: -32.677 flat angles C4'-P-C4' energy: -41.029 flat angles P-C4'-P energy: -28.034 tors. eta vs tors. theta energy: -42.581 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -494.153669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.153669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.573885 (E_RNA) where: Base-Base interactions energy: -314.565 where: short stacking energy: -149.611 Base-Backbone interact. energy: 1.866 local terms energy: -181.874213 where: bonds (distance) C4'-P energy: -38.831 bonds (distance) P-C4' energy: -36.374 flat angles C4'-P-C4' energy: -38.336 flat angles P-C4'-P energy: -27.490 tors. eta vs tors. theta energy: -40.843 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -467.800885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.800885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.889769 (E_RNA) where: Base-Base interactions energy: -301.983 where: short stacking energy: -129.123 Base-Backbone interact. energy: -0.064 local terms energy: -165.842117 where: bonds (distance) C4'-P energy: -41.379 bonds (distance) P-C4' energy: -38.286 flat angles C4'-P-C4' energy: -30.123 flat angles P-C4'-P energy: -21.795 tors. eta vs tors. theta energy: -34.260 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -454.344875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.344875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.544489 (E_RNA) where: Base-Base interactions energy: -286.450 where: short stacking energy: -125.204 Base-Backbone interact. energy: -1.417 local terms energy: -166.677525 where: bonds (distance) C4'-P energy: -34.454 bonds (distance) P-C4' energy: -35.215 flat angles C4'-P-C4' energy: -34.936 flat angles P-C4'-P energy: -23.151 tors. eta vs tors. theta energy: -38.922 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -405.261627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.261627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.456550 (E_RNA) where: Base-Base interactions energy: -248.874 where: short stacking energy: -107.307 Base-Backbone interact. energy: 1.753 local terms energy: -158.335850 where: bonds (distance) C4'-P energy: -32.339 bonds (distance) P-C4' energy: -39.867 flat angles C4'-P-C4' energy: -34.112 flat angles P-C4'-P energy: -29.678 tors. eta vs tors. theta energy: -22.339 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -285.750862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.750862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.130524 (E_RNA) where: Base-Base interactions energy: -151.827 where: short stacking energy: -81.043 Base-Backbone interact. energy: 0.279 local terms energy: -138.582259 where: bonds (distance) C4'-P energy: -35.494 bonds (distance) P-C4' energy: -37.953 flat angles C4'-P-C4' energy: -32.868 flat angles P-C4'-P energy: -23.268 tors. eta vs tors. theta energy: -8.999 Dist. restrs. and SS energy: 4.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -279.070943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.070943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.593735 (E_RNA) where: Base-Base interactions energy: -156.264 where: short stacking energy: -68.915 Base-Backbone interact. energy: -1.040 local terms energy: -122.289660 where: bonds (distance) C4'-P energy: -27.109 bonds (distance) P-C4' energy: -44.941 flat angles C4'-P-C4' energy: -31.985 flat angles P-C4'-P energy: -12.972 tors. eta vs tors. theta energy: -5.282 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -295.705692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.705692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.816569 (E_RNA) where: Base-Base interactions energy: -166.654 where: short stacking energy: -85.764 Base-Backbone interact. energy: -0.653 local terms energy: -128.508950 where: bonds (distance) C4'-P energy: -30.089 bonds (distance) P-C4' energy: -31.604 flat angles C4'-P-C4' energy: -27.930 flat angles P-C4'-P energy: -24.216 tors. eta vs tors. theta energy: -14.670 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -249.005512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.005512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.656136 (E_RNA) where: Base-Base interactions energy: -137.957 where: short stacking energy: -59.074 Base-Backbone interact. energy: -0.579 local terms energy: -113.120285 where: bonds (distance) C4'-P energy: -34.497 bonds (distance) P-C4' energy: -37.273 flat angles C4'-P-C4' energy: -26.673 flat angles P-C4'-P energy: -13.969 tors. eta vs tors. theta energy: -0.708 Dist. restrs. and SS energy: 2.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -529.928080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.928080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.973122 (E_RNA) where: Base-Base interactions energy: -339.434 where: short stacking energy: -154.539 Base-Backbone interact. energy: -0.779 local terms energy: -189.760831 where: bonds (distance) C4'-P energy: -38.665 bonds (distance) P-C4' energy: -39.972 flat angles C4'-P-C4' energy: -42.642 flat angles P-C4'-P energy: -24.966 tors. eta vs tors. theta energy: -43.516 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -509.293270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.293270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.418247 (E_RNA) where: Base-Base interactions energy: -320.758 where: short stacking energy: -158.978 Base-Backbone interact. energy: -1.507 local terms energy: -187.154119 where: bonds (distance) C4'-P energy: -30.075 bonds (distance) P-C4' energy: -43.710 flat angles C4'-P-C4' energy: -38.953 flat angles P-C4'-P energy: -24.265 tors. eta vs tors. theta energy: -50.151 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -511.173971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.173971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.298453 (E_RNA) where: Base-Base interactions energy: -321.400 where: short stacking energy: -150.263 Base-Backbone interact. energy: -0.602 local terms energy: -189.296644 where: bonds (distance) C4'-P energy: -35.603 bonds (distance) P-C4' energy: -37.899 flat angles C4'-P-C4' energy: -42.837 flat angles P-C4'-P energy: -28.647 tors. eta vs tors. theta energy: -44.312 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -457.690640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.690640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.865360 (E_RNA) where: Base-Base interactions energy: -270.799 where: short stacking energy: -144.426 Base-Backbone interact. energy: -0.568 local terms energy: -186.498090 where: bonds (distance) C4'-P energy: -36.613 bonds (distance) P-C4' energy: -42.257 flat angles C4'-P-C4' energy: -36.497 flat angles P-C4'-P energy: -28.046 tors. eta vs tors. theta energy: -43.086 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -444.834499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.834499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.202396 (E_RNA) where: Base-Base interactions energy: -273.691 where: short stacking energy: -121.986 Base-Backbone interact. energy: -0.549 local terms energy: -170.962073 where: bonds (distance) C4'-P energy: -35.688 bonds (distance) P-C4' energy: -31.759 flat angles C4'-P-C4' energy: -36.288 flat angles P-C4'-P energy: -30.200 tors. eta vs tors. theta energy: -37.026 Dist. restrs. and SS energy: 0.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -427.770220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.770220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.218049 (E_RNA) where: Base-Base interactions energy: -269.177 where: short stacking energy: -120.677 Base-Backbone interact. energy: -0.988 local terms energy: -158.054037 where: bonds (distance) C4'-P energy: -34.683 bonds (distance) P-C4' energy: -29.698 flat angles C4'-P-C4' energy: -42.486 flat angles P-C4'-P energy: -22.858 tors. eta vs tors. theta energy: -28.329 Dist. restrs. and SS energy: 0.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -317.426996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.426996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.507922 (E_RNA) where: Base-Base interactions energy: -190.282 where: short stacking energy: -77.333 Base-Backbone interact. energy: 3.199 local terms energy: -130.424317 where: bonds (distance) C4'-P energy: -33.870 bonds (distance) P-C4' energy: -31.885 flat angles C4'-P-C4' energy: -34.944 flat angles P-C4'-P energy: -17.356 tors. eta vs tors. theta energy: -12.368 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -263.782062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.782062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.493501 (E_RNA) where: Base-Base interactions energy: -128.297 where: short stacking energy: -74.133 Base-Backbone interact. energy: -0.854 local terms energy: -137.342345 where: bonds (distance) C4'-P energy: -31.618 bonds (distance) P-C4' energy: -41.622 flat angles C4'-P-C4' energy: -31.920 flat angles P-C4'-P energy: -20.221 tors. eta vs tors. theta energy: -11.962 Dist. restrs. and SS energy: 2.711 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -284.337468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.337468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.438061 (E_RNA) where: Base-Base interactions energy: -163.900 where: short stacking energy: -63.571 Base-Backbone interact. energy: 1.250 local terms energy: -121.788858 where: bonds (distance) C4'-P energy: -32.802 bonds (distance) P-C4' energy: -36.769 flat angles C4'-P-C4' energy: -32.731 flat angles P-C4'-P energy: -14.930 tors. eta vs tors. theta energy: -4.558 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -271.936981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.936981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.365364 (E_RNA) where: Base-Base interactions energy: -152.787 where: short stacking energy: -77.870 Base-Backbone interact. energy: 0.605 local terms energy: -120.183992 where: bonds (distance) C4'-P energy: -29.821 bonds (distance) P-C4' energy: -37.954 flat angles C4'-P-C4' energy: -21.928 flat angles P-C4'-P energy: -19.565 tors. eta vs tors. theta energy: -10.915 Dist. restrs. and SS energy: 0.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -543.296843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.296843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.323325 (E_RNA) where: Base-Base interactions energy: -352.769 where: short stacking energy: -171.326 Base-Backbone interact. energy: -0.867 local terms energy: -189.687181 where: bonds (distance) C4'-P energy: -36.680 bonds (distance) P-C4' energy: -40.794 flat angles C4'-P-C4' energy: -39.009 flat angles P-C4'-P energy: -25.956 tors. eta vs tors. theta energy: -47.249 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -536.583714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.583714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.701001 (E_RNA) where: Base-Base interactions energy: -341.553 where: short stacking energy: -154.609 Base-Backbone interact. energy: -1.087 local terms energy: -194.060375 where: bonds (distance) C4'-P energy: -39.156 bonds (distance) P-C4' energy: -41.063 flat angles C4'-P-C4' energy: -41.599 flat angles P-C4'-P energy: -28.639 tors. eta vs tors. theta energy: -43.603 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -480.394484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.394484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.673910 (E_RNA) where: Base-Base interactions energy: -304.319 where: short stacking energy: -158.078 Base-Backbone interact. energy: -0.190 local terms energy: -176.164594 where: bonds (distance) C4'-P energy: -36.862 bonds (distance) P-C4' energy: -43.303 flat angles C4'-P-C4' energy: -37.143 flat angles P-C4'-P energy: -19.753 tors. eta vs tors. theta energy: -39.104 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -432.115378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.115378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.298758 (E_RNA) where: Base-Base interactions energy: -261.860 where: short stacking energy: -132.570 Base-Backbone interact. energy: -0.710 local terms energy: -169.729078 where: bonds (distance) C4'-P energy: -34.666 bonds (distance) P-C4' energy: -43.466 flat angles C4'-P-C4' energy: -35.073 flat angles P-C4'-P energy: -27.210 tors. eta vs tors. theta energy: -29.314 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -427.155924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.155924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.463400 (E_RNA) where: Base-Base interactions energy: -270.417 where: short stacking energy: -119.023 Base-Backbone interact. energy: -0.384 local terms energy: -156.662377 where: bonds (distance) C4'-P energy: -34.215 bonds (distance) P-C4' energy: -36.310 flat angles C4'-P-C4' energy: -32.745 flat angles P-C4'-P energy: -20.501 tors. eta vs tors. theta energy: -32.892 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -444.447396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.447396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.738929 (E_RNA) where: Base-Base interactions energy: -286.306 where: short stacking energy: -129.427 Base-Backbone interact. energy: -1.043 local terms energy: -157.389769 where: bonds (distance) C4'-P energy: -38.010 bonds (distance) P-C4' energy: -39.995 flat angles C4'-P-C4' energy: -25.308 flat angles P-C4'-P energy: -15.643 tors. eta vs tors. theta energy: -38.433 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -337.559702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.559702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.642295 (E_RNA) where: Base-Base interactions energy: -200.062 where: short stacking energy: -109.836 Base-Backbone interact. energy: 0.307 local terms energy: -137.887440 where: bonds (distance) C4'-P energy: -39.037 bonds (distance) P-C4' energy: -30.186 flat angles C4'-P-C4' energy: -29.657 flat angles P-C4'-P energy: -16.157 tors. eta vs tors. theta energy: -22.852 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -332.299783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.299783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.301762 (E_RNA) where: Base-Base interactions energy: -185.464 where: short stacking energy: -89.077 Base-Backbone interact. energy: 0.655 local terms energy: -147.493658 where: bonds (distance) C4'-P energy: -36.837 bonds (distance) P-C4' energy: -38.195 flat angles C4'-P-C4' energy: -36.937 flat angles P-C4'-P energy: -18.690 tors. eta vs tors. theta energy: -16.835 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -262.466392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.466392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.655863 (E_RNA) where: Base-Base interactions energy: -144.748 where: short stacking energy: -74.029 Base-Backbone interact. energy: -0.460 local terms energy: -118.447753 where: bonds (distance) C4'-P energy: -30.864 bonds (distance) P-C4' energy: -35.662 flat angles C4'-P-C4' energy: -34.574 flat angles P-C4'-P energy: -4.167 tors. eta vs tors. theta energy: -13.181 Dist. restrs. and SS energy: 1.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -286.876620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.876620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.249921 (E_RNA) where: Base-Base interactions energy: -161.644 where: short stacking energy: -77.608 Base-Backbone interact. energy: 1.584 local terms energy: -127.190196 where: bonds (distance) C4'-P energy: -38.167 bonds (distance) P-C4' energy: -31.999 flat angles C4'-P-C4' energy: -29.324 flat angles P-C4'-P energy: -18.592 tors. eta vs tors. theta energy: -9.108 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -550.001067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.001067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.122919 (E_RNA) where: Base-Base interactions energy: -355.194 where: short stacking energy: -159.378 Base-Backbone interact. energy: 3.733 local terms energy: -198.661070 where: bonds (distance) C4'-P energy: -39.214 bonds (distance) P-C4' energy: -46.002 flat angles C4'-P-C4' energy: -40.245 flat angles P-C4'-P energy: -26.604 tors. eta vs tors. theta energy: -46.596 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -529.565845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.565845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.587403 (E_RNA) where: Base-Base interactions energy: -341.787 where: short stacking energy: -164.906 Base-Backbone interact. energy: -1.150 local terms energy: -186.650398 where: bonds (distance) C4'-P energy: -40.291 bonds (distance) P-C4' energy: -42.572 flat angles C4'-P-C4' energy: -36.209 flat angles P-C4'-P energy: -22.919 tors. eta vs tors. theta energy: -44.659 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -474.879288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.879288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.179325 (E_RNA) where: Base-Base interactions energy: -300.769 where: short stacking energy: -137.226 Base-Backbone interact. energy: -0.171 local terms energy: -174.238563 where: bonds (distance) C4'-P energy: -38.845 bonds (distance) P-C4' energy: -33.219 flat angles C4'-P-C4' energy: -44.976 flat angles P-C4'-P energy: -20.884 tors. eta vs tors. theta energy: -36.314 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -477.259420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.259420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.364299 (E_RNA) where: Base-Base interactions energy: -282.597 where: short stacking energy: -146.681 Base-Backbone interact. energy: 0.014 local terms energy: -194.781465 where: bonds (distance) C4'-P energy: -40.677 bonds (distance) P-C4' energy: -33.833 flat angles C4'-P-C4' energy: -44.153 flat angles P-C4'-P energy: -22.894 tors. eta vs tors. theta energy: -53.225 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -458.922120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.922120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.937927 (E_RNA) where: Base-Base interactions energy: -292.991 where: short stacking energy: -139.115 Base-Backbone interact. energy: -0.108 local terms energy: -165.839448 where: bonds (distance) C4'-P energy: -30.605 bonds (distance) P-C4' energy: -45.610 flat angles C4'-P-C4' energy: -33.126 flat angles P-C4'-P energy: -19.333 tors. eta vs tors. theta energy: -37.165 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -399.568470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.568470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.971483 (E_RNA) where: Base-Base interactions energy: -230.227 where: short stacking energy: -107.552 Base-Backbone interact. energy: -0.366 local terms energy: -169.378157 where: bonds (distance) C4'-P energy: -32.292 bonds (distance) P-C4' energy: -41.802 flat angles C4'-P-C4' energy: -39.208 flat angles P-C4'-P energy: -28.988 tors. eta vs tors. theta energy: -27.087 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -329.054178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.054178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.106644 (E_RNA) where: Base-Base interactions energy: -183.637 where: short stacking energy: -90.071 Base-Backbone interact. energy: 1.391 local terms energy: -146.859895 where: bonds (distance) C4'-P energy: -31.575 bonds (distance) P-C4' energy: -37.053 flat angles C4'-P-C4' energy: -43.873 flat angles P-C4'-P energy: -21.527 tors. eta vs tors. theta energy: -12.832 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -325.757807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.757807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.935578 (E_RNA) where: Base-Base interactions energy: -186.634 where: short stacking energy: -86.026 Base-Backbone interact. energy: -1.562 local terms energy: -137.739643 where: bonds (distance) C4'-P energy: -31.266 bonds (distance) P-C4' energy: -40.527 flat angles C4'-P-C4' energy: -38.898 flat angles P-C4'-P energy: -12.303 tors. eta vs tors. theta energy: -14.746 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -278.991630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.991630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.480698 (E_RNA) where: Base-Base interactions energy: -162.600 where: short stacking energy: -80.712 Base-Backbone interact. energy: -1.043 local terms energy: -118.837998 where: bonds (distance) C4'-P energy: -25.041 bonds (distance) P-C4' energy: -30.332 flat angles C4'-P-C4' energy: -34.183 flat angles P-C4'-P energy: -23.043 tors. eta vs tors. theta energy: -6.239 Dist. restrs. and SS energy: 3.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -282.308077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.308077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.684585 (E_RNA) where: Base-Base interactions energy: -156.455 where: short stacking energy: -68.846 Base-Backbone interact. energy: -0.422 local terms energy: -125.807188 where: bonds (distance) C4'-P energy: -28.056 bonds (distance) P-C4' energy: -30.977 flat angles C4'-P-C4' energy: -32.778 flat angles P-C4'-P energy: -22.765 tors. eta vs tors. theta energy: -11.232 Dist. restrs. and SS energy: 0.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -552.552135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.552135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.643059 (E_RNA) where: Base-Base interactions energy: -352.770 where: short stacking energy: -160.830 Base-Backbone interact. energy: -0.537 local terms energy: -199.335637 where: bonds (distance) C4'-P energy: -37.581 bonds (distance) P-C4' energy: -40.989 flat angles C4'-P-C4' energy: -41.521 flat angles P-C4'-P energy: -31.415 tors. eta vs tors. theta energy: -47.829 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -484.744185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.744185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.885597 (E_RNA) where: Base-Base interactions energy: -314.216 where: short stacking energy: -143.724 Base-Backbone interact. energy: -0.999 local terms energy: -169.670041 where: bonds (distance) C4'-P energy: -42.386 bonds (distance) P-C4' energy: -37.025 flat angles C4'-P-C4' energy: -35.091 flat angles P-C4'-P energy: -20.510 tors. eta vs tors. theta energy: -34.658 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -457.565652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.565652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.595822 (E_RNA) where: Base-Base interactions energy: -290.073 where: short stacking energy: -117.811 Base-Backbone interact. energy: -0.817 local terms energy: -166.705788 where: bonds (distance) C4'-P energy: -41.873 bonds (distance) P-C4' energy: -40.551 flat angles C4'-P-C4' energy: -37.314 flat angles P-C4'-P energy: -21.618 tors. eta vs tors. theta energy: -25.350 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -475.926707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.926707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.931462 (E_RNA) where: Base-Base interactions energy: -301.258 where: short stacking energy: -141.956 Base-Backbone interact. energy: -0.118 local terms energy: -174.555370 where: bonds (distance) C4'-P energy: -35.086 bonds (distance) P-C4' energy: -35.598 flat angles C4'-P-C4' energy: -37.781 flat angles P-C4'-P energy: -26.762 tors. eta vs tors. theta energy: -39.328 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -430.143115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.143115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.162415 (E_RNA) where: Base-Base interactions energy: -261.161 where: short stacking energy: -122.007 Base-Backbone interact. energy: -2.935 local terms energy: -166.066585 where: bonds (distance) C4'-P energy: -33.940 bonds (distance) P-C4' energy: -33.456 flat angles C4'-P-C4' energy: -36.003 flat angles P-C4'-P energy: -26.188 tors. eta vs tors. theta energy: -36.480 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -419.236594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.236594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.331052 (E_RNA) where: Base-Base interactions energy: -248.272 where: short stacking energy: -126.755 Base-Backbone interact. energy: -0.741 local terms energy: -170.317829 where: bonds (distance) C4'-P energy: -33.599 bonds (distance) P-C4' energy: -42.465 flat angles C4'-P-C4' energy: -37.230 flat angles P-C4'-P energy: -24.808 tors. eta vs tors. theta energy: -32.216 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -331.115609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.115609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.627122 (E_RNA) where: Base-Base interactions energy: -182.663 where: short stacking energy: -97.065 Base-Backbone interact. energy: -0.723 local terms energy: -148.241604 where: bonds (distance) C4'-P energy: -34.332 bonds (distance) P-C4' energy: -32.802 flat angles C4'-P-C4' energy: -38.084 flat angles P-C4'-P energy: -24.718 tors. eta vs tors. theta energy: -18.306 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -348.537607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.537607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.858392 (E_RNA) where: Base-Base interactions energy: -211.175 where: short stacking energy: -100.853 Base-Backbone interact. energy: -0.119 local terms energy: -137.563759 where: bonds (distance) C4'-P energy: -35.546 bonds (distance) P-C4' energy: -32.948 flat angles C4'-P-C4' energy: -38.724 flat angles P-C4'-P energy: -7.340 tors. eta vs tors. theta energy: -23.005 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -262.817744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.817744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.798344 (E_RNA) where: Base-Base interactions energy: -140.116 where: short stacking energy: -76.190 Base-Backbone interact. energy: -1.051 local terms energy: -123.631313 where: bonds (distance) C4'-P energy: -36.253 bonds (distance) P-C4' energy: -35.764 flat angles C4'-P-C4' energy: -26.855 flat angles P-C4'-P energy: -16.540 tors. eta vs tors. theta energy: -8.219 Dist. restrs. and SS energy: 1.981 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -272.206085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.206085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.981057 (E_RNA) where: Base-Base interactions energy: -139.243 where: short stacking energy: -61.558 Base-Backbone interact. energy: -0.733 local terms energy: -133.005304 where: bonds (distance) C4'-P energy: -35.278 bonds (distance) P-C4' energy: -33.057 flat angles C4'-P-C4' energy: -22.396 flat angles P-C4'-P energy: -33.903 tors. eta vs tors. theta energy: -8.371 Dist. restrs. and SS energy: 0.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -560.424107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.424107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.431164 (E_RNA) where: Base-Base interactions energy: -364.004 where: short stacking energy: -159.680 Base-Backbone interact. energy: -1.825 local terms energy: -194.602270 where: bonds (distance) C4'-P energy: -39.454 bonds (distance) P-C4' energy: -37.690 flat angles C4'-P-C4' energy: -44.194 flat angles P-C4'-P energy: -27.663 tors. eta vs tors. theta energy: -45.602 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -502.307615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.307615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.325633 (E_RNA) where: Base-Base interactions energy: -319.328 where: short stacking energy: -165.066 Base-Backbone interact. energy: -0.620 local terms energy: -182.376944 where: bonds (distance) C4'-P energy: -35.145 bonds (distance) P-C4' energy: -37.352 flat angles C4'-P-C4' energy: -36.897 flat angles P-C4'-P energy: -24.825 tors. eta vs tors. theta energy: -48.158 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -504.475709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.475709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.522867 (E_RNA) where: Base-Base interactions energy: -326.531 where: short stacking energy: -154.455 Base-Backbone interact. energy: 0.867 local terms energy: -178.858994 where: bonds (distance) C4'-P energy: -35.324 bonds (distance) P-C4' energy: -41.803 flat angles C4'-P-C4' energy: -31.991 flat angles P-C4'-P energy: -26.090 tors. eta vs tors. theta energy: -43.652 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -471.149798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.149798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.354683 (E_RNA) where: Base-Base interactions energy: -306.604 where: short stacking energy: -151.477 Base-Backbone interact. energy: 0.200 local terms energy: -164.950934 where: bonds (distance) C4'-P energy: -35.744 bonds (distance) P-C4' energy: -32.534 flat angles C4'-P-C4' energy: -42.074 flat angles P-C4'-P energy: -18.585 tors. eta vs tors. theta energy: -36.013 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -441.240092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.240092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.519661 (E_RNA) where: Base-Base interactions energy: -273.555 where: short stacking energy: -137.162 Base-Backbone interact. energy: -0.598 local terms energy: -167.366526 where: bonds (distance) C4'-P energy: -36.195 bonds (distance) P-C4' energy: -37.520 flat angles C4'-P-C4' energy: -39.137 flat angles P-C4'-P energy: -20.910 tors. eta vs tors. theta energy: -33.605 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -415.927408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.927408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.050087 (E_RNA) where: Base-Base interactions energy: -241.802 where: short stacking energy: -118.225 Base-Backbone interact. energy: -1.925 local terms energy: -172.323565 where: bonds (distance) C4'-P energy: -29.780 bonds (distance) P-C4' energy: -40.507 flat angles C4'-P-C4' energy: -37.658 flat angles P-C4'-P energy: -28.835 tors. eta vs tors. theta energy: -35.544 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -385.096691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.096691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.338615 (E_RNA) where: Base-Base interactions energy: -243.195 where: short stacking energy: -118.921 Base-Backbone interact. energy: -0.511 local terms energy: -141.631804 where: bonds (distance) C4'-P energy: -36.760 bonds (distance) P-C4' energy: -34.345 flat angles C4'-P-C4' energy: -34.228 flat angles P-C4'-P energy: -10.390 tors. eta vs tors. theta energy: -25.908 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -314.954496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.954496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.095979 (E_RNA) where: Base-Base interactions energy: -182.440 where: short stacking energy: -90.286 Base-Backbone interact. energy: -0.068 local terms energy: -132.588184 where: bonds (distance) C4'-P energy: -39.956 bonds (distance) P-C4' energy: -43.812 flat angles C4'-P-C4' energy: -18.487 flat angles P-C4'-P energy: -14.605 tors. eta vs tors. theta energy: -15.730 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -283.677108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.677108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.574861 (E_RNA) where: Base-Base interactions energy: -157.487 where: short stacking energy: -80.501 Base-Backbone interact. energy: -0.273 local terms energy: -126.814085 where: bonds (distance) C4'-P energy: -30.104 bonds (distance) P-C4' energy: -25.610 flat angles C4'-P-C4' energy: -35.593 flat angles P-C4'-P energy: -16.087 tors. eta vs tors. theta energy: -19.420 Dist. restrs. and SS energy: 0.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -268.396481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.396481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.973964 (E_RNA) where: Base-Base interactions energy: -158.250 where: short stacking energy: -76.232 Base-Backbone interact. energy: -0.671 local terms energy: -111.053741 where: bonds (distance) C4'-P energy: -36.121 bonds (distance) P-C4' energy: -33.704 flat angles C4'-P-C4' energy: -18.211 flat angles P-C4'-P energy: -21.429 tors. eta vs tors. theta energy: -1.588 Dist. restrs. and SS energy: 1.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -565.628376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.628376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.779556 (E_RNA) where: Base-Base interactions energy: -375.668 where: short stacking energy: -142.392 Base-Backbone interact. energy: -2.665 local terms energy: -187.447025 where: bonds (distance) C4'-P energy: -36.136 bonds (distance) P-C4' energy: -44.216 flat angles C4'-P-C4' energy: -39.096 flat angles P-C4'-P energy: -25.867 tors. eta vs tors. theta energy: -42.133 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -494.640051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.640051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.767035 (E_RNA) where: Base-Base interactions energy: -301.876 where: short stacking energy: -162.419 Base-Backbone interact. energy: -0.089 local terms energy: -192.802701 where: bonds (distance) C4'-P energy: -39.038 bonds (distance) P-C4' energy: -41.646 flat angles C4'-P-C4' energy: -39.708 flat angles P-C4'-P energy: -25.923 tors. eta vs tors. theta energy: -46.488 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -512.529485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.529485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.738776 (E_RNA) where: Base-Base interactions energy: -334.631 where: short stacking energy: -169.246 Base-Backbone interact. energy: 0.054 local terms energy: -178.162498 where: bonds (distance) C4'-P energy: -30.596 bonds (distance) P-C4' energy: -43.380 flat angles C4'-P-C4' energy: -39.761 flat angles P-C4'-P energy: -19.302 tors. eta vs tors. theta energy: -45.124 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -458.594274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.594274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.755937 (E_RNA) where: Base-Base interactions energy: -286.164 where: short stacking energy: -132.043 Base-Backbone interact. energy: -0.286 local terms energy: -172.305909 where: bonds (distance) C4'-P energy: -42.179 bonds (distance) P-C4' energy: -34.065 flat angles C4'-P-C4' energy: -37.481 flat angles P-C4'-P energy: -27.787 tors. eta vs tors. theta energy: -30.793 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -433.011521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.011521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.777895 (E_RNA) where: Base-Base interactions energy: -267.128 where: short stacking energy: -127.938 Base-Backbone interact. energy: -0.026 local terms energy: -166.623883 where: bonds (distance) C4'-P energy: -34.774 bonds (distance) P-C4' energy: -45.650 flat angles C4'-P-C4' energy: -36.675 flat angles P-C4'-P energy: -22.483 tors. eta vs tors. theta energy: -27.042 Dist. restrs. and SS energy: 0.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -421.248587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.248587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.284800 (E_RNA) where: Base-Base interactions energy: -279.205 where: short stacking energy: -126.434 Base-Backbone interact. energy: -0.508 local terms energy: -141.571874 where: bonds (distance) C4'-P energy: -31.295 bonds (distance) P-C4' energy: -33.268 flat angles C4'-P-C4' energy: -30.950 flat angles P-C4'-P energy: -17.625 tors. eta vs tors. theta energy: -28.435 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -412.063890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.063890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.078978 (E_RNA) where: Base-Base interactions energy: -256.368 where: short stacking energy: -118.443 Base-Backbone interact. energy: 0.189 local terms energy: -155.900903 where: bonds (distance) C4'-P energy: -34.199 bonds (distance) P-C4' energy: -35.159 flat angles C4'-P-C4' energy: -34.504 flat angles P-C4'-P energy: -24.140 tors. eta vs tors. theta energy: -27.899 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -289.321089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.321089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.386920 (E_RNA) where: Base-Base interactions energy: -138.839 where: short stacking energy: -77.251 Base-Backbone interact. energy: -0.467 local terms energy: -152.080582 where: bonds (distance) C4'-P energy: -39.865 bonds (distance) P-C4' energy: -38.571 flat angles C4'-P-C4' energy: -32.841 flat angles P-C4'-P energy: -18.462 tors. eta vs tors. theta energy: -22.342 Dist. restrs. and SS energy: 2.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -286.804417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.804417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.965582 (E_RNA) where: Base-Base interactions energy: -154.779 where: short stacking energy: -82.100 Base-Backbone interact. energy: -0.781 local terms energy: -131.405353 where: bonds (distance) C4'-P energy: -35.092 bonds (distance) P-C4' energy: -33.079 flat angles C4'-P-C4' energy: -33.642 flat angles P-C4'-P energy: -17.217 tors. eta vs tors. theta energy: -12.376 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -263.226751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.226751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.093826 (E_RNA) where: Base-Base interactions energy: -152.611 where: short stacking energy: -62.596 Base-Backbone interact. energy: 0.962 local terms energy: -115.445298 where: bonds (distance) C4'-P energy: -25.017 bonds (distance) P-C4' energy: -38.502 flat angles C4'-P-C4' energy: -27.313 flat angles P-C4'-P energy: -13.860 tors. eta vs tors. theta energy: -10.754 Dist. restrs. and SS energy: 3.867 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -560.637233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.637233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.899552 (E_RNA) where: Base-Base interactions energy: -361.578 where: short stacking energy: -160.221 Base-Backbone interact. energy: 0.520 local terms energy: -199.840943 where: bonds (distance) C4'-P energy: -35.065 bonds (distance) P-C4' energy: -43.687 flat angles C4'-P-C4' energy: -43.489 flat angles P-C4'-P energy: -28.062 tors. eta vs tors. theta energy: -49.538 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -504.874654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.874654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.874654 (E_RNA) where: Base-Base interactions energy: -309.575 where: short stacking energy: -152.968 Base-Backbone interact. energy: -2.417 local terms energy: -192.882264 where: bonds (distance) C4'-P energy: -41.456 bonds (distance) P-C4' energy: -44.149 flat angles C4'-P-C4' energy: -45.609 flat angles P-C4'-P energy: -22.012 tors. eta vs tors. theta energy: -39.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -529.046696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.046696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.199680 (E_RNA) where: Base-Base interactions energy: -344.312 where: short stacking energy: -155.281 Base-Backbone interact. energy: -0.014 local terms energy: -184.873772 where: bonds (distance) C4'-P energy: -41.695 bonds (distance) P-C4' energy: -36.743 flat angles C4'-P-C4' energy: -43.006 flat angles P-C4'-P energy: -20.618 tors. eta vs tors. theta energy: -42.812 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -497.310539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.310539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.766689 (E_RNA) where: Base-Base interactions energy: -313.287 where: short stacking energy: -132.468 Base-Backbone interact. energy: -0.349 local terms energy: -184.130347 where: bonds (distance) C4'-P energy: -39.651 bonds (distance) P-C4' energy: -41.744 flat angles C4'-P-C4' energy: -39.910 flat angles P-C4'-P energy: -28.010 tors. eta vs tors. theta energy: -34.815 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -454.093897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.093897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.132923 (E_RNA) where: Base-Base interactions energy: -294.834 where: short stacking energy: -146.648 Base-Backbone interact. energy: 2.772 local terms energy: -162.070524 where: bonds (distance) C4'-P energy: -30.085 bonds (distance) P-C4' energy: -40.843 flat angles C4'-P-C4' energy: -34.939 flat angles P-C4'-P energy: -23.800 tors. eta vs tors. theta energy: -32.403 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -431.735638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.735638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.040500 (E_RNA) where: Base-Base interactions energy: -274.777 where: short stacking energy: -123.231 Base-Backbone interact. energy: -0.703 local terms energy: -156.561443 where: bonds (distance) C4'-P energy: -31.405 bonds (distance) P-C4' energy: -40.392 flat angles C4'-P-C4' energy: -39.667 flat angles P-C4'-P energy: -11.682 tors. eta vs tors. theta energy: -33.416 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -413.187337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.187337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.704217 (E_RNA) where: Base-Base interactions energy: -238.516 where: short stacking energy: -123.804 Base-Backbone interact. energy: 0.707 local terms energy: -175.894616 where: bonds (distance) C4'-P energy: -35.372 bonds (distance) P-C4' energy: -41.736 flat angles C4'-P-C4' energy: -41.673 flat angles P-C4'-P energy: -22.017 tors. eta vs tors. theta energy: -35.095 Dist. restrs. and SS energy: 0.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -301.840234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.840234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.270636 (E_RNA) where: Base-Base interactions energy: -153.238 where: short stacking energy: -82.049 Base-Backbone interact. energy: -0.750 local terms energy: -151.282395 where: bonds (distance) C4'-P energy: -36.642 bonds (distance) P-C4' energy: -36.949 flat angles C4'-P-C4' energy: -32.080 flat angles P-C4'-P energy: -11.865 tors. eta vs tors. theta energy: -33.746 Dist. restrs. and SS energy: 3.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -284.333250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.333250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.538974 (E_RNA) where: Base-Base interactions energy: -162.660 where: short stacking energy: -77.177 Base-Backbone interact. energy: -0.523 local terms energy: -122.355843 where: bonds (distance) C4'-P energy: -29.635 bonds (distance) P-C4' energy: -36.660 flat angles C4'-P-C4' energy: -32.685 flat angles P-C4'-P energy: -10.995 tors. eta vs tors. theta energy: -12.381 Dist. restrs. and SS energy: 1.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -259.041721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.041721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.639239 (E_RNA) where: Base-Base interactions energy: -139.413 where: short stacking energy: -73.791 Base-Backbone interact. energy: -0.595 local terms energy: -120.631723 where: bonds (distance) C4'-P energy: -32.868 bonds (distance) P-C4' energy: -31.115 flat angles C4'-P-C4' energy: -27.023 flat angles P-C4'-P energy: -22.643 tors. eta vs tors. theta energy: -6.983 Dist. restrs. and SS energy: 1.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -555.941389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.941389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.392498 (E_RNA) where: Base-Base interactions energy: -361.345 where: short stacking energy: -157.283 Base-Backbone interact. energy: -0.523 local terms energy: -194.523850 where: bonds (distance) C4'-P energy: -34.845 bonds (distance) P-C4' energy: -49.992 flat angles C4'-P-C4' energy: -36.352 flat angles P-C4'-P energy: -29.197 tors. eta vs tors. theta energy: -44.138 Dist. restrs. and SS energy: 0.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -534.679916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.679916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.844967 (E_RNA) where: Base-Base interactions energy: -346.877 where: short stacking energy: -155.641 Base-Backbone interact. energy: -1.730 local terms energy: -186.237425 where: bonds (distance) C4'-P energy: -38.263 bonds (distance) P-C4' energy: -40.688 flat angles C4'-P-C4' energy: -39.020 flat angles P-C4'-P energy: -31.678 tors. eta vs tors. theta energy: -36.589 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -507.334859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.334859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.922598 (E_RNA) where: Base-Base interactions energy: -332.463 where: short stacking energy: -147.264 Base-Backbone interact. energy: -1.249 local terms energy: -174.210538 where: bonds (distance) C4'-P energy: -39.905 bonds (distance) P-C4' energy: -32.468 flat angles C4'-P-C4' energy: -38.455 flat angles P-C4'-P energy: -26.481 tors. eta vs tors. theta energy: -36.902 Dist. restrs. and SS energy: 0.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -451.042671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.042671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.117146 (E_RNA) where: Base-Base interactions energy: -278.065 where: short stacking energy: -130.876 Base-Backbone interact. energy: 0.117 local terms energy: -173.168764 where: bonds (distance) C4'-P energy: -33.384 bonds (distance) P-C4' energy: -43.995 flat angles C4'-P-C4' energy: -41.529 flat angles P-C4'-P energy: -19.726 tors. eta vs tors. theta energy: -34.533 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -446.641482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.641482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.973812 (E_RNA) where: Base-Base interactions energy: -284.876 where: short stacking energy: -119.766 Base-Backbone interact. energy: -0.604 local terms energy: -161.493319 where: bonds (distance) C4'-P energy: -34.248 bonds (distance) P-C4' energy: -40.820 flat angles C4'-P-C4' energy: -33.563 flat angles P-C4'-P energy: -25.798 tors. eta vs tors. theta energy: -27.064 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -431.246473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.246473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.437615 (E_RNA) where: Base-Base interactions energy: -263.128 where: short stacking energy: -114.630 Base-Backbone interact. energy: -0.729 local terms energy: -167.580270 where: bonds (distance) C4'-P energy: -42.357 bonds (distance) P-C4' energy: -32.074 flat angles C4'-P-C4' energy: -38.723 flat angles P-C4'-P energy: -26.652 tors. eta vs tors. theta energy: -27.775 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -413.101988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.101988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.309048 (E_RNA) where: Base-Base interactions energy: -280.451 where: short stacking energy: -124.438 Base-Backbone interact. energy: -0.454 local terms energy: -132.404391 where: bonds (distance) C4'-P energy: -34.093 bonds (distance) P-C4' energy: -31.007 flat angles C4'-P-C4' energy: -23.401 flat angles P-C4'-P energy: -14.240 tors. eta vs tors. theta energy: -29.664 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -342.108234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.108234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.200787 (E_RNA) where: Base-Base interactions energy: -191.386 where: short stacking energy: -84.691 Base-Backbone interact. energy: -0.820 local terms energy: -149.995122 where: bonds (distance) C4'-P energy: -34.016 bonds (distance) P-C4' energy: -33.912 flat angles C4'-P-C4' energy: -32.721 flat angles P-C4'-P energy: -26.208 tors. eta vs tors. theta energy: -23.138 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -302.429412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.429412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.508495 (E_RNA) where: Base-Base interactions energy: -165.415 where: short stacking energy: -84.389 Base-Backbone interact. energy: -0.772 local terms energy: -136.321448 where: bonds (distance) C4'-P energy: -28.968 bonds (distance) P-C4' energy: -40.568 flat angles C4'-P-C4' energy: -23.242 flat angles P-C4'-P energy: -25.598 tors. eta vs tors. theta energy: -17.946 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -258.652851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.652851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.432092 (E_RNA) where: Base-Base interactions energy: -130.980 where: short stacking energy: -61.828 Base-Backbone interact. energy: -0.419 local terms energy: -128.033072 where: bonds (distance) C4'-P energy: -34.153 bonds (distance) P-C4' energy: -42.802 flat angles C4'-P-C4' energy: -34.385 flat angles P-C4'-P energy: -16.251 tors. eta vs tors. theta energy: -0.442 Dist. restrs. and SS energy: 0.779 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -546.667869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.667869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.809462 (E_RNA) where: Base-Base interactions energy: -362.164 where: short stacking energy: -153.414 Base-Backbone interact. energy: 1.169 local terms energy: -185.814829 where: bonds (distance) C4'-P energy: -45.203 bonds (distance) P-C4' energy: -37.434 flat angles C4'-P-C4' energy: -42.182 flat angles P-C4'-P energy: -21.559 tors. eta vs tors. theta energy: -39.437 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -526.626000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.626000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.976091 (E_RNA) where: Base-Base interactions energy: -341.879 where: short stacking energy: -157.331 Base-Backbone interact. energy: -1.323 local terms energy: -183.773587 where: bonds (distance) C4'-P energy: -41.373 bonds (distance) P-C4' energy: -35.313 flat angles C4'-P-C4' energy: -43.151 flat angles P-C4'-P energy: -19.748 tors. eta vs tors. theta energy: -44.189 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -509.622033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.622033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.902703 (E_RNA) where: Base-Base interactions energy: -326.116 where: short stacking energy: -148.565 Base-Backbone interact. energy: -1.073 local terms energy: -182.714211 where: bonds (distance) C4'-P energy: -38.122 bonds (distance) P-C4' energy: -38.058 flat angles C4'-P-C4' energy: -41.824 flat angles P-C4'-P energy: -25.273 tors. eta vs tors. theta energy: -39.436 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -469.156849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.156849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.225036 (E_RNA) where: Base-Base interactions energy: -297.941 where: short stacking energy: -137.000 Base-Backbone interact. energy: -0.514 local terms energy: -170.769252 where: bonds (distance) C4'-P energy: -39.445 bonds (distance) P-C4' energy: -38.965 flat angles C4'-P-C4' energy: -37.087 flat angles P-C4'-P energy: -22.058 tors. eta vs tors. theta energy: -33.214 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -447.497887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.497887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.531196 (E_RNA) where: Base-Base interactions energy: -264.528 where: short stacking energy: -124.003 Base-Backbone interact. energy: -1.156 local terms energy: -181.847323 where: bonds (distance) C4'-P energy: -39.601 bonds (distance) P-C4' energy: -36.472 flat angles C4'-P-C4' energy: -33.569 flat angles P-C4'-P energy: -29.578 tors. eta vs tors. theta energy: -42.628 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -379.732989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.732989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.742515 (E_RNA) where: Base-Base interactions energy: -228.676 where: short stacking energy: -115.829 Base-Backbone interact. energy: -0.116 local terms energy: -150.950488 where: bonds (distance) C4'-P energy: -31.325 bonds (distance) P-C4' energy: -33.900 flat angles C4'-P-C4' energy: -38.755 flat angles P-C4'-P energy: -19.727 tors. eta vs tors. theta energy: -27.243 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -380.428152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.428152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.619919 (E_RNA) where: Base-Base interactions energy: -245.449 where: short stacking energy: -112.527 Base-Backbone interact. energy: 4.245 local terms energy: -139.416155 where: bonds (distance) C4'-P energy: -29.319 bonds (distance) P-C4' energy: -32.158 flat angles C4'-P-C4' energy: -32.584 flat angles P-C4'-P energy: -18.505 tors. eta vs tors. theta energy: -26.849 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -330.137742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.137742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.494267 (E_RNA) where: Base-Base interactions energy: -189.565 where: short stacking energy: -88.124 Base-Backbone interact. energy: 0.471 local terms energy: -141.399910 where: bonds (distance) C4'-P energy: -40.491 bonds (distance) P-C4' energy: -36.450 flat angles C4'-P-C4' energy: -29.668 flat angles P-C4'-P energy: -15.221 tors. eta vs tors. theta energy: -19.571 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -288.764420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.764420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.833295 (E_RNA) where: Base-Base interactions energy: -153.748 where: short stacking energy: -68.457 Base-Backbone interact. energy: -0.420 local terms energy: -134.665571 where: bonds (distance) C4'-P energy: -34.895 bonds (distance) P-C4' energy: -36.389 flat angles C4'-P-C4' energy: -35.372 flat angles P-C4'-P energy: -22.179 tors. eta vs tors. theta energy: -5.830 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -283.789679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.789679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.851690 (E_RNA) where: Base-Base interactions energy: -165.125 where: short stacking energy: -86.371 Base-Backbone interact. energy: -1.037 local terms energy: -122.689305 where: bonds (distance) C4'-P energy: -21.572 bonds (distance) P-C4' energy: -33.336 flat angles C4'-P-C4' energy: -29.790 flat angles P-C4'-P energy: -19.730 tors. eta vs tors. theta energy: -18.262 Dist. restrs. and SS energy: 5.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -565.536875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.536875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.681861 (E_RNA) where: Base-Base interactions energy: -365.028 where: short stacking energy: -149.355 Base-Backbone interact. energy: -2.904 local terms energy: -197.749232 where: bonds (distance) C4'-P energy: -39.195 bonds (distance) P-C4' energy: -45.435 flat angles C4'-P-C4' energy: -47.168 flat angles P-C4'-P energy: -25.626 tors. eta vs tors. theta energy: -40.325 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -530.651277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.651277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.843728 (E_RNA) where: Base-Base interactions energy: -339.857 where: short stacking energy: -149.188 Base-Backbone interact. energy: -1.284 local terms energy: -189.702641 where: bonds (distance) C4'-P energy: -46.645 bonds (distance) P-C4' energy: -43.031 flat angles C4'-P-C4' energy: -45.632 flat angles P-C4'-P energy: -16.552 tors. eta vs tors. theta energy: -37.843 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -502.735467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.735467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.794082 (E_RNA) where: Base-Base interactions energy: -327.922 where: short stacking energy: -155.958 Base-Backbone interact. energy: 3.631 local terms energy: -178.503381 where: bonds (distance) C4'-P energy: -29.376 bonds (distance) P-C4' energy: -36.967 flat angles C4'-P-C4' energy: -38.275 flat angles P-C4'-P energy: -32.787 tors. eta vs tors. theta energy: -41.098 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -473.895376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.895376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.031704 (E_RNA) where: Base-Base interactions energy: -302.253 where: short stacking energy: -132.432 Base-Backbone interact. energy: -0.303 local terms energy: -171.476118 where: bonds (distance) C4'-P energy: -42.498 bonds (distance) P-C4' energy: -35.450 flat angles C4'-P-C4' energy: -37.624 flat angles P-C4'-P energy: -15.687 tors. eta vs tors. theta energy: -40.218 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -438.804356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.804356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.927772 (E_RNA) where: Base-Base interactions energy: -293.201 where: short stacking energy: -143.393 Base-Backbone interact. energy: -0.719 local terms energy: -145.008110 where: bonds (distance) C4'-P energy: -22.645 bonds (distance) P-C4' energy: -33.028 flat angles C4'-P-C4' energy: -34.384 flat angles P-C4'-P energy: -21.903 tors. eta vs tors. theta energy: -33.049 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -423.180419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.180419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.396372 (E_RNA) where: Base-Base interactions energy: -257.495 where: short stacking energy: -119.568 Base-Backbone interact. energy: -0.304 local terms energy: -165.597495 where: bonds (distance) C4'-P energy: -36.541 bonds (distance) P-C4' energy: -35.547 flat angles C4'-P-C4' energy: -37.227 flat angles P-C4'-P energy: -22.414 tors. eta vs tors. theta energy: -33.869 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -385.269614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.269614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.487355 (E_RNA) where: Base-Base interactions energy: -222.742 where: short stacking energy: -111.127 Base-Backbone interact. energy: 0.647 local terms energy: -163.392163 where: bonds (distance) C4'-P energy: -38.093 bonds (distance) P-C4' energy: -30.964 flat angles C4'-P-C4' energy: -40.016 flat angles P-C4'-P energy: -21.466 tors. eta vs tors. theta energy: -32.853 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -306.314835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.314835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.756545 (E_RNA) where: Base-Base interactions energy: -169.979 where: short stacking energy: -83.280 Base-Backbone interact. energy: 3.074 local terms energy: -139.851243 where: bonds (distance) C4'-P energy: -24.096 bonds (distance) P-C4' energy: -31.632 flat angles C4'-P-C4' energy: -42.403 flat angles P-C4'-P energy: -29.048 tors. eta vs tors. theta energy: -12.673 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -269.254131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.254131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.272497 (E_RNA) where: Base-Base interactions energy: -144.713 where: short stacking energy: -72.436 Base-Backbone interact. energy: 1.626 local terms energy: -130.184756 where: bonds (distance) C4'-P energy: -35.396 bonds (distance) P-C4' energy: -24.327 flat angles C4'-P-C4' energy: -29.427 flat angles P-C4'-P energy: -29.471 tors. eta vs tors. theta energy: -11.565 Dist. restrs. and SS energy: 4.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -299.044889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.044889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.155458 (E_RNA) where: Base-Base interactions energy: -177.138 where: short stacking energy: -89.610 Base-Backbone interact. energy: -0.748 local terms energy: -121.268991 where: bonds (distance) C4'-P energy: -22.619 bonds (distance) P-C4' energy: -28.126 flat angles C4'-P-C4' energy: -31.021 flat angles P-C4'-P energy: -25.110 tors. eta vs tors. theta energy: -14.393 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -562.861409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.861409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.241874 (E_RNA) where: Base-Base interactions energy: -375.324 where: short stacking energy: -152.374 Base-Backbone interact. energy: -0.773 local terms energy: -187.144888 where: bonds (distance) C4'-P energy: -35.223 bonds (distance) P-C4' energy: -38.592 flat angles C4'-P-C4' energy: -43.648 flat angles P-C4'-P energy: -28.506 tors. eta vs tors. theta energy: -41.176 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -549.446789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.446789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.469754 (E_RNA) where: Base-Base interactions energy: -352.845 where: short stacking energy: -165.349 Base-Backbone interact. energy: -1.125 local terms energy: -195.500144 where: bonds (distance) C4'-P energy: -41.015 bonds (distance) P-C4' energy: -41.480 flat angles C4'-P-C4' energy: -39.261 flat angles P-C4'-P energy: -28.453 tors. eta vs tors. theta energy: -45.293 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -522.500007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.500007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.502995 (E_RNA) where: Base-Base interactions energy: -345.176 where: short stacking energy: -154.293 Base-Backbone interact. energy: -0.513 local terms energy: -176.814240 where: bonds (distance) C4'-P energy: -35.877 bonds (distance) P-C4' energy: -44.139 flat angles C4'-P-C4' energy: -37.685 flat angles P-C4'-P energy: -22.178 tors. eta vs tors. theta energy: -36.936 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -483.762145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.762145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.762145 (E_RNA) where: Base-Base interactions energy: -306.859 where: short stacking energy: -151.946 Base-Backbone interact. energy: -0.812 local terms energy: -176.090460 where: bonds (distance) C4'-P energy: -31.680 bonds (distance) P-C4' energy: -33.790 flat angles C4'-P-C4' energy: -37.279 flat angles P-C4'-P energy: -24.219 tors. eta vs tors. theta energy: -49.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -430.692604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.692604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.054545 (E_RNA) where: Base-Base interactions energy: -275.235 where: short stacking energy: -131.542 Base-Backbone interact. energy: -0.731 local terms energy: -155.089026 where: bonds (distance) C4'-P energy: -36.116 bonds (distance) P-C4' energy: -38.720 flat angles C4'-P-C4' energy: -32.991 flat angles P-C4'-P energy: -13.153 tors. eta vs tors. theta energy: -34.109 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -438.667629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.667629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.265221 (E_RNA) where: Base-Base interactions energy: -286.051 where: short stacking energy: -123.082 Base-Backbone interact. energy: -0.228 local terms energy: -152.986200 where: bonds (distance) C4'-P energy: -41.360 bonds (distance) P-C4' energy: -34.517 flat angles C4'-P-C4' energy: -35.454 flat angles P-C4'-P energy: -9.751 tors. eta vs tors. theta energy: -31.903 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -300.497539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.497539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.368254 (E_RNA) where: Base-Base interactions energy: -168.763 where: short stacking energy: -83.252 Base-Backbone interact. energy: -0.839 local terms energy: -134.766186 where: bonds (distance) C4'-P energy: -33.952 bonds (distance) P-C4' energy: -29.094 flat angles C4'-P-C4' energy: -36.531 flat angles P-C4'-P energy: -23.002 tors. eta vs tors. theta energy: -12.187 Dist. restrs. and SS energy: 3.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -313.451275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.451275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.783898 (E_RNA) where: Base-Base interactions energy: -178.008 where: short stacking energy: -79.119 Base-Backbone interact. energy: -2.035 local terms energy: -133.741084 where: bonds (distance) C4'-P energy: -37.360 bonds (distance) P-C4' energy: -36.462 flat angles C4'-P-C4' energy: -31.228 flat angles P-C4'-P energy: -17.492 tors. eta vs tors. theta energy: -11.200 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -305.065581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.065581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.081306 (E_RNA) where: Base-Base interactions energy: -178.675 where: short stacking energy: -95.772 Base-Backbone interact. energy: -0.589 local terms energy: -125.817454 where: bonds (distance) C4'-P energy: -32.678 bonds (distance) P-C4' energy: -31.730 flat angles C4'-P-C4' energy: -30.570 flat angles P-C4'-P energy: -15.174 tors. eta vs tors. theta energy: -15.665 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -291.435592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.435592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.897676 (E_RNA) where: Base-Base interactions energy: -161.746 where: short stacking energy: -79.110 Base-Backbone interact. energy: -0.496 local terms energy: -129.655925 where: bonds (distance) C4'-P energy: -27.753 bonds (distance) P-C4' energy: -34.704 flat angles C4'-P-C4' energy: -36.190 flat angles P-C4'-P energy: -21.487 tors. eta vs tors. theta energy: -9.523 Dist. restrs. and SS energy: 0.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -574.363974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.363974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.498603 (E_RNA) where: Base-Base interactions energy: -388.810 where: short stacking energy: -157.919 Base-Backbone interact. energy: 1.060 local terms energy: -186.747766 where: bonds (distance) C4'-P energy: -31.617 bonds (distance) P-C4' energy: -40.269 flat angles C4'-P-C4' energy: -43.958 flat angles P-C4'-P energy: -26.990 tors. eta vs tors. theta energy: -43.913 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -566.083804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.083804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.259328 (E_RNA) where: Base-Base interactions energy: -373.137 where: short stacking energy: -165.176 Base-Backbone interact. energy: -0.761 local terms energy: -192.361368 where: bonds (distance) C4'-P energy: -42.552 bonds (distance) P-C4' energy: -34.100 flat angles C4'-P-C4' energy: -44.383 flat angles P-C4'-P energy: -26.395 tors. eta vs tors. theta energy: -44.931 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -526.492079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.492079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.579009 (E_RNA) where: Base-Base interactions energy: -349.471 where: short stacking energy: -161.047 Base-Backbone interact. energy: -0.851 local terms energy: -176.256625 where: bonds (distance) C4'-P energy: -31.199 bonds (distance) P-C4' energy: -35.898 flat angles C4'-P-C4' energy: -32.780 flat angles P-C4'-P energy: -31.149 tors. eta vs tors. theta energy: -45.230 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -448.380303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.380303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.547033 (E_RNA) where: Base-Base interactions energy: -272.185 where: short stacking energy: -125.745 Base-Backbone interact. energy: -0.414 local terms energy: -175.948231 where: bonds (distance) C4'-P energy: -38.286 bonds (distance) P-C4' energy: -37.090 flat angles C4'-P-C4' energy: -40.301 flat angles P-C4'-P energy: -27.585 tors. eta vs tors. theta energy: -32.687 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -453.375739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.375739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.691560 (E_RNA) where: Base-Base interactions energy: -273.564 where: short stacking energy: -139.579 Base-Backbone interact. energy: 0.522 local terms energy: -180.649673 where: bonds (distance) C4'-P energy: -34.211 bonds (distance) P-C4' energy: -37.080 flat angles C4'-P-C4' energy: -39.183 flat angles P-C4'-P energy: -31.465 tors. eta vs tors. theta energy: -38.710 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -468.158742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.158742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.175095 (E_RNA) where: Base-Base interactions energy: -306.468 where: short stacking energy: -140.088 Base-Backbone interact. energy: -0.176 local terms energy: -161.530740 where: bonds (distance) C4'-P energy: -34.481 bonds (distance) P-C4' energy: -37.729 flat angles C4'-P-C4' energy: -31.563 flat angles P-C4'-P energy: -24.905 tors. eta vs tors. theta energy: -32.854 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -319.564361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.564361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.640405 (E_RNA) where: Base-Base interactions energy: -173.946 where: short stacking energy: -83.724 Base-Backbone interact. energy: -0.988 local terms energy: -144.706047 where: bonds (distance) C4'-P energy: -33.266 bonds (distance) P-C4' energy: -38.601 flat angles C4'-P-C4' energy: -30.292 flat angles P-C4'-P energy: -23.566 tors. eta vs tors. theta energy: -18.982 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -319.558102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.558102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.649813 (E_RNA) where: Base-Base interactions energy: -177.983 where: short stacking energy: -96.098 Base-Backbone interact. energy: -1.238 local terms energy: -140.428570 where: bonds (distance) C4'-P energy: -17.715 bonds (distance) P-C4' energy: -37.451 flat angles C4'-P-C4' energy: -36.710 flat angles P-C4'-P energy: -23.371 tors. eta vs tors. theta energy: -25.180 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -310.498114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.498114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.736367 (E_RNA) where: Base-Base interactions energy: -185.405 where: short stacking energy: -103.478 Base-Backbone interact. energy: -0.113 local terms energy: -125.218888 where: bonds (distance) C4'-P energy: -23.754 bonds (distance) P-C4' energy: -25.426 flat angles C4'-P-C4' energy: -36.400 flat angles P-C4'-P energy: -18.289 tors. eta vs tors. theta energy: -21.350 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -278.522754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.522754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.910328 (E_RNA) where: Base-Base interactions energy: -148.952 where: short stacking energy: -78.764 Base-Backbone interact. energy: 1.293 local terms energy: -131.251216 where: bonds (distance) C4'-P energy: -33.842 bonds (distance) P-C4' energy: -37.144 flat angles C4'-P-C4' energy: -27.003 flat angles P-C4'-P energy: -18.912 tors. eta vs tors. theta energy: -14.350 Dist. restrs. and SS energy: 0.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -574.260468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.260468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.494775 (E_RNA) where: Base-Base interactions energy: -387.484 where: short stacking energy: -162.004 Base-Backbone interact. energy: -0.366 local terms energy: -186.644319 where: bonds (distance) C4'-P energy: -40.639 bonds (distance) P-C4' energy: -42.853 flat angles C4'-P-C4' energy: -41.560 flat angles P-C4'-P energy: -19.755 tors. eta vs tors. theta energy: -41.838 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -543.021599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.021599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.228640 (E_RNA) where: Base-Base interactions energy: -351.652 where: short stacking energy: -152.176 Base-Backbone interact. energy: -0.001 local terms energy: -191.575819 where: bonds (distance) C4'-P energy: -39.521 bonds (distance) P-C4' energy: -44.795 flat angles C4'-P-C4' energy: -44.993 flat angles P-C4'-P energy: -22.084 tors. eta vs tors. theta energy: -40.183 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -510.961785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.961785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.961785 (E_RNA) where: Base-Base interactions energy: -329.617 where: short stacking energy: -141.471 Base-Backbone interact. energy: -0.180 local terms energy: -181.165255 where: bonds (distance) C4'-P energy: -35.423 bonds (distance) P-C4' energy: -44.495 flat angles C4'-P-C4' energy: -37.402 flat angles P-C4'-P energy: -26.455 tors. eta vs tors. theta energy: -37.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -444.198119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.198119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.461428 (E_RNA) where: Base-Base interactions energy: -272.533 where: short stacking energy: -149.556 Base-Backbone interact. energy: 0.346 local terms energy: -172.275091 where: bonds (distance) C4'-P energy: -38.445 bonds (distance) P-C4' energy: -34.099 flat angles C4'-P-C4' energy: -35.728 flat angles P-C4'-P energy: -23.051 tors. eta vs tors. theta energy: -40.951 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -452.938165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.938165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.048293 (E_RNA) where: Base-Base interactions energy: -280.538 where: short stacking energy: -127.825 Base-Backbone interact. energy: -0.231 local terms energy: -172.278911 where: bonds (distance) C4'-P energy: -33.709 bonds (distance) P-C4' energy: -34.695 flat angles C4'-P-C4' energy: -46.650 flat angles P-C4'-P energy: -24.990 tors. eta vs tors. theta energy: -32.235 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -432.161207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.161207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.297451 (E_RNA) where: Base-Base interactions energy: -274.282 where: short stacking energy: -119.328 Base-Backbone interact. energy: -0.073 local terms energy: -157.942320 where: bonds (distance) C4'-P energy: -33.535 bonds (distance) P-C4' energy: -33.178 flat angles C4'-P-C4' energy: -40.855 flat angles P-C4'-P energy: -15.430 tors. eta vs tors. theta energy: -34.944 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -376.202105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.202105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.406187 (E_RNA) where: Base-Base interactions energy: -237.451 where: short stacking energy: -111.081 Base-Backbone interact. energy: -0.209 local terms energy: -138.745819 where: bonds (distance) C4'-P energy: -31.158 bonds (distance) P-C4' energy: -30.147 flat angles C4'-P-C4' energy: -35.545 flat angles P-C4'-P energy: -21.349 tors. eta vs tors. theta energy: -20.547 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -350.172945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.172945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.209091 (E_RNA) where: Base-Base interactions energy: -216.566 where: short stacking energy: -97.276 Base-Backbone interact. energy: -0.282 local terms energy: -133.361208 where: bonds (distance) C4'-P energy: -23.974 bonds (distance) P-C4' energy: -37.645 flat angles C4'-P-C4' energy: -31.416 flat angles P-C4'-P energy: -20.428 tors. eta vs tors. theta energy: -19.898 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -280.827544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.827544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.944700 (E_RNA) where: Base-Base interactions energy: -156.466 where: short stacking energy: -84.294 Base-Backbone interact. energy: -0.422 local terms energy: -124.057153 where: bonds (distance) C4'-P energy: -35.087 bonds (distance) P-C4' energy: -23.922 flat angles C4'-P-C4' energy: -29.711 flat angles P-C4'-P energy: -18.356 tors. eta vs tors. theta energy: -16.982 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -266.361248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.361248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.197814 (E_RNA) where: Base-Base interactions energy: -162.383 where: short stacking energy: -83.453 Base-Backbone interact. energy: 2.702 local terms energy: -110.516858 where: bonds (distance) C4'-P energy: -27.140 bonds (distance) P-C4' energy: -29.292 flat angles C4'-P-C4' energy: -25.269 flat angles P-C4'-P energy: -24.825 tors. eta vs tors. theta energy: -3.991 Dist. restrs. and SS energy: 3.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -570.861520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.861520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.143176 (E_RNA) where: Base-Base interactions energy: -386.072 where: short stacking energy: -160.449 Base-Backbone interact. energy: 2.186 local terms energy: -187.257449 where: bonds (distance) C4'-P energy: -34.728 bonds (distance) P-C4' energy: -42.096 flat angles C4'-P-C4' energy: -43.039 flat angles P-C4'-P energy: -27.344 tors. eta vs tors. theta energy: -40.050 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -561.456497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.456497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.721575 (E_RNA) where: Base-Base interactions energy: -361.174 where: short stacking energy: -156.682 Base-Backbone interact. energy: 0.031 local terms energy: -200.578734 where: bonds (distance) C4'-P energy: -42.716 bonds (distance) P-C4' energy: -41.317 flat angles C4'-P-C4' energy: -43.489 flat angles P-C4'-P energy: -28.018 tors. eta vs tors. theta energy: -45.039 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -513.478814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.478814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.604282 (E_RNA) where: Base-Base interactions energy: -335.811 where: short stacking energy: -151.534 Base-Backbone interact. energy: -0.289 local terms energy: -177.504890 where: bonds (distance) C4'-P energy: -42.580 bonds (distance) P-C4' energy: -39.581 flat angles C4'-P-C4' energy: -38.408 flat angles P-C4'-P energy: -25.319 tors. eta vs tors. theta energy: -31.616 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -459.172449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.172449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.417186 (E_RNA) where: Base-Base interactions energy: -273.340 where: short stacking energy: -133.420 Base-Backbone interact. energy: -1.755 local terms energy: -184.322485 where: bonds (distance) C4'-P energy: -32.933 bonds (distance) P-C4' energy: -40.205 flat angles C4'-P-C4' energy: -42.797 flat angles P-C4'-P energy: -26.173 tors. eta vs tors. theta energy: -42.214 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -452.755100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.755100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.786491 (E_RNA) where: Base-Base interactions energy: -279.747 where: short stacking energy: -121.786 Base-Backbone interact. energy: 0.144 local terms energy: -173.183452 where: bonds (distance) C4'-P energy: -37.405 bonds (distance) P-C4' energy: -40.649 flat angles C4'-P-C4' energy: -29.851 flat angles P-C4'-P energy: -30.173 tors. eta vs tors. theta energy: -35.105 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -411.251250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.251250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.251250 (E_RNA) where: Base-Base interactions energy: -246.633 where: short stacking energy: -120.657 Base-Backbone interact. energy: -0.099 local terms energy: -164.519232 where: bonds (distance) C4'-P energy: -34.140 bonds (distance) P-C4' energy: -40.918 flat angles C4'-P-C4' energy: -36.796 flat angles P-C4'-P energy: -19.682 tors. eta vs tors. theta energy: -32.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -385.056901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.056901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.495957 (E_RNA) where: Base-Base interactions energy: -216.407 where: short stacking energy: -104.074 Base-Backbone interact. energy: -1.947 local terms energy: -167.141290 where: bonds (distance) C4'-P energy: -44.406 bonds (distance) P-C4' energy: -39.177 flat angles C4'-P-C4' energy: -40.070 flat angles P-C4'-P energy: -16.684 tors. eta vs tors. theta energy: -26.804 Dist. restrs. and SS energy: 0.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -391.536322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.536322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.842091 (E_RNA) where: Base-Base interactions energy: -237.988 where: short stacking energy: -102.091 Base-Backbone interact. energy: -0.673 local terms energy: -153.180683 where: bonds (distance) C4'-P energy: -34.100 bonds (distance) P-C4' energy: -35.787 flat angles C4'-P-C4' energy: -40.382 flat angles P-C4'-P energy: -19.042 tors. eta vs tors. theta energy: -23.869 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -254.328999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.328999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.163608 (E_RNA) where: Base-Base interactions energy: -151.221 where: short stacking energy: -74.028 Base-Backbone interact. energy: -1.010 local terms energy: -106.932735 where: bonds (distance) C4'-P energy: -34.163 bonds (distance) P-C4' energy: -30.367 flat angles C4'-P-C4' energy: -25.170 flat angles P-C4'-P energy: -11.661 tors. eta vs tors. theta energy: -5.572 Dist. restrs. and SS energy: 4.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -291.225331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.225331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.576480 (E_RNA) where: Base-Base interactions energy: -167.959 where: short stacking energy: -77.099 Base-Backbone interact. energy: -1.268 local terms energy: -122.350126 where: bonds (distance) C4'-P energy: -31.890 bonds (distance) P-C4' energy: -26.538 flat angles C4'-P-C4' energy: -29.760 flat angles P-C4'-P energy: -15.749 tors. eta vs tors. theta energy: -18.413 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -552.078642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.078642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.137023 (E_RNA) where: Base-Base interactions energy: -362.027 where: short stacking energy: -182.728 Base-Backbone interact. energy: -1.986 local terms energy: -188.123948 where: bonds (distance) C4'-P energy: -38.813 bonds (distance) P-C4' energy: -37.560 flat angles C4'-P-C4' energy: -44.110 flat angles P-C4'-P energy: -23.899 tors. eta vs tors. theta energy: -43.742 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -562.641031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.641031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.784895 (E_RNA) where: Base-Base interactions energy: -377.471 where: short stacking energy: -148.257 Base-Backbone interact. energy: -0.846 local terms energy: -184.467278 where: bonds (distance) C4'-P energy: -33.435 bonds (distance) P-C4' energy: -43.896 flat angles C4'-P-C4' energy: -36.181 flat angles P-C4'-P energy: -25.535 tors. eta vs tors. theta energy: -45.421 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -501.152006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.152006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.347459 (E_RNA) where: Base-Base interactions energy: -324.998 where: short stacking energy: -157.863 Base-Backbone interact. energy: -0.680 local terms energy: -175.670284 where: bonds (distance) C4'-P energy: -30.007 bonds (distance) P-C4' energy: -34.846 flat angles C4'-P-C4' energy: -37.588 flat angles P-C4'-P energy: -30.588 tors. eta vs tors. theta energy: -42.642 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -459.676008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.676008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.890814 (E_RNA) where: Base-Base interactions energy: -293.439 where: short stacking energy: -148.026 Base-Backbone interact. energy: 0.568 local terms energy: -167.019912 where: bonds (distance) C4'-P energy: -42.506 bonds (distance) P-C4' energy: -30.653 flat angles C4'-P-C4' energy: -36.213 flat angles P-C4'-P energy: -21.235 tors. eta vs tors. theta energy: -36.413 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -458.304984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.304984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.670134 (E_RNA) where: Base-Base interactions energy: -294.348 where: short stacking energy: -137.230 Base-Backbone interact. energy: -0.599 local terms energy: -163.723184 where: bonds (distance) C4'-P energy: -36.646 bonds (distance) P-C4' energy: -29.634 flat angles C4'-P-C4' energy: -36.902 flat angles P-C4'-P energy: -25.774 tors. eta vs tors. theta energy: -34.768 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -423.747576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.747576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.177249 (E_RNA) where: Base-Base interactions energy: -249.446 where: short stacking energy: -120.158 Base-Backbone interact. energy: -0.580 local terms energy: -174.151199 where: bonds (distance) C4'-P energy: -37.996 bonds (distance) P-C4' energy: -44.830 flat angles C4'-P-C4' energy: -38.858 flat angles P-C4'-P energy: -23.512 tors. eta vs tors. theta energy: -28.955 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -360.391839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.391839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.907605 (E_RNA) where: Base-Base interactions energy: -229.357 where: short stacking energy: -107.716 Base-Backbone interact. energy: 1.831 local terms energy: -134.381891 where: bonds (distance) C4'-P energy: -29.323 bonds (distance) P-C4' energy: -38.929 flat angles C4'-P-C4' energy: -28.138 flat angles P-C4'-P energy: -22.380 tors. eta vs tors. theta energy: -15.612 Dist. restrs. and SS energy: 1.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -318.649690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.649690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.951510 (E_RNA) where: Base-Base interactions energy: -168.674 where: short stacking energy: -75.493 Base-Backbone interact. energy: -0.382 local terms energy: -149.895718 where: bonds (distance) C4'-P energy: -37.465 bonds (distance) P-C4' energy: -42.391 flat angles C4'-P-C4' energy: -26.507 flat angles P-C4'-P energy: -25.799 tors. eta vs tors. theta energy: -17.733 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -316.267367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.267367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.831783 (E_RNA) where: Base-Base interactions energy: -187.091 where: short stacking energy: -87.852 Base-Backbone interact. energy: 0.456 local terms energy: -130.196436 where: bonds (distance) C4'-P energy: -35.209 bonds (distance) P-C4' energy: -36.386 flat angles C4'-P-C4' energy: -21.456 flat angles P-C4'-P energy: -19.670 tors. eta vs tors. theta energy: -17.475 Dist. restrs. and SS energy: 0.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -272.916221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.916221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.060645 (E_RNA) where: Base-Base interactions energy: -162.532 where: short stacking energy: -79.528 Base-Backbone interact. energy: -0.740 local terms energy: -109.788684 where: bonds (distance) C4'-P energy: -32.195 bonds (distance) P-C4' energy: -28.838 flat angles C4'-P-C4' energy: -21.623 flat angles P-C4'-P energy: -11.071 tors. eta vs tors. theta energy: -16.061 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -557.020274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.020274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.054653 (E_RNA) where: Base-Base interactions energy: -363.644 where: short stacking energy: -174.003 Base-Backbone interact. energy: -0.963 local terms energy: -192.447760 where: bonds (distance) C4'-P energy: -41.396 bonds (distance) P-C4' energy: -39.662 flat angles C4'-P-C4' energy: -34.227 flat angles P-C4'-P energy: -33.104 tors. eta vs tors. theta energy: -44.059 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -555.740275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.740275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.807983 (E_RNA) where: Base-Base interactions energy: -376.828 where: short stacking energy: -149.923 Base-Backbone interact. energy: -1.639 local terms energy: -177.341284 where: bonds (distance) C4'-P energy: -38.882 bonds (distance) P-C4' energy: -41.895 flat angles C4'-P-C4' energy: -43.396 flat angles P-C4'-P energy: -18.457 tors. eta vs tors. theta energy: -34.712 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -499.384242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.384242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.446106 (E_RNA) where: Base-Base interactions energy: -319.185 where: short stacking energy: -140.695 Base-Backbone interact. energy: -0.236 local terms energy: -180.024726 where: bonds (distance) C4'-P energy: -37.386 bonds (distance) P-C4' energy: -37.545 flat angles C4'-P-C4' energy: -43.466 flat angles P-C4'-P energy: -22.397 tors. eta vs tors. theta energy: -39.231 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -475.200542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.200542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.727742 (E_RNA) where: Base-Base interactions energy: -310.452 where: short stacking energy: -140.795 Base-Backbone interact. energy: -1.049 local terms energy: -164.226941 where: bonds (distance) C4'-P energy: -39.678 bonds (distance) P-C4' energy: -37.876 flat angles C4'-P-C4' energy: -31.615 flat angles P-C4'-P energy: -22.889 tors. eta vs tors. theta energy: -32.169 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -448.088757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.088757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.112582 (E_RNA) where: Base-Base interactions energy: -285.893 where: short stacking energy: -122.119 Base-Backbone interact. energy: -0.966 local terms energy: -161.253426 where: bonds (distance) C4'-P energy: -31.487 bonds (distance) P-C4' energy: -36.093 flat angles C4'-P-C4' energy: -37.350 flat angles P-C4'-P energy: -25.553 tors. eta vs tors. theta energy: -30.771 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -421.695341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.695341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.814149 (E_RNA) where: Base-Base interactions energy: -264.447 where: short stacking energy: -117.675 Base-Backbone interact. energy: -0.857 local terms energy: -156.509638 where: bonds (distance) C4'-P energy: -37.570 bonds (distance) P-C4' energy: -36.101 flat angles C4'-P-C4' energy: -38.449 flat angles P-C4'-P energy: -18.575 tors. eta vs tors. theta energy: -25.815 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -364.135511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.135511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.958939 (E_RNA) where: Base-Base interactions energy: -222.444 where: short stacking energy: -109.104 Base-Backbone interact. energy: -0.441 local terms energy: -142.074389 where: bonds (distance) C4'-P energy: -32.755 bonds (distance) P-C4' energy: -22.096 flat angles C4'-P-C4' energy: -32.401 flat angles P-C4'-P energy: -25.520 tors. eta vs tors. theta energy: -29.303 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -357.289393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.289393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.520884 (E_RNA) where: Base-Base interactions energy: -229.926 where: short stacking energy: -103.034 Base-Backbone interact. energy: -0.924 local terms energy: -126.670309 where: bonds (distance) C4'-P energy: -27.891 bonds (distance) P-C4' energy: -36.755 flat angles C4'-P-C4' energy: -34.071 flat angles P-C4'-P energy: -12.656 tors. eta vs tors. theta energy: -15.298 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -286.416583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.416583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.517933 (E_RNA) where: Base-Base interactions energy: -158.665 where: short stacking energy: -88.604 Base-Backbone interact. energy: -0.188 local terms energy: -128.664540 where: bonds (distance) C4'-P energy: -20.997 bonds (distance) P-C4' energy: -34.728 flat angles C4'-P-C4' energy: -34.291 flat angles P-C4'-P energy: -27.683 tors. eta vs tors. theta energy: -10.965 Dist. restrs. and SS energy: 1.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -323.841073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.841073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.331385 (E_RNA) where: Base-Base interactions energy: -194.958 where: short stacking energy: -86.453 Base-Backbone interact. energy: 0.814 local terms energy: -130.187101 where: bonds (distance) C4'-P energy: -27.446 bonds (distance) P-C4' energy: -40.570 flat angles C4'-P-C4' energy: -25.487 flat angles P-C4'-P energy: -21.625 tors. eta vs tors. theta energy: -15.058 Dist. restrs. and SS energy: 0.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -565.486462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.486462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.523453 (E_RNA) where: Base-Base interactions energy: -387.826 where: short stacking energy: -153.629 Base-Backbone interact. energy: -1.583 local terms energy: -176.114411 where: bonds (distance) C4'-P energy: -39.141 bonds (distance) P-C4' energy: -42.666 flat angles C4'-P-C4' energy: -27.420 flat angles P-C4'-P energy: -26.924 tors. eta vs tors. theta energy: -39.963 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -547.584952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.584952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.614025 (E_RNA) where: Base-Base interactions energy: -357.847 where: short stacking energy: -154.470 Base-Backbone interact. energy: -1.040 local terms energy: -188.726610 where: bonds (distance) C4'-P energy: -33.055 bonds (distance) P-C4' energy: -43.343 flat angles C4'-P-C4' energy: -44.745 flat angles P-C4'-P energy: -25.461 tors. eta vs tors. theta energy: -42.123 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -528.514870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.514870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.665151 (E_RNA) where: Base-Base interactions energy: -331.437 where: short stacking energy: -173.638 Base-Backbone interact. energy: -0.393 local terms energy: -196.835553 where: bonds (distance) C4'-P energy: -37.200 bonds (distance) P-C4' energy: -41.171 flat angles C4'-P-C4' energy: -40.584 flat angles P-C4'-P energy: -27.484 tors. eta vs tors. theta energy: -50.397 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -474.231100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.231100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.585709 (E_RNA) where: Base-Base interactions energy: -283.834 where: short stacking energy: -136.751 Base-Backbone interact. energy: -0.624 local terms energy: -190.128145 where: bonds (distance) C4'-P energy: -42.147 bonds (distance) P-C4' energy: -41.296 flat angles C4'-P-C4' energy: -38.610 flat angles P-C4'-P energy: -30.197 tors. eta vs tors. theta energy: -37.878 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -453.839349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.839349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.008241 (E_RNA) where: Base-Base interactions energy: -275.631 where: short stacking energy: -131.612 Base-Backbone interact. energy: -1.135 local terms energy: -177.242362 where: bonds (distance) C4'-P energy: -30.972 bonds (distance) P-C4' energy: -40.314 flat angles C4'-P-C4' energy: -40.944 flat angles P-C4'-P energy: -29.216 tors. eta vs tors. theta energy: -35.797 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -411.116071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.116071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.171501 (E_RNA) where: Base-Base interactions energy: -251.242 where: short stacking energy: -109.986 Base-Backbone interact. energy: 0.512 local terms energy: -160.441826 where: bonds (distance) C4'-P energy: -42.821 bonds (distance) P-C4' energy: -42.638 flat angles C4'-P-C4' energy: -26.472 flat angles P-C4'-P energy: -19.203 tors. eta vs tors. theta energy: -29.308 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -394.452454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.452454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.950396 (E_RNA) where: Base-Base interactions energy: -233.111 where: short stacking energy: -113.949 Base-Backbone interact. energy: 0.675 local terms energy: -163.514681 where: bonds (distance) C4'-P energy: -40.581 bonds (distance) P-C4' energy: -40.197 flat angles C4'-P-C4' energy: -24.680 flat angles P-C4'-P energy: -26.872 tors. eta vs tors. theta energy: -31.185 Dist. restrs. and SS energy: 1.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -388.715790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.715790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.759450 (E_RNA) where: Base-Base interactions energy: -253.287 where: short stacking energy: -105.773 Base-Backbone interact. energy: -1.840 local terms energy: -134.631892 where: bonds (distance) C4'-P energy: -33.269 bonds (distance) P-C4' energy: -34.463 flat angles C4'-P-C4' energy: -28.052 flat angles P-C4'-P energy: -17.844 tors. eta vs tors. theta energy: -21.004 Dist. restrs. and SS energy: 1.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -322.736814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.736814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.920645 (E_RNA) where: Base-Base interactions energy: -191.681 where: short stacking energy: -88.486 Base-Backbone interact. energy: -1.559 local terms energy: -129.680430 where: bonds (distance) C4'-P energy: -27.108 bonds (distance) P-C4' energy: -31.972 flat angles C4'-P-C4' energy: -28.937 flat angles P-C4'-P energy: -27.724 tors. eta vs tors. theta energy: -13.940 Dist. restrs. and SS energy: 0.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -288.806902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.806902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.858835 (E_RNA) where: Base-Base interactions energy: -163.876 where: short stacking energy: -73.350 Base-Backbone interact. energy: 0.109 local terms energy: -125.091767 where: bonds (distance) C4'-P energy: -33.999 bonds (distance) P-C4' energy: -30.526 flat angles C4'-P-C4' energy: -25.590 flat angles P-C4'-P energy: -22.287 tors. eta vs tors. theta energy: -12.689 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -584.917962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.917962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.991639 (E_RNA) where: Base-Base interactions energy: -390.046 where: short stacking energy: -164.779 Base-Backbone interact. energy: -1.402 local terms energy: -193.543643 where: bonds (distance) C4'-P energy: -34.140 bonds (distance) P-C4' energy: -47.913 flat angles C4'-P-C4' energy: -36.674 flat angles P-C4'-P energy: -30.206 tors. eta vs tors. theta energy: -44.610 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -543.660492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.660492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.041888 (E_RNA) where: Base-Base interactions energy: -352.236 where: short stacking energy: -169.311 Base-Backbone interact. energy: -0.937 local terms energy: -192.868580 where: bonds (distance) C4'-P energy: -37.922 bonds (distance) P-C4' energy: -44.241 flat angles C4'-P-C4' energy: -36.295 flat angles P-C4'-P energy: -26.817 tors. eta vs tors. theta energy: -47.594 Dist. restrs. and SS energy: 2.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -527.200619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.200619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.328646 (E_RNA) where: Base-Base interactions energy: -341.921 where: short stacking energy: -135.513 Base-Backbone interact. energy: -0.383 local terms energy: -185.024869 where: bonds (distance) C4'-P energy: -37.054 bonds (distance) P-C4' energy: -43.655 flat angles C4'-P-C4' energy: -44.362 flat angles P-C4'-P energy: -26.516 tors. eta vs tors. theta energy: -33.438 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -499.053385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.053385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.544553 (E_RNA) where: Base-Base interactions energy: -306.836 where: short stacking energy: -148.427 Base-Backbone interact. energy: 3.280 local terms energy: -195.988411 where: bonds (distance) C4'-P energy: -36.739 bonds (distance) P-C4' energy: -44.908 flat angles C4'-P-C4' energy: -40.178 flat angles P-C4'-P energy: -28.351 tors. eta vs tors. theta energy: -45.812 Dist. restrs. and SS energy: 0.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -451.745697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.745697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.766903 (E_RNA) where: Base-Base interactions energy: -265.168 where: short stacking energy: -116.417 Base-Backbone interact. energy: -0.939 local terms energy: -185.660310 where: bonds (distance) C4'-P energy: -38.329 bonds (distance) P-C4' energy: -44.375 flat angles C4'-P-C4' energy: -39.096 flat angles P-C4'-P energy: -29.024 tors. eta vs tors. theta energy: -34.835 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -424.648988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.648988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.794537 (E_RNA) where: Base-Base interactions energy: -268.034 where: short stacking energy: -118.788 Base-Backbone interact. energy: -0.298 local terms energy: -156.462171 where: bonds (distance) C4'-P energy: -31.308 bonds (distance) P-C4' energy: -32.699 flat angles C4'-P-C4' energy: -42.039 flat angles P-C4'-P energy: -18.301 tors. eta vs tors. theta energy: -32.115 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -370.181241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.181241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.709233 (E_RNA) where: Base-Base interactions energy: -215.539 where: short stacking energy: -132.576 Base-Backbone interact. energy: 0.125 local terms energy: -157.295676 where: bonds (distance) C4'-P energy: -33.279 bonds (distance) P-C4' energy: -38.737 flat angles C4'-P-C4' energy: -30.216 flat angles P-C4'-P energy: -21.039 tors. eta vs tors. theta energy: -34.025 Dist. restrs. and SS energy: 2.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -398.148795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.148795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.765806 (E_RNA) where: Base-Base interactions energy: -260.204 where: short stacking energy: -111.860 Base-Backbone interact. energy: 0.025 local terms energy: -138.586749 where: bonds (distance) C4'-P energy: -34.424 bonds (distance) P-C4' energy: -32.452 flat angles C4'-P-C4' energy: -28.599 flat angles P-C4'-P energy: -19.286 tors. eta vs tors. theta energy: -23.826 Dist. restrs. and SS energy: 0.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -386.678980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.678980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.935794 (E_RNA) where: Base-Base interactions energy: -237.276 where: short stacking energy: -109.773 Base-Backbone interact. energy: -0.992 local terms energy: -148.667443 where: bonds (distance) C4'-P energy: -28.594 bonds (distance) P-C4' energy: -38.171 flat angles C4'-P-C4' energy: -37.424 flat angles P-C4'-P energy: -24.205 tors. eta vs tors. theta energy: -20.273 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -319.199363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.199363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.163216 (E_RNA) where: Base-Base interactions energy: -182.135 where: short stacking energy: -86.938 Base-Backbone interact. energy: 0.179 local terms energy: -138.207588 where: bonds (distance) C4'-P energy: -33.735 bonds (distance) P-C4' energy: -36.437 flat angles C4'-P-C4' energy: -31.393 flat angles P-C4'-P energy: -18.028 tors. eta vs tors. theta energy: -18.615 Dist. restrs. and SS energy: 0.964 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -594.169218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.169218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.459328 (E_RNA) where: Base-Base interactions energy: -404.662 where: short stacking energy: -166.745 Base-Backbone interact. energy: -1.881 local terms energy: -187.915794 where: bonds (distance) C4'-P energy: -35.922 bonds (distance) P-C4' energy: -40.561 flat angles C4'-P-C4' energy: -44.963 flat angles P-C4'-P energy: -25.010 tors. eta vs tors. theta energy: -41.461 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -541.405935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.405935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.641247 (E_RNA) where: Base-Base interactions energy: -350.621 where: short stacking energy: -150.358 Base-Backbone interact. energy: -1.057 local terms energy: -190.962811 where: bonds (distance) C4'-P energy: -41.490 bonds (distance) P-C4' energy: -39.274 flat angles C4'-P-C4' energy: -37.301 flat angles P-C4'-P energy: -24.844 tors. eta vs tors. theta energy: -48.054 Dist. restrs. and SS energy: 1.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -509.997438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.997438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.739810 (E_RNA) where: Base-Base interactions energy: -316.010 where: short stacking energy: -149.668 Base-Backbone interact. energy: -0.551 local terms energy: -194.178229 where: bonds (distance) C4'-P energy: -33.930 bonds (distance) P-C4' energy: -38.141 flat angles C4'-P-C4' energy: -42.206 flat angles P-C4'-P energy: -33.508 tors. eta vs tors. theta energy: -46.394 Dist. restrs. and SS energy: 0.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -504.152177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.152177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.397262 (E_RNA) where: Base-Base interactions energy: -318.918 where: short stacking energy: -144.252 Base-Backbone interact. energy: -0.918 local terms energy: -184.560827 where: bonds (distance) C4'-P energy: -42.066 bonds (distance) P-C4' energy: -29.281 flat angles C4'-P-C4' energy: -46.066 flat angles P-C4'-P energy: -23.250 tors. eta vs tors. theta energy: -43.898 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -457.116804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.116804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.319992 (E_RNA) where: Base-Base interactions energy: -274.227 where: short stacking energy: -139.462 Base-Backbone interact. energy: -0.115 local terms energy: -182.978043 where: bonds (distance) C4'-P energy: -37.076 bonds (distance) P-C4' energy: -32.618 flat angles C4'-P-C4' energy: -39.519 flat angles P-C4'-P energy: -33.845 tors. eta vs tors. theta energy: -39.920 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -422.462939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.462939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.159150 (E_RNA) where: Base-Base interactions energy: -260.919 where: short stacking energy: -116.253 Base-Backbone interact. energy: -0.290 local terms energy: -161.949818 where: bonds (distance) C4'-P energy: -35.498 bonds (distance) P-C4' energy: -35.165 flat angles C4'-P-C4' energy: -39.635 flat angles P-C4'-P energy: -23.859 tors. eta vs tors. theta energy: -27.793 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -399.027361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.027361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.115110 (E_RNA) where: Base-Base interactions energy: -258.287 where: short stacking energy: -111.925 Base-Backbone interact. energy: -1.811 local terms energy: -139.017244 where: bonds (distance) C4'-P energy: -26.504 bonds (distance) P-C4' energy: -30.039 flat angles C4'-P-C4' energy: -32.299 flat angles P-C4'-P energy: -20.862 tors. eta vs tors. theta energy: -29.313 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -328.048962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.048962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.174229 (E_RNA) where: Base-Base interactions energy: -190.952 where: short stacking energy: -92.444 Base-Backbone interact. energy: -0.244 local terms energy: -136.977536 where: bonds (distance) C4'-P energy: -35.508 bonds (distance) P-C4' energy: -36.017 flat angles C4'-P-C4' energy: -25.037 flat angles P-C4'-P energy: -25.347 tors. eta vs tors. theta energy: -15.068 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -388.535578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.535578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.129701 (E_RNA) where: Base-Base interactions energy: -254.605 where: short stacking energy: -115.966 Base-Backbone interact. energy: 1.480 local terms energy: -136.005042 where: bonds (distance) C4'-P energy: -19.807 bonds (distance) P-C4' energy: -38.241 flat angles C4'-P-C4' energy: -28.789 flat angles P-C4'-P energy: -23.012 tors. eta vs tors. theta energy: -26.157 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -333.210227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.210227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.399091 (E_RNA) where: Base-Base interactions energy: -197.909 where: short stacking energy: -88.758 Base-Backbone interact. energy: -0.747 local terms energy: -134.743464 where: bonds (distance) C4'-P energy: -31.496 bonds (distance) P-C4' energy: -37.300 flat angles C4'-P-C4' energy: -23.366 flat angles P-C4'-P energy: -17.470 tors. eta vs tors. theta energy: -25.111 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -583.795303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.795303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.196096 (E_RNA) where: Base-Base interactions energy: -398.086 where: short stacking energy: -161.583 Base-Backbone interact. energy: -1.343 local terms energy: -184.767119 where: bonds (distance) C4'-P energy: -37.993 bonds (distance) P-C4' energy: -37.158 flat angles C4'-P-C4' energy: -34.314 flat angles P-C4'-P energy: -30.203 tors. eta vs tors. theta energy: -45.099 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -559.007478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.007478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.697559 (E_RNA) where: Base-Base interactions energy: -361.680 where: short stacking energy: -166.290 Base-Backbone interact. energy: -0.930 local terms energy: -197.087731 where: bonds (distance) C4'-P energy: -35.198 bonds (distance) P-C4' energy: -43.614 flat angles C4'-P-C4' energy: -44.298 flat angles P-C4'-P energy: -29.995 tors. eta vs tors. theta energy: -43.982 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -501.887335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.887335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.127659 (E_RNA) where: Base-Base interactions energy: -311.322 where: short stacking energy: -147.436 Base-Backbone interact. energy: -0.466 local terms energy: -190.340495 where: bonds (distance) C4'-P energy: -38.635 bonds (distance) P-C4' energy: -37.114 flat angles C4'-P-C4' energy: -39.297 flat angles P-C4'-P energy: -31.601 tors. eta vs tors. theta energy: -43.693 Dist. restrs. and SS energy: 0.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -488.082267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.082267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.163809 (E_RNA) where: Base-Base interactions energy: -318.918 where: short stacking energy: -140.557 Base-Backbone interact. energy: 2.687 local terms energy: -171.932709 where: bonds (distance) C4'-P energy: -28.998 bonds (distance) P-C4' energy: -41.766 flat angles C4'-P-C4' energy: -39.767 flat angles P-C4'-P energy: -27.185 tors. eta vs tors. theta energy: -34.218 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -456.597346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.597346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.039828 (E_RNA) where: Base-Base interactions energy: -269.836 where: short stacking energy: -140.814 Base-Backbone interact. energy: -0.646 local terms energy: -186.558516 where: bonds (distance) C4'-P energy: -34.378 bonds (distance) P-C4' energy: -43.959 flat angles C4'-P-C4' energy: -36.457 flat angles P-C4'-P energy: -26.555 tors. eta vs tors. theta energy: -45.210 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -391.415433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.415433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.482758 (E_RNA) where: Base-Base interactions energy: -241.214 where: short stacking energy: -119.558 Base-Backbone interact. energy: -0.149 local terms energy: -150.120490 where: bonds (distance) C4'-P energy: -32.488 bonds (distance) P-C4' energy: -37.241 flat angles C4'-P-C4' energy: -35.468 flat angles P-C4'-P energy: -8.700 tors. eta vs tors. theta energy: -36.224 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -430.217724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.217724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.501223 (E_RNA) where: Base-Base interactions energy: -273.354 where: short stacking energy: -115.154 Base-Backbone interact. energy: -1.152 local terms energy: -155.995109 where: bonds (distance) C4'-P energy: -35.066 bonds (distance) P-C4' energy: -40.704 flat angles C4'-P-C4' energy: -40.063 flat angles P-C4'-P energy: -14.146 tors. eta vs tors. theta energy: -26.016 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -345.059034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.059034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.106577 (E_RNA) where: Base-Base interactions energy: -203.126 where: short stacking energy: -90.559 Base-Backbone interact. energy: -0.497 local terms energy: -141.483722 where: bonds (distance) C4'-P energy: -40.821 bonds (distance) P-C4' energy: -29.669 flat angles C4'-P-C4' energy: -30.182 flat angles P-C4'-P energy: -25.400 tors. eta vs tors. theta energy: -15.412 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -315.381123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.381123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.607442 (E_RNA) where: Base-Base interactions energy: -167.875 where: short stacking energy: -96.547 Base-Backbone interact. energy: -0.455 local terms energy: -147.277518 where: bonds (distance) C4'-P energy: -35.028 bonds (distance) P-C4' energy: -27.420 flat angles C4'-P-C4' energy: -37.273 flat angles P-C4'-P energy: -23.142 tors. eta vs tors. theta energy: -24.414 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -317.502002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.502002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.341031 (E_RNA) where: Base-Base interactions energy: -191.304 where: short stacking energy: -73.941 Base-Backbone interact. energy: -0.395 local terms energy: -130.641430 where: bonds (distance) C4'-P energy: -34.442 bonds (distance) P-C4' energy: -40.526 flat angles C4'-P-C4' energy: -32.368 flat angles P-C4'-P energy: -12.484 tors. eta vs tors. theta energy: -10.821 Dist. restrs. and SS energy: 4.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -568.858404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.858404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.894382 (E_RNA) where: Base-Base interactions energy: -382.086 where: short stacking energy: -174.910 Base-Backbone interact. energy: 0.165 local terms energy: -187.973798 where: bonds (distance) C4'-P energy: -39.684 bonds (distance) P-C4' energy: -32.792 flat angles C4'-P-C4' energy: -41.224 flat angles P-C4'-P energy: -29.671 tors. eta vs tors. theta energy: -44.603 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -556.744515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.744515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.809516 (E_RNA) where: Base-Base interactions energy: -366.968 where: short stacking energy: -159.631 Base-Backbone interact. energy: -1.539 local terms energy: -188.302093 where: bonds (distance) C4'-P energy: -37.790 bonds (distance) P-C4' energy: -35.660 flat angles C4'-P-C4' energy: -38.914 flat angles P-C4'-P energy: -30.413 tors. eta vs tors. theta energy: -45.525 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -512.756301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.756301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.786080 (E_RNA) where: Base-Base interactions energy: -330.187 where: short stacking energy: -134.786 Base-Backbone interact. energy: -0.613 local terms energy: -181.986080 where: bonds (distance) C4'-P energy: -34.409 bonds (distance) P-C4' energy: -43.621 flat angles C4'-P-C4' energy: -43.376 flat angles P-C4'-P energy: -20.647 tors. eta vs tors. theta energy: -39.932 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -499.789370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.789370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.840437 (E_RNA) where: Base-Base interactions energy: -326.409 where: short stacking energy: -145.418 Base-Backbone interact. energy: -0.086 local terms energy: -173.345781 where: bonds (distance) C4'-P energy: -35.744 bonds (distance) P-C4' energy: -37.060 flat angles C4'-P-C4' energy: -34.763 flat angles P-C4'-P energy: -26.426 tors. eta vs tors. theta energy: -39.353 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -461.746341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.746341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.403740 (E_RNA) where: Base-Base interactions energy: -279.121 where: short stacking energy: -138.772 Base-Backbone interact. energy: -0.478 local terms energy: -182.805012 where: bonds (distance) C4'-P energy: -42.323 bonds (distance) P-C4' energy: -36.114 flat angles C4'-P-C4' energy: -39.452 flat angles P-C4'-P energy: -19.808 tors. eta vs tors. theta energy: -45.109 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -366.273830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.273830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.359095 (E_RNA) where: Base-Base interactions energy: -210.297 where: short stacking energy: -104.373 Base-Backbone interact. energy: 0.310 local terms energy: -156.372269 where: bonds (distance) C4'-P energy: -35.241 bonds (distance) P-C4' energy: -36.746 flat angles C4'-P-C4' energy: -41.340 flat angles P-C4'-P energy: -15.580 tors. eta vs tors. theta energy: -27.466 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -419.077130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.077130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.151233 (E_RNA) where: Base-Base interactions energy: -247.267 where: short stacking energy: -110.967 Base-Backbone interact. energy: -0.459 local terms energy: -171.425104 where: bonds (distance) C4'-P energy: -36.737 bonds (distance) P-C4' energy: -34.624 flat angles C4'-P-C4' energy: -42.351 flat angles P-C4'-P energy: -26.059 tors. eta vs tors. theta energy: -31.654 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -369.402204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.402204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.607186 (E_RNA) where: Base-Base interactions energy: -215.170 where: short stacking energy: -105.820 Base-Backbone interact. energy: 3.214 local terms energy: -157.651665 where: bonds (distance) C4'-P energy: -21.433 bonds (distance) P-C4' energy: -34.017 flat angles C4'-P-C4' energy: -40.491 flat angles P-C4'-P energy: -27.301 tors. eta vs tors. theta energy: -34.410 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -376.753493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.753493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.812285 (E_RNA) where: Base-Base interactions energy: -234.128 where: short stacking energy: -110.787 Base-Backbone interact. energy: -1.104 local terms energy: -141.579717 where: bonds (distance) C4'-P energy: -27.374 bonds (distance) P-C4' energy: -42.555 flat angles C4'-P-C4' energy: -36.696 flat angles P-C4'-P energy: -15.045 tors. eta vs tors. theta energy: -19.910 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -275.944481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.944481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.518076 (E_RNA) where: Base-Base interactions energy: -155.482 where: short stacking energy: -83.489 Base-Backbone interact. energy: -0.542 local terms energy: -123.493494 where: bonds (distance) C4'-P energy: -29.450 bonds (distance) P-C4' energy: -33.742 flat angles C4'-P-C4' energy: -24.268 flat angles P-C4'-P energy: -20.516 tors. eta vs tors. theta energy: -15.518 Dist. restrs. and SS energy: 3.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -574.173258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.173258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.140389 (E_RNA) where: Base-Base interactions energy: -378.965 where: short stacking energy: -156.649 Base-Backbone interact. energy: 0.853 local terms energy: -197.028092 where: bonds (distance) C4'-P energy: -39.035 bonds (distance) P-C4' energy: -44.043 flat angles C4'-P-C4' energy: -40.860 flat angles P-C4'-P energy: -30.336 tors. eta vs tors. theta energy: -42.754 Dist. restrs. and SS energy: 0.967 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -565.805355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.805355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.002020 (E_RNA) where: Base-Base interactions energy: -378.208 where: short stacking energy: -166.319 Base-Backbone interact. energy: -0.806 local terms energy: -186.987427 where: bonds (distance) C4'-P energy: -37.725 bonds (distance) P-C4' energy: -37.879 flat angles C4'-P-C4' energy: -42.291 flat angles P-C4'-P energy: -23.982 tors. eta vs tors. theta energy: -45.110 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -533.435862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.435862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.035316 (E_RNA) where: Base-Base interactions energy: -340.866 where: short stacking energy: -154.938 Base-Backbone interact. energy: -0.503 local terms energy: -192.665696 where: bonds (distance) C4'-P energy: -38.026 bonds (distance) P-C4' energy: -42.679 flat angles C4'-P-C4' energy: -40.990 flat angles P-C4'-P energy: -25.235 tors. eta vs tors. theta energy: -45.736 Dist. restrs. and SS energy: 0.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -482.529356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.529356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.720752 (E_RNA) where: Base-Base interactions energy: -314.224 where: short stacking energy: -148.781 Base-Backbone interact. energy: -0.830 local terms energy: -167.666706 where: bonds (distance) C4'-P energy: -27.591 bonds (distance) P-C4' energy: -40.839 flat angles C4'-P-C4' energy: -40.055 flat angles P-C4'-P energy: -23.674 tors. eta vs tors. theta energy: -35.507 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -451.958630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.958630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.967489 (E_RNA) where: Base-Base interactions energy: -267.725 where: short stacking energy: -145.499 Base-Backbone interact. energy: 0.274 local terms energy: -185.516447 where: bonds (distance) C4'-P energy: -37.325 bonds (distance) P-C4' energy: -43.209 flat angles C4'-P-C4' energy: -45.761 flat angles P-C4'-P energy: -24.450 tors. eta vs tors. theta energy: -34.772 Dist. restrs. and SS energy: 1.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -425.956997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.956997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.186758 (E_RNA) where: Base-Base interactions energy: -270.266 where: short stacking energy: -119.660 Base-Backbone interact. energy: -0.198 local terms energy: -155.723047 where: bonds (distance) C4'-P energy: -33.267 bonds (distance) P-C4' energy: -29.953 flat angles C4'-P-C4' energy: -35.445 flat angles P-C4'-P energy: -28.922 tors. eta vs tors. theta energy: -28.136 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -356.387888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.387888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.729404 (E_RNA) where: Base-Base interactions energy: -193.516 where: short stacking energy: -110.613 Base-Backbone interact. energy: -0.697 local terms energy: -162.516194 where: bonds (distance) C4'-P energy: -34.446 bonds (distance) P-C4' energy: -38.844 flat angles C4'-P-C4' energy: -37.315 flat angles P-C4'-P energy: -28.333 tors. eta vs tors. theta energy: -23.579 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -378.195049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.195049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.257404 (E_RNA) where: Base-Base interactions energy: -226.518 where: short stacking energy: -99.019 Base-Backbone interact. energy: -1.405 local terms energy: -150.334394 where: bonds (distance) C4'-P energy: -35.245 bonds (distance) P-C4' energy: -32.947 flat angles C4'-P-C4' energy: -31.850 flat angles P-C4'-P energy: -26.426 tors. eta vs tors. theta energy: -23.866 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -317.467441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.467441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.746480 (E_RNA) where: Base-Base interactions energy: -186.494 where: short stacking energy: -99.648 Base-Backbone interact. energy: -0.103 local terms energy: -132.150147 where: bonds (distance) C4'-P energy: -36.554 bonds (distance) P-C4' energy: -39.102 flat angles C4'-P-C4' energy: -21.958 flat angles P-C4'-P energy: -13.488 tors. eta vs tors. theta energy: -21.049 Dist. restrs. and SS energy: 1.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -271.105384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.105384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.371143 (E_RNA) where: Base-Base interactions energy: -166.242 where: short stacking energy: -72.160 Base-Backbone interact. energy: -0.656 local terms energy: -110.473916 where: bonds (distance) C4'-P energy: -35.890 bonds (distance) P-C4' energy: -30.756 flat angles C4'-P-C4' energy: -17.556 flat angles P-C4'-P energy: -19.582 tors. eta vs tors. theta energy: -6.689 Dist. restrs. and SS energy: 6.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -587.179443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.179443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.213088 (E_RNA) where: Base-Base interactions energy: -382.553 where: short stacking energy: -176.239 Base-Backbone interact. energy: -0.510 local terms energy: -204.150359 where: bonds (distance) C4'-P energy: -38.888 bonds (distance) P-C4' energy: -42.319 flat angles C4'-P-C4' energy: -46.142 flat angles P-C4'-P energy: -28.613 tors. eta vs tors. theta energy: -48.188 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -557.213388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.213388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.698357 (E_RNA) where: Base-Base interactions energy: -366.503 where: short stacking energy: -156.738 Base-Backbone interact. energy: -0.497 local terms energy: -190.697668 where: bonds (distance) C4'-P energy: -36.711 bonds (distance) P-C4' energy: -39.841 flat angles C4'-P-C4' energy: -39.933 flat angles P-C4'-P energy: -31.955 tors. eta vs tors. theta energy: -42.256 Dist. restrs. and SS energy: 0.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -500.807111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.807111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.855945 (E_RNA) where: Base-Base interactions energy: -306.764 where: short stacking energy: -155.514 Base-Backbone interact. energy: -0.832 local terms energy: -193.260037 where: bonds (distance) C4'-P energy: -39.240 bonds (distance) P-C4' energy: -40.589 flat angles C4'-P-C4' energy: -35.325 flat angles P-C4'-P energy: -31.742 tors. eta vs tors. theta energy: -46.364 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -519.983658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.983658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.997631 (E_RNA) where: Base-Base interactions energy: -340.597 where: short stacking energy: -163.685 Base-Backbone interact. energy: 3.430 local terms energy: -182.830532 where: bonds (distance) C4'-P energy: -35.820 bonds (distance) P-C4' energy: -35.538 flat angles C4'-P-C4' energy: -38.248 flat angles P-C4'-P energy: -26.130 tors. eta vs tors. theta energy: -47.094 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -441.272305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.272305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.335775 (E_RNA) where: Base-Base interactions energy: -275.072 where: short stacking energy: -116.840 Base-Backbone interact. energy: 0.045 local terms energy: -166.309284 where: bonds (distance) C4'-P energy: -39.175 bonds (distance) P-C4' energy: -36.329 flat angles C4'-P-C4' energy: -35.589 flat angles P-C4'-P energy: -22.579 tors. eta vs tors. theta energy: -32.637 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -410.210587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.210587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.553510 (E_RNA) where: Base-Base interactions energy: -259.195 where: short stacking energy: -104.634 Base-Backbone interact. energy: 1.544 local terms energy: -152.902634 where: bonds (distance) C4'-P energy: -39.825 bonds (distance) P-C4' energy: -33.734 flat angles C4'-P-C4' energy: -32.274 flat angles P-C4'-P energy: -22.996 tors. eta vs tors. theta energy: -24.074 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -352.141531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.141531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.216829 (E_RNA) where: Base-Base interactions energy: -205.610 where: short stacking energy: -95.959 Base-Backbone interact. energy: -0.845 local terms energy: -145.762368 where: bonds (distance) C4'-P energy: -36.342 bonds (distance) P-C4' energy: -39.748 flat angles C4'-P-C4' energy: -32.380 flat angles P-C4'-P energy: -15.753 tors. eta vs tors. theta energy: -21.540 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -352.784375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.784375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.998119 (E_RNA) where: Base-Base interactions energy: -206.625 where: short stacking energy: -107.803 Base-Backbone interact. energy: -0.298 local terms energy: -146.075138 where: bonds (distance) C4'-P energy: -41.099 bonds (distance) P-C4' energy: -30.182 flat angles C4'-P-C4' energy: -39.609 flat angles P-C4'-P energy: -15.859 tors. eta vs tors. theta energy: -19.326 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -305.275072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.275072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.822001 (E_RNA) where: Base-Base interactions energy: -191.501 where: short stacking energy: -91.619 Base-Backbone interact. energy: -0.008 local terms energy: -114.312505 where: bonds (distance) C4'-P energy: -32.624 bonds (distance) P-C4' energy: -27.436 flat angles C4'-P-C4' energy: -29.572 flat angles P-C4'-P energy: -15.950 tors. eta vs tors. theta energy: -8.730 Dist. restrs. and SS energy: 0.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -322.932800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.932800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.208069 (E_RNA) where: Base-Base interactions energy: -193.522 where: short stacking energy: -89.346 Base-Backbone interact. energy: 0.863 local terms energy: -130.548985 where: bonds (distance) C4'-P energy: -13.456 bonds (distance) P-C4' energy: -42.345 flat angles C4'-P-C4' energy: -32.143 flat angles P-C4'-P energy: -25.963 tors. eta vs tors. theta energy: -16.641 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -570.353737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.353737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.476391 (E_RNA) where: Base-Base interactions energy: -386.692 where: short stacking energy: -168.623 Base-Backbone interact. energy: -0.766 local terms energy: -183.017776 where: bonds (distance) C4'-P energy: -33.588 bonds (distance) P-C4' energy: -31.461 flat angles C4'-P-C4' energy: -42.771 flat angles P-C4'-P energy: -29.192 tors. eta vs tors. theta energy: -46.006 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -544.689600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.689600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.635668 (E_RNA) where: Base-Base interactions energy: -357.242 where: short stacking energy: -156.037 Base-Backbone interact. energy: -0.368 local terms energy: -188.025550 where: bonds (distance) C4'-P energy: -41.424 bonds (distance) P-C4' energy: -40.139 flat angles C4'-P-C4' energy: -42.754 flat angles P-C4'-P energy: -18.910 tors. eta vs tors. theta energy: -44.799 Dist. restrs. and SS energy: 0.946 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -506.354015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.354015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.379013 (E_RNA) where: Base-Base interactions energy: -323.991 where: short stacking energy: -166.078 Base-Backbone interact. energy: -1.110 local terms energy: -181.278079 where: bonds (distance) C4'-P energy: -30.703 bonds (distance) P-C4' energy: -32.348 flat angles C4'-P-C4' energy: -41.857 flat angles P-C4'-P energy: -30.692 tors. eta vs tors. theta energy: -45.678 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -532.210564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.210564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.360681 (E_RNA) where: Base-Base interactions energy: -341.728 where: short stacking energy: -156.142 Base-Backbone interact. energy: -0.925 local terms energy: -189.707465 where: bonds (distance) C4'-P energy: -39.512 bonds (distance) P-C4' energy: -33.629 flat angles C4'-P-C4' energy: -44.143 flat angles P-C4'-P energy: -27.195 tors. eta vs tors. theta energy: -45.229 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -445.552460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.552460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.672008 (E_RNA) where: Base-Base interactions energy: -275.460 where: short stacking energy: -133.711 Base-Backbone interact. energy: -0.100 local terms energy: -170.112683 where: bonds (distance) C4'-P energy: -38.830 bonds (distance) P-C4' energy: -36.632 flat angles C4'-P-C4' energy: -41.391 flat angles P-C4'-P energy: -19.268 tors. eta vs tors. theta energy: -33.992 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -421.097920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.097920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.304907 (E_RNA) where: Base-Base interactions energy: -265.887 where: short stacking energy: -108.666 Base-Backbone interact. energy: -0.533 local terms energy: -154.885650 where: bonds (distance) C4'-P energy: -40.208 bonds (distance) P-C4' energy: -34.293 flat angles C4'-P-C4' energy: -36.055 flat angles P-C4'-P energy: -21.179 tors. eta vs tors. theta energy: -23.150 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -332.315343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.315343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.379137 (E_RNA) where: Base-Base interactions energy: -189.294 where: short stacking energy: -86.426 Base-Backbone interact. energy: 0.022 local terms energy: -143.106968 where: bonds (distance) C4'-P energy: -34.026 bonds (distance) P-C4' energy: -33.655 flat angles C4'-P-C4' energy: -37.264 flat angles P-C4'-P energy: -22.582 tors. eta vs tors. theta energy: -15.580 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -344.417150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.417150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.483921 (E_RNA) where: Base-Base interactions energy: -208.478 where: short stacking energy: -92.453 Base-Backbone interact. energy: 0.818 local terms energy: -136.823605 where: bonds (distance) C4'-P energy: -33.029 bonds (distance) P-C4' energy: -33.855 flat angles C4'-P-C4' energy: -27.626 flat angles P-C4'-P energy: -23.018 tors. eta vs tors. theta energy: -19.295 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -315.116944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.116944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.734617 (E_RNA) where: Base-Base interactions energy: -180.267 where: short stacking energy: -89.155 Base-Backbone interact. energy: 0.597 local terms energy: -139.064864 where: bonds (distance) C4'-P energy: -27.122 bonds (distance) P-C4' energy: -42.254 flat angles C4'-P-C4' energy: -30.486 flat angles P-C4'-P energy: -27.576 tors. eta vs tors. theta energy: -11.627 Dist. restrs. and SS energy: 3.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -295.950770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.950770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.036936 (E_RNA) where: Base-Base interactions energy: -172.917 where: short stacking energy: -91.439 Base-Backbone interact. energy: -0.397 local terms energy: -125.723175 where: bonds (distance) C4'-P energy: -34.493 bonds (distance) P-C4' energy: -34.124 flat angles C4'-P-C4' energy: -30.287 flat angles P-C4'-P energy: -10.163 tors. eta vs tors. theta energy: -16.656 Dist. restrs. and SS energy: 3.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -567.506700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.506700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.806216 (E_RNA) where: Base-Base interactions energy: -374.735 where: short stacking energy: -162.646 Base-Backbone interact. energy: -0.952 local terms energy: -192.119372 where: bonds (distance) C4'-P energy: -41.197 bonds (distance) P-C4' energy: -38.911 flat angles C4'-P-C4' energy: -38.064 flat angles P-C4'-P energy: -24.634 tors. eta vs tors. theta energy: -49.313 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -555.829853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.829853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.662935 (E_RNA) where: Base-Base interactions energy: -359.096 where: short stacking energy: -165.704 Base-Backbone interact. energy: -0.244 local terms energy: -197.323698 where: bonds (distance) C4'-P energy: -43.086 bonds (distance) P-C4' energy: -42.916 flat angles C4'-P-C4' energy: -39.571 flat angles P-C4'-P energy: -26.296 tors. eta vs tors. theta energy: -45.455 Dist. restrs. and SS energy: 0.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -527.183465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.183465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.548775 (E_RNA) where: Base-Base interactions energy: -339.169 where: short stacking energy: -150.806 Base-Backbone interact. energy: -0.382 local terms energy: -187.997716 where: bonds (distance) C4'-P energy: -34.228 bonds (distance) P-C4' energy: -37.081 flat angles C4'-P-C4' energy: -44.613 flat angles P-C4'-P energy: -26.087 tors. eta vs tors. theta energy: -45.989 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -510.560348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.560348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.587819 (E_RNA) where: Base-Base interactions energy: -323.595 where: short stacking energy: -152.689 Base-Backbone interact. energy: -0.107 local terms energy: -186.885586 where: bonds (distance) C4'-P energy: -33.096 bonds (distance) P-C4' energy: -38.024 flat angles C4'-P-C4' energy: -40.799 flat angles P-C4'-P energy: -25.986 tors. eta vs tors. theta energy: -48.981 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -427.171754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.171754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.405727 (E_RNA) where: Base-Base interactions energy: -267.281 where: short stacking energy: -140.745 Base-Backbone interact. energy: 0.740 local terms energy: -160.864395 where: bonds (distance) C4'-P energy: -25.227 bonds (distance) P-C4' energy: -35.229 flat angles C4'-P-C4' energy: -37.772 flat angles P-C4'-P energy: -28.314 tors. eta vs tors. theta energy: -34.322 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -394.732428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.732428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.034275 (E_RNA) where: Base-Base interactions energy: -255.058 where: short stacking energy: -118.995 Base-Backbone interact. energy: -0.398 local terms energy: -139.578244 where: bonds (distance) C4'-P energy: -32.013 bonds (distance) P-C4' energy: -34.128 flat angles C4'-P-C4' energy: -28.938 flat angles P-C4'-P energy: -20.372 tors. eta vs tors. theta energy: -24.128 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -335.462754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.462754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.818585 (E_RNA) where: Base-Base interactions energy: -194.544 where: short stacking energy: -97.426 Base-Backbone interact. energy: -0.481 local terms energy: -140.793597 where: bonds (distance) C4'-P energy: -36.106 bonds (distance) P-C4' energy: -36.082 flat angles C4'-P-C4' energy: -34.872 flat angles P-C4'-P energy: -13.529 tors. eta vs tors. theta energy: -20.204 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -362.238502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.238502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.464026 (E_RNA) where: Base-Base interactions energy: -217.867 where: short stacking energy: -107.126 Base-Backbone interact. energy: -1.376 local terms energy: -143.221418 where: bonds (distance) C4'-P energy: -26.343 bonds (distance) P-C4' energy: -38.989 flat angles C4'-P-C4' energy: -34.730 flat angles P-C4'-P energy: -22.665 tors. eta vs tors. theta energy: -20.495 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -332.867966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.867966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.276800 (E_RNA) where: Base-Base interactions energy: -192.846 where: short stacking energy: -100.125 Base-Backbone interact. energy: -0.467 local terms energy: -140.963336 where: bonds (distance) C4'-P energy: -32.129 bonds (distance) P-C4' energy: -35.909 flat angles C4'-P-C4' energy: -29.741 flat angles P-C4'-P energy: -19.606 tors. eta vs tors. theta energy: -23.579 Dist. restrs. and SS energy: 1.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -291.855036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.855036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.153320 (E_RNA) where: Base-Base interactions energy: -167.022 where: short stacking energy: -85.787 Base-Backbone interact. energy: 0.226 local terms energy: -125.357167 where: bonds (distance) C4'-P energy: -16.065 bonds (distance) P-C4' energy: -39.297 flat angles C4'-P-C4' energy: -31.287 flat angles P-C4'-P energy: -23.673 tors. eta vs tors. theta energy: -15.036 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -590.507464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.507464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.584562 (E_RNA) where: Base-Base interactions energy: -393.551 where: short stacking energy: -188.153 Base-Backbone interact. energy: -1.145 local terms energy: -195.888805 where: bonds (distance) C4'-P energy: -40.941 bonds (distance) P-C4' energy: -37.379 flat angles C4'-P-C4' energy: -42.033 flat angles P-C4'-P energy: -21.716 tors. eta vs tors. theta energy: -53.821 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -556.179304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.179304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.578328 (E_RNA) where: Base-Base interactions energy: -357.625 where: short stacking energy: -167.032 Base-Backbone interact. energy: -0.743 local terms energy: -198.210458 where: bonds (distance) C4'-P energy: -38.149 bonds (distance) P-C4' energy: -43.925 flat angles C4'-P-C4' energy: -42.333 flat angles P-C4'-P energy: -27.147 tors. eta vs tors. theta energy: -46.656 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -531.477476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.477476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.739762 (E_RNA) where: Base-Base interactions energy: -340.169 where: short stacking energy: -166.560 Base-Backbone interact. energy: -0.454 local terms energy: -191.116675 where: bonds (distance) C4'-P energy: -30.342 bonds (distance) P-C4' energy: -44.212 flat angles C4'-P-C4' energy: -44.351 flat angles P-C4'-P energy: -24.420 tors. eta vs tors. theta energy: -47.791 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -503.775882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.775882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.046149 (E_RNA) where: Base-Base interactions energy: -333.617 where: short stacking energy: -154.283 Base-Backbone interact. energy: 1.372 local terms energy: -171.800974 where: bonds (distance) C4'-P energy: -32.788 bonds (distance) P-C4' energy: -36.312 flat angles C4'-P-C4' energy: -37.836 flat angles P-C4'-P energy: -22.017 tors. eta vs tors. theta energy: -42.847 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -437.920546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.920546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.145134 (E_RNA) where: Base-Base interactions energy: -285.140 where: short stacking energy: -130.723 Base-Backbone interact. energy: 0.178 local terms energy: -153.183353 where: bonds (distance) C4'-P energy: -35.620 bonds (distance) P-C4' energy: -28.560 flat angles C4'-P-C4' energy: -39.134 flat angles P-C4'-P energy: -18.140 tors. eta vs tors. theta energy: -31.729 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -388.722706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.722706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.118810 (E_RNA) where: Base-Base interactions energy: -235.598 where: short stacking energy: -112.955 Base-Backbone interact. energy: -0.627 local terms energy: -152.893580 where: bonds (distance) C4'-P energy: -31.726 bonds (distance) P-C4' energy: -40.074 flat angles C4'-P-C4' energy: -37.157 flat angles P-C4'-P energy: -23.958 tors. eta vs tors. theta energy: -19.978 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -353.952882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.952882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.414600 (E_RNA) where: Base-Base interactions energy: -207.034 where: short stacking energy: -90.243 Base-Backbone interact. energy: -0.222 local terms energy: -148.158866 where: bonds (distance) C4'-P energy: -35.249 bonds (distance) P-C4' energy: -35.149 flat angles C4'-P-C4' energy: -36.447 flat angles P-C4'-P energy: -16.304 tors. eta vs tors. theta energy: -25.010 Dist. restrs. and SS energy: 1.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -319.975564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.975564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.052372 (E_RNA) where: Base-Base interactions energy: -186.903 where: short stacking energy: -79.867 Base-Backbone interact. energy: -0.986 local terms energy: -132.163653 where: bonds (distance) C4'-P energy: -32.089 bonds (distance) P-C4' energy: -40.664 flat angles C4'-P-C4' energy: -27.882 flat angles P-C4'-P energy: -17.799 tors. eta vs tors. theta energy: -13.730 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -301.517828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.517828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.869343 (E_RNA) where: Base-Base interactions energy: -168.695 where: short stacking energy: -93.000 Base-Backbone interact. energy: -0.283 local terms energy: -132.891663 where: bonds (distance) C4'-P energy: -30.533 bonds (distance) P-C4' energy: -37.190 flat angles C4'-P-C4' energy: -34.204 flat angles P-C4'-P energy: -18.001 tors. eta vs tors. theta energy: -12.964 Dist. restrs. and SS energy: 0.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -290.980585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.980585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.125097 (E_RNA) where: Base-Base interactions energy: -178.107 where: short stacking energy: -84.381 Base-Backbone interact. energy: 1.816 local terms energy: -114.834467 where: bonds (distance) C4'-P energy: -28.505 bonds (distance) P-C4' energy: -37.324 flat angles C4'-P-C4' energy: -27.657 flat angles P-C4'-P energy: -10.386 tors. eta vs tors. theta energy: -10.962 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -579.004298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.004298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.473092 (E_RNA) where: Base-Base interactions energy: -376.813 where: short stacking energy: -177.786 Base-Backbone interact. energy: -0.511 local terms energy: -202.148432 where: bonds (distance) C4'-P energy: -39.415 bonds (distance) P-C4' energy: -42.995 flat angles C4'-P-C4' energy: -40.923 flat angles P-C4'-P energy: -26.651 tors. eta vs tors. theta energy: -52.164 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -569.722670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.722670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.266163 (E_RNA) where: Base-Base interactions energy: -371.916 where: short stacking energy: -162.314 Base-Backbone interact. energy: -0.486 local terms energy: -197.863965 where: bonds (distance) C4'-P energy: -37.696 bonds (distance) P-C4' energy: -40.281 flat angles C4'-P-C4' energy: -39.954 flat angles P-C4'-P energy: -31.124 tors. eta vs tors. theta energy: -48.809 Dist. restrs. and SS energy: 0.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -511.342712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.342712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.495499 (E_RNA) where: Base-Base interactions energy: -331.899 where: short stacking energy: -150.720 Base-Backbone interact. energy: -0.362 local terms energy: -179.234766 where: bonds (distance) C4'-P energy: -34.920 bonds (distance) P-C4' energy: -36.600 flat angles C4'-P-C4' energy: -41.355 flat angles P-C4'-P energy: -27.051 tors. eta vs tors. theta energy: -39.309 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -494.219656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.219656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.506627 (E_RNA) where: Base-Base interactions energy: -313.560 where: short stacking energy: -140.611 Base-Backbone interact. energy: -0.532 local terms energy: -180.414630 where: bonds (distance) C4'-P energy: -37.079 bonds (distance) P-C4' energy: -44.692 flat angles C4'-P-C4' energy: -35.304 flat angles P-C4'-P energy: -19.849 tors. eta vs tors. theta energy: -43.491 Dist. restrs. and SS energy: 0.287 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -436.261244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.261244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.382464 (E_RNA) where: Base-Base interactions energy: -266.340 where: short stacking energy: -130.397 Base-Backbone interact. energy: -0.753 local terms energy: -169.289354 where: bonds (distance) C4'-P energy: -39.090 bonds (distance) P-C4' energy: -32.264 flat angles C4'-P-C4' energy: -40.935 flat angles P-C4'-P energy: -19.959 tors. eta vs tors. theta energy: -37.041 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -415.651047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.651047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.089105 (E_RNA) where: Base-Base interactions energy: -268.245 where: short stacking energy: -125.409 Base-Backbone interact. energy: -0.033 local terms energy: -147.810670 where: bonds (distance) C4'-P energy: -31.692 bonds (distance) P-C4' energy: -28.674 flat angles C4'-P-C4' energy: -33.970 flat angles P-C4'-P energy: -24.994 tors. eta vs tors. theta energy: -28.481 Dist. restrs. and SS energy: 0.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -363.574516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.574516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.611873 (E_RNA) where: Base-Base interactions energy: -214.746 where: short stacking energy: -96.414 Base-Backbone interact. energy: 0.023 local terms energy: -149.888607 where: bonds (distance) C4'-P energy: -36.852 bonds (distance) P-C4' energy: -37.915 flat angles C4'-P-C4' energy: -36.068 flat angles P-C4'-P energy: -18.020 tors. eta vs tors. theta energy: -21.033 Dist. restrs. and SS energy: 1.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -281.323843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.323843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.713513 (E_RNA) where: Base-Base interactions energy: -134.903 where: short stacking energy: -73.287 Base-Backbone interact. energy: -0.048 local terms energy: -147.762958 where: bonds (distance) C4'-P energy: -37.218 bonds (distance) P-C4' energy: -38.722 flat angles C4'-P-C4' energy: -32.848 flat angles P-C4'-P energy: -20.098 tors. eta vs tors. theta energy: -18.878 Dist. restrs. and SS energy: 1.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -292.673041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.673041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.287499 (E_RNA) where: Base-Base interactions energy: -160.541 where: short stacking energy: -92.245 Base-Backbone interact. energy: -0.870 local terms energy: -134.876377 where: bonds (distance) C4'-P energy: -30.218 bonds (distance) P-C4' energy: -33.175 flat angles C4'-P-C4' energy: -28.302 flat angles P-C4'-P energy: -28.072 tors. eta vs tors. theta energy: -15.109 Dist. restrs. and SS energy: 3.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -278.914159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.914159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.137278 (E_RNA) where: Base-Base interactions energy: -150.848 where: short stacking energy: -76.170 Base-Backbone interact. energy: -0.280 local terms energy: -128.009361 where: bonds (distance) C4'-P energy: -26.733 bonds (distance) P-C4' energy: -30.503 flat angles C4'-P-C4' energy: -31.065 flat angles P-C4'-P energy: -19.678 tors. eta vs tors. theta energy: -20.030 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -586.353017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.353017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.374598 (E_RNA) where: Base-Base interactions energy: -387.103 where: short stacking energy: -185.508 Base-Backbone interact. energy: -0.984 local terms energy: -198.287899 where: bonds (distance) C4'-P energy: -34.598 bonds (distance) P-C4' energy: -36.538 flat angles C4'-P-C4' energy: -43.533 flat angles P-C4'-P energy: -30.955 tors. eta vs tors. theta energy: -52.663 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -560.612551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.612551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.136322 (E_RNA) where: Base-Base interactions energy: -363.539 where: short stacking energy: -171.611 Base-Backbone interact. energy: 1.756 local terms energy: -199.353467 where: bonds (distance) C4'-P energy: -44.540 bonds (distance) P-C4' energy: -40.751 flat angles C4'-P-C4' energy: -35.327 flat angles P-C4'-P energy: -28.637 tors. eta vs tors. theta energy: -50.098 Dist. restrs. and SS energy: 0.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -535.458384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.458384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.018792 (E_RNA) where: Base-Base interactions energy: -357.934 where: short stacking energy: -154.466 Base-Backbone interact. energy: -0.283 local terms energy: -177.802217 where: bonds (distance) C4'-P energy: -39.464 bonds (distance) P-C4' energy: -32.461 flat angles C4'-P-C4' energy: -37.235 flat angles P-C4'-P energy: -26.340 tors. eta vs tors. theta energy: -42.302 Dist. restrs. and SS energy: 0.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -500.576942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.576942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.916544 (E_RNA) where: Base-Base interactions energy: -313.493 where: short stacking energy: -139.387 Base-Backbone interact. energy: 0.447 local terms energy: -187.870562 where: bonds (distance) C4'-P energy: -39.496 bonds (distance) P-C4' energy: -40.229 flat angles C4'-P-C4' energy: -43.732 flat angles P-C4'-P energy: -27.592 tors. eta vs tors. theta energy: -36.822 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -437.454859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.454859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.468011 (E_RNA) where: Base-Base interactions energy: -266.724 where: short stacking energy: -132.764 Base-Backbone interact. energy: -0.504 local terms energy: -170.240134 where: bonds (distance) C4'-P energy: -30.168 bonds (distance) P-C4' energy: -37.542 flat angles C4'-P-C4' energy: -36.120 flat angles P-C4'-P energy: -29.960 tors. eta vs tors. theta energy: -36.449 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -395.108174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.108174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.191156 (E_RNA) where: Base-Base interactions energy: -239.716 where: short stacking energy: -104.878 Base-Backbone interact. energy: 0.560 local terms energy: -156.035048 where: bonds (distance) C4'-P energy: -45.709 bonds (distance) P-C4' energy: -30.046 flat angles C4'-P-C4' energy: -36.504 flat angles P-C4'-P energy: -23.874 tors. eta vs tors. theta energy: -19.902 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -357.794878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.794878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.820082 (E_RNA) where: Base-Base interactions energy: -201.144 where: short stacking energy: -97.313 Base-Backbone interact. energy: -1.736 local terms energy: -154.939426 where: bonds (distance) C4'-P energy: -41.292 bonds (distance) P-C4' energy: -38.302 flat angles C4'-P-C4' energy: -36.155 flat angles P-C4'-P energy: -22.453 tors. eta vs tors. theta energy: -16.738 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -303.809344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.809344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.273142 (E_RNA) where: Base-Base interactions energy: -181.750 where: short stacking energy: -92.175 Base-Backbone interact. energy: -1.421 local terms energy: -121.102041 where: bonds (distance) C4'-P energy: -23.292 bonds (distance) P-C4' energy: -33.684 flat angles C4'-P-C4' energy: -31.422 flat angles P-C4'-P energy: -14.409 tors. eta vs tors. theta energy: -18.296 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -296.705891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.705891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.597426 (E_RNA) where: Base-Base interactions energy: -171.301 where: short stacking energy: -92.414 Base-Backbone interact. energy: 0.377 local terms energy: -126.672878 where: bonds (distance) C4'-P energy: -32.028 bonds (distance) P-C4' energy: -39.126 flat angles C4'-P-C4' energy: -29.034 flat angles P-C4'-P energy: -11.585 tors. eta vs tors. theta energy: -14.900 Dist. restrs. and SS energy: 0.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -293.381481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.381481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.859519 (E_RNA) where: Base-Base interactions energy: -166.652 where: short stacking energy: -61.044 Base-Backbone interact. energy: 0.511 local terms energy: -127.718769 where: bonds (distance) C4'-P energy: -22.588 bonds (distance) P-C4' energy: -38.954 flat angles C4'-P-C4' energy: -34.313 flat angles P-C4'-P energy: -19.384 tors. eta vs tors. theta energy: -12.480 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -585.457693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.457693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.335495 (E_RNA) where: Base-Base interactions energy: -382.754 where: short stacking energy: -174.933 Base-Backbone interact. energy: -1.204 local terms energy: -202.377003 where: bonds (distance) C4'-P energy: -44.088 bonds (distance) P-C4' energy: -38.065 flat angles C4'-P-C4' energy: -42.686 flat angles P-C4'-P energy: -26.859 tors. eta vs tors. theta energy: -50.679 Dist. restrs. and SS energy: 0.878 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -573.595417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.595417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.662542 (E_RNA) where: Base-Base interactions energy: -372.728 where: short stacking energy: -168.458 Base-Backbone interact. energy: -0.046 local terms energy: -200.888864 where: bonds (distance) C4'-P energy: -39.211 bonds (distance) P-C4' energy: -44.232 flat angles C4'-P-C4' energy: -40.000 flat angles P-C4'-P energy: -25.161 tors. eta vs tors. theta energy: -52.285 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -542.345872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.345872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.532486 (E_RNA) where: Base-Base interactions energy: -373.107 where: short stacking energy: -156.940 Base-Backbone interact. energy: -0.435 local terms energy: -168.990728 where: bonds (distance) C4'-P energy: -35.344 bonds (distance) P-C4' energy: -38.751 flat angles C4'-P-C4' energy: -30.227 flat angles P-C4'-P energy: -21.089 tors. eta vs tors. theta energy: -43.580 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -513.975535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.975535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.138142 (E_RNA) where: Base-Base interactions energy: -355.253 where: short stacking energy: -150.582 Base-Backbone interact. energy: -0.460 local terms energy: -158.425422 where: bonds (distance) C4'-P energy: -35.329 bonds (distance) P-C4' energy: -34.510 flat angles C4'-P-C4' energy: -32.498 flat angles P-C4'-P energy: -18.498 tors. eta vs tors. theta energy: -37.590 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -438.255456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.255456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.451503 (E_RNA) where: Base-Base interactions energy: -265.360 where: short stacking energy: -138.170 Base-Backbone interact. energy: -1.010 local terms energy: -172.081571 where: bonds (distance) C4'-P energy: -35.928 bonds (distance) P-C4' energy: -39.718 flat angles C4'-P-C4' energy: -43.104 flat angles P-C4'-P energy: -17.783 tors. eta vs tors. theta energy: -35.548 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -418.749569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.749569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.868137 (E_RNA) where: Base-Base interactions energy: -254.161 where: short stacking energy: -132.780 Base-Backbone interact. energy: -0.792 local terms energy: -163.915497 where: bonds (distance) C4'-P energy: -38.098 bonds (distance) P-C4' energy: -26.057 flat angles C4'-P-C4' energy: -35.941 flat angles P-C4'-P energy: -33.882 tors. eta vs tors. theta energy: -29.939 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -311.224329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.224329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.307006 (E_RNA) where: Base-Base interactions energy: -169.277 where: short stacking energy: -89.157 Base-Backbone interact. energy: -0.542 local terms energy: -141.488085 where: bonds (distance) C4'-P energy: -37.456 bonds (distance) P-C4' energy: -33.326 flat angles C4'-P-C4' energy: -26.229 flat angles P-C4'-P energy: -24.919 tors. eta vs tors. theta energy: -19.558 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -366.102783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.102783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.278352 (E_RNA) where: Base-Base interactions energy: -216.233 where: short stacking energy: -96.858 Base-Backbone interact. energy: -0.199 local terms energy: -149.845764 where: bonds (distance) C4'-P energy: -30.552 bonds (distance) P-C4' energy: -42.473 flat angles C4'-P-C4' energy: -31.236 flat angles P-C4'-P energy: -23.490 tors. eta vs tors. theta energy: -22.094 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -351.702677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.702677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.941744 (E_RNA) where: Base-Base interactions energy: -214.145 where: short stacking energy: -92.506 Base-Backbone interact. energy: 0.012 local terms energy: -138.808457 where: bonds (distance) C4'-P energy: -43.226 bonds (distance) P-C4' energy: -27.062 flat angles C4'-P-C4' energy: -36.426 flat angles P-C4'-P energy: -16.807 tors. eta vs tors. theta energy: -15.287 Dist. restrs. and SS energy: 1.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -265.098979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.098979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.018090 (E_RNA) where: Base-Base interactions energy: -134.514 where: short stacking energy: -70.432 Base-Backbone interact. energy: -0.167 local terms energy: -132.336812 where: bonds (distance) C4'-P energy: -33.712 bonds (distance) P-C4' energy: -26.172 flat angles C4'-P-C4' energy: -35.762 flat angles P-C4'-P energy: -23.173 tors. eta vs tors. theta energy: -13.517 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -572.177120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.177120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.818993 (E_RNA) where: Base-Base interactions energy: -373.520 where: short stacking energy: -157.458 Base-Backbone interact. energy: -0.915 local terms energy: -198.383527 where: bonds (distance) C4'-P energy: -38.703 bonds (distance) P-C4' energy: -44.270 flat angles C4'-P-C4' energy: -43.458 flat angles P-C4'-P energy: -26.774 tors. eta vs tors. theta energy: -45.177 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -571.133002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.133002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.238342 (E_RNA) where: Base-Base interactions energy: -368.590 where: short stacking energy: -163.661 Base-Backbone interact. energy: -0.856 local terms energy: -201.792158 where: bonds (distance) C4'-P energy: -40.810 bonds (distance) P-C4' energy: -38.559 flat angles C4'-P-C4' energy: -45.122 flat angles P-C4'-P energy: -28.054 tors. eta vs tors. theta energy: -49.246 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -554.041162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.041162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.117489 (E_RNA) where: Base-Base interactions energy: -364.730 where: short stacking energy: -170.886 Base-Backbone interact. energy: -1.630 local terms energy: -187.757339 where: bonds (distance) C4'-P energy: -41.063 bonds (distance) P-C4' energy: -34.470 flat angles C4'-P-C4' energy: -40.589 flat angles P-C4'-P energy: -22.220 tors. eta vs tors. theta energy: -49.415 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -496.595704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.595704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.756498 (E_RNA) where: Base-Base interactions energy: -327.939 where: short stacking energy: -144.625 Base-Backbone interact. energy: 1.826 local terms energy: -170.643712 where: bonds (distance) C4'-P energy: -28.852 bonds (distance) P-C4' energy: -43.789 flat angles C4'-P-C4' energy: -40.871 flat angles P-C4'-P energy: -22.676 tors. eta vs tors. theta energy: -34.456 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -425.084664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.084664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.408822 (E_RNA) where: Base-Base interactions energy: -268.897 where: short stacking energy: -125.293 Base-Backbone interact. energy: 1.989 local terms energy: -158.500700 where: bonds (distance) C4'-P energy: -33.525 bonds (distance) P-C4' energy: -38.706 flat angles C4'-P-C4' energy: -39.161 flat angles P-C4'-P energy: -20.777 tors. eta vs tors. theta energy: -26.331 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -371.946669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.946669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.009601 (E_RNA) where: Base-Base interactions energy: -222.113 where: short stacking energy: -118.300 Base-Backbone interact. energy: 0.960 local terms energy: -150.856405 where: bonds (distance) C4'-P energy: -40.314 bonds (distance) P-C4' energy: -37.372 flat angles C4'-P-C4' energy: -32.172 flat angles P-C4'-P energy: -18.455 tors. eta vs tors. theta energy: -22.543 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -394.026408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.026408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.573107 (E_RNA) where: Base-Base interactions energy: -240.240 where: short stacking energy: -122.817 Base-Backbone interact. energy: -0.751 local terms energy: -153.581938 where: bonds (distance) C4'-P energy: -32.009 bonds (distance) P-C4' energy: -36.900 flat angles C4'-P-C4' energy: -37.483 flat angles P-C4'-P energy: -17.816 tors. eta vs tors. theta energy: -29.373 Dist. restrs. and SS energy: 0.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -346.917380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.917380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.859052 (E_RNA) where: Base-Base interactions energy: -197.554 where: short stacking energy: -106.773 Base-Backbone interact. energy: -1.247 local terms energy: -153.058166 where: bonds (distance) C4'-P energy: -34.084 bonds (distance) P-C4' energy: -37.367 flat angles C4'-P-C4' energy: -39.268 flat angles P-C4'-P energy: -22.381 tors. eta vs tors. theta energy: -19.958 Dist. restrs. and SS energy: 4.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -335.047289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.047289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.109993 (E_RNA) where: Base-Base interactions energy: -196.783 where: short stacking energy: -79.032 Base-Backbone interact. energy: -0.759 local terms energy: -137.568183 where: bonds (distance) C4'-P energy: -34.242 bonds (distance) P-C4' energy: -36.313 flat angles C4'-P-C4' energy: -36.681 flat angles P-C4'-P energy: -16.425 tors. eta vs tors. theta energy: -13.906 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -289.305452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.305452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.527011 (E_RNA) where: Base-Base interactions energy: -173.293 where: short stacking energy: -83.373 Base-Backbone interact. energy: -0.392 local terms energy: -115.841349 where: bonds (distance) C4'-P energy: -33.932 bonds (distance) P-C4' energy: -21.652 flat angles C4'-P-C4' energy: -28.632 flat angles P-C4'-P energy: -16.834 tors. eta vs tors. theta energy: -14.791 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -572.194025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.194025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.274894 (E_RNA) where: Base-Base interactions energy: -381.268 where: short stacking energy: -165.856 Base-Backbone interact. energy: -0.566 local terms energy: -190.440184 where: bonds (distance) C4'-P energy: -35.173 bonds (distance) P-C4' energy: -42.827 flat angles C4'-P-C4' energy: -39.141 flat angles P-C4'-P energy: -22.044 tors. eta vs tors. theta energy: -51.254 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -576.087892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.087892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.980726 (E_RNA) where: Base-Base interactions energy: -371.902 where: short stacking energy: -174.344 Base-Backbone interact. energy: -0.403 local terms energy: -204.676493 where: bonds (distance) C4'-P energy: -41.615 bonds (distance) P-C4' energy: -45.292 flat angles C4'-P-C4' energy: -38.863 flat angles P-C4'-P energy: -26.689 tors. eta vs tors. theta energy: -52.217 Dist. restrs. and SS energy: 0.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -547.139383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.139383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.188798 (E_RNA) where: Base-Base interactions energy: -365.788 where: short stacking energy: -157.923 Base-Backbone interact. energy: -0.446 local terms energy: -180.954143 where: bonds (distance) C4'-P energy: -35.975 bonds (distance) P-C4' energy: -40.327 flat angles C4'-P-C4' energy: -41.950 flat angles P-C4'-P energy: -20.310 tors. eta vs tors. theta energy: -42.392 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -491.357738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.357738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.377713 (E_RNA) where: Base-Base interactions energy: -306.242 where: short stacking energy: -130.416 Base-Backbone interact. energy: -0.477 local terms energy: -184.658657 where: bonds (distance) C4'-P energy: -40.970 bonds (distance) P-C4' energy: -38.306 flat angles C4'-P-C4' energy: -40.391 flat angles P-C4'-P energy: -26.891 tors. eta vs tors. theta energy: -38.100 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -403.944440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.944440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.123564 (E_RNA) where: Base-Base interactions energy: -253.320 where: short stacking energy: -92.804 Base-Backbone interact. energy: -1.706 local terms energy: -149.097001 where: bonds (distance) C4'-P energy: -39.483 bonds (distance) P-C4' energy: -36.011 flat angles C4'-P-C4' energy: -31.890 flat angles P-C4'-P energy: -21.984 tors. eta vs tors. theta energy: -19.728 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -332.095913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.095913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.260186 (E_RNA) where: Base-Base interactions energy: -173.881 where: short stacking energy: -82.570 Base-Backbone interact. energy: -0.703 local terms energy: -157.675506 where: bonds (distance) C4'-P energy: -38.086 bonds (distance) P-C4' energy: -42.912 flat angles C4'-P-C4' energy: -33.486 flat angles P-C4'-P energy: -25.974 tors. eta vs tors. theta energy: -17.218 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -383.554617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.554617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.612096 (E_RNA) where: Base-Base interactions energy: -232.703 where: short stacking energy: -100.811 Base-Backbone interact. energy: -1.658 local terms energy: -149.251126 where: bonds (distance) C4'-P energy: -26.567 bonds (distance) P-C4' energy: -31.616 flat angles C4'-P-C4' energy: -48.651 flat angles P-C4'-P energy: -23.815 tors. eta vs tors. theta energy: -18.602 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -348.768018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.768018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.754453 (E_RNA) where: Base-Base interactions energy: -208.045 where: short stacking energy: -92.483 Base-Backbone interact. energy: -0.735 local terms energy: -140.974003 where: bonds (distance) C4'-P energy: -33.631 bonds (distance) P-C4' energy: -37.338 flat angles C4'-P-C4' energy: -35.204 flat angles P-C4'-P energy: -22.875 tors. eta vs tors. theta energy: -11.926 Dist. restrs. and SS energy: 0.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -277.827386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.827386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.885412 (E_RNA) where: Base-Base interactions energy: -153.549 where: short stacking energy: -68.502 Base-Backbone interact. energy: -1.253 local terms energy: -123.083734 where: bonds (distance) C4'-P energy: -23.962 bonds (distance) P-C4' energy: -33.323 flat angles C4'-P-C4' energy: -29.675 flat angles P-C4'-P energy: -22.139 tors. eta vs tors. theta energy: -13.984 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -309.504755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.504755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.054405 (E_RNA) where: Base-Base interactions energy: -166.464 where: short stacking energy: -74.744 Base-Backbone interact. energy: -0.388 local terms energy: -144.202262 where: bonds (distance) C4'-P energy: -37.536 bonds (distance) P-C4' energy: -42.573 flat angles C4'-P-C4' energy: -34.164 flat angles P-C4'-P energy: -18.705 tors. eta vs tors. theta energy: -11.225 Dist. restrs. and SS energy: 1.550 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -572.973850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.973850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.337657 (E_RNA) where: Base-Base interactions energy: -376.546 where: short stacking energy: -169.232 Base-Backbone interact. energy: -0.728 local terms energy: -196.063956 where: bonds (distance) C4'-P energy: -36.341 bonds (distance) P-C4' energy: -40.609 flat angles C4'-P-C4' energy: -43.199 flat angles P-C4'-P energy: -24.431 tors. eta vs tors. theta energy: -51.485 Dist. restrs. and SS energy: 0.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -558.363597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.363597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.954611 (E_RNA) where: Base-Base interactions energy: -353.740 where: short stacking energy: -164.352 Base-Backbone interact. energy: -0.099 local terms energy: -206.115204 where: bonds (distance) C4'-P energy: -36.965 bonds (distance) P-C4' energy: -45.140 flat angles C4'-P-C4' energy: -47.792 flat angles P-C4'-P energy: -29.470 tors. eta vs tors. theta energy: -46.749 Dist. restrs. and SS energy: 1.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -551.346393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.346393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.488472 (E_RNA) where: Base-Base interactions energy: -351.072 where: short stacking energy: -154.032 Base-Backbone interact. energy: -0.146 local terms energy: -200.271038 where: bonds (distance) C4'-P energy: -43.903 bonds (distance) P-C4' energy: -39.036 flat angles C4'-P-C4' energy: -42.516 flat angles P-C4'-P energy: -25.311 tors. eta vs tors. theta energy: -49.506 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -458.758269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.758269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.837459 (E_RNA) where: Base-Base interactions energy: -289.896 where: short stacking energy: -129.124 Base-Backbone interact. energy: -1.322 local terms energy: -167.620068 where: bonds (distance) C4'-P energy: -37.807 bonds (distance) P-C4' energy: -37.051 flat angles C4'-P-C4' energy: -35.504 flat angles P-C4'-P energy: -22.104 tors. eta vs tors. theta energy: -35.153 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -430.844675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.844675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.906025 (E_RNA) where: Base-Base interactions energy: -277.341 where: short stacking energy: -122.630 Base-Backbone interact. energy: -1.462 local terms energy: -152.102684 where: bonds (distance) C4'-P energy: -27.472 bonds (distance) P-C4' energy: -37.735 flat angles C4'-P-C4' energy: -36.062 flat angles P-C4'-P energy: -27.605 tors. eta vs tors. theta energy: -23.230 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -402.433486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.433486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.474388 (E_RNA) where: Base-Base interactions energy: -233.876 where: short stacking energy: -104.961 Base-Backbone interact. energy: -0.304 local terms energy: -168.294699 where: bonds (distance) C4'-P energy: -41.459 bonds (distance) P-C4' energy: -32.552 flat angles C4'-P-C4' energy: -36.852 flat angles P-C4'-P energy: -22.805 tors. eta vs tors. theta energy: -34.628 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -338.532254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.532254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.569655 (E_RNA) where: Base-Base interactions energy: -182.650 where: short stacking energy: -96.954 Base-Backbone interact. energy: -0.481 local terms energy: -155.438523 where: bonds (distance) C4'-P energy: -34.352 bonds (distance) P-C4' energy: -42.341 flat angles C4'-P-C4' energy: -41.463 flat angles P-C4'-P energy: -20.843 tors. eta vs tors. theta energy: -16.439 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -348.205742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.205742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.264953 (E_RNA) where: Base-Base interactions energy: -228.131 where: short stacking energy: -95.639 Base-Backbone interact. energy: -2.097 local terms energy: -118.037220 where: bonds (distance) C4'-P energy: -30.134 bonds (distance) P-C4' energy: -33.427 flat angles C4'-P-C4' energy: -23.207 flat angles P-C4'-P energy: -8.819 tors. eta vs tors. theta energy: -22.449 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -268.231049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.231049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.417281 (E_RNA) where: Base-Base interactions energy: -145.341 where: short stacking energy: -73.411 Base-Backbone interact. energy: -0.828 local terms energy: -124.248336 where: bonds (distance) C4'-P energy: -26.547 bonds (distance) P-C4' energy: -36.771 flat angles C4'-P-C4' energy: -31.018 flat angles P-C4'-P energy: -15.465 tors. eta vs tors. theta energy: -14.448 Dist. restrs. and SS energy: 2.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -294.814200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.814200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.128862 (E_RNA) where: Base-Base interactions energy: -182.462 where: short stacking energy: -69.947 Base-Backbone interact. energy: -1.456 local terms energy: -119.210531 where: bonds (distance) C4'-P energy: -36.693 bonds (distance) P-C4' energy: -33.235 flat angles C4'-P-C4' energy: -19.518 flat angles P-C4'-P energy: -20.189 tors. eta vs tors. theta energy: -9.576 Dist. restrs. and SS energy: 8.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -602.779265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.779265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.668024 (E_RNA) where: Base-Base interactions energy: -409.940 where: short stacking energy: -186.451 Base-Backbone interact. energy: -0.838 local terms energy: -192.890296 where: bonds (distance) C4'-P energy: -38.486 bonds (distance) P-C4' energy: -34.751 flat angles C4'-P-C4' energy: -36.650 flat angles P-C4'-P energy: -32.090 tors. eta vs tors. theta energy: -50.913 Dist. restrs. and SS energy: 0.889 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -570.016279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.016279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.082690 (E_RNA) where: Base-Base interactions energy: -385.571 where: short stacking energy: -164.360 Base-Backbone interact. energy: -0.804 local terms energy: -183.707078 where: bonds (distance) C4'-P energy: -31.914 bonds (distance) P-C4' energy: -39.349 flat angles C4'-P-C4' energy: -34.827 flat angles P-C4'-P energy: -22.453 tors. eta vs tors. theta energy: -55.164 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -529.673599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.673599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.676478 (E_RNA) where: Base-Base interactions energy: -340.323 where: short stacking energy: -152.044 Base-Backbone interact. energy: 0.152 local terms energy: -189.505765 where: bonds (distance) C4'-P energy: -36.365 bonds (distance) P-C4' energy: -40.543 flat angles C4'-P-C4' energy: -37.888 flat angles P-C4'-P energy: -26.264 tors. eta vs tors. theta energy: -48.446 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -493.358053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.358053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.463532 (E_RNA) where: Base-Base interactions energy: -329.380 where: short stacking energy: -128.765 Base-Backbone interact. energy: -0.246 local terms energy: -163.838016 where: bonds (distance) C4'-P energy: -31.587 bonds (distance) P-C4' energy: -41.497 flat angles C4'-P-C4' energy: -37.170 flat angles P-C4'-P energy: -20.824 tors. eta vs tors. theta energy: -32.760 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -405.578891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.578891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.694643 (E_RNA) where: Base-Base interactions energy: -242.524 where: short stacking energy: -125.953 Base-Backbone interact. energy: 2.850 local terms energy: -166.021477 where: bonds (distance) C4'-P energy: -33.347 bonds (distance) P-C4' energy: -38.716 flat angles C4'-P-C4' energy: -38.780 flat angles P-C4'-P energy: -25.532 tors. eta vs tors. theta energy: -29.646 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -427.282829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.282829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.740816 (E_RNA) where: Base-Base interactions energy: -271.575 where: short stacking energy: -125.875 Base-Backbone interact. energy: 1.784 local terms energy: -157.949850 where: bonds (distance) C4'-P energy: -30.619 bonds (distance) P-C4' energy: -40.028 flat angles C4'-P-C4' energy: -36.526 flat angles P-C4'-P energy: -19.890 tors. eta vs tors. theta energy: -30.886 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -373.278550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.278550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.206083 (E_RNA) where: Base-Base interactions energy: -231.829 where: short stacking energy: -104.837 Base-Backbone interact. energy: 0.441 local terms energy: -142.818246 where: bonds (distance) C4'-P energy: -28.420 bonds (distance) P-C4' energy: -34.830 flat angles C4'-P-C4' energy: -34.738 flat angles P-C4'-P energy: -22.223 tors. eta vs tors. theta energy: -22.607 Dist. restrs. and SS energy: 0.928 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -308.983369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.983369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.125458 (E_RNA) where: Base-Base interactions energy: -178.549 where: short stacking energy: -91.628 Base-Backbone interact. energy: -1.013 local terms energy: -131.563366 where: bonds (distance) C4'-P energy: -27.243 bonds (distance) P-C4' energy: -28.726 flat angles C4'-P-C4' energy: -26.785 flat angles P-C4'-P energy: -29.853 tors. eta vs tors. theta energy: -18.957 Dist. restrs. and SS energy: 2.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -309.048845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.048845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.190955 (E_RNA) where: Base-Base interactions energy: -189.248 where: short stacking energy: -82.147 Base-Backbone interact. energy: -0.714 local terms energy: -119.228747 where: bonds (distance) C4'-P energy: -29.480 bonds (distance) P-C4' energy: -34.318 flat angles C4'-P-C4' energy: -30.740 flat angles P-C4'-P energy: -15.427 tors. eta vs tors. theta energy: -9.263 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -273.100646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.100646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.058848 (E_RNA) where: Base-Base interactions energy: -145.408 where: short stacking energy: -67.777 Base-Backbone interact. energy: -1.569 local terms energy: -128.081931 where: bonds (distance) C4'-P energy: -34.863 bonds (distance) P-C4' energy: -35.863 flat angles C4'-P-C4' energy: -37.216 flat angles P-C4'-P energy: -8.128 tors. eta vs tors. theta energy: -12.012 Dist. restrs. and SS energy: 1.958 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -604.433984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.433984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.456118 (E_RNA) where: Base-Base interactions energy: -392.130 where: short stacking energy: -198.543 Base-Backbone interact. energy: -0.385 local terms energy: -212.941111 where: bonds (distance) C4'-P energy: -39.449 bonds (distance) P-C4' energy: -41.608 flat angles C4'-P-C4' energy: -46.085 flat angles P-C4'-P energy: -31.086 tors. eta vs tors. theta energy: -54.713 Dist. restrs. and SS energy: 1.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -559.278180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.278180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.457585 (E_RNA) where: Base-Base interactions energy: -375.361 where: short stacking energy: -148.728 Base-Backbone interact. energy: -0.476 local terms energy: -183.620727 where: bonds (distance) C4'-P energy: -37.550 bonds (distance) P-C4' energy: -42.026 flat angles C4'-P-C4' energy: -38.971 flat angles P-C4'-P energy: -23.618 tors. eta vs tors. theta energy: -41.455 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -535.388547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.388547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.605378 (E_RNA) where: Base-Base interactions energy: -355.154 where: short stacking energy: -154.723 Base-Backbone interact. energy: -0.447 local terms energy: -180.004589 where: bonds (distance) C4'-P energy: -29.046 bonds (distance) P-C4' energy: -38.026 flat angles C4'-P-C4' energy: -40.904 flat angles P-C4'-P energy: -28.628 tors. eta vs tors. theta energy: -43.400 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -509.258447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.258447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.392381 (E_RNA) where: Base-Base interactions energy: -334.576 where: short stacking energy: -154.600 Base-Backbone interact. energy: -1.077 local terms energy: -173.738766 where: bonds (distance) C4'-P energy: -33.070 bonds (distance) P-C4' energy: -44.868 flat angles C4'-P-C4' energy: -36.478 flat angles P-C4'-P energy: -17.377 tors. eta vs tors. theta energy: -41.945 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -426.232355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.232355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.310447 (E_RNA) where: Base-Base interactions energy: -260.947 where: short stacking energy: -121.753 Base-Backbone interact. energy: -3.089 local terms energy: -162.273803 where: bonds (distance) C4'-P energy: -34.038 bonds (distance) P-C4' energy: -31.999 flat angles C4'-P-C4' energy: -39.665 flat angles P-C4'-P energy: -26.683 tors. eta vs tors. theta energy: -29.889 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -433.370632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.370632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.400354 (E_RNA) where: Base-Base interactions energy: -281.021 where: short stacking energy: -122.427 Base-Backbone interact. energy: 3.476 local terms energy: -155.855217 where: bonds (distance) C4'-P energy: -21.576 bonds (distance) P-C4' energy: -41.360 flat angles C4'-P-C4' energy: -37.127 flat angles P-C4'-P energy: -24.756 tors. eta vs tors. theta energy: -31.036 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -382.089141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.089141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.468897 (E_RNA) where: Base-Base interactions energy: -219.805 where: short stacking energy: -114.902 Base-Backbone interact. energy: 0.432 local terms energy: -163.096339 where: bonds (distance) C4'-P energy: -39.715 bonds (distance) P-C4' energy: -34.540 flat angles C4'-P-C4' energy: -34.917 flat angles P-C4'-P energy: -21.876 tors. eta vs tors. theta energy: -32.048 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -336.392917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.392917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.371070 (E_RNA) where: Base-Base interactions energy: -223.849 where: short stacking energy: -112.362 Base-Backbone interact. energy: 1.353 local terms energy: -115.875110 where: bonds (distance) C4'-P energy: -21.749 bonds (distance) P-C4' energy: -25.959 flat angles C4'-P-C4' energy: -31.383 flat angles P-C4'-P energy: -14.804 tors. eta vs tors. theta energy: -21.979 Dist. restrs. and SS energy: 1.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -317.253874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.253874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.425773 (E_RNA) where: Base-Base interactions energy: -196.112 where: short stacking energy: -81.155 Base-Backbone interact. energy: 2.943 local terms energy: -124.256858 where: bonds (distance) C4'-P energy: -23.730 bonds (distance) P-C4' energy: -26.214 flat angles C4'-P-C4' energy: -37.701 flat angles P-C4'-P energy: -19.983 tors. eta vs tors. theta energy: -16.629 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -273.234141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.234141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.929975 (E_RNA) where: Base-Base interactions energy: -154.402 where: short stacking energy: -82.434 Base-Backbone interact. energy: 5.660 local terms energy: -125.188198 where: bonds (distance) C4'-P energy: -30.055 bonds (distance) P-C4' energy: -31.896 flat angles C4'-P-C4' energy: -31.745 flat angles P-C4'-P energy: -22.443 tors. eta vs tors. theta energy: -9.049 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -612.837815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.837815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.083070 (E_RNA) where: Base-Base interactions energy: -393.827 where: short stacking energy: -187.326 Base-Backbone interact. energy: 1.991 local terms energy: -222.247582 where: bonds (distance) C4'-P energy: -40.189 bonds (distance) P-C4' energy: -47.804 flat angles C4'-P-C4' energy: -44.825 flat angles P-C4'-P energy: -35.968 tors. eta vs tors. theta energy: -53.461 Dist. restrs. and SS energy: 1.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -552.004349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.004349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.182206 (E_RNA) where: Base-Base interactions energy: -357.345 where: short stacking energy: -167.987 Base-Backbone interact. energy: -0.572 local terms energy: -194.265348 where: bonds (distance) C4'-P energy: -42.513 bonds (distance) P-C4' energy: -42.207 flat angles C4'-P-C4' energy: -36.770 flat angles P-C4'-P energy: -20.031 tors. eta vs tors. theta energy: -52.743 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -519.911740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.911740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.978573 (E_RNA) where: Base-Base interactions energy: -340.690 where: short stacking energy: -156.852 Base-Backbone interact. energy: -0.285 local terms energy: -179.004533 where: bonds (distance) C4'-P energy: -32.909 bonds (distance) P-C4' energy: -39.886 flat angles C4'-P-C4' energy: -44.304 flat angles P-C4'-P energy: -23.169 tors. eta vs tors. theta energy: -38.737 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -522.503706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.503706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.652541 (E_RNA) where: Base-Base interactions energy: -338.941 where: short stacking energy: -154.236 Base-Backbone interact. energy: -1.092 local terms energy: -182.619103 where: bonds (distance) C4'-P energy: -39.836 bonds (distance) P-C4' energy: -32.558 flat angles C4'-P-C4' energy: -41.548 flat angles P-C4'-P energy: -29.220 tors. eta vs tors. theta energy: -39.458 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -444.193569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.193569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.291752 (E_RNA) where: Base-Base interactions energy: -281.342 where: short stacking energy: -134.097 Base-Backbone interact. energy: -1.266 local terms energy: -161.682862 where: bonds (distance) C4'-P energy: -30.943 bonds (distance) P-C4' energy: -39.582 flat angles C4'-P-C4' energy: -41.508 flat angles P-C4'-P energy: -19.815 tors. eta vs tors. theta energy: -29.835 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -421.259576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.259576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.639584 (E_RNA) where: Base-Base interactions energy: -269.984 where: short stacking energy: -135.480 Base-Backbone interact. energy: -0.143 local terms energy: -151.512678 where: bonds (distance) C4'-P energy: -22.921 bonds (distance) P-C4' energy: -40.031 flat angles C4'-P-C4' energy: -37.902 flat angles P-C4'-P energy: -20.417 tors. eta vs tors. theta energy: -30.241 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -391.322367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.322367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.762619 (E_RNA) where: Base-Base interactions energy: -236.713 where: short stacking energy: -105.799 Base-Backbone interact. energy: -0.651 local terms energy: -154.398766 where: bonds (distance) C4'-P energy: -35.460 bonds (distance) P-C4' energy: -34.288 flat angles C4'-P-C4' energy: -32.494 flat angles P-C4'-P energy: -20.738 tors. eta vs tors. theta energy: -31.419 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -377.206164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.206164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.641099 (E_RNA) where: Base-Base interactions energy: -221.129 where: short stacking energy: -107.250 Base-Backbone interact. energy: -1.434 local terms energy: -155.077967 where: bonds (distance) C4'-P energy: -37.302 bonds (distance) P-C4' energy: -40.688 flat angles C4'-P-C4' energy: -37.570 flat angles P-C4'-P energy: -16.923 tors. eta vs tors. theta energy: -22.595 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -286.859129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.859129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.052756 (E_RNA) where: Base-Base interactions energy: -155.998 where: short stacking energy: -75.935 Base-Backbone interact. energy: -1.301 local terms energy: -129.753826 where: bonds (distance) C4'-P energy: -28.762 bonds (distance) P-C4' energy: -30.504 flat angles C4'-P-C4' energy: -34.372 flat angles P-C4'-P energy: -30.684 tors. eta vs tors. theta energy: -5.431 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -325.505892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.505892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.370932 (E_RNA) where: Base-Base interactions energy: -189.531 where: short stacking energy: -79.803 Base-Backbone interact. energy: -1.296 local terms energy: -136.543186 where: bonds (distance) C4'-P energy: -32.404 bonds (distance) P-C4' energy: -38.466 flat angles C4'-P-C4' energy: -31.066 flat angles P-C4'-P energy: -17.938 tors. eta vs tors. theta energy: -16.670 Dist. restrs. and SS energy: 1.865 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -613.931952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.931952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.936302 (E_RNA) where: Base-Base interactions energy: -402.713 where: short stacking energy: -188.272 Base-Backbone interact. energy: -0.685 local terms energy: -211.537444 where: bonds (distance) C4'-P energy: -32.997 bonds (distance) P-C4' energy: -44.427 flat angles C4'-P-C4' energy: -47.826 flat angles P-C4'-P energy: -33.381 tors. eta vs tors. theta energy: -52.907 Dist. restrs. and SS energy: 1.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -548.956591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.956591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.996934 (E_RNA) where: Base-Base interactions energy: -355.108 where: short stacking energy: -165.905 Base-Backbone interact. energy: -0.758 local terms energy: -193.131172 where: bonds (distance) C4'-P energy: -39.636 bonds (distance) P-C4' energy: -39.047 flat angles C4'-P-C4' energy: -35.778 flat angles P-C4'-P energy: -25.767 tors. eta vs tors. theta energy: -52.904 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -515.038925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.038925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.181693 (E_RNA) where: Base-Base interactions energy: -349.498 where: short stacking energy: -142.523 Base-Backbone interact. energy: -0.939 local terms energy: -164.744658 where: bonds (distance) C4'-P energy: -35.353 bonds (distance) P-C4' energy: -40.459 flat angles C4'-P-C4' energy: -34.851 flat angles P-C4'-P energy: -18.814 tors. eta vs tors. theta energy: -35.267 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -476.484284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.484284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.616450 (E_RNA) where: Base-Base interactions energy: -287.389 where: short stacking energy: -143.744 Base-Backbone interact. energy: -0.650 local terms energy: -188.576653 where: bonds (distance) C4'-P energy: -38.784 bonds (distance) P-C4' energy: -42.193 flat angles C4'-P-C4' energy: -37.373 flat angles P-C4'-P energy: -28.809 tors. eta vs tors. theta energy: -41.417 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -403.303049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.303049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.631124 (E_RNA) where: Base-Base interactions energy: -258.196 where: short stacking energy: -133.332 Base-Backbone interact. energy: -0.552 local terms energy: -144.883472 where: bonds (distance) C4'-P energy: -33.748 bonds (distance) P-C4' energy: -24.464 flat angles C4'-P-C4' energy: -40.960 flat angles P-C4'-P energy: -20.837 tors. eta vs tors. theta energy: -24.875 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -425.403040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.403040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.484417 (E_RNA) where: Base-Base interactions energy: -270.271 where: short stacking energy: -119.551 Base-Backbone interact. energy: 2.345 local terms energy: -157.558667 where: bonds (distance) C4'-P energy: -34.191 bonds (distance) P-C4' energy: -37.170 flat angles C4'-P-C4' energy: -41.539 flat angles P-C4'-P energy: -19.999 tors. eta vs tors. theta energy: -24.660 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -388.542983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.542983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.906436 (E_RNA) where: Base-Base interactions energy: -236.233 where: short stacking energy: -107.209 Base-Backbone interact. energy: -0.246 local terms energy: -152.427926 where: bonds (distance) C4'-P energy: -34.816 bonds (distance) P-C4' energy: -26.124 flat angles C4'-P-C4' energy: -37.515 flat angles P-C4'-P energy: -23.310 tors. eta vs tors. theta energy: -30.662 Dist. restrs. and SS energy: 0.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -385.624989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.624989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.817721 (E_RNA) where: Base-Base interactions energy: -244.372 where: short stacking energy: -115.045 Base-Backbone interact. energy: -0.376 local terms energy: -141.068912 where: bonds (distance) C4'-P energy: -27.833 bonds (distance) P-C4' energy: -23.594 flat angles C4'-P-C4' energy: -38.740 flat angles P-C4'-P energy: -20.188 tors. eta vs tors. theta energy: -30.713 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -298.858320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.858320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.492387 (E_RNA) where: Base-Base interactions energy: -153.199 where: short stacking energy: -80.325 Base-Backbone interact. energy: -0.435 local terms energy: -146.858490 where: bonds (distance) C4'-P energy: -32.036 bonds (distance) P-C4' energy: -34.575 flat angles C4'-P-C4' energy: -35.245 flat angles P-C4'-P energy: -26.373 tors. eta vs tors. theta energy: -18.630 Dist. restrs. and SS energy: 1.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -319.371435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.371435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.488736 (E_RNA) where: Base-Base interactions energy: -199.134 where: short stacking energy: -87.204 Base-Backbone interact. energy: 4.402 local terms energy: -124.756469 where: bonds (distance) C4'-P energy: -26.236 bonds (distance) P-C4' energy: -32.427 flat angles C4'-P-C4' energy: -35.193 flat angles P-C4'-P energy: -16.568 tors. eta vs tors. theta energy: -14.332 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -599.351460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.351460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.027873 (E_RNA) where: Base-Base interactions energy: -389.941 where: short stacking energy: -183.899 Base-Backbone interact. energy: -1.112 local terms energy: -208.974349 where: bonds (distance) C4'-P energy: -40.432 bonds (distance) P-C4' energy: -44.781 flat angles C4'-P-C4' energy: -43.083 flat angles P-C4'-P energy: -29.702 tors. eta vs tors. theta energy: -50.977 Dist. restrs. and SS energy: 0.676 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -562.061379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.061379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.145225 (E_RNA) where: Base-Base interactions energy: -364.735 where: short stacking energy: -165.376 Base-Backbone interact. energy: -0.308 local terms energy: -197.102215 where: bonds (distance) C4'-P energy: -38.160 bonds (distance) P-C4' energy: -35.370 flat angles C4'-P-C4' energy: -45.547 flat angles P-C4'-P energy: -27.755 tors. eta vs tors. theta energy: -50.271 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -491.012131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.012131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.047153 (E_RNA) where: Base-Base interactions energy: -302.910 where: short stacking energy: -157.365 Base-Backbone interact. energy: -0.292 local terms energy: -187.845603 where: bonds (distance) C4'-P energy: -37.279 bonds (distance) P-C4' energy: -37.843 flat angles C4'-P-C4' energy: -41.992 flat angles P-C4'-P energy: -23.779 tors. eta vs tors. theta energy: -46.953 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -496.782049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.782049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.791158 (E_RNA) where: Base-Base interactions energy: -317.403 where: short stacking energy: -148.991 Base-Backbone interact. energy: 0.149 local terms energy: -179.536928 where: bonds (distance) C4'-P energy: -37.533 bonds (distance) P-C4' energy: -32.280 flat angles C4'-P-C4' energy: -46.086 flat angles P-C4'-P energy: -24.246 tors. eta vs tors. theta energy: -39.393 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -424.465353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.465353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.847467 (E_RNA) where: Base-Base interactions energy: -252.465 where: short stacking energy: -117.576 Base-Backbone interact. energy: -0.221 local terms energy: -172.161299 where: bonds (distance) C4'-P energy: -32.230 bonds (distance) P-C4' energy: -44.967 flat angles C4'-P-C4' energy: -42.242 flat angles P-C4'-P energy: -23.801 tors. eta vs tors. theta energy: -28.922 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -394.460107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.460107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.533384 (E_RNA) where: Base-Base interactions energy: -234.676 where: short stacking energy: -115.954 Base-Backbone interact. energy: -0.921 local terms energy: -158.936296 where: bonds (distance) C4'-P energy: -29.377 bonds (distance) P-C4' energy: -28.801 flat angles C4'-P-C4' energy: -39.002 flat angles P-C4'-P energy: -31.403 tors. eta vs tors. theta energy: -30.353 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -406.043026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.043026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.122219 (E_RNA) where: Base-Base interactions energy: -246.041 where: short stacking energy: -123.256 Base-Backbone interact. energy: 1.381 local terms energy: -161.461800 where: bonds (distance) C4'-P energy: -30.555 bonds (distance) P-C4' energy: -31.548 flat angles C4'-P-C4' energy: -41.921 flat angles P-C4'-P energy: -24.644 tors. eta vs tors. theta energy: -32.794 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -373.173156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.173156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.653927 (E_RNA) where: Base-Base interactions energy: -225.559 where: short stacking energy: -117.814 Base-Backbone interact. energy: -0.463 local terms energy: -147.631038 where: bonds (distance) C4'-P energy: -39.156 bonds (distance) P-C4' energy: -32.780 flat angles C4'-P-C4' energy: -30.435 flat angles P-C4'-P energy: -20.549 tors. eta vs tors. theta energy: -24.711 Dist. restrs. and SS energy: 0.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -343.212700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.212700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.225492 (E_RNA) where: Base-Base interactions energy: -216.322 where: short stacking energy: -115.276 Base-Backbone interact. energy: -0.240 local terms energy: -126.663061 where: bonds (distance) C4'-P energy: -22.537 bonds (distance) P-C4' energy: -28.321 flat angles C4'-P-C4' energy: -36.217 flat angles P-C4'-P energy: -14.597 tors. eta vs tors. theta energy: -24.992 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -276.177998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.177998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.487530 (E_RNA) where: Base-Base interactions energy: -147.612 where: short stacking energy: -59.967 Base-Backbone interact. energy: -0.397 local terms energy: -128.477973 where: bonds (distance) C4'-P energy: -28.687 bonds (distance) P-C4' energy: -38.100 flat angles C4'-P-C4' energy: -25.182 flat angles P-C4'-P energy: -20.285 tors. eta vs tors. theta energy: -16.225 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -606.152067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.152067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.449879 (E_RNA) where: Base-Base interactions energy: -402.797 where: short stacking energy: -183.568 Base-Backbone interact. energy: -1.503 local terms energy: -203.150004 where: bonds (distance) C4'-P energy: -38.693 bonds (distance) P-C4' energy: -45.318 flat angles C4'-P-C4' energy: -37.589 flat angles P-C4'-P energy: -26.122 tors. eta vs tors. theta energy: -55.427 Dist. restrs. and SS energy: 1.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -553.691655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.691655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.776031 (E_RNA) where: Base-Base interactions energy: -361.278 where: short stacking energy: -149.601 Base-Backbone interact. energy: -0.808 local terms energy: -191.689935 where: bonds (distance) C4'-P energy: -37.767 bonds (distance) P-C4' energy: -44.486 flat angles C4'-P-C4' energy: -42.768 flat angles P-C4'-P energy: -26.749 tors. eta vs tors. theta energy: -39.920 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -491.061166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.061166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.140887 (E_RNA) where: Base-Base interactions energy: -302.505 where: short stacking energy: -150.161 Base-Backbone interact. energy: 0.285 local terms energy: -188.921162 where: bonds (distance) C4'-P energy: -39.972 bonds (distance) P-C4' energy: -40.231 flat angles C4'-P-C4' energy: -41.698 flat angles P-C4'-P energy: -21.165 tors. eta vs tors. theta energy: -45.855 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -486.277121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.277121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.311369 (E_RNA) where: Base-Base interactions energy: -318.830 where: short stacking energy: -139.311 Base-Backbone interact. energy: -0.930 local terms energy: -166.551074 where: bonds (distance) C4'-P energy: -36.142 bonds (distance) P-C4' energy: -36.049 flat angles C4'-P-C4' energy: -30.786 flat angles P-C4'-P energy: -19.357 tors. eta vs tors. theta energy: -44.217 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -448.488470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.488470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.640611 (E_RNA) where: Base-Base interactions energy: -295.796 where: short stacking energy: -130.348 Base-Backbone interact. energy: 0.009 local terms energy: -152.852840 where: bonds (distance) C4'-P energy: -36.892 bonds (distance) P-C4' energy: -40.350 flat angles C4'-P-C4' energy: -28.510 flat angles P-C4'-P energy: -26.661 tors. eta vs tors. theta energy: -20.439 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -434.277683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.277683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.632751 (E_RNA) where: Base-Base interactions energy: -274.388 where: short stacking energy: -135.096 Base-Backbone interact. energy: 0.516 local terms energy: -160.761548 where: bonds (distance) C4'-P energy: -27.788 bonds (distance) P-C4' energy: -39.106 flat angles C4'-P-C4' energy: -39.109 flat angles P-C4'-P energy: -23.527 tors. eta vs tors. theta energy: -31.231 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -402.797919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.797919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.864441 (E_RNA) where: Base-Base interactions energy: -241.677 where: short stacking energy: -121.021 Base-Backbone interact. energy: -0.211 local terms energy: -160.977159 where: bonds (distance) C4'-P energy: -28.920 bonds (distance) P-C4' energy: -36.668 flat angles C4'-P-C4' energy: -41.347 flat angles P-C4'-P energy: -24.908 tors. eta vs tors. theta energy: -29.134 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -375.615539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.615539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.885610 (E_RNA) where: Base-Base interactions energy: -223.635 where: short stacking energy: -110.381 Base-Backbone interact. energy: 0.942 local terms energy: -153.192542 where: bonds (distance) C4'-P energy: -33.465 bonds (distance) P-C4' energy: -37.509 flat angles C4'-P-C4' energy: -31.684 flat angles P-C4'-P energy: -27.308 tors. eta vs tors. theta energy: -23.226 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -319.013204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.013204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.705155 (E_RNA) where: Base-Base interactions energy: -183.846 where: short stacking energy: -84.996 Base-Backbone interact. energy: -1.827 local terms energy: -135.032552 where: bonds (distance) C4'-P energy: -34.823 bonds (distance) P-C4' energy: -37.589 flat angles C4'-P-C4' energy: -32.598 flat angles P-C4'-P energy: -15.473 tors. eta vs tors. theta energy: -14.549 Dist. restrs. and SS energy: 1.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -272.544075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.544075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.155049 (E_RNA) where: Base-Base interactions energy: -160.697 where: short stacking energy: -83.693 Base-Backbone interact. energy: 0.226 local terms energy: -116.684137 where: bonds (distance) C4'-P energy: -24.778 bonds (distance) P-C4' energy: -30.694 flat angles C4'-P-C4' energy: -28.119 flat angles P-C4'-P energy: -17.573 tors. eta vs tors. theta energy: -15.520 Dist. restrs. and SS energy: 4.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -599.539485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.539485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.939694 (E_RNA) where: Base-Base interactions energy: -403.672 where: short stacking energy: -178.224 Base-Backbone interact. energy: -0.166 local terms energy: -197.101139 where: bonds (distance) C4'-P energy: -36.766 bonds (distance) P-C4' energy: -37.813 flat angles C4'-P-C4' energy: -43.313 flat angles P-C4'-P energy: -30.308 tors. eta vs tors. theta energy: -48.901 Dist. restrs. and SS energy: 1.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -564.828247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.828247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.486742 (E_RNA) where: Base-Base interactions energy: -362.013 where: short stacking energy: -171.058 Base-Backbone interact. energy: 0.324 local terms energy: -203.797655 where: bonds (distance) C4'-P energy: -40.768 bonds (distance) P-C4' energy: -44.944 flat angles C4'-P-C4' energy: -41.714 flat angles P-C4'-P energy: -29.908 tors. eta vs tors. theta energy: -46.464 Dist. restrs. and SS energy: 0.658 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -487.626836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.626836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.639923 (E_RNA) where: Base-Base interactions energy: -314.083 where: short stacking energy: -146.107 Base-Backbone interact. energy: 1.244 local terms energy: -174.801066 where: bonds (distance) C4'-P energy: -35.778 bonds (distance) P-C4' energy: -35.031 flat angles C4'-P-C4' energy: -39.540 flat angles P-C4'-P energy: -27.149 tors. eta vs tors. theta energy: -37.304 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -477.663293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.663293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.665798 (E_RNA) where: Base-Base interactions energy: -308.759 where: short stacking energy: -150.805 Base-Backbone interact. energy: -0.651 local terms energy: -168.255791 where: bonds (distance) C4'-P energy: -38.206 bonds (distance) P-C4' energy: -31.476 flat angles C4'-P-C4' energy: -36.312 flat angles P-C4'-P energy: -22.641 tors. eta vs tors. theta energy: -39.621 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -434.887802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.887802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.908646 (E_RNA) where: Base-Base interactions energy: -273.189 where: short stacking energy: -126.924 Base-Backbone interact. energy: -0.693 local terms energy: -161.026695 where: bonds (distance) C4'-P energy: -36.094 bonds (distance) P-C4' energy: -42.218 flat angles C4'-P-C4' energy: -40.258 flat angles P-C4'-P energy: -17.963 tors. eta vs tors. theta energy: -24.494 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -417.029652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.029652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.274321 (E_RNA) where: Base-Base interactions energy: -270.505 where: short stacking energy: -112.130 Base-Backbone interact. energy: -0.401 local terms energy: -146.367822 where: bonds (distance) C4'-P energy: -24.084 bonds (distance) P-C4' energy: -37.128 flat angles C4'-P-C4' energy: -37.996 flat angles P-C4'-P energy: -24.949 tors. eta vs tors. theta energy: -22.212 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -399.064212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.064212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.234117 (E_RNA) where: Base-Base interactions energy: -256.364 where: short stacking energy: -104.961 Base-Backbone interact. energy: 0.368 local terms energy: -143.238431 where: bonds (distance) C4'-P energy: -40.108 bonds (distance) P-C4' energy: -37.642 flat angles C4'-P-C4' energy: -25.136 flat angles P-C4'-P energy: -16.796 tors. eta vs tors. theta energy: -23.556 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -380.808049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.808049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.337497 (E_RNA) where: Base-Base interactions energy: -238.399 where: short stacking energy: -112.900 Base-Backbone interact. energy: -0.359 local terms energy: -142.579578 where: bonds (distance) C4'-P energy: -29.643 bonds (distance) P-C4' energy: -31.282 flat angles C4'-P-C4' energy: -34.372 flat angles P-C4'-P energy: -28.067 tors. eta vs tors. theta energy: -19.215 Dist. restrs. and SS energy: 0.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -280.720676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.720676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.434744 (E_RNA) where: Base-Base interactions energy: -160.522 where: short stacking energy: -76.475 Base-Backbone interact. energy: 0.191 local terms energy: -121.104498 where: bonds (distance) C4'-P energy: -27.604 bonds (distance) P-C4' energy: -34.316 flat angles C4'-P-C4' energy: -27.547 flat angles P-C4'-P energy: -18.800 tors. eta vs tors. theta energy: -12.836 Dist. restrs. and SS energy: 0.714 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -302.460586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.460586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.426360 (E_RNA) where: Base-Base interactions energy: -176.089 where: short stacking energy: -77.362 Base-Backbone interact. energy: 2.340 local terms energy: -131.677389 where: bonds (distance) C4'-P energy: -39.089 bonds (distance) P-C4' energy: -29.837 flat angles C4'-P-C4' energy: -32.738 flat angles P-C4'-P energy: -16.914 tors. eta vs tors. theta energy: -13.100 Dist. restrs. and SS energy: 2.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -615.287023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.287023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.447735 (E_RNA) where: Base-Base interactions energy: -406.938 where: short stacking energy: -190.461 Base-Backbone interact. energy: -0.685 local terms energy: -208.824387 where: bonds (distance) C4'-P energy: -43.315 bonds (distance) P-C4' energy: -43.908 flat angles C4'-P-C4' energy: -43.611 flat angles P-C4'-P energy: -30.085 tors. eta vs tors. theta energy: -47.906 Dist. restrs. and SS energy: 1.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -549.656383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.656383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.978893 (E_RNA) where: Base-Base interactions energy: -356.455 where: short stacking energy: -170.734 Base-Backbone interact. energy: -0.133 local terms energy: -193.390527 where: bonds (distance) C4'-P energy: -31.125 bonds (distance) P-C4' energy: -42.532 flat angles C4'-P-C4' energy: -44.147 flat angles P-C4'-P energy: -33.801 tors. eta vs tors. theta energy: -41.785 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -503.282358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.282358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.371407 (E_RNA) where: Base-Base interactions energy: -318.161 where: short stacking energy: -150.793 Base-Backbone interact. energy: 0.552 local terms energy: -185.762202 where: bonds (distance) C4'-P energy: -36.407 bonds (distance) P-C4' energy: -38.757 flat angles C4'-P-C4' energy: -39.038 flat angles P-C4'-P energy: -30.676 tors. eta vs tors. theta energy: -40.885 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -486.357740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.357740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.639603 (E_RNA) where: Base-Base interactions energy: -302.193 where: short stacking energy: -143.329 Base-Backbone interact. energy: 1.816 local terms energy: -186.262483 where: bonds (distance) C4'-P energy: -36.777 bonds (distance) P-C4' energy: -34.977 flat angles C4'-P-C4' energy: -43.519 flat angles P-C4'-P energy: -33.504 tors. eta vs tors. theta energy: -37.485 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -435.281566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.281566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.352824 (E_RNA) where: Base-Base interactions energy: -283.689 where: short stacking energy: -135.095 Base-Backbone interact. energy: -0.501 local terms energy: -151.162609 where: bonds (distance) C4'-P energy: -30.839 bonds (distance) P-C4' energy: -44.334 flat angles C4'-P-C4' energy: -39.077 flat angles P-C4'-P energy: -12.603 tors. eta vs tors. theta energy: -24.309 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -417.829070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.829070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.947290 (E_RNA) where: Base-Base interactions energy: -264.861 where: short stacking energy: -115.640 Base-Backbone interact. energy: -0.638 local terms energy: -152.448377 where: bonds (distance) C4'-P energy: -33.391 bonds (distance) P-C4' energy: -32.599 flat angles C4'-P-C4' energy: -35.519 flat angles P-C4'-P energy: -14.652 tors. eta vs tors. theta energy: -36.288 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -376.426672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.426672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.220073 (E_RNA) where: Base-Base interactions energy: -216.827 where: short stacking energy: -125.622 Base-Backbone interact. energy: -0.106 local terms energy: -160.287740 where: bonds (distance) C4'-P energy: -33.212 bonds (distance) P-C4' energy: -34.382 flat angles C4'-P-C4' energy: -31.381 flat angles P-C4'-P energy: -30.265 tors. eta vs tors. theta energy: -31.048 Dist. restrs. and SS energy: 0.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -394.086256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.086256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.238222 (E_RNA) where: Base-Base interactions energy: -237.127 where: short stacking energy: -110.030 Base-Backbone interact. energy: -1.035 local terms energy: -156.076390 where: bonds (distance) C4'-P energy: -35.517 bonds (distance) P-C4' energy: -30.877 flat angles C4'-P-C4' energy: -38.274 flat angles P-C4'-P energy: -25.460 tors. eta vs tors. theta energy: -25.950 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -344.187569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.187569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.374938 (E_RNA) where: Base-Base interactions energy: -210.312 where: short stacking energy: -91.971 Base-Backbone interact. energy: 0.402 local terms energy: -134.464977 where: bonds (distance) C4'-P energy: -33.637 bonds (distance) P-C4' energy: -35.186 flat angles C4'-P-C4' energy: -28.737 flat angles P-C4'-P energy: -20.657 tors. eta vs tors. theta energy: -16.248 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -343.824373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.824373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.732081 (E_RNA) where: Base-Base interactions energy: -211.016 where: short stacking energy: -98.590 Base-Backbone interact. energy: -1.157 local terms energy: -137.558830 where: bonds (distance) C4'-P energy: -21.917 bonds (distance) P-C4' energy: -37.184 flat angles C4'-P-C4' energy: -31.837 flat angles P-C4'-P energy: -23.446 tors. eta vs tors. theta energy: -23.174 Dist. restrs. and SS energy: 5.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -589.476677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.476677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.242534 (E_RNA) where: Base-Base interactions energy: -389.579 where: short stacking energy: -185.748 Base-Backbone interact. energy: -0.549 local terms energy: -200.114515 where: bonds (distance) C4'-P energy: -40.376 bonds (distance) P-C4' energy: -41.522 flat angles C4'-P-C4' energy: -40.448 flat angles P-C4'-P energy: -29.566 tors. eta vs tors. theta energy: -48.203 Dist. restrs. and SS energy: 0.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -529.859434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.859434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.060283 (E_RNA) where: Base-Base interactions energy: -338.675 where: short stacking energy: -155.715 Base-Backbone interact. energy: -0.788 local terms energy: -190.597736 where: bonds (distance) C4'-P energy: -42.080 bonds (distance) P-C4' energy: -39.595 flat angles C4'-P-C4' energy: -42.000 flat angles P-C4'-P energy: -20.911 tors. eta vs tors. theta energy: -46.011 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -471.083156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.083156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.192831 (E_RNA) where: Base-Base interactions energy: -290.700 where: short stacking energy: -134.694 Base-Backbone interact. energy: -0.524 local terms energy: -179.969248 where: bonds (distance) C4'-P energy: -38.093 bonds (distance) P-C4' energy: -38.386 flat angles C4'-P-C4' energy: -43.632 flat angles P-C4'-P energy: -18.838 tors. eta vs tors. theta energy: -41.021 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -482.900480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.900480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.947246 (E_RNA) where: Base-Base interactions energy: -312.981 where: short stacking energy: -152.756 Base-Backbone interact. energy: 0.939 local terms energy: -170.905482 where: bonds (distance) C4'-P energy: -33.114 bonds (distance) P-C4' energy: -32.727 flat angles C4'-P-C4' energy: -38.213 flat angles P-C4'-P energy: -24.314 tors. eta vs tors. theta energy: -42.539 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -434.144407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.144407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.474633 (E_RNA) where: Base-Base interactions energy: -264.007 where: short stacking energy: -118.445 Base-Backbone interact. energy: -0.282 local terms energy: -170.185122 where: bonds (distance) C4'-P energy: -35.210 bonds (distance) P-C4' energy: -36.579 flat angles C4'-P-C4' energy: -38.466 flat angles P-C4'-P energy: -25.571 tors. eta vs tors. theta energy: -34.359 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -426.556500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.556500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.013107 (E_RNA) where: Base-Base interactions energy: -283.977 where: short stacking energy: -118.423 Base-Backbone interact. energy: -0.253 local terms energy: -142.782750 where: bonds (distance) C4'-P energy: -28.840 bonds (distance) P-C4' energy: -34.290 flat angles C4'-P-C4' energy: -31.941 flat angles P-C4'-P energy: -17.407 tors. eta vs tors. theta energy: -30.304 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -379.515763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.515763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.687673 (E_RNA) where: Base-Base interactions energy: -231.632 where: short stacking energy: -120.313 Base-Backbone interact. energy: -0.835 local terms energy: -147.220512 where: bonds (distance) C4'-P energy: -32.338 bonds (distance) P-C4' energy: -36.713 flat angles C4'-P-C4' energy: -33.551 flat angles P-C4'-P energy: -11.199 tors. eta vs tors. theta energy: -33.419 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -399.454923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.454923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.488421 (E_RNA) where: Base-Base interactions energy: -247.442 where: short stacking energy: -113.697 Base-Backbone interact. energy: 0.098 local terms energy: -152.145176 where: bonds (distance) C4'-P energy: -31.217 bonds (distance) P-C4' energy: -41.665 flat angles C4'-P-C4' energy: -34.110 flat angles P-C4'-P energy: -17.235 tors. eta vs tors. theta energy: -27.918 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -313.764887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.764887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.021200 (E_RNA) where: Base-Base interactions energy: -198.927 where: short stacking energy: -91.483 Base-Backbone interact. energy: -0.717 local terms energy: -114.377766 where: bonds (distance) C4'-P energy: -29.184 bonds (distance) P-C4' energy: -28.850 flat angles C4'-P-C4' energy: -27.327 flat angles P-C4'-P energy: -18.025 tors. eta vs tors. theta energy: -10.991 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -339.695540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.695540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.170043 (E_RNA) where: Base-Base interactions energy: -212.312 where: short stacking energy: -83.354 Base-Backbone interact. energy: -0.152 local terms energy: -127.705999 where: bonds (distance) C4'-P energy: -29.167 bonds (distance) P-C4' energy: -29.771 flat angles C4'-P-C4' energy: -31.878 flat angles P-C4'-P energy: -21.669 tors. eta vs tors. theta energy: -15.221 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -596.693374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.693374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.588459 (E_RNA) where: Base-Base interactions energy: -401.698 where: short stacking energy: -177.854 Base-Backbone interact. energy: 0.412 local terms energy: -196.302093 where: bonds (distance) C4'-P energy: -40.597 bonds (distance) P-C4' energy: -42.554 flat angles C4'-P-C4' energy: -38.727 flat angles P-C4'-P energy: -29.124 tors. eta vs tors. theta energy: -45.301 Dist. restrs. and SS energy: 0.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -526.772891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.772891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.830229 (E_RNA) where: Base-Base interactions energy: -342.272 where: short stacking energy: -149.129 Base-Backbone interact. energy: -2.163 local terms energy: -182.395468 where: bonds (distance) C4'-P energy: -31.294 bonds (distance) P-C4' energy: -44.198 flat angles C4'-P-C4' energy: -42.026 flat angles P-C4'-P energy: -19.998 tors. eta vs tors. theta energy: -44.879 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -481.676302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.676302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.103372 (E_RNA) where: Base-Base interactions energy: -304.927 where: short stacking energy: -147.949 Base-Backbone interact. energy: -0.352 local terms energy: -176.824628 where: bonds (distance) C4'-P energy: -44.762 bonds (distance) P-C4' energy: -31.388 flat angles C4'-P-C4' energy: -42.956 flat angles P-C4'-P energy: -17.266 tors. eta vs tors. theta energy: -40.453 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -490.521280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.521280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.538809 (E_RNA) where: Base-Base interactions energy: -301.186 where: short stacking energy: -154.350 Base-Backbone interact. energy: 0.155 local terms energy: -189.507329 where: bonds (distance) C4'-P energy: -36.614 bonds (distance) P-C4' energy: -40.714 flat angles C4'-P-C4' energy: -47.589 flat angles P-C4'-P energy: -24.009 tors. eta vs tors. theta energy: -40.582 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -457.564980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.564980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.621483 (E_RNA) where: Base-Base interactions energy: -290.965 where: short stacking energy: -129.116 Base-Backbone interact. energy: -0.882 local terms energy: -165.773680 where: bonds (distance) C4'-P energy: -44.088 bonds (distance) P-C4' energy: -36.376 flat angles C4'-P-C4' energy: -34.025 flat angles P-C4'-P energy: -11.764 tors. eta vs tors. theta energy: -39.521 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -406.928924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.928924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.111734 (E_RNA) where: Base-Base interactions energy: -245.628 where: short stacking energy: -106.507 Base-Backbone interact. energy: 2.262 local terms energy: -163.746300 where: bonds (distance) C4'-P energy: -37.165 bonds (distance) P-C4' energy: -41.524 flat angles C4'-P-C4' energy: -34.766 flat angles P-C4'-P energy: -26.900 tors. eta vs tors. theta energy: -23.392 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -406.791427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.791427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.990074 (E_RNA) where: Base-Base interactions energy: -248.940 where: short stacking energy: -119.270 Base-Backbone interact. energy: 1.104 local terms energy: -159.154144 where: bonds (distance) C4'-P energy: -37.383 bonds (distance) P-C4' energy: -33.503 flat angles C4'-P-C4' energy: -32.845 flat angles P-C4'-P energy: -17.560 tors. eta vs tors. theta energy: -37.863 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -376.692896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.692896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.843220 (E_RNA) where: Base-Base interactions energy: -217.028 where: short stacking energy: -94.350 Base-Backbone interact. energy: -0.411 local terms energy: -159.404490 where: bonds (distance) C4'-P energy: -26.405 bonds (distance) P-C4' energy: -40.930 flat angles C4'-P-C4' energy: -42.372 flat angles P-C4'-P energy: -28.494 tors. eta vs tors. theta energy: -21.204 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -305.922726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.922726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.273603 (E_RNA) where: Base-Base interactions energy: -174.040 where: short stacking energy: -86.571 Base-Backbone interact. energy: -0.758 local terms energy: -131.475789 where: bonds (distance) C4'-P energy: -22.924 bonds (distance) P-C4' energy: -34.100 flat angles C4'-P-C4' energy: -42.232 flat angles P-C4'-P energy: -18.635 tors. eta vs tors. theta energy: -13.585 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -301.002817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.002817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.152053 (E_RNA) where: Base-Base interactions energy: -178.187 where: short stacking energy: -78.528 Base-Backbone interact. energy: 0.442 local terms energy: -127.406862 where: bonds (distance) C4'-P energy: -31.751 bonds (distance) P-C4' energy: -32.503 flat angles C4'-P-C4' energy: -34.387 flat angles P-C4'-P energy: -17.949 tors. eta vs tors. theta energy: -10.817 Dist. restrs. and SS energy: 4.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -603.603245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.603245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.282402 (E_RNA) where: Base-Base interactions energy: -396.714 where: short stacking energy: -183.692 Base-Backbone interact. energy: -0.995 local terms energy: -206.573324 where: bonds (distance) C4'-P energy: -43.376 bonds (distance) P-C4' energy: -36.499 flat angles C4'-P-C4' energy: -44.204 flat angles P-C4'-P energy: -32.014 tors. eta vs tors. theta energy: -50.481 Dist. restrs. and SS energy: 0.679 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -527.368265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.368265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.499721 (E_RNA) where: Base-Base interactions energy: -337.933 where: short stacking energy: -154.406 Base-Backbone interact. energy: -0.223 local terms energy: -189.344658 where: bonds (distance) C4'-P energy: -38.403 bonds (distance) P-C4' energy: -38.490 flat angles C4'-P-C4' energy: -37.611 flat angles P-C4'-P energy: -26.993 tors. eta vs tors. theta energy: -47.848 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -500.600138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.600138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.006456 (E_RNA) where: Base-Base interactions energy: -318.223 where: short stacking energy: -147.543 Base-Backbone interact. energy: -2.008 local terms energy: -181.775642 where: bonds (distance) C4'-P energy: -38.405 bonds (distance) P-C4' energy: -33.932 flat angles C4'-P-C4' energy: -36.554 flat angles P-C4'-P energy: -25.497 tors. eta vs tors. theta energy: -47.388 Dist. restrs. and SS energy: 1.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -464.013379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.013379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.312625 (E_RNA) where: Base-Base interactions energy: -293.789 where: short stacking energy: -136.986 Base-Backbone interact. energy: 1.806 local terms energy: -172.329779 where: bonds (distance) C4'-P energy: -45.168 bonds (distance) P-C4' energy: -38.573 flat angles C4'-P-C4' energy: -35.849 flat angles P-C4'-P energy: -15.430 tors. eta vs tors. theta energy: -37.310 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -453.303902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.303902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.649190 (E_RNA) where: Base-Base interactions energy: -277.607 where: short stacking energy: -123.162 Base-Backbone interact. energy: 1.414 local terms energy: -177.456139 where: bonds (distance) C4'-P energy: -37.676 bonds (distance) P-C4' energy: -40.841 flat angles C4'-P-C4' energy: -36.037 flat angles P-C4'-P energy: -27.804 tors. eta vs tors. theta energy: -35.098 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -411.877694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.877694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.020658 (E_RNA) where: Base-Base interactions energy: -274.583 where: short stacking energy: -104.905 Base-Backbone interact. energy: -0.783 local terms energy: -136.655075 where: bonds (distance) C4'-P energy: -33.737 bonds (distance) P-C4' energy: -31.160 flat angles C4'-P-C4' energy: -32.502 flat angles P-C4'-P energy: -16.403 tors. eta vs tors. theta energy: -22.853 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -411.968626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.968626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.112536 (E_RNA) where: Base-Base interactions energy: -242.822 where: short stacking energy: -118.556 Base-Backbone interact. energy: -0.959 local terms energy: -169.331233 where: bonds (distance) C4'-P energy: -37.993 bonds (distance) P-C4' energy: -40.438 flat angles C4'-P-C4' energy: -37.250 flat angles P-C4'-P energy: -24.467 tors. eta vs tors. theta energy: -29.184 Dist. restrs. and SS energy: 1.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -366.127789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.127789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.259534 (E_RNA) where: Base-Base interactions energy: -220.644 where: short stacking energy: -99.558 Base-Backbone interact. energy: 0.261 local terms energy: -145.876981 where: bonds (distance) C4'-P energy: -29.425 bonds (distance) P-C4' energy: -38.274 flat angles C4'-P-C4' energy: -37.012 flat angles P-C4'-P energy: -18.798 tors. eta vs tors. theta energy: -22.369 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -308.319918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.319918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.485657 (E_RNA) where: Base-Base interactions energy: -173.316 where: short stacking energy: -86.032 Base-Backbone interact. energy: -0.752 local terms energy: -134.418097 where: bonds (distance) C4'-P energy: -27.952 bonds (distance) P-C4' energy: -27.627 flat angles C4'-P-C4' energy: -42.860 flat angles P-C4'-P energy: -21.685 tors. eta vs tors. theta energy: -14.294 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -315.196047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.196047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.898436 (E_RNA) where: Base-Base interactions energy: -196.854 where: short stacking energy: -92.241 Base-Backbone interact. energy: 2.700 local terms energy: -122.744443 where: bonds (distance) C4'-P energy: -25.678 bonds (distance) P-C4' energy: -39.576 flat angles C4'-P-C4' energy: -27.595 flat angles P-C4'-P energy: -18.180 tors. eta vs tors. theta energy: -11.716 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -606.879095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.879095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.319834 (E_RNA) where: Base-Base interactions energy: -392.613 where: short stacking energy: -178.831 Base-Backbone interact. energy: -0.442 local terms energy: -214.265671 where: bonds (distance) C4'-P energy: -37.391 bonds (distance) P-C4' energy: -44.662 flat angles C4'-P-C4' energy: -47.301 flat angles P-C4'-P energy: -29.991 tors. eta vs tors. theta energy: -54.921 Dist. restrs. and SS energy: 0.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -528.110675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.110675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.306438 (E_RNA) where: Base-Base interactions energy: -343.308 where: short stacking energy: -157.956 Base-Backbone interact. energy: -1.635 local terms energy: -183.363433 where: bonds (distance) C4'-P energy: -34.136 bonds (distance) P-C4' energy: -43.364 flat angles C4'-P-C4' energy: -42.586 flat angles P-C4'-P energy: -20.602 tors. eta vs tors. theta energy: -42.675 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -521.625720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.625720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.718809 (E_RNA) where: Base-Base interactions energy: -344.962 where: short stacking energy: -146.541 Base-Backbone interact. energy: -1.556 local terms energy: -175.200076 where: bonds (distance) C4'-P energy: -35.736 bonds (distance) P-C4' energy: -31.966 flat angles C4'-P-C4' energy: -31.166 flat angles P-C4'-P energy: -31.183 tors. eta vs tors. theta energy: -45.149 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -472.004205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.004205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.277378 (E_RNA) where: Base-Base interactions energy: -310.582 where: short stacking energy: -136.996 Base-Backbone interact. energy: 0.508 local terms energy: -162.203529 where: bonds (distance) C4'-P energy: -36.840 bonds (distance) P-C4' energy: -37.111 flat angles C4'-P-C4' energy: -35.774 flat angles P-C4'-P energy: -23.807 tors. eta vs tors. theta energy: -28.672 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -457.916946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.916946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.033790 (E_RNA) where: Base-Base interactions energy: -294.920 where: short stacking energy: -142.976 Base-Backbone interact. energy: -0.637 local terms energy: -162.477129 where: bonds (distance) C4'-P energy: -36.881 bonds (distance) P-C4' energy: -33.958 flat angles C4'-P-C4' energy: -28.155 flat angles P-C4'-P energy: -23.961 tors. eta vs tors. theta energy: -39.522 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -434.730912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.730912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.836640 (E_RNA) where: Base-Base interactions energy: -272.645 where: short stacking energy: -108.168 Base-Backbone interact. energy: -0.394 local terms energy: -161.798599 where: bonds (distance) C4'-P energy: -28.361 bonds (distance) P-C4' energy: -42.543 flat angles C4'-P-C4' energy: -37.288 flat angles P-C4'-P energy: -24.700 tors. eta vs tors. theta energy: -28.906 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -417.325214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.325214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.438857 (E_RNA) where: Base-Base interactions energy: -250.839 where: short stacking energy: -109.672 Base-Backbone interact. energy: -0.632 local terms energy: -165.967371 where: bonds (distance) C4'-P energy: -34.094 bonds (distance) P-C4' energy: -39.984 flat angles C4'-P-C4' energy: -41.126 flat angles P-C4'-P energy: -23.108 tors. eta vs tors. theta energy: -27.655 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -342.257864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.257864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.651621 (E_RNA) where: Base-Base interactions energy: -201.754 where: short stacking energy: -108.215 Base-Backbone interact. energy: -0.498 local terms energy: -141.399156 where: bonds (distance) C4'-P energy: -25.483 bonds (distance) P-C4' energy: -31.279 flat angles C4'-P-C4' energy: -38.918 flat angles P-C4'-P energy: -23.098 tors. eta vs tors. theta energy: -22.621 Dist. restrs. and SS energy: 1.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -277.006960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.006960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.131826 (E_RNA) where: Base-Base interactions energy: -158.757 where: short stacking energy: -70.671 Base-Backbone interact. energy: -1.202 local terms energy: -117.172755 where: bonds (distance) C4'-P energy: -27.231 bonds (distance) P-C4' energy: -26.696 flat angles C4'-P-C4' energy: -32.266 flat angles P-C4'-P energy: -27.940 tors. eta vs tors. theta energy: -3.040 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -296.487901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.487901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.549919 (E_RNA) where: Base-Base interactions energy: -189.372 where: short stacking energy: -99.641 Base-Backbone interact. energy: 0.024 local terms energy: -107.201517 where: bonds (distance) C4'-P energy: -20.419 bonds (distance) P-C4' energy: -25.655 flat angles C4'-P-C4' energy: -29.864 flat angles P-C4'-P energy: -18.647 tors. eta vs tors. theta energy: -12.616 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -586.806919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.806919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.101809 (E_RNA) where: Base-Base interactions energy: -390.285 where: short stacking energy: -177.642 Base-Backbone interact. energy: 0.009 local terms energy: -196.825508 where: bonds (distance) C4'-P energy: -38.833 bonds (distance) P-C4' energy: -34.719 flat angles C4'-P-C4' energy: -46.466 flat angles P-C4'-P energy: -27.923 tors. eta vs tors. theta energy: -48.885 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -533.477203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.477203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.530655 (E_RNA) where: Base-Base interactions energy: -337.768 where: short stacking energy: -158.576 Base-Backbone interact. energy: -0.063 local terms energy: -195.699526 where: bonds (distance) C4'-P energy: -39.579 bonds (distance) P-C4' energy: -34.581 flat angles C4'-P-C4' energy: -45.503 flat angles P-C4'-P energy: -26.922 tors. eta vs tors. theta energy: -49.114 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -501.255456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.255456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.429372 (E_RNA) where: Base-Base interactions energy: -322.837 where: short stacking energy: -141.265 Base-Backbone interact. energy: -1.035 local terms energy: -177.557165 where: bonds (distance) C4'-P energy: -42.707 bonds (distance) P-C4' energy: -38.651 flat angles C4'-P-C4' energy: -34.196 flat angles P-C4'-P energy: -22.268 tors. eta vs tors. theta energy: -39.734 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -496.576351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.576351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.735859 (E_RNA) where: Base-Base interactions energy: -301.014 where: short stacking energy: -154.538 Base-Backbone interact. energy: 0.607 local terms energy: -196.328809 where: bonds (distance) C4'-P energy: -42.843 bonds (distance) P-C4' energy: -35.119 flat angles C4'-P-C4' energy: -44.396 flat angles P-C4'-P energy: -28.277 tors. eta vs tors. theta energy: -45.695 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -453.823915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.823915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.845330 (E_RNA) where: Base-Base interactions energy: -287.297 where: short stacking energy: -124.196 Base-Backbone interact. energy: -1.114 local terms energy: -165.434801 where: bonds (distance) C4'-P energy: -32.367 bonds (distance) P-C4' energy: -39.061 flat angles C4'-P-C4' energy: -30.396 flat angles P-C4'-P energy: -29.911 tors. eta vs tors. theta energy: -33.700 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -438.966579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.966579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.379480 (E_RNA) where: Base-Base interactions energy: -264.315 where: short stacking energy: -124.070 Base-Backbone interact. energy: -1.166 local terms energy: -173.898816 where: bonds (distance) C4'-P energy: -38.615 bonds (distance) P-C4' energy: -41.693 flat angles C4'-P-C4' energy: -35.693 flat angles P-C4'-P energy: -20.876 tors. eta vs tors. theta energy: -37.022 Dist. restrs. and SS energy: 0.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -421.075279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.075279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.114253 (E_RNA) where: Base-Base interactions energy: -253.219 where: short stacking energy: -126.729 Base-Backbone interact. energy: -0.409 local terms energy: -167.486976 where: bonds (distance) C4'-P energy: -38.036 bonds (distance) P-C4' energy: -41.510 flat angles C4'-P-C4' energy: -30.788 flat angles P-C4'-P energy: -20.912 tors. eta vs tors. theta energy: -36.240 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -347.050623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.050623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.046350 (E_RNA) where: Base-Base interactions energy: -200.704 where: short stacking energy: -99.766 Base-Backbone interact. energy: -0.242 local terms energy: -147.100356 where: bonds (distance) C4'-P energy: -33.837 bonds (distance) P-C4' energy: -42.792 flat angles C4'-P-C4' energy: -35.536 flat angles P-C4'-P energy: -18.393 tors. eta vs tors. theta energy: -16.542 Dist. restrs. and SS energy: 0.996 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -299.316812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.316812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.353535 (E_RNA) where: Base-Base interactions energy: -172.484 where: short stacking energy: -82.279 Base-Backbone interact. energy: -0.691 local terms energy: -126.178625 where: bonds (distance) C4'-P energy: -34.837 bonds (distance) P-C4' energy: -38.130 flat angles C4'-P-C4' energy: -30.409 flat angles P-C4'-P energy: -10.861 tors. eta vs tors. theta energy: -11.941 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -259.274464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.274464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.832041 (E_RNA) where: Base-Base interactions energy: -126.677 where: short stacking energy: -65.687 Base-Backbone interact. energy: 0.599 local terms energy: -137.754151 where: bonds (distance) C4'-P energy: -35.895 bonds (distance) P-C4' energy: -32.722 flat angles C4'-P-C4' energy: -36.585 flat angles P-C4'-P energy: -27.060 tors. eta vs tors. theta energy: -5.492 Dist. restrs. and SS energy: 4.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -585.970705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.970705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.727657 (E_RNA) where: Base-Base interactions energy: -383.682 where: short stacking energy: -180.954 Base-Backbone interact. energy: 1.244 local terms energy: -204.289512 where: bonds (distance) C4'-P energy: -38.705 bonds (distance) P-C4' energy: -42.276 flat angles C4'-P-C4' energy: -39.058 flat angles P-C4'-P energy: -38.514 tors. eta vs tors. theta energy: -45.737 Dist. restrs. and SS energy: 0.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -543.329592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.329592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.396660 (E_RNA) where: Base-Base interactions energy: -343.934 where: short stacking energy: -156.800 Base-Backbone interact. energy: -2.035 local terms energy: -197.427081 where: bonds (distance) C4'-P energy: -39.301 bonds (distance) P-C4' energy: -36.887 flat angles C4'-P-C4' energy: -38.911 flat angles P-C4'-P energy: -32.122 tors. eta vs tors. theta energy: -50.206 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -534.784145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.784145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.784145 (E_RNA) where: Base-Base interactions energy: -342.057 where: short stacking energy: -154.717 Base-Backbone interact. energy: -0.517 local terms energy: -192.210582 where: bonds (distance) C4'-P energy: -39.641 bonds (distance) P-C4' energy: -41.307 flat angles C4'-P-C4' energy: -38.640 flat angles P-C4'-P energy: -26.467 tors. eta vs tors. theta energy: -46.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -520.489186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.489186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.665389 (E_RNA) where: Base-Base interactions energy: -346.693 where: short stacking energy: -158.193 Base-Backbone interact. energy: -0.124 local terms energy: -173.847670 where: bonds (distance) C4'-P energy: -32.307 bonds (distance) P-C4' energy: -37.541 flat angles C4'-P-C4' energy: -36.643 flat angles P-C4'-P energy: -24.724 tors. eta vs tors. theta energy: -42.633 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -494.964660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.964660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.078308 (E_RNA) where: Base-Base interactions energy: -324.508 where: short stacking energy: -146.176 Base-Backbone interact. energy: -0.632 local terms energy: -169.938528 where: bonds (distance) C4'-P energy: -34.681 bonds (distance) P-C4' energy: -36.896 flat angles C4'-P-C4' energy: -37.833 flat angles P-C4'-P energy: -20.992 tors. eta vs tors. theta energy: -39.537 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -429.167667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.167667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.191231 (E_RNA) where: Base-Base interactions energy: -256.630 where: short stacking energy: -128.463 Base-Backbone interact. energy: -1.789 local terms energy: -170.771589 where: bonds (distance) C4'-P energy: -38.268 bonds (distance) P-C4' energy: -37.716 flat angles C4'-P-C4' energy: -42.833 flat angles P-C4'-P energy: -15.157 tors. eta vs tors. theta energy: -36.797 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -429.180910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.180910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.299964 (E_RNA) where: Base-Base interactions energy: -265.921 where: short stacking energy: -134.765 Base-Backbone interact. energy: -0.074 local terms energy: -163.304471 where: bonds (distance) C4'-P energy: -36.094 bonds (distance) P-C4' energy: -44.422 flat angles C4'-P-C4' energy: -35.078 flat angles P-C4'-P energy: -14.115 tors. eta vs tors. theta energy: -33.596 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -342.322701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.322701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.632310 (E_RNA) where: Base-Base interactions energy: -196.699 where: short stacking energy: -96.034 Base-Backbone interact. energy: -0.120 local terms energy: -145.812937 where: bonds (distance) C4'-P energy: -37.443 bonds (distance) P-C4' energy: -24.302 flat angles C4'-P-C4' energy: -35.133 flat angles P-C4'-P energy: -27.316 tors. eta vs tors. theta energy: -21.619 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -290.389381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.389381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.688001 (E_RNA) where: Base-Base interactions energy: -165.845 where: short stacking energy: -93.973 Base-Backbone interact. energy: -0.673 local terms energy: -124.169422 where: bonds (distance) C4'-P energy: -27.925 bonds (distance) P-C4' energy: -33.186 flat angles C4'-P-C4' energy: -31.762 flat angles P-C4'-P energy: -9.913 tors. eta vs tors. theta energy: -21.383 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -270.844447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.844447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.614899 (E_RNA) where: Base-Base interactions energy: -162.166 where: short stacking energy: -76.813 Base-Backbone interact. energy: -0.166 local terms energy: -109.282163 where: bonds (distance) C4'-P energy: -21.801 bonds (distance) P-C4' energy: -33.022 flat angles C4'-P-C4' energy: -21.714 flat angles P-C4'-P energy: -20.896 tors. eta vs tors. theta energy: -11.849 Dist. restrs. and SS energy: 0.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -545.137343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.137343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.313776 (E_RNA) where: Base-Base interactions energy: -352.591 where: short stacking energy: -170.700 Base-Backbone interact. energy: -0.372 local terms energy: -192.350812 where: bonds (distance) C4'-P energy: -35.970 bonds (distance) P-C4' energy: -44.318 flat angles C4'-P-C4' energy: -47.455 flat angles P-C4'-P energy: -21.515 tors. eta vs tors. theta energy: -43.093 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -555.726159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.726159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.549012 (E_RNA) where: Base-Base interactions energy: -371.782 where: short stacking energy: -175.395 Base-Backbone interact. energy: 1.595 local terms energy: -186.362360 where: bonds (distance) C4'-P energy: -36.588 bonds (distance) P-C4' energy: -39.165 flat angles C4'-P-C4' energy: -41.372 flat angles P-C4'-P energy: -25.761 tors. eta vs tors. theta energy: -43.477 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -503.741887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.741887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.994717 (E_RNA) where: Base-Base interactions energy: -318.127 where: short stacking energy: -164.784 Base-Backbone interact. energy: 6.266 local terms energy: -192.133839 where: bonds (distance) C4'-P energy: -45.571 bonds (distance) P-C4' energy: -36.854 flat angles C4'-P-C4' energy: -39.125 flat angles P-C4'-P energy: -22.355 tors. eta vs tors. theta energy: -48.229 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -495.626246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.626246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.005772 (E_RNA) where: Base-Base interactions energy: -323.035 where: short stacking energy: -147.229 Base-Backbone interact. energy: -0.502 local terms energy: -172.468638 where: bonds (distance) C4'-P energy: -40.223 bonds (distance) P-C4' energy: -37.874 flat angles C4'-P-C4' energy: -40.746 flat angles P-C4'-P energy: -15.094 tors. eta vs tors. theta energy: -38.531 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -483.825439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.825439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.342491 (E_RNA) where: Base-Base interactions energy: -318.254 where: short stacking energy: -133.489 Base-Backbone interact. energy: -0.971 local terms energy: -165.118120 where: bonds (distance) C4'-P energy: -42.615 bonds (distance) P-C4' energy: -33.603 flat angles C4'-P-C4' energy: -42.153 flat angles P-C4'-P energy: -14.814 tors. eta vs tors. theta energy: -31.933 Dist. restrs. and SS energy: 0.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -453.701163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.701163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.056042 (E_RNA) where: Base-Base interactions energy: -287.459 where: short stacking energy: -112.294 Base-Backbone interact. energy: -0.501 local terms energy: -166.096332 where: bonds (distance) C4'-P energy: -38.228 bonds (distance) P-C4' energy: -38.135 flat angles C4'-P-C4' energy: -36.147 flat angles P-C4'-P energy: -25.269 tors. eta vs tors. theta energy: -28.317 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -389.650020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.650020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.905596 (E_RNA) where: Base-Base interactions energy: -236.316 where: short stacking energy: -113.209 Base-Backbone interact. energy: -0.758 local terms energy: -152.831144 where: bonds (distance) C4'-P energy: -36.396 bonds (distance) P-C4' energy: -38.065 flat angles C4'-P-C4' energy: -38.507 flat angles P-C4'-P energy: -15.712 tors. eta vs tors. theta energy: -24.151 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -320.942938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.942938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.995027 (E_RNA) where: Base-Base interactions energy: -171.249 where: short stacking energy: -80.672 Base-Backbone interact. energy: -0.948 local terms energy: -148.797986 where: bonds (distance) C4'-P energy: -36.793 bonds (distance) P-C4' energy: -31.749 flat angles C4'-P-C4' energy: -36.271 flat angles P-C4'-P energy: -23.307 tors. eta vs tors. theta energy: -20.679 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -282.573476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.573476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.390356 (E_RNA) where: Base-Base interactions energy: -135.654 where: short stacking energy: -69.394 Base-Backbone interact. energy: -0.337 local terms energy: -147.399331 where: bonds (distance) C4'-P energy: -31.877 bonds (distance) P-C4' energy: -46.557 flat angles C4'-P-C4' energy: -32.015 flat angles P-C4'-P energy: -26.437 tors. eta vs tors. theta energy: -10.514 Dist. restrs. and SS energy: 0.817 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -334.781646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.781646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.843216 (E_RNA) where: Base-Base interactions energy: -193.647 where: short stacking energy: -91.769 Base-Backbone interact. energy: -1.002 local terms energy: -140.193513 where: bonds (distance) C4'-P energy: -30.658 bonds (distance) P-C4' energy: -28.610 flat angles C4'-P-C4' energy: -30.141 flat angles P-C4'-P energy: -20.906 tors. eta vs tors. theta energy: -29.878 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -540.154713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.154713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.210263 (E_RNA) where: Base-Base interactions energy: -350.888 where: short stacking energy: -152.926 Base-Backbone interact. energy: 0.011 local terms energy: -189.332423 where: bonds (distance) C4'-P energy: -41.001 bonds (distance) P-C4' energy: -42.795 flat angles C4'-P-C4' energy: -38.774 flat angles P-C4'-P energy: -28.926 tors. eta vs tors. theta energy: -37.837 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -547.443348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.443348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.901254 (E_RNA) where: Base-Base interactions energy: -361.350 where: short stacking energy: -160.336 Base-Backbone interact. energy: -1.337 local terms energy: -185.214644 where: bonds (distance) C4'-P energy: -35.808 bonds (distance) P-C4' energy: -37.410 flat angles C4'-P-C4' energy: -41.907 flat angles P-C4'-P energy: -24.125 tors. eta vs tors. theta energy: -45.963 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -495.496479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.496479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.683854 (E_RNA) where: Base-Base interactions energy: -315.822 where: short stacking energy: -157.385 Base-Backbone interact. energy: -0.159 local terms energy: -179.702672 where: bonds (distance) C4'-P energy: -36.406 bonds (distance) P-C4' energy: -35.826 flat angles C4'-P-C4' energy: -38.170 flat angles P-C4'-P energy: -22.203 tors. eta vs tors. theta energy: -47.097 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -496.061818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.061818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.082786 (E_RNA) where: Base-Base interactions energy: -315.496 where: short stacking energy: -146.888 Base-Backbone interact. energy: -0.234 local terms energy: -180.352440 where: bonds (distance) C4'-P energy: -36.120 bonds (distance) P-C4' energy: -40.182 flat angles C4'-P-C4' energy: -35.512 flat angles P-C4'-P energy: -27.584 tors. eta vs tors. theta energy: -40.954 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -474.328957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.328957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.429532 (E_RNA) where: Base-Base interactions energy: -309.298 where: short stacking energy: -138.501 Base-Backbone interact. energy: 2.863 local terms energy: -167.993791 where: bonds (distance) C4'-P energy: -33.854 bonds (distance) P-C4' energy: -28.472 flat angles C4'-P-C4' energy: -44.589 flat angles P-C4'-P energy: -21.570 tors. eta vs tors. theta energy: -39.509 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -470.451598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.451598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.453099 (E_RNA) where: Base-Base interactions energy: -298.195 where: short stacking energy: -114.991 Base-Backbone interact. energy: -0.718 local terms energy: -171.539704 where: bonds (distance) C4'-P energy: -38.983 bonds (distance) P-C4' energy: -42.732 flat angles C4'-P-C4' energy: -38.045 flat angles P-C4'-P energy: -22.855 tors. eta vs tors. theta energy: -28.925 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -390.758413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.758413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.921010 (E_RNA) where: Base-Base interactions energy: -235.986 where: short stacking energy: -107.670 Base-Backbone interact. energy: -0.574 local terms energy: -154.360829 where: bonds (distance) C4'-P energy: -34.964 bonds (distance) P-C4' energy: -25.511 flat angles C4'-P-C4' energy: -43.064 flat angles P-C4'-P energy: -26.178 tors. eta vs tors. theta energy: -24.645 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -349.191065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.191065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.390161 (E_RNA) where: Base-Base interactions energy: -200.548 where: short stacking energy: -111.432 Base-Backbone interact. energy: -0.819 local terms energy: -148.023372 where: bonds (distance) C4'-P energy: -31.955 bonds (distance) P-C4' energy: -29.605 flat angles C4'-P-C4' energy: -37.069 flat angles P-C4'-P energy: -22.507 tors. eta vs tors. theta energy: -26.887 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -344.057192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.057192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.298253 (E_RNA) where: Base-Base interactions energy: -207.857 where: short stacking energy: -97.653 Base-Backbone interact. energy: -0.426 local terms energy: -136.014598 where: bonds (distance) C4'-P energy: -30.788 bonds (distance) P-C4' energy: -38.693 flat angles C4'-P-C4' energy: -27.965 flat angles P-C4'-P energy: -21.722 tors. eta vs tors. theta energy: -16.846 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -289.744175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.744175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.531419 (E_RNA) where: Base-Base interactions energy: -166.952 where: short stacking energy: -88.404 Base-Backbone interact. energy: -0.525 local terms energy: -123.054283 where: bonds (distance) C4'-P energy: -30.639 bonds (distance) P-C4' energy: -32.876 flat angles C4'-P-C4' energy: -29.779 flat angles P-C4'-P energy: -13.839 tors. eta vs tors. theta energy: -15.921 Dist. restrs. and SS energy: 0.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -555.965226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.965226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.632573 (E_RNA) where: Base-Base interactions energy: -357.267 where: short stacking energy: -160.571 Base-Backbone interact. energy: -0.197 local terms energy: -199.169367 where: bonds (distance) C4'-P energy: -42.736 bonds (distance) P-C4' energy: -39.694 flat angles C4'-P-C4' energy: -41.991 flat angles P-C4'-P energy: -26.397 tors. eta vs tors. theta energy: -48.352 Dist. restrs. and SS energy: 0.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -519.577193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.577193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.636061 (E_RNA) where: Base-Base interactions energy: -333.273 where: short stacking energy: -158.089 Base-Backbone interact. energy: -0.904 local terms energy: -185.459244 where: bonds (distance) C4'-P energy: -39.368 bonds (distance) P-C4' energy: -37.809 flat angles C4'-P-C4' energy: -43.246 flat angles P-C4'-P energy: -29.352 tors. eta vs tors. theta energy: -35.685 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -507.920561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.920561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.079660 (E_RNA) where: Base-Base interactions energy: -323.799 where: short stacking energy: -141.827 Base-Backbone interact. energy: -1.472 local terms energy: -182.808027 where: bonds (distance) C4'-P energy: -37.826 bonds (distance) P-C4' energy: -41.471 flat angles C4'-P-C4' energy: -41.407 flat angles P-C4'-P energy: -22.388 tors. eta vs tors. theta energy: -39.716 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -475.369916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.369916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.452699 (E_RNA) where: Base-Base interactions energy: -305.566 where: short stacking energy: -148.846 Base-Backbone interact. energy: -0.814 local terms energy: -169.073147 where: bonds (distance) C4'-P energy: -38.205 bonds (distance) P-C4' energy: -38.099 flat angles C4'-P-C4' energy: -40.743 flat angles P-C4'-P energy: -17.381 tors. eta vs tors. theta energy: -34.645 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -496.681574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.681574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.818029 (E_RNA) where: Base-Base interactions energy: -325.440 where: short stacking energy: -141.934 Base-Backbone interact. energy: -0.479 local terms energy: -170.899878 where: bonds (distance) C4'-P energy: -33.559 bonds (distance) P-C4' energy: -44.003 flat angles C4'-P-C4' energy: -40.463 flat angles P-C4'-P energy: -15.330 tors. eta vs tors. theta energy: -37.545 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -450.422996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.422996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.673330 (E_RNA) where: Base-Base interactions energy: -288.295 where: short stacking energy: -138.983 Base-Backbone interact. energy: -0.254 local terms energy: -162.124076 where: bonds (distance) C4'-P energy: -31.623 bonds (distance) P-C4' energy: -38.135 flat angles C4'-P-C4' energy: -38.184 flat angles P-C4'-P energy: -16.810 tors. eta vs tors. theta energy: -37.372 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -406.321020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.321020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.671026 (E_RNA) where: Base-Base interactions energy: -246.957 where: short stacking energy: -113.054 Base-Backbone interact. energy: -0.887 local terms energy: -158.827120 where: bonds (distance) C4'-P energy: -34.532 bonds (distance) P-C4' energy: -41.921 flat angles C4'-P-C4' energy: -40.034 flat angles P-C4'-P energy: -17.660 tors. eta vs tors. theta energy: -24.679 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -300.890581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.890581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.957880 (E_RNA) where: Base-Base interactions energy: -174.653 where: short stacking energy: -94.092 Base-Backbone interact. energy: -1.592 local terms energy: -124.713478 where: bonds (distance) C4'-P energy: -22.978 bonds (distance) P-C4' energy: -41.406 flat angles C4'-P-C4' energy: -28.438 flat angles P-C4'-P energy: -20.316 tors. eta vs tors. theta energy: -11.575 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -306.037266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.037266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.192350 (E_RNA) where: Base-Base interactions energy: -168.275 where: short stacking energy: -82.418 Base-Backbone interact. energy: 1.439 local terms energy: -139.356226 where: bonds (distance) C4'-P energy: -36.222 bonds (distance) P-C4' energy: -36.332 flat angles C4'-P-C4' energy: -35.647 flat angles P-C4'-P energy: -21.431 tors. eta vs tors. theta energy: -9.724 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -272.277512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.277512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.270292 (E_RNA) where: Base-Base interactions energy: -156.549 where: short stacking energy: -72.123 Base-Backbone interact. energy: 1.955 local terms energy: -125.676413 where: bonds (distance) C4'-P energy: -26.193 bonds (distance) P-C4' energy: -42.677 flat angles C4'-P-C4' energy: -31.421 flat angles P-C4'-P energy: -14.405 tors. eta vs tors. theta energy: -10.980 Dist. restrs. and SS energy: 7.993 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -542.287475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.287475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.181154 (E_RNA) where: Base-Base interactions energy: -347.760 where: short stacking energy: -170.483 Base-Backbone interact. energy: -0.774 local terms energy: -194.647816 where: bonds (distance) C4'-P energy: -40.069 bonds (distance) P-C4' energy: -36.633 flat angles C4'-P-C4' energy: -44.306 flat angles P-C4'-P energy: -28.305 tors. eta vs tors. theta energy: -45.335 Dist. restrs. and SS energy: 0.894 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -515.110438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.110438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.177257 (E_RNA) where: Base-Base interactions energy: -336.300 where: short stacking energy: -156.258 Base-Backbone interact. energy: -0.892 local terms energy: -177.985751 where: bonds (distance) C4'-P energy: -39.553 bonds (distance) P-C4' energy: -41.224 flat angles C4'-P-C4' energy: -37.118 flat angles P-C4'-P energy: -17.373 tors. eta vs tors. theta energy: -42.718 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -506.127619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.127619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.193370 (E_RNA) where: Base-Base interactions energy: -304.766 where: short stacking energy: -155.725 Base-Backbone interact. energy: 1.336 local terms energy: -202.763627 where: bonds (distance) C4'-P energy: -46.017 bonds (distance) P-C4' energy: -40.860 flat angles C4'-P-C4' energy: -37.742 flat angles P-C4'-P energy: -21.333 tors. eta vs tors. theta energy: -56.812 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -468.203778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.203778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.280121 (E_RNA) where: Base-Base interactions energy: -301.623 where: short stacking energy: -153.881 Base-Backbone interact. energy: -1.112 local terms energy: -165.545703 where: bonds (distance) C4'-P energy: -33.564 bonds (distance) P-C4' energy: -35.434 flat angles C4'-P-C4' energy: -41.731 flat angles P-C4'-P energy: -21.711 tors. eta vs tors. theta energy: -33.105 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -482.319407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.319407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.343131 (E_RNA) where: Base-Base interactions energy: -318.354 where: short stacking energy: -156.843 Base-Backbone interact. energy: 1.232 local terms energy: -165.221467 where: bonds (distance) C4'-P energy: -31.025 bonds (distance) P-C4' energy: -38.783 flat angles C4'-P-C4' energy: -39.593 flat angles P-C4'-P energy: -15.419 tors. eta vs tors. theta energy: -40.401 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -435.905125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.905125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.286630 (E_RNA) where: Base-Base interactions energy: -282.556 where: short stacking energy: -124.550 Base-Backbone interact. energy: -0.274 local terms energy: -153.456017 where: bonds (distance) C4'-P energy: -22.315 bonds (distance) P-C4' energy: -39.482 flat angles C4'-P-C4' energy: -36.204 flat angles P-C4'-P energy: -26.519 tors. eta vs tors. theta energy: -28.936 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -422.506798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.506798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.761223 (E_RNA) where: Base-Base interactions energy: -265.852 where: short stacking energy: -127.456 Base-Backbone interact. energy: -0.069 local terms energy: -156.840050 where: bonds (distance) C4'-P energy: -24.885 bonds (distance) P-C4' energy: -44.586 flat angles C4'-P-C4' energy: -30.370 flat angles P-C4'-P energy: -21.793 tors. eta vs tors. theta energy: -35.206 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -301.101002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.101002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.168620 (E_RNA) where: Base-Base interactions energy: -168.936 where: short stacking energy: -81.020 Base-Backbone interact. energy: 0.552 local terms energy: -132.784812 where: bonds (distance) C4'-P energy: -34.912 bonds (distance) P-C4' energy: -26.315 flat angles C4'-P-C4' energy: -39.059 flat angles P-C4'-P energy: -16.118 tors. eta vs tors. theta energy: -16.380 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -301.282766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.282766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.564514 (E_RNA) where: Base-Base interactions energy: -180.921 where: short stacking energy: -86.988 Base-Backbone interact. energy: -0.273 local terms energy: -120.370590 where: bonds (distance) C4'-P energy: -32.364 bonds (distance) P-C4' energy: -27.218 flat angles C4'-P-C4' energy: -30.437 flat angles P-C4'-P energy: -23.109 tors. eta vs tors. theta energy: -7.243 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -274.397955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.397955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.617831 (E_RNA) where: Base-Base interactions energy: -152.977 where: short stacking energy: -68.191 Base-Backbone interact. energy: 1.430 local terms energy: -123.070956 where: bonds (distance) C4'-P energy: -38.277 bonds (distance) P-C4' energy: -31.143 flat angles C4'-P-C4' energy: -30.053 flat angles P-C4'-P energy: -16.968 tors. eta vs tors. theta energy: -6.630 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -521.970011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.970011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.085069 (E_RNA) where: Base-Base interactions energy: -344.022 where: short stacking energy: -157.135 Base-Backbone interact. energy: -0.006 local terms energy: -178.056581 where: bonds (distance) C4'-P energy: -35.244 bonds (distance) P-C4' energy: -45.471 flat angles C4'-P-C4' energy: -37.905 flat angles P-C4'-P energy: -25.733 tors. eta vs tors. theta energy: -33.704 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -555.116959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.116959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.606815 (E_RNA) where: Base-Base interactions energy: -359.609 where: short stacking energy: -172.547 Base-Backbone interact. energy: -0.529 local terms energy: -196.469485 where: bonds (distance) C4'-P energy: -36.041 bonds (distance) P-C4' energy: -37.960 flat angles C4'-P-C4' energy: -41.394 flat angles P-C4'-P energy: -29.013 tors. eta vs tors. theta energy: -52.062 Dist. restrs. and SS energy: 1.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -490.988143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.988143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.125167 (E_RNA) where: Base-Base interactions energy: -309.302 where: short stacking energy: -153.731 Base-Backbone interact. energy: -1.457 local terms energy: -180.366194 where: bonds (distance) C4'-P energy: -36.424 bonds (distance) P-C4' energy: -42.561 flat angles C4'-P-C4' energy: -35.309 flat angles P-C4'-P energy: -20.987 tors. eta vs tors. theta energy: -45.084 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -520.623524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.623524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.833478 (E_RNA) where: Base-Base interactions energy: -345.463 where: short stacking energy: -138.128 Base-Backbone interact. energy: 1.272 local terms energy: -176.641888 where: bonds (distance) C4'-P energy: -34.317 bonds (distance) P-C4' energy: -43.613 flat angles C4'-P-C4' energy: -44.622 flat angles P-C4'-P energy: -20.928 tors. eta vs tors. theta energy: -33.163 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -470.317383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.317383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.541931 (E_RNA) where: Base-Base interactions energy: -301.610 where: short stacking energy: -130.528 Base-Backbone interact. energy: -0.332 local terms energy: -168.600149 where: bonds (distance) C4'-P energy: -39.368 bonds (distance) P-C4' energy: -35.912 flat angles C4'-P-C4' energy: -37.243 flat angles P-C4'-P energy: -23.582 tors. eta vs tors. theta energy: -32.494 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -453.784030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.784030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.224520 (E_RNA) where: Base-Base interactions energy: -285.684 where: short stacking energy: -136.060 Base-Backbone interact. energy: -0.737 local terms energy: -167.803344 where: bonds (distance) C4'-P energy: -36.626 bonds (distance) P-C4' energy: -37.652 flat angles C4'-P-C4' energy: -37.104 flat angles P-C4'-P energy: -23.518 tors. eta vs tors. theta energy: -32.902 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -457.779209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.779209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.911948 (E_RNA) where: Base-Base interactions energy: -288.755 where: short stacking energy: -121.276 Base-Backbone interact. energy: 0.156 local terms energy: -169.312923 where: bonds (distance) C4'-P energy: -40.168 bonds (distance) P-C4' energy: -41.702 flat angles C4'-P-C4' energy: -32.099 flat angles P-C4'-P energy: -21.619 tors. eta vs tors. theta energy: -33.725 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -330.589171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.589171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.738714 (E_RNA) where: Base-Base interactions energy: -204.518 where: short stacking energy: -102.870 Base-Backbone interact. energy: -0.843 local terms energy: -125.377925 where: bonds (distance) C4'-P energy: -33.643 bonds (distance) P-C4' energy: -27.082 flat angles C4'-P-C4' energy: -31.129 flat angles P-C4'-P energy: -11.595 tors. eta vs tors. theta energy: -21.929 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -297.404139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.404139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.510022 (E_RNA) where: Base-Base interactions energy: -157.184 where: short stacking energy: -74.109 Base-Backbone interact. energy: 0.200 local terms energy: -140.526118 where: bonds (distance) C4'-P energy: -36.489 bonds (distance) P-C4' energy: -44.272 flat angles C4'-P-C4' energy: -33.078 flat angles P-C4'-P energy: -13.097 tors. eta vs tors. theta energy: -13.590 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -269.463528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.463528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.281860 (E_RNA) where: Base-Base interactions energy: -140.730 where: short stacking energy: -64.956 Base-Backbone interact. energy: -1.181 local terms energy: -130.370124 where: bonds (distance) C4'-P energy: -34.975 bonds (distance) P-C4' energy: -40.996 flat angles C4'-P-C4' energy: -27.996 flat angles P-C4'-P energy: -20.429 tors. eta vs tors. theta energy: -5.974 Dist. restrs. and SS energy: 2.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -538.355139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.355139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.355139 (E_RNA) where: Base-Base interactions energy: -349.541 where: short stacking energy: -161.890 Base-Backbone interact. energy: -1.838 local terms energy: -186.975961 where: bonds (distance) C4'-P energy: -41.239 bonds (distance) P-C4' energy: -37.753 flat angles C4'-P-C4' energy: -34.395 flat angles P-C4'-P energy: -28.012 tors. eta vs tors. theta energy: -45.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -551.079896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.079896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.164481 (E_RNA) where: Base-Base interactions energy: -352.451 where: short stacking energy: -170.615 Base-Backbone interact. energy: -1.221 local terms energy: -198.492854 where: bonds (distance) C4'-P energy: -38.267 bonds (distance) P-C4' energy: -45.786 flat angles C4'-P-C4' energy: -43.676 flat angles P-C4'-P energy: -23.743 tors. eta vs tors. theta energy: -47.021 Dist. restrs. and SS energy: 1.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -488.992985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.992985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.156939 (E_RNA) where: Base-Base interactions energy: -307.834 where: short stacking energy: -139.518 Base-Backbone interact. energy: -2.333 local terms energy: -178.989948 where: bonds (distance) C4'-P energy: -32.160 bonds (distance) P-C4' energy: -42.076 flat angles C4'-P-C4' energy: -40.429 flat angles P-C4'-P energy: -23.695 tors. eta vs tors. theta energy: -40.630 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -522.204167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.204167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.250118 (E_RNA) where: Base-Base interactions energy: -347.366 where: short stacking energy: -135.540 Base-Backbone interact. energy: -0.405 local terms energy: -174.479718 where: bonds (distance) C4'-P energy: -38.627 bonds (distance) P-C4' energy: -38.673 flat angles C4'-P-C4' energy: -40.701 flat angles P-C4'-P energy: -29.517 tors. eta vs tors. theta energy: -26.961 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -481.190632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.190632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.504311 (E_RNA) where: Base-Base interactions energy: -286.746 where: short stacking energy: -147.331 Base-Backbone interact. energy: 0.501 local terms energy: -195.259103 where: bonds (distance) C4'-P energy: -38.968 bonds (distance) P-C4' energy: -40.847 flat angles C4'-P-C4' energy: -36.194 flat angles P-C4'-P energy: -26.177 tors. eta vs tors. theta energy: -53.073 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -425.475923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.475923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.521687 (E_RNA) where: Base-Base interactions energy: -264.496 where: short stacking energy: -140.193 Base-Backbone interact. energy: -0.245 local terms energy: -160.780600 where: bonds (distance) C4'-P energy: -32.375 bonds (distance) P-C4' energy: -33.001 flat angles C4'-P-C4' energy: -35.441 flat angles P-C4'-P energy: -20.665 tors. eta vs tors. theta energy: -39.299 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -382.040478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.040478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.078376 (E_RNA) where: Base-Base interactions energy: -232.119 where: short stacking energy: -104.725 Base-Backbone interact. energy: 1.165 local terms energy: -151.124780 where: bonds (distance) C4'-P energy: -44.660 bonds (distance) P-C4' energy: -39.839 flat angles C4'-P-C4' energy: -30.863 flat angles P-C4'-P energy: -16.403 tors. eta vs tors. theta energy: -19.360 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -375.297028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.297028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.484184 (E_RNA) where: Base-Base interactions energy: -227.744 where: short stacking energy: -123.627 Base-Backbone interact. energy: -0.591 local terms energy: -147.149504 where: bonds (distance) C4'-P energy: -28.649 bonds (distance) P-C4' energy: -33.012 flat angles C4'-P-C4' energy: -35.543 flat angles P-C4'-P energy: -22.760 tors. eta vs tors. theta energy: -27.184 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -288.906659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.906659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.168571 (E_RNA) where: Base-Base interactions energy: -168.599 where: short stacking energy: -78.768 Base-Backbone interact. energy: -0.541 local terms energy: -120.028434 where: bonds (distance) C4'-P energy: -31.785 bonds (distance) P-C4' energy: -30.530 flat angles C4'-P-C4' energy: -33.285 flat angles P-C4'-P energy: -18.808 tors. eta vs tors. theta energy: -5.621 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -273.552705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.552705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.108070 (E_RNA) where: Base-Base interactions energy: -156.268 where: short stacking energy: -67.024 Base-Backbone interact. energy: 2.424 local terms energy: -120.263390 where: bonds (distance) C4'-P energy: -32.134 bonds (distance) P-C4' energy: -33.643 flat angles C4'-P-C4' energy: -35.542 flat angles P-C4'-P energy: -19.645 tors. eta vs tors. theta energy: 0.700 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -540.221942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.221942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.281893 (E_RNA) where: Base-Base interactions energy: -348.456 where: short stacking energy: -165.937 Base-Backbone interact. energy: -0.180 local terms energy: -191.645508 where: bonds (distance) C4'-P energy: -40.261 bonds (distance) P-C4' energy: -44.669 flat angles C4'-P-C4' energy: -43.128 flat angles P-C4'-P energy: -22.140 tors. eta vs tors. theta energy: -41.447 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -518.291429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.291429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.541476 (E_RNA) where: Base-Base interactions energy: -335.649 where: short stacking energy: -157.514 Base-Backbone interact. energy: 1.157 local terms energy: -185.048743 where: bonds (distance) C4'-P energy: -38.125 bonds (distance) P-C4' energy: -40.629 flat angles C4'-P-C4' energy: -35.290 flat angles P-C4'-P energy: -27.625 tors. eta vs tors. theta energy: -43.380 Dist. restrs. and SS energy: 1.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -537.709838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.709838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.938576 (E_RNA) where: Base-Base interactions energy: -356.073 where: short stacking energy: -155.834 Base-Backbone interact. energy: -1.121 local terms energy: -180.744016 where: bonds (distance) C4'-P energy: -37.653 bonds (distance) P-C4' energy: -33.805 flat angles C4'-P-C4' energy: -43.205 flat angles P-C4'-P energy: -24.561 tors. eta vs tors. theta energy: -41.520 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -479.417374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.417374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.881491 (E_RNA) where: Base-Base interactions energy: -298.344 where: short stacking energy: -155.422 Base-Backbone interact. energy: -0.677 local terms energy: -180.860267 where: bonds (distance) C4'-P energy: -38.538 bonds (distance) P-C4' energy: -43.126 flat angles C4'-P-C4' energy: -40.278 flat angles P-C4'-P energy: -20.194 tors. eta vs tors. theta energy: -38.724 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -494.812683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.812683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.928799 (E_RNA) where: Base-Base interactions energy: -318.797 where: short stacking energy: -152.664 Base-Backbone interact. energy: -1.137 local terms energy: -174.995334 where: bonds (distance) C4'-P energy: -30.669 bonds (distance) P-C4' energy: -36.750 flat angles C4'-P-C4' energy: -40.321 flat angles P-C4'-P energy: -24.170 tors. eta vs tors. theta energy: -43.085 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -413.250172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.250172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.258458 (E_RNA) where: Base-Base interactions energy: -267.321 where: short stacking energy: -114.152 Base-Backbone interact. energy: -0.340 local terms energy: -145.597839 where: bonds (distance) C4'-P energy: -23.563 bonds (distance) P-C4' energy: -37.820 flat angles C4'-P-C4' energy: -32.036 flat angles P-C4'-P energy: -28.074 tors. eta vs tors. theta energy: -24.106 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -410.042669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.042669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.242376 (E_RNA) where: Base-Base interactions energy: -252.107 where: short stacking energy: -124.356 Base-Backbone interact. energy: -0.245 local terms energy: -157.889782 where: bonds (distance) C4'-P energy: -29.438 bonds (distance) P-C4' energy: -39.132 flat angles C4'-P-C4' energy: -43.708 flat angles P-C4'-P energy: -24.069 tors. eta vs tors. theta energy: -21.543 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -370.056736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.056736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.112714 (E_RNA) where: Base-Base interactions energy: -238.221 where: short stacking energy: -101.308 Base-Backbone interact. energy: 0.526 local terms energy: -133.417183 where: bonds (distance) C4'-P energy: -34.508 bonds (distance) P-C4' energy: -33.247 flat angles C4'-P-C4' energy: -32.915 flat angles P-C4'-P energy: -16.489 tors. eta vs tors. theta energy: -16.258 Dist. restrs. and SS energy: 1.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -272.132978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.132978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.589242 (E_RNA) where: Base-Base interactions energy: -158.807 where: short stacking energy: -78.910 Base-Backbone interact. energy: -1.569 local terms energy: -112.213030 where: bonds (distance) C4'-P energy: -27.962 bonds (distance) P-C4' energy: -35.117 flat angles C4'-P-C4' energy: -24.522 flat angles P-C4'-P energy: -10.608 tors. eta vs tors. theta energy: -14.005 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -290.786781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.786781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.460753 (E_RNA) where: Base-Base interactions energy: -177.452 where: short stacking energy: -90.129 Base-Backbone interact. energy: -1.091 local terms energy: -112.918608 where: bonds (distance) C4'-P energy: -27.973 bonds (distance) P-C4' energy: -35.735 flat angles C4'-P-C4' energy: -28.339 flat angles P-C4'-P energy: -14.226 tors. eta vs tors. theta energy: -6.646 Dist. restrs. and SS energy: 0.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -540.471231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.471231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.724002 (E_RNA) where: Base-Base interactions energy: -341.318 where: short stacking energy: -159.539 Base-Backbone interact. energy: -1.015 local terms energy: -198.390820 where: bonds (distance) C4'-P energy: -38.554 bonds (distance) P-C4' energy: -44.264 flat angles C4'-P-C4' energy: -41.949 flat angles P-C4'-P energy: -29.825 tors. eta vs tors. theta energy: -43.799 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -556.620264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.620264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.803168 (E_RNA) where: Base-Base interactions energy: -375.850 where: short stacking energy: -155.464 Base-Backbone interact. energy: -0.387 local terms energy: -180.565899 where: bonds (distance) C4'-P energy: -30.042 bonds (distance) P-C4' energy: -40.886 flat angles C4'-P-C4' energy: -41.050 flat angles P-C4'-P energy: -26.897 tors. eta vs tors. theta energy: -41.691 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -516.727399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.727399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.479748 (E_RNA) where: Base-Base interactions energy: -334.472 where: short stacking energy: -155.060 Base-Backbone interact. energy: -0.823 local terms energy: -182.185372 where: bonds (distance) C4'-P energy: -27.718 bonds (distance) P-C4' energy: -39.908 flat angles C4'-P-C4' energy: -41.284 flat angles P-C4'-P energy: -25.509 tors. eta vs tors. theta energy: -47.766 Dist. restrs. and SS energy: 0.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -529.736129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.736129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.946920 (E_RNA) where: Base-Base interactions energy: -343.414 where: short stacking energy: -155.789 Base-Backbone interact. energy: -0.963 local terms energy: -185.570245 where: bonds (distance) C4'-P energy: -38.188 bonds (distance) P-C4' energy: -35.973 flat angles C4'-P-C4' energy: -39.082 flat angles P-C4'-P energy: -29.010 tors. eta vs tors. theta energy: -43.318 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -456.794135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.794135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.992547 (E_RNA) where: Base-Base interactions energy: -294.325 where: short stacking energy: -151.016 Base-Backbone interact. energy: -0.693 local terms energy: -161.974716 where: bonds (distance) C4'-P energy: -28.378 bonds (distance) P-C4' energy: -28.719 flat angles C4'-P-C4' energy: -37.735 flat angles P-C4'-P energy: -23.841 tors. eta vs tors. theta energy: -43.302 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -435.342393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.342393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.508392 (E_RNA) where: Base-Base interactions energy: -270.502 where: short stacking energy: -129.665 Base-Backbone interact. energy: -0.573 local terms energy: -164.433672 where: bonds (distance) C4'-P energy: -32.694 bonds (distance) P-C4' energy: -33.982 flat angles C4'-P-C4' energy: -39.184 flat angles P-C4'-P energy: -22.852 tors. eta vs tors. theta energy: -35.721 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -404.371221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.371221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.524831 (E_RNA) where: Base-Base interactions energy: -256.267 where: short stacking energy: -112.106 Base-Backbone interact. energy: -0.503 local terms energy: -147.755338 where: bonds (distance) C4'-P energy: -35.513 bonds (distance) P-C4' energy: -31.546 flat angles C4'-P-C4' energy: -36.059 flat angles P-C4'-P energy: -20.179 tors. eta vs tors. theta energy: -24.459 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -394.590340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.590340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.242598 (E_RNA) where: Base-Base interactions energy: -255.710 where: short stacking energy: -118.661 Base-Backbone interact. energy: -1.203 local terms energy: -138.329742 where: bonds (distance) C4'-P energy: -26.237 bonds (distance) P-C4' energy: -32.623 flat angles C4'-P-C4' energy: -32.770 flat angles P-C4'-P energy: -17.466 tors. eta vs tors. theta energy: -29.234 Dist. restrs. and SS energy: 0.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -276.409923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.409923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.404774 (E_RNA) where: Base-Base interactions energy: -157.285 where: short stacking energy: -83.916 Base-Backbone interact. energy: -1.405 local terms energy: -122.714985 where: bonds (distance) C4'-P energy: -37.757 bonds (distance) P-C4' energy: -35.486 flat angles C4'-P-C4' energy: -22.120 flat angles P-C4'-P energy: -15.462 tors. eta vs tors. theta energy: -11.890 Dist. restrs. and SS energy: 4.995 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -287.699663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.699663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.204821 (E_RNA) where: Base-Base interactions energy: -182.104 where: short stacking energy: -86.184 Base-Backbone interact. energy: -0.352 local terms energy: -105.748620 where: bonds (distance) C4'-P energy: -22.322 bonds (distance) P-C4' energy: -27.828 flat angles C4'-P-C4' energy: -29.410 flat angles P-C4'-P energy: -8.812 tors. eta vs tors. theta energy: -17.376 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -576.609160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.609160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.619211 (E_RNA) where: Base-Base interactions energy: -395.656 where: short stacking energy: -172.796 Base-Backbone interact. energy: 0.484 local terms energy: -181.447357 where: bonds (distance) C4'-P energy: -33.765 bonds (distance) P-C4' energy: -39.674 flat angles C4'-P-C4' energy: -42.903 flat angles P-C4'-P energy: -21.243 tors. eta vs tors. theta energy: -43.862 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -539.160362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.160362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.379836 (E_RNA) where: Base-Base interactions energy: -349.108 where: short stacking energy: -175.667 Base-Backbone interact. energy: 0.604 local terms energy: -190.875621 where: bonds (distance) C4'-P energy: -32.253 bonds (distance) P-C4' energy: -36.760 flat angles C4'-P-C4' energy: -46.952 flat angles P-C4'-P energy: -30.250 tors. eta vs tors. theta energy: -44.660 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -578.223951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.223951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.496820 (E_RNA) where: Base-Base interactions energy: -387.886 where: short stacking energy: -180.222 Base-Backbone interact. energy: -0.052 local terms energy: -190.558035 where: bonds (distance) C4'-P energy: -39.381 bonds (distance) P-C4' energy: -40.346 flat angles C4'-P-C4' energy: -39.183 flat angles P-C4'-P energy: -23.703 tors. eta vs tors. theta energy: -47.944 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -498.332686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.332686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.345469 (E_RNA) where: Base-Base interactions energy: -339.862 where: short stacking energy: -145.477 Base-Backbone interact. energy: -1.871 local terms energy: -157.612525 where: bonds (distance) C4'-P energy: -32.759 bonds (distance) P-C4' energy: -31.033 flat angles C4'-P-C4' energy: -36.775 flat angles P-C4'-P energy: -21.166 tors. eta vs tors. theta energy: -35.879 Dist. restrs. and SS energy: 1.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -443.867225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.867225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.108489 (E_RNA) where: Base-Base interactions energy: -276.785 where: short stacking energy: -126.129 Base-Backbone interact. energy: -1.220 local terms energy: -166.103398 where: bonds (distance) C4'-P energy: -31.340 bonds (distance) P-C4' energy: -34.478 flat angles C4'-P-C4' energy: -40.465 flat angles P-C4'-P energy: -30.438 tors. eta vs tors. theta energy: -29.383 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -452.339823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.339823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.400036 (E_RNA) where: Base-Base interactions energy: -275.444 where: short stacking energy: -131.347 Base-Backbone interact. energy: -1.385 local terms energy: -175.570867 where: bonds (distance) C4'-P energy: -39.360 bonds (distance) P-C4' energy: -42.234 flat angles C4'-P-C4' energy: -38.754 flat angles P-C4'-P energy: -24.550 tors. eta vs tors. theta energy: -30.673 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -392.617487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.617487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.805887 (E_RNA) where: Base-Base interactions energy: -259.931 where: short stacking energy: -114.998 Base-Backbone interact. energy: -0.575 local terms energy: -132.300547 where: bonds (distance) C4'-P energy: -35.464 bonds (distance) P-C4' energy: -30.707 flat angles C4'-P-C4' energy: -21.400 flat angles P-C4'-P energy: -18.274 tors. eta vs tors. theta energy: -26.456 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -353.800476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.800476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.321428 (E_RNA) where: Base-Base interactions energy: -210.708 where: short stacking energy: -114.923 Base-Backbone interact. energy: 1.755 local terms energy: -145.367882 where: bonds (distance) C4'-P energy: -34.268 bonds (distance) P-C4' energy: -37.095 flat angles C4'-P-C4' energy: -32.182 flat angles P-C4'-P energy: -19.699 tors. eta vs tors. theta energy: -22.124 Dist. restrs. and SS energy: 0.521 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -324.867608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.867608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.943736 (E_RNA) where: Base-Base interactions energy: -191.259 where: short stacking energy: -87.507 Base-Backbone interact. energy: -0.303 local terms energy: -133.382291 where: bonds (distance) C4'-P energy: -34.656 bonds (distance) P-C4' energy: -32.438 flat angles C4'-P-C4' energy: -36.794 flat angles P-C4'-P energy: -17.777 tors. eta vs tors. theta energy: -11.717 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -255.101679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.101679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.278852 (E_RNA) where: Base-Base interactions energy: -142.276 where: short stacking energy: -64.962 Base-Backbone interact. energy: -0.569 local terms energy: -112.433983 where: bonds (distance) C4'-P energy: -33.763 bonds (distance) P-C4' energy: -28.082 flat angles C4'-P-C4' energy: -27.002 flat angles P-C4'-P energy: -20.411 tors. eta vs tors. theta energy: -3.175 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -572.753024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.753024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.850017 (E_RNA) where: Base-Base interactions energy: -375.820 where: short stacking energy: -169.253 Base-Backbone interact. energy: -1.236 local terms energy: -195.793815 where: bonds (distance) C4'-P energy: -41.291 bonds (distance) P-C4' energy: -40.344 flat angles C4'-P-C4' energy: -43.828 flat angles P-C4'-P energy: -23.035 tors. eta vs tors. theta energy: -47.296 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -577.469755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.469755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.470918 (E_RNA) where: Base-Base interactions energy: -389.279 where: short stacking energy: -172.033 Base-Backbone interact. energy: -0.269 local terms energy: -187.922481 where: bonds (distance) C4'-P energy: -30.481 bonds (distance) P-C4' energy: -36.613 flat angles C4'-P-C4' energy: -42.721 flat angles P-C4'-P energy: -29.870 tors. eta vs tors. theta energy: -48.237 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -505.273949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.273949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.492330 (E_RNA) where: Base-Base interactions energy: -321.593 where: short stacking energy: -144.119 Base-Backbone interact. energy: -0.262 local terms energy: -183.637841 where: bonds (distance) C4'-P energy: -42.618 bonds (distance) P-C4' energy: -35.185 flat angles C4'-P-C4' energy: -43.296 flat angles P-C4'-P energy: -28.276 tors. eta vs tors. theta energy: -34.263 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -505.981804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.981804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.172405 (E_RNA) where: Base-Base interactions energy: -337.699 where: short stacking energy: -140.350 Base-Backbone interact. energy: 0.263 local terms energy: -169.736572 where: bonds (distance) C4'-P energy: -40.999 bonds (distance) P-C4' energy: -37.432 flat angles C4'-P-C4' energy: -32.968 flat angles P-C4'-P energy: -25.504 tors. eta vs tors. theta energy: -32.834 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -456.698154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.698154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.170021 (E_RNA) where: Base-Base interactions energy: -281.712 where: short stacking energy: -129.151 Base-Backbone interact. energy: 1.385 local terms energy: -176.842471 where: bonds (distance) C4'-P energy: -30.356 bonds (distance) P-C4' energy: -33.914 flat angles C4'-P-C4' energy: -46.042 flat angles P-C4'-P energy: -29.788 tors. eta vs tors. theta energy: -36.742 Dist. restrs. and SS energy: 0.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -433.419131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.419131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.511458 (E_RNA) where: Base-Base interactions energy: -272.663 where: short stacking energy: -119.282 Base-Backbone interact. energy: -0.000 local terms energy: -160.848123 where: bonds (distance) C4'-P energy: -35.311 bonds (distance) P-C4' energy: -40.004 flat angles C4'-P-C4' energy: -36.523 flat angles P-C4'-P energy: -25.787 tors. eta vs tors. theta energy: -23.223 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -405.577625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.577625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.811580 (E_RNA) where: Base-Base interactions energy: -246.298 where: short stacking energy: -118.755 Base-Backbone interact. energy: 0.591 local terms energy: -160.104394 where: bonds (distance) C4'-P energy: -41.328 bonds (distance) P-C4' energy: -26.846 flat angles C4'-P-C4' energy: -34.348 flat angles P-C4'-P energy: -23.750 tors. eta vs tors. theta energy: -33.833 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -360.770184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.770184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.251877 (E_RNA) where: Base-Base interactions energy: -222.309 where: short stacking energy: -99.909 Base-Backbone interact. energy: -1.109 local terms energy: -137.834194 where: bonds (distance) C4'-P energy: -32.482 bonds (distance) P-C4' energy: -34.121 flat angles C4'-P-C4' energy: -33.737 flat angles P-C4'-P energy: -19.060 tors. eta vs tors. theta energy: -18.434 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -293.961207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.961207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.039695 (E_RNA) where: Base-Base interactions energy: -166.906 where: short stacking energy: -86.935 Base-Backbone interact. energy: -0.132 local terms energy: -127.001729 where: bonds (distance) C4'-P energy: -37.173 bonds (distance) P-C4' energy: -30.808 flat angles C4'-P-C4' energy: -28.308 flat angles P-C4'-P energy: -18.716 tors. eta vs tors. theta energy: -11.996 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -272.388403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.388403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.590824 (E_RNA) where: Base-Base interactions energy: -166.105 where: short stacking energy: -76.921 Base-Backbone interact. energy: -0.557 local terms energy: -105.928464 where: bonds (distance) C4'-P energy: -23.603 bonds (distance) P-C4' energy: -21.983 flat angles C4'-P-C4' energy: -34.117 flat angles P-C4'-P energy: -10.262 tors. eta vs tors. theta energy: -15.964 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -583.674190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.674190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.739936 (E_RNA) where: Base-Base interactions energy: -393.519 where: short stacking energy: -171.863 Base-Backbone interact. energy: 0.169 local terms energy: -190.389001 where: bonds (distance) C4'-P energy: -37.860 bonds (distance) P-C4' energy: -41.811 flat angles C4'-P-C4' energy: -41.465 flat angles P-C4'-P energy: -19.815 tors. eta vs tors. theta energy: -49.438 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -557.902346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.902346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.943128 (E_RNA) where: Base-Base interactions energy: -367.980 where: short stacking energy: -146.215 Base-Backbone interact. energy: -0.096 local terms energy: -189.866903 where: bonds (distance) C4'-P energy: -40.616 bonds (distance) P-C4' energy: -45.597 flat angles C4'-P-C4' energy: -42.542 flat angles P-C4'-P energy: -19.516 tors. eta vs tors. theta energy: -41.597 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -514.768811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.768811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.226284 (E_RNA) where: Base-Base interactions energy: -326.010 where: short stacking energy: -163.105 Base-Backbone interact. energy: -0.661 local terms energy: -188.555510 where: bonds (distance) C4'-P energy: -35.733 bonds (distance) P-C4' energy: -33.206 flat angles C4'-P-C4' energy: -45.895 flat angles P-C4'-P energy: -26.745 tors. eta vs tors. theta energy: -46.977 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -501.921735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.921735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.764887 (E_RNA) where: Base-Base interactions energy: -324.804 where: short stacking energy: -146.624 Base-Backbone interact. energy: -3.451 local terms energy: -174.509668 where: bonds (distance) C4'-P energy: -34.332 bonds (distance) P-C4' energy: -37.623 flat angles C4'-P-C4' energy: -35.236 flat angles P-C4'-P energy: -25.892 tors. eta vs tors. theta energy: -41.428 Dist. restrs. and SS energy: 0.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -455.106698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.106698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.134135 (E_RNA) where: Base-Base interactions energy: -274.840 where: short stacking energy: -136.413 Base-Backbone interact. energy: -0.345 local terms energy: -179.948711 where: bonds (distance) C4'-P energy: -41.580 bonds (distance) P-C4' energy: -39.446 flat angles C4'-P-C4' energy: -40.545 flat angles P-C4'-P energy: -17.685 tors. eta vs tors. theta energy: -40.692 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -443.934926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.934926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.946509 (E_RNA) where: Base-Base interactions energy: -278.988 where: short stacking energy: -138.849 Base-Backbone interact. energy: 0.927 local terms energy: -165.885386 where: bonds (distance) C4'-P energy: -36.143 bonds (distance) P-C4' energy: -37.080 flat angles C4'-P-C4' energy: -40.220 flat angles P-C4'-P energy: -23.499 tors. eta vs tors. theta energy: -28.943 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -423.108809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.108809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.218068 (E_RNA) where: Base-Base interactions energy: -261.058 where: short stacking energy: -122.122 Base-Backbone interact. energy: -0.354 local terms energy: -161.806704 where: bonds (distance) C4'-P energy: -30.534 bonds (distance) P-C4' energy: -41.828 flat angles C4'-P-C4' energy: -36.239 flat angles P-C4'-P energy: -22.293 tors. eta vs tors. theta energy: -30.913 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -351.469439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.469439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.930227 (E_RNA) where: Base-Base interactions energy: -222.488 where: short stacking energy: -88.526 Base-Backbone interact. energy: -1.146 local terms energy: -128.296436 where: bonds (distance) C4'-P energy: -28.191 bonds (distance) P-C4' energy: -38.146 flat angles C4'-P-C4' energy: -30.891 flat angles P-C4'-P energy: -13.643 tors. eta vs tors. theta energy: -17.425 Dist. restrs. and SS energy: 0.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -304.834766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.834766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.257804 (E_RNA) where: Base-Base interactions energy: -170.800 where: short stacking energy: -79.699 Base-Backbone interact. energy: -0.156 local terms energy: -134.301710 where: bonds (distance) C4'-P energy: -32.795 bonds (distance) P-C4' energy: -32.933 flat angles C4'-P-C4' energy: -37.578 flat angles P-C4'-P energy: -20.546 tors. eta vs tors. theta energy: -10.449 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -246.940001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.940001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.806402 (E_RNA) where: Base-Base interactions energy: -122.783 where: short stacking energy: -59.479 Base-Backbone interact. energy: 1.896 local terms energy: -129.918812 where: bonds (distance) C4'-P energy: -37.093 bonds (distance) P-C4' energy: -34.866 flat angles C4'-P-C4' energy: -30.071 flat angles P-C4'-P energy: -19.547 tors. eta vs tors. theta energy: -8.342 Dist. restrs. and SS energy: 3.866 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -587.649636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.649636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.763808 (E_RNA) where: Base-Base interactions energy: -390.246 where: short stacking energy: -179.352 Base-Backbone interact. energy: -0.208 local terms energy: -197.310616 where: bonds (distance) C4'-P energy: -41.550 bonds (distance) P-C4' energy: -35.580 flat angles C4'-P-C4' energy: -39.806 flat angles P-C4'-P energy: -27.876 tors. eta vs tors. theta energy: -52.499 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -560.080223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.080223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.160035 (E_RNA) where: Base-Base interactions energy: -373.042 where: short stacking energy: -149.528 Base-Backbone interact. energy: -1.201 local terms energy: -185.917028 where: bonds (distance) C4'-P energy: -37.465 bonds (distance) P-C4' energy: -39.090 flat angles C4'-P-C4' energy: -42.359 flat angles P-C4'-P energy: -25.126 tors. eta vs tors. theta energy: -41.877 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -506.963046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.963046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.493416 (E_RNA) where: Base-Base interactions energy: -328.135 where: short stacking energy: -158.480 Base-Backbone interact. energy: -0.392 local terms energy: -178.966936 where: bonds (distance) C4'-P energy: -37.858 bonds (distance) P-C4' energy: -36.755 flat angles C4'-P-C4' energy: -38.914 flat angles P-C4'-P energy: -19.525 tors. eta vs tors. theta energy: -45.915 Dist. restrs. and SS energy: 0.530 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -506.807027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.807027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.978156 (E_RNA) where: Base-Base interactions energy: -318.979 where: short stacking energy: -151.499 Base-Backbone interact. energy: -1.092 local terms energy: -187.907475 where: bonds (distance) C4'-P energy: -39.342 bonds (distance) P-C4' energy: -41.492 flat angles C4'-P-C4' energy: -37.167 flat angles P-C4'-P energy: -26.527 tors. eta vs tors. theta energy: -43.380 Dist. restrs. and SS energy: 1.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -453.562057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.562057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.006807 (E_RNA) where: Base-Base interactions energy: -270.465 where: short stacking energy: -119.583 Base-Backbone interact. energy: -0.498 local terms energy: -183.044331 where: bonds (distance) C4'-P energy: -39.888 bonds (distance) P-C4' energy: -45.657 flat angles C4'-P-C4' energy: -39.132 flat angles P-C4'-P energy: -28.911 tors. eta vs tors. theta energy: -29.456 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -446.226831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.226831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.229674 (E_RNA) where: Base-Base interactions energy: -294.731 where: short stacking energy: -118.357 Base-Backbone interact. energy: 0.585 local terms energy: -152.083848 where: bonds (distance) C4'-P energy: -32.129 bonds (distance) P-C4' energy: -39.514 flat angles C4'-P-C4' energy: -35.721 flat angles P-C4'-P energy: -22.272 tors. eta vs tors. theta energy: -22.448 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -379.061268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.061268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.140079 (E_RNA) where: Base-Base interactions energy: -228.134 where: short stacking energy: -96.382 Base-Backbone interact. energy: 1.751 local terms energy: -152.757499 where: bonds (distance) C4'-P energy: -35.377 bonds (distance) P-C4' energy: -34.158 flat angles C4'-P-C4' energy: -34.944 flat angles P-C4'-P energy: -32.517 tors. eta vs tors. theta energy: -15.761 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -350.642932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.642932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.263531 (E_RNA) where: Base-Base interactions energy: -208.757 where: short stacking energy: -90.621 Base-Backbone interact. energy: -0.211 local terms energy: -142.296110 where: bonds (distance) C4'-P energy: -29.996 bonds (distance) P-C4' energy: -35.161 flat angles C4'-P-C4' energy: -34.649 flat angles P-C4'-P energy: -19.996 tors. eta vs tors. theta energy: -22.494 Dist. restrs. and SS energy: 0.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -290.641610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.641610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.039592 (E_RNA) where: Base-Base interactions energy: -165.110 where: short stacking energy: -85.284 Base-Backbone interact. energy: -0.254 local terms energy: -125.675424 where: bonds (distance) C4'-P energy: -27.417 bonds (distance) P-C4' energy: -35.770 flat angles C4'-P-C4' energy: -30.861 flat angles P-C4'-P energy: -19.912 tors. eta vs tors. theta energy: -11.715 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -307.756320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.756320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.039385 (E_RNA) where: Base-Base interactions energy: -172.484 where: short stacking energy: -89.521 Base-Backbone interact. energy: -0.644 local terms energy: -134.910902 where: bonds (distance) C4'-P energy: -12.437 bonds (distance) P-C4' energy: -35.932 flat angles C4'-P-C4' energy: -43.986 flat angles P-C4'-P energy: -24.575 tors. eta vs tors. theta energy: -17.982 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -593.216049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.216049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.250709 (E_RNA) where: Base-Base interactions energy: -389.516 where: short stacking energy: -185.490 Base-Backbone interact. energy: 1.847 local terms energy: -205.582620 where: bonds (distance) C4'-P energy: -46.763 bonds (distance) P-C4' energy: -38.123 flat angles C4'-P-C4' energy: -39.665 flat angles P-C4'-P energy: -31.234 tors. eta vs tors. theta energy: -49.797 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -536.778811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.778811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.085381 (E_RNA) where: Base-Base interactions energy: -368.398 where: short stacking energy: -139.203 Base-Backbone interact. energy: -1.024 local terms energy: -167.663988 where: bonds (distance) C4'-P energy: -37.445 bonds (distance) P-C4' energy: -37.753 flat angles C4'-P-C4' energy: -36.611 flat angles P-C4'-P energy: -27.621 tors. eta vs tors. theta energy: -28.234 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -510.140416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.140416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.207051 (E_RNA) where: Base-Base interactions energy: -333.166 where: short stacking energy: -154.595 Base-Backbone interact. energy: -1.955 local terms energy: -176.086143 where: bonds (distance) C4'-P energy: -34.894 bonds (distance) P-C4' energy: -32.921 flat angles C4'-P-C4' energy: -36.989 flat angles P-C4'-P energy: -28.263 tors. eta vs tors. theta energy: -43.019 Dist. restrs. and SS energy: 1.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -482.026765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.026765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.375803 (E_RNA) where: Base-Base interactions energy: -299.221 where: short stacking energy: -136.041 Base-Backbone interact. energy: -1.199 local terms energy: -181.956100 where: bonds (distance) C4'-P energy: -39.666 bonds (distance) P-C4' energy: -36.930 flat angles C4'-P-C4' energy: -40.510 flat angles P-C4'-P energy: -30.485 tors. eta vs tors. theta energy: -34.366 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -467.722356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.722356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.075442 (E_RNA) where: Base-Base interactions energy: -297.201 where: short stacking energy: -127.373 Base-Backbone interact. energy: -0.112 local terms energy: -170.762965 where: bonds (distance) C4'-P energy: -35.362 bonds (distance) P-C4' energy: -39.936 flat angles C4'-P-C4' energy: -39.100 flat angles P-C4'-P energy: -21.779 tors. eta vs tors. theta energy: -34.587 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -469.247539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.247539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.293062 (E_RNA) where: Base-Base interactions energy: -321.842 where: short stacking energy: -154.079 Base-Backbone interact. energy: -2.236 local terms energy: -145.215629 where: bonds (distance) C4'-P energy: -24.408 bonds (distance) P-C4' energy: -26.987 flat angles C4'-P-C4' energy: -34.883 flat angles P-C4'-P energy: -19.705 tors. eta vs tors. theta energy: -39.233 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -360.605955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.605955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.672650 (E_RNA) where: Base-Base interactions energy: -226.080 where: short stacking energy: -98.578 Base-Backbone interact. energy: -0.167 local terms energy: -134.425458 where: bonds (distance) C4'-P energy: -36.966 bonds (distance) P-C4' energy: -36.271 flat angles C4'-P-C4' energy: -29.862 flat angles P-C4'-P energy: -18.629 tors. eta vs tors. theta energy: -12.697 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -381.084688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.084688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.190439 (E_RNA) where: Base-Base interactions energy: -226.745 where: short stacking energy: -104.644 Base-Backbone interact. energy: -0.206 local terms energy: -154.239626 where: bonds (distance) C4'-P energy: -37.797 bonds (distance) P-C4' energy: -33.717 flat angles C4'-P-C4' energy: -29.930 flat angles P-C4'-P energy: -28.617 tors. eta vs tors. theta energy: -24.179 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -280.303259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.303259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.558355 (E_RNA) where: Base-Base interactions energy: -159.250 where: short stacking energy: -86.343 Base-Backbone interact. energy: 1.113 local terms energy: -126.421820 where: bonds (distance) C4'-P energy: -20.961 bonds (distance) P-C4' energy: -34.896 flat angles C4'-P-C4' energy: -33.016 flat angles P-C4'-P energy: -23.493 tors. eta vs tors. theta energy: -14.055 Dist. restrs. and SS energy: 4.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -246.813687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.813687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.517998 (E_RNA) where: Base-Base interactions energy: -127.594 where: short stacking energy: -66.721 Base-Backbone interact. energy: -1.237 local terms energy: -123.686255 where: bonds (distance) C4'-P energy: -34.938 bonds (distance) P-C4' energy: -34.106 flat angles C4'-P-C4' energy: -27.435 flat angles P-C4'-P energy: -16.265 tors. eta vs tors. theta energy: -10.941 Dist. restrs. and SS energy: 5.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -580.676147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.676147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.820471 (E_RNA) where: Base-Base interactions energy: -379.170 where: short stacking energy: -168.613 Base-Backbone interact. energy: -0.271 local terms energy: -201.379606 where: bonds (distance) C4'-P energy: -36.427 bonds (distance) P-C4' energy: -43.646 flat angles C4'-P-C4' energy: -44.540 flat angles P-C4'-P energy: -31.518 tors. eta vs tors. theta energy: -45.248 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -539.504132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.504132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.751712 (E_RNA) where: Base-Base interactions energy: -354.737 where: short stacking energy: -156.069 Base-Backbone interact. energy: -0.106 local terms energy: -185.909064 where: bonds (distance) C4'-P energy: -35.538 bonds (distance) P-C4' energy: -41.431 flat angles C4'-P-C4' energy: -40.939 flat angles P-C4'-P energy: -33.800 tors. eta vs tors. theta energy: -34.202 Dist. restrs. and SS energy: 1.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -543.392357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.392357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.538146 (E_RNA) where: Base-Base interactions energy: -363.273 where: short stacking energy: -148.369 Base-Backbone interact. energy: -0.897 local terms energy: -179.367639 where: bonds (distance) C4'-P energy: -40.135 bonds (distance) P-C4' energy: -41.095 flat angles C4'-P-C4' energy: -42.872 flat angles P-C4'-P energy: -16.430 tors. eta vs tors. theta energy: -38.835 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -499.961416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.961416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.187608 (E_RNA) where: Base-Base interactions energy: -314.990 where: short stacking energy: -152.377 Base-Backbone interact. energy: -0.257 local terms energy: -184.940286 where: bonds (distance) C4'-P energy: -34.404 bonds (distance) P-C4' energy: -42.539 flat angles C4'-P-C4' energy: -44.825 flat angles P-C4'-P energy: -15.249 tors. eta vs tors. theta energy: -47.923 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -471.021736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.021736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.586449 (E_RNA) where: Base-Base interactions energy: -302.972 where: short stacking energy: -140.030 Base-Backbone interact. energy: -1.041 local terms energy: -167.572935 where: bonds (distance) C4'-P energy: -32.378 bonds (distance) P-C4' energy: -36.493 flat angles C4'-P-C4' energy: -33.271 flat angles P-C4'-P energy: -25.478 tors. eta vs tors. theta energy: -39.953 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -402.499343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.499343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.600534 (E_RNA) where: Base-Base interactions energy: -257.455 where: short stacking energy: -107.555 Base-Backbone interact. energy: -2.460 local terms energy: -142.686251 where: bonds (distance) C4'-P energy: -36.736 bonds (distance) P-C4' energy: -35.253 flat angles C4'-P-C4' energy: -32.204 flat angles P-C4'-P energy: -18.580 tors. eta vs tors. theta energy: -19.914 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -429.068705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.068705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.184125 (E_RNA) where: Base-Base interactions energy: -277.655 where: short stacking energy: -131.392 Base-Backbone interact. energy: 1.185 local terms energy: -152.714830 where: bonds (distance) C4'-P energy: -35.128 bonds (distance) P-C4' energy: -27.241 flat angles C4'-P-C4' energy: -41.366 flat angles P-C4'-P energy: -22.655 tors. eta vs tors. theta energy: -26.325 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -343.880920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.880920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.960806 (E_RNA) where: Base-Base interactions energy: -213.272 where: short stacking energy: -98.747 Base-Backbone interact. energy: -0.331 local terms energy: -130.357496 where: bonds (distance) C4'-P energy: -23.618 bonds (distance) P-C4' energy: -39.422 flat angles C4'-P-C4' energy: -33.376 flat angles P-C4'-P energy: -14.911 tors. eta vs tors. theta energy: -19.029 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -274.634203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.634203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.520158 (E_RNA) where: Base-Base interactions energy: -127.138 where: short stacking energy: -66.102 Base-Backbone interact. energy: -0.541 local terms energy: -149.840597 where: bonds (distance) C4'-P energy: -38.349 bonds (distance) P-C4' energy: -36.432 flat angles C4'-P-C4' energy: -37.576 flat angles P-C4'-P energy: -20.758 tors. eta vs tors. theta energy: -16.725 Dist. restrs. and SS energy: 2.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -319.514758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.514758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.751114 (E_RNA) where: Base-Base interactions energy: -191.370 where: short stacking energy: -98.490 Base-Backbone interact. energy: -1.003 local terms energy: -127.378373 where: bonds (distance) C4'-P energy: -20.881 bonds (distance) P-C4' energy: -36.157 flat angles C4'-P-C4' energy: -33.118 flat angles P-C4'-P energy: -17.551 tors. eta vs tors. theta energy: -19.671 Dist. restrs. and SS energy: 0.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -569.619770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.619770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.695097 (E_RNA) where: Base-Base interactions energy: -378.248 where: short stacking energy: -166.180 Base-Backbone interact. energy: -0.470 local terms energy: -190.976567 where: bonds (distance) C4'-P energy: -42.966 bonds (distance) P-C4' energy: -39.248 flat angles C4'-P-C4' energy: -41.597 flat angles P-C4'-P energy: -27.256 tors. eta vs tors. theta energy: -39.910 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -543.124996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.124996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.516390 (E_RNA) where: Base-Base interactions energy: -351.150 where: short stacking energy: -162.933 Base-Backbone interact. energy: -2.203 local terms energy: -191.162994 where: bonds (distance) C4'-P energy: -42.303 bonds (distance) P-C4' energy: -40.324 flat angles C4'-P-C4' energy: -40.084 flat angles P-C4'-P energy: -27.627 tors. eta vs tors. theta energy: -40.824 Dist. restrs. and SS energy: 1.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -536.983817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.983817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.364695 (E_RNA) where: Base-Base interactions energy: -353.999 where: short stacking energy: -152.716 Base-Backbone interact. energy: -1.368 local terms energy: -181.996899 where: bonds (distance) C4'-P energy: -39.531 bonds (distance) P-C4' energy: -38.524 flat angles C4'-P-C4' energy: -37.543 flat angles P-C4'-P energy: -27.118 tors. eta vs tors. theta energy: -39.280 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -473.861672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.861672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.241630 (E_RNA) where: Base-Base interactions energy: -303.450 where: short stacking energy: -135.770 Base-Backbone interact. energy: -0.310 local terms energy: -170.481786 where: bonds (distance) C4'-P energy: -34.835 bonds (distance) P-C4' energy: -41.370 flat angles C4'-P-C4' energy: -39.217 flat angles P-C4'-P energy: -26.420 tors. eta vs tors. theta energy: -28.640 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -446.654229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.654229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.860769 (E_RNA) where: Base-Base interactions energy: -278.433 where: short stacking energy: -126.286 Base-Backbone interact. energy: 0.479 local terms energy: -168.906489 where: bonds (distance) C4'-P energy: -37.912 bonds (distance) P-C4' energy: -38.714 flat angles C4'-P-C4' energy: -32.163 flat angles P-C4'-P energy: -26.202 tors. eta vs tors. theta energy: -33.916 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -433.957975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.957975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.565134 (E_RNA) where: Base-Base interactions energy: -266.233 where: short stacking energy: -131.907 Base-Backbone interact. energy: -0.604 local terms energy: -167.727896 where: bonds (distance) C4'-P energy: -33.735 bonds (distance) P-C4' energy: -40.390 flat angles C4'-P-C4' energy: -38.351 flat angles P-C4'-P energy: -21.405 tors. eta vs tors. theta energy: -33.846 Dist. restrs. and SS energy: 0.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -433.495855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.495855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.711218 (E_RNA) where: Base-Base interactions energy: -265.082 where: short stacking energy: -118.218 Base-Backbone interact. energy: -0.825 local terms energy: -167.803977 where: bonds (distance) C4'-P energy: -32.894 bonds (distance) P-C4' energy: -37.115 flat angles C4'-P-C4' energy: -40.999 flat angles P-C4'-P energy: -25.186 tors. eta vs tors. theta energy: -31.610 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -321.501788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.501788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.156876 (E_RNA) where: Base-Base interactions energy: -190.677 where: short stacking energy: -91.361 Base-Backbone interact. energy: 0.094 local terms energy: -131.573555 where: bonds (distance) C4'-P energy: -28.993 bonds (distance) P-C4' energy: -31.168 flat angles C4'-P-C4' energy: -37.035 flat angles P-C4'-P energy: -13.800 tors. eta vs tors. theta energy: -20.578 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -272.807365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.807365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.390268 (E_RNA) where: Base-Base interactions energy: -157.456 where: short stacking energy: -86.905 Base-Backbone interact. energy: 0.107 local terms energy: -117.041338 where: bonds (distance) C4'-P energy: -28.239 bonds (distance) P-C4' energy: -28.510 flat angles C4'-P-C4' energy: -30.253 flat angles P-C4'-P energy: -16.454 tors. eta vs tors. theta energy: -13.585 Dist. restrs. and SS energy: 1.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -297.474704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.474704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.497774 (E_RNA) where: Base-Base interactions energy: -164.946 where: short stacking energy: -72.830 Base-Backbone interact. energy: 4.799 local terms energy: -137.350678 where: bonds (distance) C4'-P energy: -35.393 bonds (distance) P-C4' energy: -36.141 flat angles C4'-P-C4' energy: -33.513 flat angles P-C4'-P energy: -22.492 tors. eta vs tors. theta energy: -9.811 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -569.728027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.728027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.925245 (E_RNA) where: Base-Base interactions energy: -379.762 where: short stacking energy: -168.197 Base-Backbone interact. energy: 3.227 local terms energy: -193.389690 where: bonds (distance) C4'-P energy: -32.171 bonds (distance) P-C4' energy: -41.951 flat angles C4'-P-C4' energy: -44.688 flat angles P-C4'-P energy: -25.801 tors. eta vs tors. theta energy: -48.778 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -548.066361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.066361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.784875 (E_RNA) where: Base-Base interactions energy: -351.343 where: short stacking energy: -152.758 Base-Backbone interact. energy: -2.213 local terms energy: -195.229643 where: bonds (distance) C4'-P energy: -42.242 bonds (distance) P-C4' energy: -42.628 flat angles C4'-P-C4' energy: -41.341 flat angles P-C4'-P energy: -26.959 tors. eta vs tors. theta energy: -42.058 Dist. restrs. and SS energy: 0.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -522.388360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.388360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.497732 (E_RNA) where: Base-Base interactions energy: -340.020 where: short stacking energy: -145.107 Base-Backbone interact. energy: 0.542 local terms energy: -183.019856 where: bonds (distance) C4'-P energy: -40.002 bonds (distance) P-C4' energy: -41.336 flat angles C4'-P-C4' energy: -45.145 flat angles P-C4'-P energy: -25.096 tors. eta vs tors. theta energy: -31.441 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -476.855628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.855628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.177431 (E_RNA) where: Base-Base interactions energy: -299.579 where: short stacking energy: -136.146 Base-Backbone interact. energy: -0.507 local terms energy: -177.092071 where: bonds (distance) C4'-P energy: -36.786 bonds (distance) P-C4' energy: -43.917 flat angles C4'-P-C4' energy: -35.792 flat angles P-C4'-P energy: -24.507 tors. eta vs tors. theta energy: -36.090 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -444.427673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.427673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.783530 (E_RNA) where: Base-Base interactions energy: -274.773 where: short stacking energy: -118.891 Base-Backbone interact. energy: -1.400 local terms energy: -168.610485 where: bonds (distance) C4'-P energy: -36.194 bonds (distance) P-C4' energy: -35.925 flat angles C4'-P-C4' energy: -39.558 flat angles P-C4'-P energy: -29.911 tors. eta vs tors. theta energy: -27.022 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -420.647560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.647560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.755251 (E_RNA) where: Base-Base interactions energy: -261.088 where: short stacking energy: -120.255 Base-Backbone interact. energy: -0.256 local terms energy: -159.410467 where: bonds (distance) C4'-P energy: -39.108 bonds (distance) P-C4' energy: -30.588 flat angles C4'-P-C4' energy: -37.000 flat angles P-C4'-P energy: -26.472 tors. eta vs tors. theta energy: -26.244 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -371.506286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.506286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.813186 (E_RNA) where: Base-Base interactions energy: -222.703 where: short stacking energy: -88.671 Base-Backbone interact. energy: -1.078 local terms energy: -148.032925 where: bonds (distance) C4'-P energy: -35.238 bonds (distance) P-C4' energy: -34.164 flat angles C4'-P-C4' energy: -36.259 flat angles P-C4'-P energy: -18.176 tors. eta vs tors. theta energy: -24.196 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -325.667225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.667225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.595988 (E_RNA) where: Base-Base interactions energy: -184.351 where: short stacking energy: -68.112 Base-Backbone interact. energy: 0.475 local terms energy: -142.719822 where: bonds (distance) C4'-P energy: -35.624 bonds (distance) P-C4' energy: -39.982 flat angles C4'-P-C4' energy: -27.634 flat angles P-C4'-P energy: -24.668 tors. eta vs tors. theta energy: -14.811 Dist. restrs. and SS energy: 0.929 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -321.496775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.496775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.456846 (E_RNA) where: Base-Base interactions energy: -199.251 where: short stacking energy: -100.307 Base-Backbone interact. energy: -0.340 local terms energy: -125.865351 where: bonds (distance) C4'-P energy: -32.145 bonds (distance) P-C4' energy: -35.547 flat angles C4'-P-C4' energy: -30.258 flat angles P-C4'-P energy: -15.978 tors. eta vs tors. theta energy: -11.937 Dist. restrs. and SS energy: 3.960 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -291.713489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.713489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.730724 (E_RNA) where: Base-Base interactions energy: -159.448 where: short stacking energy: -82.669 Base-Backbone interact. energy: -0.394 local terms energy: -131.888190 where: bonds (distance) C4'-P energy: -29.250 bonds (distance) P-C4' energy: -34.923 flat angles C4'-P-C4' energy: -31.915 flat angles P-C4'-P energy: -19.736 tors. eta vs tors. theta energy: -16.064 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -566.383486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.383486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.587401 (E_RNA) where: Base-Base interactions energy: -370.666 where: short stacking energy: -161.344 Base-Backbone interact. energy: -0.696 local terms energy: -195.225822 where: bonds (distance) C4'-P energy: -36.385 bonds (distance) P-C4' energy: -43.441 flat angles C4'-P-C4' energy: -40.680 flat angles P-C4'-P energy: -28.549 tors. eta vs tors. theta energy: -46.170 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -537.851812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.851812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.545495 (E_RNA) where: Base-Base interactions energy: -336.613 where: short stacking energy: -150.915 Base-Backbone interact. energy: -2.826 local terms energy: -199.106739 where: bonds (distance) C4'-P energy: -36.843 bonds (distance) P-C4' energy: -42.627 flat angles C4'-P-C4' energy: -44.708 flat angles P-C4'-P energy: -26.775 tors. eta vs tors. theta energy: -48.154 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -542.678416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.678416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.714833 (E_RNA) where: Base-Base interactions energy: -361.999 where: short stacking energy: -145.140 Base-Backbone interact. energy: 0.422 local terms energy: -181.138008 where: bonds (distance) C4'-P energy: -39.832 bonds (distance) P-C4' energy: -39.898 flat angles C4'-P-C4' energy: -33.966 flat angles P-C4'-P energy: -28.962 tors. eta vs tors. theta energy: -38.481 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -463.383903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.383903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.946367 (E_RNA) where: Base-Base interactions energy: -286.119 where: short stacking energy: -137.768 Base-Backbone interact. energy: -1.134 local terms energy: -176.693346 where: bonds (distance) C4'-P energy: -36.069 bonds (distance) P-C4' energy: -38.550 flat angles C4'-P-C4' energy: -41.665 flat angles P-C4'-P energy: -22.569 tors. eta vs tors. theta energy: -37.841 Dist. restrs. and SS energy: 0.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -472.561152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.561152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.692520 (E_RNA) where: Base-Base interactions energy: -299.365 where: short stacking energy: -155.216 Base-Backbone interact. energy: -0.252 local terms energy: -173.074653 where: bonds (distance) C4'-P energy: -37.428 bonds (distance) P-C4' energy: -32.370 flat angles C4'-P-C4' energy: -40.151 flat angles P-C4'-P energy: -19.277 tors. eta vs tors. theta energy: -43.849 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -435.565450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.565450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.688811 (E_RNA) where: Base-Base interactions energy: -267.920 where: short stacking energy: -118.603 Base-Backbone interact. energy: -0.529 local terms energy: -167.240075 where: bonds (distance) C4'-P energy: -34.431 bonds (distance) P-C4' energy: -42.213 flat angles C4'-P-C4' energy: -42.840 flat angles P-C4'-P energy: -20.393 tors. eta vs tors. theta energy: -27.363 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -375.364712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.364712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.510959 (E_RNA) where: Base-Base interactions energy: -210.450 where: short stacking energy: -94.478 Base-Backbone interact. energy: -0.371 local terms energy: -164.690350 where: bonds (distance) C4'-P energy: -41.355 bonds (distance) P-C4' energy: -35.027 flat angles C4'-P-C4' energy: -33.032 flat angles P-C4'-P energy: -30.987 tors. eta vs tors. theta energy: -24.289 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -357.990781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.990781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.086286 (E_RNA) where: Base-Base interactions energy: -217.317 where: short stacking energy: -92.495 Base-Backbone interact. energy: -0.763 local terms energy: -140.006255 where: bonds (distance) C4'-P energy: -27.790 bonds (distance) P-C4' energy: -39.269 flat angles C4'-P-C4' energy: -42.850 flat angles P-C4'-P energy: -10.599 tors. eta vs tors. theta energy: -19.499 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -279.477604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.477604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.234280 (E_RNA) where: Base-Base interactions energy: -151.409 where: short stacking energy: -72.175 Base-Backbone interact. energy: -0.933 local terms energy: -129.892058 where: bonds (distance) C4'-P energy: -33.338 bonds (distance) P-C4' energy: -42.273 flat angles C4'-P-C4' energy: -27.955 flat angles P-C4'-P energy: -16.280 tors. eta vs tors. theta energy: -10.045 Dist. restrs. and SS energy: 2.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -252.738420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.738420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.353692 (E_RNA) where: Base-Base interactions energy: -132.069 where: short stacking energy: -61.542 Base-Backbone interact. energy: 0.231 local terms energy: -128.515355 where: bonds (distance) C4'-P energy: -30.594 bonds (distance) P-C4' energy: -35.800 flat angles C4'-P-C4' energy: -30.689 flat angles P-C4'-P energy: -24.684 tors. eta vs tors. theta energy: -6.748 Dist. restrs. and SS energy: 7.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -573.868290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.868290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.924010 (E_RNA) where: Base-Base interactions energy: -372.331 where: short stacking energy: -163.135 Base-Backbone interact. energy: -0.208 local terms energy: -201.385166 where: bonds (distance) C4'-P energy: -42.215 bonds (distance) P-C4' energy: -38.499 flat angles C4'-P-C4' energy: -38.683 flat angles P-C4'-P energy: -30.772 tors. eta vs tors. theta energy: -51.217 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -530.230392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.230392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.879737 (E_RNA) where: Base-Base interactions energy: -331.641 where: short stacking energy: -137.708 Base-Backbone interact. energy: -2.615 local terms energy: -196.623932 where: bonds (distance) C4'-P energy: -43.103 bonds (distance) P-C4' energy: -45.474 flat angles C4'-P-C4' energy: -42.750 flat angles P-C4'-P energy: -29.238 tors. eta vs tors. theta energy: -36.059 Dist. restrs. and SS energy: 0.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -530.096958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.096958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.130723 (E_RNA) where: Base-Base interactions energy: -356.543 where: short stacking energy: -140.033 Base-Backbone interact. energy: -1.480 local terms energy: -172.107955 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -41.523 flat angles C4'-P-C4' energy: -42.464 flat angles P-C4'-P energy: -18.298 tors. eta vs tors. theta energy: -30.960 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -495.228588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.228588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.680239 (E_RNA) where: Base-Base interactions energy: -310.761 where: short stacking energy: -150.931 Base-Backbone interact. energy: -1.241 local terms energy: -183.678265 where: bonds (distance) C4'-P energy: -37.869 bonds (distance) P-C4' energy: -34.914 flat angles C4'-P-C4' energy: -42.254 flat angles P-C4'-P energy: -29.104 tors. eta vs tors. theta energy: -39.537 Dist. restrs. and SS energy: 0.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -446.288161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.288161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.399807 (E_RNA) where: Base-Base interactions energy: -274.898 where: short stacking energy: -124.850 Base-Backbone interact. energy: -0.215 local terms energy: -171.287045 where: bonds (distance) C4'-P energy: -38.140 bonds (distance) P-C4' energy: -37.957 flat angles C4'-P-C4' energy: -37.622 flat angles P-C4'-P energy: -21.650 tors. eta vs tors. theta energy: -35.918 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -377.868893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.868893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.064497 (E_RNA) where: Base-Base interactions energy: -230.673 where: short stacking energy: -111.799 Base-Backbone interact. energy: -1.021 local terms energy: -146.370114 where: bonds (distance) C4'-P energy: -36.878 bonds (distance) P-C4' energy: -35.451 flat angles C4'-P-C4' energy: -33.048 flat angles P-C4'-P energy: -21.801 tors. eta vs tors. theta energy: -19.192 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -398.223030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.223030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.464027 (E_RNA) where: Base-Base interactions energy: -255.144 where: short stacking energy: -110.352 Base-Backbone interact. energy: 0.229 local terms energy: -143.548369 where: bonds (distance) C4'-P energy: -34.930 bonds (distance) P-C4' energy: -32.826 flat angles C4'-P-C4' energy: -31.244 flat angles P-C4'-P energy: -18.210 tors. eta vs tors. theta energy: -26.338 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -321.841313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.841313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.219256 (E_RNA) where: Base-Base interactions energy: -183.263 where: short stacking energy: -81.784 Base-Backbone interact. energy: 1.548 local terms energy: -140.504936 where: bonds (distance) C4'-P energy: -38.341 bonds (distance) P-C4' energy: -32.857 flat angles C4'-P-C4' energy: -31.306 flat angles P-C4'-P energy: -23.244 tors. eta vs tors. theta energy: -14.756 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -290.036742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.036742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.281411 (E_RNA) where: Base-Base interactions energy: -161.823 where: short stacking energy: -78.139 Base-Backbone interact. energy: -1.959 local terms energy: -126.500108 where: bonds (distance) C4'-P energy: -32.478 bonds (distance) P-C4' energy: -36.011 flat angles C4'-P-C4' energy: -35.415 flat angles P-C4'-P energy: -17.836 tors. eta vs tors. theta energy: -4.760 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -257.924905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.924905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.581037 (E_RNA) where: Base-Base interactions energy: -151.521 where: short stacking energy: -70.926 Base-Backbone interact. energy: 0.909 local terms energy: -107.968802 where: bonds (distance) C4'-P energy: -27.970 bonds (distance) P-C4' energy: -25.592 flat angles C4'-P-C4' energy: -32.719 flat angles P-C4'-P energy: -14.167 tors. eta vs tors. theta energy: -7.520 Dist. restrs. and SS energy: 0.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -553.690038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.690038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.630564 (E_RNA) where: Base-Base interactions energy: -365.598 where: short stacking energy: -169.695 Base-Backbone interact. energy: -0.118 local terms energy: -188.913862 where: bonds (distance) C4'-P energy: -34.447 bonds (distance) P-C4' energy: -45.522 flat angles C4'-P-C4' energy: -41.690 flat angles P-C4'-P energy: -29.143 tors. eta vs tors. theta energy: -38.112 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -568.889963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.889963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.927835 (E_RNA) where: Base-Base interactions energy: -382.378 where: short stacking energy: -175.482 Base-Backbone interact. energy: -0.066 local terms energy: -186.483766 where: bonds (distance) C4'-P energy: -29.326 bonds (distance) P-C4' energy: -36.214 flat angles C4'-P-C4' energy: -46.965 flat angles P-C4'-P energy: -25.573 tors. eta vs tors. theta energy: -48.406 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -530.931482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.931482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.965881 (E_RNA) where: Base-Base interactions energy: -357.589 where: short stacking energy: -159.852 Base-Backbone interact. energy: -0.871 local terms energy: -172.506441 where: bonds (distance) C4'-P energy: -38.817 bonds (distance) P-C4' energy: -33.911 flat angles C4'-P-C4' energy: -39.553 flat angles P-C4'-P energy: -23.800 tors. eta vs tors. theta energy: -36.426 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -483.881677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.881677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.968916 (E_RNA) where: Base-Base interactions energy: -303.896 where: short stacking energy: -146.900 Base-Backbone interact. energy: -0.122 local terms energy: -179.950425 where: bonds (distance) C4'-P energy: -36.385 bonds (distance) P-C4' energy: -40.930 flat angles C4'-P-C4' energy: -39.518 flat angles P-C4'-P energy: -20.243 tors. eta vs tors. theta energy: -42.874 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -436.961691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.961691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.369600 (E_RNA) where: Base-Base interactions energy: -259.234 where: short stacking energy: -126.604 Base-Backbone interact. energy: -1.118 local terms energy: -177.017224 where: bonds (distance) C4'-P energy: -36.471 bonds (distance) P-C4' energy: -41.788 flat angles C4'-P-C4' energy: -36.781 flat angles P-C4'-P energy: -23.629 tors. eta vs tors. theta energy: -38.348 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -446.197239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.197239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.302209 (E_RNA) where: Base-Base interactions energy: -268.303 where: short stacking energy: -137.291 Base-Backbone interact. energy: -0.086 local terms energy: -177.913120 where: bonds (distance) C4'-P energy: -33.280 bonds (distance) P-C4' energy: -44.321 flat angles C4'-P-C4' energy: -42.550 flat angles P-C4'-P energy: -25.108 tors. eta vs tors. theta energy: -32.654 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -374.897830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.897830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.022040 (E_RNA) where: Base-Base interactions energy: -229.197 where: short stacking energy: -110.736 Base-Backbone interact. energy: -0.035 local terms energy: -145.790449 where: bonds (distance) C4'-P energy: -36.201 bonds (distance) P-C4' energy: -31.933 flat angles C4'-P-C4' energy: -26.415 flat angles P-C4'-P energy: -29.964 tors. eta vs tors. theta energy: -21.278 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -345.440209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.440209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.597283 (E_RNA) where: Base-Base interactions energy: -207.953 where: short stacking energy: -102.394 Base-Backbone interact. energy: 1.958 local terms energy: -139.602032 where: bonds (distance) C4'-P energy: -35.129 bonds (distance) P-C4' energy: -31.980 flat angles C4'-P-C4' energy: -37.925 flat angles P-C4'-P energy: -19.416 tors. eta vs tors. theta energy: -15.152 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -357.292992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.292992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.431797 (E_RNA) where: Base-Base interactions energy: -218.957 where: short stacking energy: -98.022 Base-Backbone interact. energy: 1.066 local terms energy: -143.540389 where: bonds (distance) C4'-P energy: -25.288 bonds (distance) P-C4' energy: -37.692 flat angles C4'-P-C4' energy: -44.364 flat angles P-C4'-P energy: -14.942 tors. eta vs tors. theta energy: -21.254 Dist. restrs. and SS energy: 4.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -262.125050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.125050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.869518 (E_RNA) where: Base-Base interactions energy: -135.998 where: short stacking energy: -69.225 Base-Backbone interact. energy: -0.256 local terms energy: -126.616118 where: bonds (distance) C4'-P energy: -29.955 bonds (distance) P-C4' energy: -36.293 flat angles C4'-P-C4' energy: -32.936 flat angles P-C4'-P energy: -18.528 tors. eta vs tors. theta energy: -8.903 Dist. restrs. and SS energy: 0.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -558.856943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.856943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.348089 (E_RNA) where: Base-Base interactions energy: -361.255 where: short stacking energy: -159.155 Base-Backbone interact. energy: -1.347 local terms energy: -196.746069 where: bonds (distance) C4'-P energy: -36.337 bonds (distance) P-C4' energy: -45.775 flat angles C4'-P-C4' energy: -38.411 flat angles P-C4'-P energy: -33.588 tors. eta vs tors. theta energy: -42.636 Dist. restrs. and SS energy: 0.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -574.087564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.087564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.095297 (E_RNA) where: Base-Base interactions energy: -377.796 where: short stacking energy: -169.950 Base-Backbone interact. energy: 1.438 local terms energy: -197.737354 where: bonds (distance) C4'-P energy: -43.102 bonds (distance) P-C4' energy: -38.179 flat angles C4'-P-C4' energy: -43.015 flat angles P-C4'-P energy: -28.404 tors. eta vs tors. theta energy: -45.037 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -538.280351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.280351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.613097 (E_RNA) where: Base-Base interactions energy: -360.147 where: short stacking energy: -157.965 Base-Backbone interact. energy: 0.213 local terms energy: -178.679599 where: bonds (distance) C4'-P energy: -38.365 bonds (distance) P-C4' energy: -39.937 flat angles C4'-P-C4' energy: -39.211 flat angles P-C4'-P energy: -23.011 tors. eta vs tors. theta energy: -38.156 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -484.076264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.076264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.099257 (E_RNA) where: Base-Base interactions energy: -308.458 where: short stacking energy: -133.043 Base-Backbone interact. energy: -1.797 local terms energy: -173.844592 where: bonds (distance) C4'-P energy: -37.337 bonds (distance) P-C4' energy: -33.324 flat angles C4'-P-C4' energy: -39.143 flat angles P-C4'-P energy: -27.876 tors. eta vs tors. theta energy: -36.164 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -425.509671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.509671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.633129 (E_RNA) where: Base-Base interactions energy: -268.235 where: short stacking energy: -123.212 Base-Backbone interact. energy: -0.628 local terms energy: -156.769647 where: bonds (distance) C4'-P energy: -32.632 bonds (distance) P-C4' energy: -28.880 flat angles C4'-P-C4' energy: -38.333 flat angles P-C4'-P energy: -24.669 tors. eta vs tors. theta energy: -32.255 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -445.619127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.619127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.946244 (E_RNA) where: Base-Base interactions energy: -282.609 where: short stacking energy: -134.203 Base-Backbone interact. energy: -0.415 local terms energy: -162.922715 where: bonds (distance) C4'-P energy: -30.678 bonds (distance) P-C4' energy: -42.257 flat angles C4'-P-C4' energy: -32.709 flat angles P-C4'-P energy: -25.274 tors. eta vs tors. theta energy: -32.005 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -439.234764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.234764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.412084 (E_RNA) where: Base-Base interactions energy: -278.019 where: short stacking energy: -121.417 Base-Backbone interact. energy: 0.414 local terms energy: -161.807036 where: bonds (distance) C4'-P energy: -35.300 bonds (distance) P-C4' energy: -40.541 flat angles C4'-P-C4' energy: -40.020 flat angles P-C4'-P energy: -13.116 tors. eta vs tors. theta energy: -32.829 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -361.963995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.963995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.105615 (E_RNA) where: Base-Base interactions energy: -231.552 where: short stacking energy: -92.291 Base-Backbone interact. energy: -1.081 local terms energy: -129.472555 where: bonds (distance) C4'-P energy: -33.343 bonds (distance) P-C4' energy: -34.815 flat angles C4'-P-C4' energy: -23.016 flat angles P-C4'-P energy: -19.633 tors. eta vs tors. theta energy: -18.665 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -355.415866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.415866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.458189 (E_RNA) where: Base-Base interactions energy: -221.764 where: short stacking energy: -105.150 Base-Backbone interact. energy: 0.598 local terms energy: -134.292812 where: bonds (distance) C4'-P energy: -25.077 bonds (distance) P-C4' energy: -32.095 flat angles C4'-P-C4' energy: -35.046 flat angles P-C4'-P energy: -17.844 tors. eta vs tors. theta energy: -24.230 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -254.225052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.225052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.239439 (E_RNA) where: Base-Base interactions energy: -132.666 where: short stacking energy: -62.946 Base-Backbone interact. energy: -0.485 local terms energy: -121.088315 where: bonds (distance) C4'-P energy: -25.653 bonds (distance) P-C4' energy: -28.045 flat angles C4'-P-C4' energy: -31.823 flat angles P-C4'-P energy: -24.315 tors. eta vs tors. theta energy: -11.252 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -577.572798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.572798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.681113 (E_RNA) where: Base-Base interactions energy: -366.219 where: short stacking energy: -158.853 Base-Backbone interact. energy: -0.271 local terms energy: -212.190394 where: bonds (distance) C4'-P energy: -44.009 bonds (distance) P-C4' energy: -47.529 flat angles C4'-P-C4' energy: -42.940 flat angles P-C4'-P energy: -31.757 tors. eta vs tors. theta energy: -45.956 Dist. restrs. and SS energy: 1.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -555.516749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.516749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.574332 (E_RNA) where: Base-Base interactions energy: -356.450 where: short stacking energy: -169.056 Base-Backbone interact. energy: -0.271 local terms energy: -198.853909 where: bonds (distance) C4'-P energy: -37.041 bonds (distance) P-C4' energy: -43.654 flat angles C4'-P-C4' energy: -47.267 flat angles P-C4'-P energy: -25.645 tors. eta vs tors. theta energy: -45.247 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -530.897630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.897630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.147471 (E_RNA) where: Base-Base interactions energy: -334.562 where: short stacking energy: -147.969 Base-Backbone interact. energy: -0.855 local terms energy: -195.730659 where: bonds (distance) C4'-P energy: -43.384 bonds (distance) P-C4' energy: -43.863 flat angles C4'-P-C4' energy: -39.765 flat angles P-C4'-P energy: -27.435 tors. eta vs tors. theta energy: -41.284 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -487.748100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.748100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.790912 (E_RNA) where: Base-Base interactions energy: -321.830 where: short stacking energy: -145.072 Base-Backbone interact. energy: -0.244 local terms energy: -165.716974 where: bonds (distance) C4'-P energy: -40.988 bonds (distance) P-C4' energy: -34.265 flat angles C4'-P-C4' energy: -39.545 flat angles P-C4'-P energy: -16.733 tors. eta vs tors. theta energy: -34.186 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -456.457947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.457947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.597463 (E_RNA) where: Base-Base interactions energy: -283.664 where: short stacking energy: -139.907 Base-Backbone interact. energy: -0.579 local terms energy: -172.354556 where: bonds (distance) C4'-P energy: -42.523 bonds (distance) P-C4' energy: -38.373 flat angles C4'-P-C4' energy: -33.383 flat angles P-C4'-P energy: -25.976 tors. eta vs tors. theta energy: -32.100 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -420.808764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.808764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.160070 (E_RNA) where: Base-Base interactions energy: -264.116 where: short stacking energy: -117.471 Base-Backbone interact. energy: -0.836 local terms energy: -156.208369 where: bonds (distance) C4'-P energy: -36.450 bonds (distance) P-C4' energy: -38.463 flat angles C4'-P-C4' energy: -32.961 flat angles P-C4'-P energy: -19.663 tors. eta vs tors. theta energy: -28.671 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -410.323879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.323879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.535294 (E_RNA) where: Base-Base interactions energy: -257.741 where: short stacking energy: -124.090 Base-Backbone interact. energy: -0.426 local terms energy: -152.368229 where: bonds (distance) C4'-P energy: -30.199 bonds (distance) P-C4' energy: -25.732 flat angles C4'-P-C4' energy: -43.566 flat angles P-C4'-P energy: -21.541 tors. eta vs tors. theta energy: -31.331 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -301.609960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.609960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.874986 (E_RNA) where: Base-Base interactions energy: -163.206 where: short stacking energy: -101.072 Base-Backbone interact. energy: -0.530 local terms energy: -140.138395 where: bonds (distance) C4'-P energy: -38.230 bonds (distance) P-C4' energy: -29.802 flat angles C4'-P-C4' energy: -34.642 flat angles P-C4'-P energy: -17.345 tors. eta vs tors. theta energy: -20.120 Dist. restrs. and SS energy: 2.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -321.571698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.571698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.341158 (E_RNA) where: Base-Base interactions energy: -195.726 where: short stacking energy: -83.212 Base-Backbone interact. energy: 0.905 local terms energy: -128.520172 where: bonds (distance) C4'-P energy: -29.892 bonds (distance) P-C4' energy: -34.370 flat angles C4'-P-C4' energy: -27.883 flat angles P-C4'-P energy: -15.945 tors. eta vs tors. theta energy: -20.430 Dist. restrs. and SS energy: 1.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -277.203872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.203872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.468158 (E_RNA) where: Base-Base interactions energy: -150.967 where: short stacking energy: -73.640 Base-Backbone interact. energy: -0.672 local terms energy: -125.829353 where: bonds (distance) C4'-P energy: -29.484 bonds (distance) P-C4' energy: -32.786 flat angles C4'-P-C4' energy: -30.828 flat angles P-C4'-P energy: -18.575 tors. eta vs tors. theta energy: -14.156 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -554.899553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.899553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.515716 (E_RNA) where: Base-Base interactions energy: -363.864 where: short stacking energy: -151.039 Base-Backbone interact. energy: -1.360 local terms energy: -190.291030 where: bonds (distance) C4'-P energy: -39.173 bonds (distance) P-C4' energy: -42.401 flat angles C4'-P-C4' energy: -41.434 flat angles P-C4'-P energy: -29.109 tors. eta vs tors. theta energy: -38.175 Dist. restrs. and SS energy: 0.616 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -545.662414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.662414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.674569 (E_RNA) where: Base-Base interactions energy: -367.723 where: short stacking energy: -152.197 Base-Backbone interact. energy: -0.329 local terms energy: -177.622739 where: bonds (distance) C4'-P energy: -41.893 bonds (distance) P-C4' energy: -35.240 flat angles C4'-P-C4' energy: -33.909 flat angles P-C4'-P energy: -24.674 tors. eta vs tors. theta energy: -41.906 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -508.801649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.801649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.987092 (E_RNA) where: Base-Base interactions energy: -332.945 where: short stacking energy: -154.267 Base-Backbone interact. energy: 0.608 local terms energy: -176.649487 where: bonds (distance) C4'-P energy: -28.931 bonds (distance) P-C4' energy: -42.268 flat angles C4'-P-C4' energy: -40.347 flat angles P-C4'-P energy: -24.528 tors. eta vs tors. theta energy: -40.575 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -504.592605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.592605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.840648 (E_RNA) where: Base-Base interactions energy: -308.122 where: short stacking energy: -146.252 Base-Backbone interact. energy: -0.389 local terms energy: -196.329264 where: bonds (distance) C4'-P energy: -38.843 bonds (distance) P-C4' energy: -37.934 flat angles C4'-P-C4' energy: -44.751 flat angles P-C4'-P energy: -27.471 tors. eta vs tors. theta energy: -47.331 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -416.697441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.697441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.763537 (E_RNA) where: Base-Base interactions energy: -259.407 where: short stacking energy: -111.827 Base-Backbone interact. energy: -0.147 local terms energy: -157.209623 where: bonds (distance) C4'-P energy: -34.242 bonds (distance) P-C4' energy: -32.612 flat angles C4'-P-C4' energy: -37.646 flat angles P-C4'-P energy: -22.013 tors. eta vs tors. theta energy: -30.696 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -433.063241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.063241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.187608 (E_RNA) where: Base-Base interactions energy: -276.399 where: short stacking energy: -125.082 Base-Backbone interact. energy: -1.013 local terms energy: -155.775435 where: bonds (distance) C4'-P energy: -26.241 bonds (distance) P-C4' energy: -35.309 flat angles C4'-P-C4' energy: -39.225 flat angles P-C4'-P energy: -16.993 tors. eta vs tors. theta energy: -38.007 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -430.089743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.089743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.240364 (E_RNA) where: Base-Base interactions energy: -283.551 where: short stacking energy: -119.899 Base-Backbone interact. energy: 2.014 local terms energy: -148.703392 where: bonds (distance) C4'-P energy: -39.921 bonds (distance) P-C4' energy: -38.991 flat angles C4'-P-C4' energy: -29.943 flat angles P-C4'-P energy: -13.909 tors. eta vs tors. theta energy: -25.939 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -302.868780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.868780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.473546 (E_RNA) where: Base-Base interactions energy: -174.193 where: short stacking energy: -81.122 Base-Backbone interact. energy: 0.691 local terms energy: -129.971700 where: bonds (distance) C4'-P energy: -23.445 bonds (distance) P-C4' energy: -28.126 flat angles C4'-P-C4' energy: -38.593 flat angles P-C4'-P energy: -27.616 tors. eta vs tors. theta energy: -12.192 Dist. restrs. and SS energy: 0.605 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -290.108242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.108242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.709815 (E_RNA) where: Base-Base interactions energy: -169.939 where: short stacking energy: -89.174 Base-Backbone interact. energy: -0.380 local terms energy: -120.391225 where: bonds (distance) C4'-P energy: -23.457 bonds (distance) P-C4' energy: -32.718 flat angles C4'-P-C4' energy: -32.875 flat angles P-C4'-P energy: -21.629 tors. eta vs tors. theta energy: -9.711 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -300.799840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.799840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.019821 (E_RNA) where: Base-Base interactions energy: -175.488 where: short stacking energy: -90.085 Base-Backbone interact. energy: -0.111 local terms energy: -125.421266 where: bonds (distance) C4'-P energy: -28.427 bonds (distance) P-C4' energy: -30.584 flat angles C4'-P-C4' energy: -33.645 flat angles P-C4'-P energy: -12.905 tors. eta vs tors. theta energy: -19.861 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -562.071531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.071531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.493893 (E_RNA) where: Base-Base interactions energy: -372.495 where: short stacking energy: -167.721 Base-Backbone interact. energy: -1.983 local terms energy: -188.015731 where: bonds (distance) C4'-P energy: -43.018 bonds (distance) P-C4' energy: -38.799 flat angles C4'-P-C4' energy: -36.798 flat angles P-C4'-P energy: -28.909 tors. eta vs tors. theta energy: -40.492 Dist. restrs. and SS energy: 0.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -542.851881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.851881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.911733 (E_RNA) where: Base-Base interactions energy: -344.992 where: short stacking energy: -167.179 Base-Backbone interact. energy: -0.557 local terms energy: -197.362689 where: bonds (distance) C4'-P energy: -37.741 bonds (distance) P-C4' energy: -38.967 flat angles C4'-P-C4' energy: -43.988 flat angles P-C4'-P energy: -27.638 tors. eta vs tors. theta energy: -49.028 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -525.516823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.516823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.542352 (E_RNA) where: Base-Base interactions energy: -322.545 where: short stacking energy: -153.108 Base-Backbone interact. energy: -0.790 local terms energy: -202.207442 where: bonds (distance) C4'-P energy: -36.551 bonds (distance) P-C4' energy: -40.937 flat angles C4'-P-C4' energy: -42.215 flat angles P-C4'-P energy: -33.366 tors. eta vs tors. theta energy: -49.139 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -486.935384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.935384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.994361 (E_RNA) where: Base-Base interactions energy: -303.557 where: short stacking energy: -137.610 Base-Backbone interact. energy: 0.296 local terms energy: -183.733116 where: bonds (distance) C4'-P energy: -37.256 bonds (distance) P-C4' energy: -40.835 flat angles C4'-P-C4' energy: -40.713 flat angles P-C4'-P energy: -29.940 tors. eta vs tors. theta energy: -34.990 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -431.047660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.047660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.346389 (E_RNA) where: Base-Base interactions energy: -258.493 where: short stacking energy: -118.076 Base-Backbone interact. energy: -1.494 local terms energy: -171.359086 where: bonds (distance) C4'-P energy: -34.202 bonds (distance) P-C4' energy: -37.421 flat angles C4'-P-C4' energy: -42.239 flat angles P-C4'-P energy: -25.884 tors. eta vs tors. theta energy: -31.612 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -411.961360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.961360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.127082 (E_RNA) where: Base-Base interactions energy: -256.223 where: short stacking energy: -132.224 Base-Backbone interact. energy: -0.464 local terms energy: -155.439811 where: bonds (distance) C4'-P energy: -25.088 bonds (distance) P-C4' energy: -35.422 flat angles C4'-P-C4' energy: -36.225 flat angles P-C4'-P energy: -20.330 tors. eta vs tors. theta energy: -38.375 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -414.797269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.797269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.874934 (E_RNA) where: Base-Base interactions energy: -241.501 where: short stacking energy: -106.721 Base-Backbone interact. energy: -0.503 local terms energy: -172.870877 where: bonds (distance) C4'-P energy: -33.966 bonds (distance) P-C4' energy: -43.137 flat angles C4'-P-C4' energy: -38.650 flat angles P-C4'-P energy: -26.506 tors. eta vs tors. theta energy: -30.612 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -343.189294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.189294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.272363 (E_RNA) where: Base-Base interactions energy: -205.073 where: short stacking energy: -84.632 Base-Backbone interact. energy: -0.267 local terms energy: -137.932039 where: bonds (distance) C4'-P energy: -23.912 bonds (distance) P-C4' energy: -40.859 flat angles C4'-P-C4' energy: -33.880 flat angles P-C4'-P energy: -22.611 tors. eta vs tors. theta energy: -16.670 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -349.939199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.939199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.481695 (E_RNA) where: Base-Base interactions energy: -205.022 where: short stacking energy: -105.682 Base-Backbone interact. energy: -0.234 local terms energy: -145.224952 where: bonds (distance) C4'-P energy: -34.693 bonds (distance) P-C4' energy: -26.578 flat angles C4'-P-C4' energy: -40.402 flat angles P-C4'-P energy: -16.871 tors. eta vs tors. theta energy: -26.682 Dist. restrs. and SS energy: 0.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -258.244675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.244675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.024611 (E_RNA) where: Base-Base interactions energy: -143.563 where: short stacking energy: -82.710 Base-Backbone interact. energy: -0.691 local terms energy: -114.770406 where: bonds (distance) C4'-P energy: -24.821 bonds (distance) P-C4' energy: -31.903 flat angles C4'-P-C4' energy: -30.420 flat angles P-C4'-P energy: -17.328 tors. eta vs tors. theta energy: -10.298 Dist. restrs. and SS energy: 0.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -553.090505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.090505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.131401 (E_RNA) where: Base-Base interactions energy: -354.600 where: short stacking energy: -156.464 Base-Backbone interact. energy: -1.269 local terms energy: -198.263271 where: bonds (distance) C4'-P energy: -44.001 bonds (distance) P-C4' energy: -42.693 flat angles C4'-P-C4' energy: -39.081 flat angles P-C4'-P energy: -26.231 tors. eta vs tors. theta energy: -46.257 Dist. restrs. and SS energy: 1.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -528.342398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.342398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.702103 (E_RNA) where: Base-Base interactions energy: -357.218 where: short stacking energy: -136.169 Base-Backbone interact. energy: -0.659 local terms energy: -170.824362 where: bonds (distance) C4'-P energy: -36.192 bonds (distance) P-C4' energy: -38.130 flat angles C4'-P-C4' energy: -39.054 flat angles P-C4'-P energy: -23.794 tors. eta vs tors. theta energy: -33.654 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -523.608519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.608519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.608519 (E_RNA) where: Base-Base interactions energy: -333.596 where: short stacking energy: -153.077 Base-Backbone interact. energy: -0.568 local terms energy: -189.444524 where: bonds (distance) C4'-P energy: -40.317 bonds (distance) P-C4' energy: -39.920 flat angles C4'-P-C4' energy: -32.272 flat angles P-C4'-P energy: -27.151 tors. eta vs tors. theta energy: -49.785 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -470.315597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.315597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.373212 (E_RNA) where: Base-Base interactions energy: -306.908 where: short stacking energy: -132.089 Base-Backbone interact. energy: 0.139 local terms energy: -163.604102 where: bonds (distance) C4'-P energy: -37.690 bonds (distance) P-C4' energy: -35.466 flat angles C4'-P-C4' energy: -40.045 flat angles P-C4'-P energy: -18.204 tors. eta vs tors. theta energy: -32.200 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -454.705722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.705722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.932401 (E_RNA) where: Base-Base interactions energy: -305.666 where: short stacking energy: -134.749 Base-Backbone interact. energy: -0.680 local terms energy: -148.586156 where: bonds (distance) C4'-P energy: -37.422 bonds (distance) P-C4' energy: -34.786 flat angles C4'-P-C4' energy: -30.879 flat angles P-C4'-P energy: -20.577 tors. eta vs tors. theta energy: -24.922 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -438.215878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.215878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.418831 (E_RNA) where: Base-Base interactions energy: -274.464 where: short stacking energy: -141.409 Base-Backbone interact. energy: -0.425 local terms energy: -163.529221 where: bonds (distance) C4'-P energy: -32.880 bonds (distance) P-C4' energy: -32.910 flat angles C4'-P-C4' energy: -29.822 flat angles P-C4'-P energy: -28.189 tors. eta vs tors. theta energy: -39.728 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -402.115225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.115225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.814976 (E_RNA) where: Base-Base interactions energy: -250.449 where: short stacking energy: -113.393 Base-Backbone interact. energy: -0.995 local terms energy: -151.371086 where: bonds (distance) C4'-P energy: -41.322 bonds (distance) P-C4' energy: -34.665 flat angles C4'-P-C4' energy: -33.363 flat angles P-C4'-P energy: -14.269 tors. eta vs tors. theta energy: -27.752 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -327.712101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.712101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.944158 (E_RNA) where: Base-Base interactions energy: -194.066 where: short stacking energy: -81.703 Base-Backbone interact. energy: 4.545 local terms energy: -138.422698 where: bonds (distance) C4'-P energy: -31.697 bonds (distance) P-C4' energy: -37.166 flat angles C4'-P-C4' energy: -28.923 flat angles P-C4'-P energy: -21.076 tors. eta vs tors. theta energy: -19.560 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -341.677571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.677571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.017910 (E_RNA) where: Base-Base interactions energy: -223.339 where: short stacking energy: -89.044 Base-Backbone interact. energy: -0.699 local terms energy: -117.980317 where: bonds (distance) C4'-P energy: -26.873 bonds (distance) P-C4' energy: -30.315 flat angles C4'-P-C4' energy: -26.833 flat angles P-C4'-P energy: -20.037 tors. eta vs tors. theta energy: -13.922 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -231.519534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.519534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.235234 (E_RNA) where: Base-Base interactions energy: -135.825 where: short stacking energy: -68.110 Base-Backbone interact. energy: -0.874 local terms energy: -101.536525 where: bonds (distance) C4'-P energy: -23.730 bonds (distance) P-C4' energy: -24.437 flat angles C4'-P-C4' energy: -30.796 flat angles P-C4'-P energy: -18.389 tors. eta vs tors. theta energy: -4.184 Dist. restrs. and SS energy: 6.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -576.483715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.483715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.651345 (E_RNA) where: Base-Base interactions energy: -385.667 where: short stacking energy: -167.970 Base-Backbone interact. energy: -0.455 local terms energy: -190.529304 where: bonds (distance) C4'-P energy: -35.231 bonds (distance) P-C4' energy: -39.695 flat angles C4'-P-C4' energy: -37.464 flat angles P-C4'-P energy: -25.929 tors. eta vs tors. theta energy: -52.211 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -552.729028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.729028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.798986 (E_RNA) where: Base-Base interactions energy: -347.466 where: short stacking energy: -167.792 Base-Backbone interact. energy: -1.347 local terms energy: -204.985985 where: bonds (distance) C4'-P energy: -43.384 bonds (distance) P-C4' energy: -34.246 flat angles C4'-P-C4' energy: -44.395 flat angles P-C4'-P energy: -35.053 tors. eta vs tors. theta energy: -47.908 Dist. restrs. and SS energy: 1.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -513.922018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.922018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.019404 (E_RNA) where: Base-Base interactions energy: -337.824 where: short stacking energy: -156.486 Base-Backbone interact. energy: -0.271 local terms energy: -175.924075 where: bonds (distance) C4'-P energy: -34.873 bonds (distance) P-C4' energy: -37.709 flat angles C4'-P-C4' energy: -42.418 flat angles P-C4'-P energy: -20.757 tors. eta vs tors. theta energy: -40.167 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -497.287886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.287886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.576202 (E_RNA) where: Base-Base interactions energy: -322.447 where: short stacking energy: -132.787 Base-Backbone interact. energy: -0.935 local terms energy: -174.194755 where: bonds (distance) C4'-P energy: -36.251 bonds (distance) P-C4' energy: -38.066 flat angles C4'-P-C4' energy: -33.858 flat angles P-C4'-P energy: -31.382 tors. eta vs tors. theta energy: -34.638 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -427.379399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.379399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.434241 (E_RNA) where: Base-Base interactions energy: -256.682 where: short stacking energy: -109.344 Base-Backbone interact. energy: -0.240 local terms energy: -170.512618 where: bonds (distance) C4'-P energy: -43.242 bonds (distance) P-C4' energy: -33.251 flat angles C4'-P-C4' energy: -38.579 flat angles P-C4'-P energy: -31.463 tors. eta vs tors. theta energy: -23.978 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -442.373446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.373446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.705042 (E_RNA) where: Base-Base interactions energy: -286.732 where: short stacking energy: -123.636 Base-Backbone interact. energy: -0.572 local terms energy: -155.401440 where: bonds (distance) C4'-P energy: -33.849 bonds (distance) P-C4' energy: -34.124 flat angles C4'-P-C4' energy: -37.004 flat angles P-C4'-P energy: -18.321 tors. eta vs tors. theta energy: -32.103 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -430.034029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.034029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.134010 (E_RNA) where: Base-Base interactions energy: -260.092 where: short stacking energy: -120.236 Base-Backbone interact. energy: -0.615 local terms energy: -169.426355 where: bonds (distance) C4'-P energy: -36.222 bonds (distance) P-C4' energy: -33.930 flat angles C4'-P-C4' energy: -40.386 flat angles P-C4'-P energy: -27.096 tors. eta vs tors. theta energy: -31.793 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -319.259496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.259496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.327653 (E_RNA) where: Base-Base interactions energy: -169.348 where: short stacking energy: -82.990 Base-Backbone interact. energy: 0.306 local terms energy: -150.285708 where: bonds (distance) C4'-P energy: -27.058 bonds (distance) P-C4' energy: -37.612 flat angles C4'-P-C4' energy: -39.076 flat angles P-C4'-P energy: -29.297 tors. eta vs tors. theta energy: -17.243 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -342.611234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.611234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.462692 (E_RNA) where: Base-Base interactions energy: -209.159 where: short stacking energy: -83.142 Base-Backbone interact. energy: -0.886 local terms energy: -135.417252 where: bonds (distance) C4'-P energy: -34.820 bonds (distance) P-C4' energy: -33.360 flat angles C4'-P-C4' energy: -29.076 flat angles P-C4'-P energy: -26.634 tors. eta vs tors. theta energy: -11.528 Dist. restrs. and SS energy: 2.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -275.446267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.446267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.316045 (E_RNA) where: Base-Base interactions energy: -163.358 where: short stacking energy: -89.466 Base-Backbone interact. energy: -0.715 local terms energy: -114.243205 where: bonds (distance) C4'-P energy: -24.400 bonds (distance) P-C4' energy: -32.232 flat angles C4'-P-C4' energy: -23.829 flat angles P-C4'-P energy: -21.380 tors. eta vs tors. theta energy: -12.403 Dist. restrs. and SS energy: 2.870 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -593.109398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.109398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.109398 (E_RNA) where: Base-Base interactions energy: -394.301 where: short stacking energy: -157.887 Base-Backbone interact. energy: -0.295 local terms energy: -198.513492 where: bonds (distance) C4'-P energy: -39.678 bonds (distance) P-C4' energy: -38.101 flat angles C4'-P-C4' energy: -43.311 flat angles P-C4'-P energy: -28.324 tors. eta vs tors. theta energy: -49.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -557.045430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.045430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.617929 (E_RNA) where: Base-Base interactions energy: -367.130 where: short stacking energy: -155.180 Base-Backbone interact. energy: -1.238 local terms energy: -190.249905 where: bonds (distance) C4'-P energy: -38.133 bonds (distance) P-C4' energy: -39.025 flat angles C4'-P-C4' energy: -38.610 flat angles P-C4'-P energy: -33.038 tors. eta vs tors. theta energy: -41.443 Dist. restrs. and SS energy: 1.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -509.618814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.618814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.764887 (E_RNA) where: Base-Base interactions energy: -341.858 where: short stacking energy: -144.905 Base-Backbone interact. energy: 1.120 local terms energy: -169.026961 where: bonds (distance) C4'-P energy: -37.154 bonds (distance) P-C4' energy: -34.786 flat angles C4'-P-C4' energy: -41.255 flat angles P-C4'-P energy: -19.740 tors. eta vs tors. theta energy: -36.092 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -498.073794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.073794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.175071 (E_RNA) where: Base-Base interactions energy: -324.463 where: short stacking energy: -150.276 Base-Backbone interact. energy: -0.329 local terms energy: -173.382840 where: bonds (distance) C4'-P energy: -34.510 bonds (distance) P-C4' energy: -31.882 flat angles C4'-P-C4' energy: -36.968 flat angles P-C4'-P energy: -26.859 tors. eta vs tors. theta energy: -43.164 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -456.788465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.788465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.888674 (E_RNA) where: Base-Base interactions energy: -287.057 where: short stacking energy: -126.876 Base-Backbone interact. energy: 1.022 local terms energy: -170.853587 where: bonds (distance) C4'-P energy: -41.186 bonds (distance) P-C4' energy: -39.533 flat angles C4'-P-C4' energy: -42.522 flat angles P-C4'-P energy: -17.534 tors. eta vs tors. theta energy: -30.078 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -420.383496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.383496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.693607 (E_RNA) where: Base-Base interactions energy: -269.940 where: short stacking energy: -131.947 Base-Backbone interact. energy: 0.012 local terms energy: -150.765660 where: bonds (distance) C4'-P energy: -31.739 bonds (distance) P-C4' energy: -35.906 flat angles C4'-P-C4' energy: -40.270 flat angles P-C4'-P energy: -18.612 tors. eta vs tors. theta energy: -24.238 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -424.270763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.270763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.343455 (E_RNA) where: Base-Base interactions energy: -270.987 where: short stacking energy: -115.337 Base-Backbone interact. energy: -0.112 local terms energy: -153.244706 where: bonds (distance) C4'-P energy: -31.598 bonds (distance) P-C4' energy: -31.729 flat angles C4'-P-C4' energy: -37.955 flat angles P-C4'-P energy: -20.065 tors. eta vs tors. theta energy: -31.897 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -319.822267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.822267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.532187 (E_RNA) where: Base-Base interactions energy: -181.395 where: short stacking energy: -89.883 Base-Backbone interact. energy: 0.449 local terms energy: -139.586172 where: bonds (distance) C4'-P energy: -34.984 bonds (distance) P-C4' energy: -28.582 flat angles C4'-P-C4' energy: -28.770 flat angles P-C4'-P energy: -23.001 tors. eta vs tors. theta energy: -24.249 Dist. restrs. and SS energy: 0.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -339.920688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.920688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.075125 (E_RNA) where: Base-Base interactions energy: -208.386 where: short stacking energy: -84.971 Base-Backbone interact. energy: -0.252 local terms energy: -131.437498 where: bonds (distance) C4'-P energy: -32.935 bonds (distance) P-C4' energy: -36.326 flat angles C4'-P-C4' energy: -34.073 flat angles P-C4'-P energy: -6.904 tors. eta vs tors. theta energy: -21.200 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -261.391267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.391267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.958959 (E_RNA) where: Base-Base interactions energy: -149.652 where: short stacking energy: -73.980 Base-Backbone interact. energy: 0.260 local terms energy: -112.567598 where: bonds (distance) C4'-P energy: -27.719 bonds (distance) P-C4' energy: -33.002 flat angles C4'-P-C4' energy: -28.279 flat angles P-C4'-P energy: -15.045 tors. eta vs tors. theta energy: -8.523 Dist. restrs. and SS energy: 0.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -612.076562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.076562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.117277 (E_RNA) where: Base-Base interactions energy: -413.077 where: short stacking energy: -169.620 Base-Backbone interact. energy: -0.604 local terms energy: -198.436202 where: bonds (distance) C4'-P energy: -38.198 bonds (distance) P-C4' energy: -40.486 flat angles C4'-P-C4' energy: -46.349 flat angles P-C4'-P energy: -20.348 tors. eta vs tors. theta energy: -53.054 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -547.152261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.152261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.015530 (E_RNA) where: Base-Base interactions energy: -364.373 where: short stacking energy: -160.801 Base-Backbone interact. energy: -1.452 local terms energy: -183.190054 where: bonds (distance) C4'-P energy: -32.174 bonds (distance) P-C4' energy: -38.571 flat angles C4'-P-C4' energy: -44.820 flat angles P-C4'-P energy: -24.947 tors. eta vs tors. theta energy: -42.679 Dist. restrs. and SS energy: 1.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -533.801089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.801089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.944286 (E_RNA) where: Base-Base interactions energy: -362.979 where: short stacking energy: -161.532 Base-Backbone interact. energy: 0.618 local terms energy: -171.583743 where: bonds (distance) C4'-P energy: -22.846 bonds (distance) P-C4' energy: -41.128 flat angles C4'-P-C4' energy: -39.077 flat angles P-C4'-P energy: -28.041 tors. eta vs tors. theta energy: -40.491 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -491.376998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.376998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.479302 (E_RNA) where: Base-Base interactions energy: -326.721 where: short stacking energy: -143.361 Base-Backbone interact. energy: -0.286 local terms energy: -164.472800 where: bonds (distance) C4'-P energy: -33.448 bonds (distance) P-C4' energy: -35.336 flat angles C4'-P-C4' energy: -41.211 flat angles P-C4'-P energy: -21.253 tors. eta vs tors. theta energy: -33.225 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -475.569444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.569444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.625790 (E_RNA) where: Base-Base interactions energy: -314.157 where: short stacking energy: -129.368 Base-Backbone interact. energy: -1.541 local terms energy: -159.928184 where: bonds (distance) C4'-P energy: -44.336 bonds (distance) P-C4' energy: -31.995 flat angles C4'-P-C4' energy: -38.992 flat angles P-C4'-P energy: -16.462 tors. eta vs tors. theta energy: -28.143 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -413.548174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.548174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.659244 (E_RNA) where: Base-Base interactions energy: -246.839 where: short stacking energy: -104.268 Base-Backbone interact. energy: -0.744 local terms energy: -166.076704 where: bonds (distance) C4'-P energy: -38.354 bonds (distance) P-C4' energy: -39.279 flat angles C4'-P-C4' energy: -38.935 flat angles P-C4'-P energy: -24.242 tors. eta vs tors. theta energy: -25.266 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -438.977032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.977032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.060129 (E_RNA) where: Base-Base interactions energy: -295.300 where: short stacking energy: -140.267 Base-Backbone interact. energy: 0.677 local terms energy: -144.437273 where: bonds (distance) C4'-P energy: -28.461 bonds (distance) P-C4' energy: -35.188 flat angles C4'-P-C4' energy: -25.502 flat angles P-C4'-P energy: -22.034 tors. eta vs tors. theta energy: -33.252 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -298.209901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.209901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.600554 (E_RNA) where: Base-Base interactions energy: -160.088 where: short stacking energy: -97.096 Base-Backbone interact. energy: -1.316 local terms energy: -137.196762 where: bonds (distance) C4'-P energy: -36.161 bonds (distance) P-C4' energy: -30.019 flat angles C4'-P-C4' energy: -33.013 flat angles P-C4'-P energy: -21.555 tors. eta vs tors. theta energy: -16.450 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -333.834494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.834494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.010995 (E_RNA) where: Base-Base interactions energy: -199.996 where: short stacking energy: -89.931 Base-Backbone interact. energy: -0.640 local terms energy: -133.375387 where: bonds (distance) C4'-P energy: -36.075 bonds (distance) P-C4' energy: -32.947 flat angles C4'-P-C4' energy: -35.627 flat angles P-C4'-P energy: -14.225 tors. eta vs tors. theta energy: -14.501 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -294.855051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.855051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.933642 (E_RNA) where: Base-Base interactions energy: -188.871 where: short stacking energy: -92.361 Base-Backbone interact. energy: -0.869 local terms energy: -105.193871 where: bonds (distance) C4'-P energy: -23.698 bonds (distance) P-C4' energy: -20.361 flat angles C4'-P-C4' energy: -28.281 flat angles P-C4'-P energy: -18.267 tors. eta vs tors. theta energy: -14.587 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -608.423545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.423545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.496484 (E_RNA) where: Base-Base interactions energy: -421.175 where: short stacking energy: -165.475 Base-Backbone interact. energy: -0.187 local terms energy: -187.134845 where: bonds (distance) C4'-P energy: -36.379 bonds (distance) P-C4' energy: -39.667 flat angles C4'-P-C4' energy: -40.913 flat angles P-C4'-P energy: -22.708 tors. eta vs tors. theta energy: -47.467 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -554.530629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.530629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.934678 (E_RNA) where: Base-Base interactions energy: -373.217 where: short stacking energy: -147.004 Base-Backbone interact. energy: -1.227 local terms energy: -180.490472 where: bonds (distance) C4'-P energy: -35.004 bonds (distance) P-C4' energy: -39.650 flat angles C4'-P-C4' energy: -44.853 flat angles P-C4'-P energy: -22.082 tors. eta vs tors. theta energy: -38.902 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -517.727301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.727301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.457779 (E_RNA) where: Base-Base interactions energy: -337.392 where: short stacking energy: -138.361 Base-Backbone interact. energy: -0.519 local terms energy: -180.546629 where: bonds (distance) C4'-P energy: -39.402 bonds (distance) P-C4' energy: -30.179 flat angles C4'-P-C4' energy: -45.776 flat angles P-C4'-P energy: -34.156 tors. eta vs tors. theta energy: -31.033 Dist. restrs. and SS energy: 0.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -475.613620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.613620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.623133 (E_RNA) where: Base-Base interactions energy: -305.271 where: short stacking energy: -138.199 Base-Backbone interact. energy: -1.649 local terms energy: -168.703583 where: bonds (distance) C4'-P energy: -33.591 bonds (distance) P-C4' energy: -33.684 flat angles C4'-P-C4' energy: -36.617 flat angles P-C4'-P energy: -24.024 tors. eta vs tors. theta energy: -40.787 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -461.643998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.643998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.687523 (E_RNA) where: Base-Base interactions energy: -293.439 where: short stacking energy: -122.701 Base-Backbone interact. energy: 1.321 local terms energy: -169.569238 where: bonds (distance) C4'-P energy: -35.706 bonds (distance) P-C4' energy: -31.304 flat angles C4'-P-C4' energy: -40.304 flat angles P-C4'-P energy: -30.213 tors. eta vs tors. theta energy: -32.042 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -428.478241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.478241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.966114 (E_RNA) where: Base-Base interactions energy: -267.734 where: short stacking energy: -127.586 Base-Backbone interact. energy: -1.212 local terms energy: -160.020655 where: bonds (distance) C4'-P energy: -32.683 bonds (distance) P-C4' energy: -25.745 flat angles C4'-P-C4' energy: -34.908 flat angles P-C4'-P energy: -27.884 tors. eta vs tors. theta energy: -38.801 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -389.172536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.172536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.572358 (E_RNA) where: Base-Base interactions energy: -233.347 where: short stacking energy: -111.509 Base-Backbone interact. energy: -0.543 local terms energy: -155.682518 where: bonds (distance) C4'-P energy: -33.585 bonds (distance) P-C4' energy: -35.795 flat angles C4'-P-C4' energy: -34.385 flat angles P-C4'-P energy: -21.243 tors. eta vs tors. theta energy: -30.674 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -356.631119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.631119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.833979 (E_RNA) where: Base-Base interactions energy: -210.486 where: short stacking energy: -95.030 Base-Backbone interact. energy: -0.289 local terms energy: -146.058640 where: bonds (distance) C4'-P energy: -42.669 bonds (distance) P-C4' energy: -35.003 flat angles C4'-P-C4' energy: -31.525 flat angles P-C4'-P energy: -21.035 tors. eta vs tors. theta energy: -15.827 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -297.008259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.008259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.395024 (E_RNA) where: Base-Base interactions energy: -171.053 where: short stacking energy: -85.297 Base-Backbone interact. energy: -0.777 local terms energy: -125.565050 where: bonds (distance) C4'-P energy: -31.985 bonds (distance) P-C4' energy: -36.500 flat angles C4'-P-C4' energy: -29.488 flat angles P-C4'-P energy: -16.442 tors. eta vs tors. theta energy: -11.152 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -285.529306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.529306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.527845 (E_RNA) where: Base-Base interactions energy: -165.782 where: short stacking energy: -88.269 Base-Backbone interact. energy: -0.273 local terms energy: -120.473669 where: bonds (distance) C4'-P energy: -37.245 bonds (distance) P-C4' energy: -12.484 flat angles C4'-P-C4' energy: -29.577 flat angles P-C4'-P energy: -27.524 tors. eta vs tors. theta energy: -13.643 Dist. restrs. and SS energy: 0.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -564.224202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.224202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.232057 (E_RNA) where: Base-Base interactions energy: -371.807 where: short stacking energy: -151.495 Base-Backbone interact. energy: -0.710 local terms energy: -191.715057 where: bonds (distance) C4'-P energy: -32.902 bonds (distance) P-C4' energy: -45.724 flat angles C4'-P-C4' energy: -44.056 flat angles P-C4'-P energy: -28.005 tors. eta vs tors. theta energy: -41.028 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -612.221684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.221684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.500370 (E_RNA) where: Base-Base interactions energy: -413.151 where: short stacking energy: -182.859 Base-Backbone interact. energy: 0.280 local terms energy: -199.629825 where: bonds (distance) C4'-P energy: -44.231 bonds (distance) P-C4' energy: -36.309 flat angles C4'-P-C4' energy: -45.138 flat angles P-C4'-P energy: -21.754 tors. eta vs tors. theta energy: -52.198 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -520.839089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.839089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.186928 (E_RNA) where: Base-Base interactions energy: -338.264 where: short stacking energy: -149.222 Base-Backbone interact. energy: -1.392 local terms energy: -181.531731 where: bonds (distance) C4'-P energy: -34.398 bonds (distance) P-C4' energy: -35.757 flat angles C4'-P-C4' energy: -41.460 flat angles P-C4'-P energy: -30.198 tors. eta vs tors. theta energy: -39.719 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -472.377272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.377272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.428669 (E_RNA) where: Base-Base interactions energy: -302.800 where: short stacking energy: -145.729 Base-Backbone interact. energy: -0.551 local terms energy: -169.078265 where: bonds (distance) C4'-P energy: -34.041 bonds (distance) P-C4' energy: -32.676 flat angles C4'-P-C4' energy: -40.141 flat angles P-C4'-P energy: -23.563 tors. eta vs tors. theta energy: -38.657 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -443.226068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.226068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.720339 (E_RNA) where: Base-Base interactions energy: -269.744 where: short stacking energy: -127.396 Base-Backbone interact. energy: -0.790 local terms energy: -173.186689 where: bonds (distance) C4'-P energy: -39.747 bonds (distance) P-C4' energy: -38.082 flat angles C4'-P-C4' energy: -34.810 flat angles P-C4'-P energy: -27.339 tors. eta vs tors. theta energy: -33.209 Dist. restrs. and SS energy: 0.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -437.596163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.596163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.657831 (E_RNA) where: Base-Base interactions energy: -265.375 where: short stacking energy: -120.170 Base-Backbone interact. energy: -1.059 local terms energy: -171.223207 where: bonds (distance) C4'-P energy: -35.518 bonds (distance) P-C4' energy: -31.485 flat angles C4'-P-C4' energy: -36.179 flat angles P-C4'-P energy: -28.519 tors. eta vs tors. theta energy: -39.522 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -345.643526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.643526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.658604 (E_RNA) where: Base-Base interactions energy: -216.327 where: short stacking energy: -96.040 Base-Backbone interact. energy: 0.770 local terms energy: -130.101705 where: bonds (distance) C4'-P energy: -31.371 bonds (distance) P-C4' energy: -35.679 flat angles C4'-P-C4' energy: -31.346 flat angles P-C4'-P energy: -11.483 tors. eta vs tors. theta energy: -20.222 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -282.344441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.344441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.174040 (E_RNA) where: Base-Base interactions energy: -163.945 where: short stacking energy: -90.849 Base-Backbone interact. energy: -0.342 local terms energy: -118.886953 where: bonds (distance) C4'-P energy: -26.565 bonds (distance) P-C4' energy: -32.657 flat angles C4'-P-C4' energy: -29.753 flat angles P-C4'-P energy: -13.166 tors. eta vs tors. theta energy: -16.746 Dist. restrs. and SS energy: 0.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -284.790195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.790195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.791104 (E_RNA) where: Base-Base interactions energy: -143.716 where: short stacking energy: -66.670 Base-Backbone interact. energy: -0.282 local terms energy: -142.793465 where: bonds (distance) C4'-P energy: -41.110 bonds (distance) P-C4' energy: -33.358 flat angles C4'-P-C4' energy: -34.018 flat angles P-C4'-P energy: -23.451 tors. eta vs tors. theta energy: -10.856 Dist. restrs. and SS energy: 2.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -245.747696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.747696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.203603 (E_RNA) where: Base-Base interactions energy: -127.058 where: short stacking energy: -73.654 Base-Backbone interact. energy: 4.391 local terms energy: -127.536347 where: bonds (distance) C4'-P energy: -35.809 bonds (distance) P-C4' energy: -35.630 flat angles C4'-P-C4' energy: -33.708 flat angles P-C4'-P energy: -13.080 tors. eta vs tors. theta energy: -9.309 Dist. restrs. and SS energy: 4.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -580.299764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.299764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.416383 (E_RNA) where: Base-Base interactions energy: -394.415 where: short stacking energy: -154.159 Base-Backbone interact. energy: -0.740 local terms energy: -185.261734 where: bonds (distance) C4'-P energy: -39.644 bonds (distance) P-C4' energy: -42.678 flat angles C4'-P-C4' energy: -41.014 flat angles P-C4'-P energy: -21.557 tors. eta vs tors. theta energy: -40.369 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -523.274630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.274630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.215997 (E_RNA) where: Base-Base interactions energy: -327.838 where: short stacking energy: -147.332 Base-Backbone interact. energy: -1.449 local terms energy: -194.929516 where: bonds (distance) C4'-P energy: -40.311 bonds (distance) P-C4' energy: -45.258 flat angles C4'-P-C4' energy: -45.558 flat angles P-C4'-P energy: -24.053 tors. eta vs tors. theta energy: -39.751 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -562.402871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.402871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.515824 (E_RNA) where: Base-Base interactions energy: -376.514 where: short stacking energy: -168.196 Base-Backbone interact. energy: -0.629 local terms energy: -185.373188 where: bonds (distance) C4'-P energy: -36.533 bonds (distance) P-C4' energy: -40.707 flat angles C4'-P-C4' energy: -37.634 flat angles P-C4'-P energy: -26.495 tors. eta vs tors. theta energy: -44.004 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -448.819111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.819111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.139648 (E_RNA) where: Base-Base interactions energy: -283.499 where: short stacking energy: -145.288 Base-Backbone interact. energy: -0.125 local terms energy: -165.514893 where: bonds (distance) C4'-P energy: -36.272 bonds (distance) P-C4' energy: -25.865 flat angles C4'-P-C4' energy: -38.882 flat angles P-C4'-P energy: -26.295 tors. eta vs tors. theta energy: -38.201 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -445.011655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.011655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.188745 (E_RNA) where: Base-Base interactions energy: -282.120 where: short stacking energy: -129.409 Base-Backbone interact. energy: -0.317 local terms energy: -162.752474 where: bonds (distance) C4'-P energy: -30.327 bonds (distance) P-C4' energy: -38.247 flat angles C4'-P-C4' energy: -37.550 flat angles P-C4'-P energy: -24.736 tors. eta vs tors. theta energy: -31.892 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -425.850951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.850951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.996389 (E_RNA) where: Base-Base interactions energy: -276.499 where: short stacking energy: -116.348 Base-Backbone interact. energy: -0.517 local terms energy: -148.981032 where: bonds (distance) C4'-P energy: -39.332 bonds (distance) P-C4' energy: -31.269 flat angles C4'-P-C4' energy: -38.705 flat angles P-C4'-P energy: -17.286 tors. eta vs tors. theta energy: -22.389 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -368.813276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.813276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.816475 (E_RNA) where: Base-Base interactions energy: -239.472 where: short stacking energy: -102.582 Base-Backbone interact. energy: 6.624 local terms energy: -135.968071 where: bonds (distance) C4'-P energy: -30.203 bonds (distance) P-C4' energy: -40.519 flat angles C4'-P-C4' energy: -33.118 flat angles P-C4'-P energy: -16.320 tors. eta vs tors. theta energy: -15.808 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -312.098229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.098229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.514988 (E_RNA) where: Base-Base interactions energy: -162.040 where: short stacking energy: -84.804 Base-Backbone interact. energy: 1.575 local terms energy: -152.050488 where: bonds (distance) C4'-P energy: -35.346 bonds (distance) P-C4' energy: -37.032 flat angles C4'-P-C4' energy: -40.072 flat angles P-C4'-P energy: -18.349 tors. eta vs tors. theta energy: -21.251 Dist. restrs. and SS energy: 0.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -304.186498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.186498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.027031 (E_RNA) where: Base-Base interactions energy: -166.611 where: short stacking energy: -79.539 Base-Backbone interact. energy: -0.730 local terms energy: -139.686359 where: bonds (distance) C4'-P energy: -33.500 bonds (distance) P-C4' energy: -32.865 flat angles C4'-P-C4' energy: -33.451 flat angles P-C4'-P energy: -25.317 tors. eta vs tors. theta energy: -14.554 Dist. restrs. and SS energy: 2.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -258.774674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.774674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.526235 (E_RNA) where: Base-Base interactions energy: -137.225 where: short stacking energy: -78.162 Base-Backbone interact. energy: -0.195 local terms energy: -123.106505 where: bonds (distance) C4'-P energy: -32.220 bonds (distance) P-C4' energy: -35.595 flat angles C4'-P-C4' energy: -23.212 flat angles P-C4'-P energy: -24.734 tors. eta vs tors. theta energy: -7.345 Dist. restrs. and SS energy: 1.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -587.914308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.914308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.276300 (E_RNA) where: Base-Base interactions energy: -400.448 where: short stacking energy: -169.344 Base-Backbone interact. energy: -1.560 local terms energy: -186.268222 where: bonds (distance) C4'-P energy: -38.575 bonds (distance) P-C4' energy: -28.627 flat angles C4'-P-C4' energy: -43.562 flat angles P-C4'-P energy: -27.667 tors. eta vs tors. theta energy: -47.838 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -536.721595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.721595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.405121 (E_RNA) where: Base-Base interactions energy: -358.203 where: short stacking energy: -164.381 Base-Backbone interact. energy: 1.145 local terms energy: -180.347127 where: bonds (distance) C4'-P energy: -33.115 bonds (distance) P-C4' energy: -41.402 flat angles C4'-P-C4' energy: -41.019 flat angles P-C4'-P energy: -20.850 tors. eta vs tors. theta energy: -43.961 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -554.779715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.779715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.792735 (E_RNA) where: Base-Base interactions energy: -362.821 where: short stacking energy: -161.545 Base-Backbone interact. energy: -0.387 local terms energy: -191.584737 where: bonds (distance) C4'-P energy: -37.671 bonds (distance) P-C4' energy: -33.245 flat angles C4'-P-C4' energy: -41.143 flat angles P-C4'-P energy: -28.580 tors. eta vs tors. theta energy: -50.945 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -438.109059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.109059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.171737 (E_RNA) where: Base-Base interactions energy: -262.641 where: short stacking energy: -132.302 Base-Backbone interact. energy: -0.057 local terms energy: -175.473463 where: bonds (distance) C4'-P energy: -41.782 bonds (distance) P-C4' energy: -37.025 flat angles C4'-P-C4' energy: -39.054 flat angles P-C4'-P energy: -19.696 tors. eta vs tors. theta energy: -37.917 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -448.816191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.816191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.938270 (E_RNA) where: Base-Base interactions energy: -276.791 where: short stacking energy: -136.448 Base-Backbone interact. energy: -1.111 local terms energy: -171.036532 where: bonds (distance) C4'-P energy: -30.820 bonds (distance) P-C4' energy: -38.095 flat angles C4'-P-C4' energy: -38.490 flat angles P-C4'-P energy: -27.465 tors. eta vs tors. theta energy: -36.167 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -418.786061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.786061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.910375 (E_RNA) where: Base-Base interactions energy: -255.774 where: short stacking energy: -125.073 Base-Backbone interact. energy: -0.195 local terms energy: -162.941990 where: bonds (distance) C4'-P energy: -27.145 bonds (distance) P-C4' energy: -42.169 flat angles C4'-P-C4' energy: -41.190 flat angles P-C4'-P energy: -20.931 tors. eta vs tors. theta energy: -31.508 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -352.334639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.334639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.479971 (E_RNA) where: Base-Base interactions energy: -201.691 where: short stacking energy: -99.055 Base-Backbone interact. energy: -3.421 local terms energy: -147.367888 where: bonds (distance) C4'-P energy: -32.798 bonds (distance) P-C4' energy: -41.176 flat angles C4'-P-C4' energy: -22.693 flat angles P-C4'-P energy: -25.430 tors. eta vs tors. theta energy: -25.271 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -339.003583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.003583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.214926 (E_RNA) where: Base-Base interactions energy: -199.112 where: short stacking energy: -88.149 Base-Backbone interact. energy: -0.353 local terms energy: -139.749261 where: bonds (distance) C4'-P energy: -37.320 bonds (distance) P-C4' energy: -40.525 flat angles C4'-P-C4' energy: -31.783 flat angles P-C4'-P energy: -13.939 tors. eta vs tors. theta energy: -16.182 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -271.429559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.429559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.303004 (E_RNA) where: Base-Base interactions energy: -164.684 where: short stacking energy: -67.760 Base-Backbone interact. energy: 0.387 local terms energy: -108.005437 where: bonds (distance) C4'-P energy: -27.565 bonds (distance) P-C4' energy: -35.072 flat angles C4'-P-C4' energy: -22.660 flat angles P-C4'-P energy: -19.144 tors. eta vs tors. theta energy: -3.565 Dist. restrs. and SS energy: 0.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -279.547418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.547418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.902436 (E_RNA) where: Base-Base interactions energy: -160.288 where: short stacking energy: -84.091 Base-Backbone interact. energy: 0.001 local terms energy: -122.615848 where: bonds (distance) C4'-P energy: -28.951 bonds (distance) P-C4' energy: -30.389 flat angles C4'-P-C4' energy: -33.989 flat angles P-C4'-P energy: -20.648 tors. eta vs tors. theta energy: -8.638 Dist. restrs. and SS energy: 3.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -583.673251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.673251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.708941 (E_RNA) where: Base-Base interactions energy: -383.436 where: short stacking energy: -156.623 Base-Backbone interact. energy: 0.115 local terms energy: -200.387970 where: bonds (distance) C4'-P energy: -42.995 bonds (distance) P-C4' energy: -44.677 flat angles C4'-P-C4' energy: -41.811 flat angles P-C4'-P energy: -27.084 tors. eta vs tors. theta energy: -43.821 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -554.341739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.341739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.414431 (E_RNA) where: Base-Base interactions energy: -363.659 where: short stacking energy: -158.085 Base-Backbone interact. energy: -0.901 local terms energy: -189.854495 where: bonds (distance) C4'-P energy: -39.195 bonds (distance) P-C4' energy: -39.978 flat angles C4'-P-C4' energy: -44.575 flat angles P-C4'-P energy: -21.629 tors. eta vs tors. theta energy: -44.478 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -517.982809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.982809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.851032 (E_RNA) where: Base-Base interactions energy: -328.139 where: short stacking energy: -148.958 Base-Backbone interact. energy: -1.076 local terms energy: -189.635836 where: bonds (distance) C4'-P energy: -35.522 bonds (distance) P-C4' energy: -43.845 flat angles C4'-P-C4' energy: -35.888 flat angles P-C4'-P energy: -31.808 tors. eta vs tors. theta energy: -42.573 Dist. restrs. and SS energy: 0.868 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -479.901606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.901606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.942198 (E_RNA) where: Base-Base interactions energy: -291.836 where: short stacking energy: -143.563 Base-Backbone interact. energy: -0.144 local terms energy: -187.962296 where: bonds (distance) C4'-P energy: -42.161 bonds (distance) P-C4' energy: -43.831 flat angles C4'-P-C4' energy: -40.987 flat angles P-C4'-P energy: -18.520 tors. eta vs tors. theta energy: -42.465 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -448.167751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.167751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.441029 (E_RNA) where: Base-Base interactions energy: -284.025 where: short stacking energy: -122.609 Base-Backbone interact. energy: -0.391 local terms energy: -164.025847 where: bonds (distance) C4'-P energy: -35.573 bonds (distance) P-C4' energy: -38.852 flat angles C4'-P-C4' energy: -37.043 flat angles P-C4'-P energy: -20.149 tors. eta vs tors. theta energy: -32.409 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -423.156316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.156316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.171117 (E_RNA) where: Base-Base interactions energy: -251.272 where: short stacking energy: -113.159 Base-Backbone interact. energy: -1.456 local terms energy: -170.443531 where: bonds (distance) C4'-P energy: -37.293 bonds (distance) P-C4' energy: -42.764 flat angles C4'-P-C4' energy: -35.937 flat angles P-C4'-P energy: -23.860 tors. eta vs tors. theta energy: -30.589 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -357.343720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.343720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.718871 (E_RNA) where: Base-Base interactions energy: -218.703 where: short stacking energy: -75.088 Base-Backbone interact. energy: 1.261 local terms energy: -140.276459 where: bonds (distance) C4'-P energy: -37.738 bonds (distance) P-C4' energy: -41.643 flat angles C4'-P-C4' energy: -30.412 flat angles P-C4'-P energy: -16.244 tors. eta vs tors. theta energy: -14.240 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -349.822378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.822378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.829794 (E_RNA) where: Base-Base interactions energy: -209.083 where: short stacking energy: -106.090 Base-Backbone interact. energy: 1.824 local terms energy: -142.571034 where: bonds (distance) C4'-P energy: -34.538 bonds (distance) P-C4' energy: -37.687 flat angles C4'-P-C4' energy: -28.890 flat angles P-C4'-P energy: -20.287 tors. eta vs tors. theta energy: -21.168 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -272.413186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.413186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.172409 (E_RNA) where: Base-Base interactions energy: -140.728 where: short stacking energy: -70.563 Base-Backbone interact. energy: -1.241 local terms energy: -131.203709 where: bonds (distance) C4'-P energy: -35.467 bonds (distance) P-C4' energy: -35.413 flat angles C4'-P-C4' energy: -24.175 flat angles P-C4'-P energy: -18.942 tors. eta vs tors. theta energy: -17.207 Dist. restrs. and SS energy: 0.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -282.353576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.353576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.570661 (E_RNA) where: Base-Base interactions energy: -182.061 where: short stacking energy: -82.369 Base-Backbone interact. energy: 1.588 local terms energy: -102.097718 where: bonds (distance) C4'-P energy: -22.113 bonds (distance) P-C4' energy: -30.535 flat angles C4'-P-C4' energy: -31.267 flat angles P-C4'-P energy: -10.119 tors. eta vs tors. theta energy: -8.064 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -569.484651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.484651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.623247 (E_RNA) where: Base-Base interactions energy: -376.523 where: short stacking energy: -147.768 Base-Backbone interact. energy: -0.765 local terms energy: -192.334761 where: bonds (distance) C4'-P energy: -40.949 bonds (distance) P-C4' energy: -43.946 flat angles C4'-P-C4' energy: -37.489 flat angles P-C4'-P energy: -27.227 tors. eta vs tors. theta energy: -42.724 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -573.165430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.165430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.265251 (E_RNA) where: Base-Base interactions energy: -379.030 where: short stacking energy: -161.438 Base-Backbone interact. energy: -0.001 local terms energy: -194.234264 where: bonds (distance) C4'-P energy: -41.391 bonds (distance) P-C4' energy: -39.340 flat angles C4'-P-C4' energy: -38.041 flat angles P-C4'-P energy: -28.784 tors. eta vs tors. theta energy: -46.678 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -523.273248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.273248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.663020 (E_RNA) where: Base-Base interactions energy: -333.335 where: short stacking energy: -146.698 Base-Backbone interact. energy: -2.070 local terms energy: -189.257604 where: bonds (distance) C4'-P energy: -43.599 bonds (distance) P-C4' energy: -31.397 flat angles C4'-P-C4' energy: -47.158 flat angles P-C4'-P energy: -27.939 tors. eta vs tors. theta energy: -39.164 Dist. restrs. and SS energy: 1.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -471.426786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.426786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.484481 (E_RNA) where: Base-Base interactions energy: -297.688 where: short stacking energy: -129.699 Base-Backbone interact. energy: 1.031 local terms energy: -174.828143 where: bonds (distance) C4'-P energy: -37.862 bonds (distance) P-C4' energy: -37.343 flat angles C4'-P-C4' energy: -43.023 flat angles P-C4'-P energy: -28.948 tors. eta vs tors. theta energy: -27.652 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -466.037785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.037785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.219518 (E_RNA) where: Base-Base interactions energy: -296.700 where: short stacking energy: -125.578 Base-Backbone interact. energy: -0.784 local terms energy: -168.735129 where: bonds (distance) C4'-P energy: -36.971 bonds (distance) P-C4' energy: -35.578 flat angles C4'-P-C4' energy: -34.559 flat angles P-C4'-P energy: -26.738 tors. eta vs tors. theta energy: -34.889 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -419.116171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.116171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.256932 (E_RNA) where: Base-Base interactions energy: -261.560 where: short stacking energy: -116.006 Base-Backbone interact. energy: -2.310 local terms energy: -155.386897 where: bonds (distance) C4'-P energy: -33.753 bonds (distance) P-C4' energy: -29.948 flat angles C4'-P-C4' energy: -40.187 flat angles P-C4'-P energy: -19.874 tors. eta vs tors. theta energy: -31.626 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -353.221648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.221648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.380689 (E_RNA) where: Base-Base interactions energy: -225.088 where: short stacking energy: -102.964 Base-Backbone interact. energy: 1.481 local terms energy: -129.773665 where: bonds (distance) C4'-P energy: -30.996 bonds (distance) P-C4' energy: -35.367 flat angles C4'-P-C4' energy: -31.237 flat angles P-C4'-P energy: -16.623 tors. eta vs tors. theta energy: -15.550 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -352.762018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.762018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.165696 (E_RNA) where: Base-Base interactions energy: -218.240 where: short stacking energy: -98.913 Base-Backbone interact. energy: -0.571 local terms energy: -134.354919 where: bonds (distance) C4'-P energy: -28.119 bonds (distance) P-C4' energy: -33.118 flat angles C4'-P-C4' energy: -27.800 flat angles P-C4'-P energy: -28.829 tors. eta vs tors. theta energy: -16.488 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -314.058109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.058109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.163062 (E_RNA) where: Base-Base interactions energy: -179.976 where: short stacking energy: -80.108 Base-Backbone interact. energy: -0.429 local terms energy: -133.758105 where: bonds (distance) C4'-P energy: -33.655 bonds (distance) P-C4' energy: -36.577 flat angles C4'-P-C4' energy: -30.460 flat angles P-C4'-P energy: -23.152 tors. eta vs tors. theta energy: -9.915 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -271.488743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.488743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.986163 (E_RNA) where: Base-Base interactions energy: -151.328 where: short stacking energy: -87.256 Base-Backbone interact. energy: -1.005 local terms energy: -119.652639 where: bonds (distance) C4'-P energy: -26.678 bonds (distance) P-C4' energy: -34.605 flat angles C4'-P-C4' energy: -19.659 flat angles P-C4'-P energy: -25.788 tors. eta vs tors. theta energy: -12.923 Dist. restrs. and SS energy: 0.497 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -568.749602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.749602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.942386 (E_RNA) where: Base-Base interactions energy: -374.374 where: short stacking energy: -168.804 Base-Backbone interact. energy: -1.138 local terms energy: -193.430372 where: bonds (distance) C4'-P energy: -36.292 bonds (distance) P-C4' energy: -31.393 flat angles C4'-P-C4' energy: -42.536 flat angles P-C4'-P energy: -33.241 tors. eta vs tors. theta energy: -49.968 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -587.873162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.873162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.033625 (E_RNA) where: Base-Base interactions energy: -396.386 where: short stacking energy: -173.408 Base-Backbone interact. energy: -0.900 local terms energy: -190.747342 where: bonds (distance) C4'-P energy: -40.908 bonds (distance) P-C4' energy: -38.555 flat angles C4'-P-C4' energy: -42.055 flat angles P-C4'-P energy: -23.399 tors. eta vs tors. theta energy: -45.830 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -517.509561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.509561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.136135 (E_RNA) where: Base-Base interactions energy: -348.426 where: short stacking energy: -161.395 Base-Backbone interact. energy: -0.622 local terms energy: -169.088329 where: bonds (distance) C4'-P energy: -39.870 bonds (distance) P-C4' energy: -36.117 flat angles C4'-P-C4' energy: -38.783 flat angles P-C4'-P energy: -18.389 tors. eta vs tors. theta energy: -35.928 Dist. restrs. and SS energy: 0.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -486.394448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.394448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.009931 (E_RNA) where: Base-Base interactions energy: -295.528 where: short stacking energy: -153.529 Base-Backbone interact. energy: 0.269 local terms energy: -191.750900 where: bonds (distance) C4'-P energy: -43.038 bonds (distance) P-C4' energy: -35.817 flat angles C4'-P-C4' energy: -41.875 flat angles P-C4'-P energy: -27.275 tors. eta vs tors. theta energy: -43.747 Dist. restrs. and SS energy: 0.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -422.298047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.298047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.565592 (E_RNA) where: Base-Base interactions energy: -266.878 where: short stacking energy: -119.251 Base-Backbone interact. energy: 3.339 local terms energy: -159.026495 where: bonds (distance) C4'-P energy: -28.936 bonds (distance) P-C4' energy: -41.753 flat angles C4'-P-C4' energy: -41.215 flat angles P-C4'-P energy: -23.692 tors. eta vs tors. theta energy: -23.430 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -460.486953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.486953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.532670 (E_RNA) where: Base-Base interactions energy: -294.519 where: short stacking energy: -142.897 Base-Backbone interact. energy: -1.295 local terms energy: -164.719475 where: bonds (distance) C4'-P energy: -36.620 bonds (distance) P-C4' energy: -42.924 flat angles C4'-P-C4' energy: -28.705 flat angles P-C4'-P energy: -22.180 tors. eta vs tors. theta energy: -34.291 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -347.354214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.354214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.501195 (E_RNA) where: Base-Base interactions energy: -202.092 where: short stacking energy: -99.217 Base-Backbone interact. energy: -1.773 local terms energy: -143.636789 where: bonds (distance) C4'-P energy: -29.525 bonds (distance) P-C4' energy: -33.506 flat angles C4'-P-C4' energy: -36.683 flat angles P-C4'-P energy: -23.751 tors. eta vs tors. theta energy: -20.172 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -308.605194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.605194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.001108 (E_RNA) where: Base-Base interactions energy: -182.246 where: short stacking energy: -88.383 Base-Backbone interact. energy: -0.434 local terms energy: -126.320877 where: bonds (distance) C4'-P energy: -23.045 bonds (distance) P-C4' energy: -40.177 flat angles C4'-P-C4' energy: -28.186 flat angles P-C4'-P energy: -17.182 tors. eta vs tors. theta energy: -17.731 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -295.820798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.820798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.224335 (E_RNA) where: Base-Base interactions energy: -185.916 where: short stacking energy: -95.141 Base-Backbone interact. energy: -0.272 local terms energy: -110.036558 where: bonds (distance) C4'-P energy: -32.514 bonds (distance) P-C4' energy: -34.295 flat angles C4'-P-C4' energy: -31.156 flat angles P-C4'-P energy: -3.956 tors. eta vs tors. theta energy: -8.115 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -276.621426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.621426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.312952 (E_RNA) where: Base-Base interactions energy: -156.414 where: short stacking energy: -74.834 Base-Backbone interact. energy: -0.574 local terms energy: -122.325463 where: bonds (distance) C4'-P energy: -33.223 bonds (distance) P-C4' energy: -34.641 flat angles C4'-P-C4' energy: -30.731 flat angles P-C4'-P energy: -16.490 tors. eta vs tors. theta energy: -7.241 Dist. restrs. and SS energy: 2.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -577.273333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.273333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.904455 (E_RNA) where: Base-Base interactions energy: -378.610 where: short stacking energy: -178.418 Base-Backbone interact. energy: -0.346 local terms energy: -199.948000 where: bonds (distance) C4'-P energy: -33.033 bonds (distance) P-C4' energy: -39.779 flat angles C4'-P-C4' energy: -47.634 flat angles P-C4'-P energy: -23.624 tors. eta vs tors. theta energy: -55.878 Dist. restrs. and SS energy: 1.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -587.127707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.127707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.113252 (E_RNA) where: Base-Base interactions energy: -408.227 where: short stacking energy: -170.983 Base-Backbone interact. energy: 1.607 local terms energy: -181.493527 where: bonds (distance) C4'-P energy: -38.204 bonds (distance) P-C4' energy: -37.092 flat angles C4'-P-C4' energy: -36.204 flat angles P-C4'-P energy: -32.613 tors. eta vs tors. theta energy: -37.381 Dist. restrs. and SS energy: 0.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -518.396747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.396747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.976287 (E_RNA) where: Base-Base interactions energy: -335.116 where: short stacking energy: -141.056 Base-Backbone interact. energy: -1.135 local terms energy: -182.724847 where: bonds (distance) C4'-P energy: -40.008 bonds (distance) P-C4' energy: -38.827 flat angles C4'-P-C4' energy: -45.628 flat angles P-C4'-P energy: -26.354 tors. eta vs tors. theta energy: -31.907 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -460.213096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.213096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.308520 (E_RNA) where: Base-Base interactions energy: -284.201 where: short stacking energy: -133.993 Base-Backbone interact. energy: -0.075 local terms energy: -176.031981 where: bonds (distance) C4'-P energy: -41.740 bonds (distance) P-C4' energy: -38.325 flat angles C4'-P-C4' energy: -40.162 flat angles P-C4'-P energy: -21.631 tors. eta vs tors. theta energy: -34.173 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -448.742349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.742349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.093560 (E_RNA) where: Base-Base interactions energy: -276.939 where: short stacking energy: -138.179 Base-Backbone interact. energy: -0.263 local terms energy: -171.891810 where: bonds (distance) C4'-P energy: -40.450 bonds (distance) P-C4' energy: -29.044 flat angles C4'-P-C4' energy: -42.986 flat angles P-C4'-P energy: -24.816 tors. eta vs tors. theta energy: -34.596 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -427.323790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.323790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.372034 (E_RNA) where: Base-Base interactions energy: -269.723 where: short stacking energy: -131.073 Base-Backbone interact. energy: -0.732 local terms energy: -156.917083 where: bonds (distance) C4'-P energy: -30.591 bonds (distance) P-C4' energy: -29.719 flat angles C4'-P-C4' energy: -39.804 flat angles P-C4'-P energy: -27.210 tors. eta vs tors. theta energy: -29.594 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -390.195849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.195849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.228653 (E_RNA) where: Base-Base interactions energy: -236.127 where: short stacking energy: -118.762 Base-Backbone interact. energy: -1.471 local terms energy: -152.630705 where: bonds (distance) C4'-P energy: -37.216 bonds (distance) P-C4' energy: -31.412 flat angles C4'-P-C4' energy: -36.094 flat angles P-C4'-P energy: -18.962 tors. eta vs tors. theta energy: -28.946 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -363.143622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.143622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.640015 (E_RNA) where: Base-Base interactions energy: -211.112 where: short stacking energy: -103.341 Base-Backbone interact. energy: -0.410 local terms energy: -152.118717 where: bonds (distance) C4'-P energy: -32.741 bonds (distance) P-C4' energy: -40.076 flat angles C4'-P-C4' energy: -36.227 flat angles P-C4'-P energy: -19.552 tors. eta vs tors. theta energy: -23.524 Dist. restrs. and SS energy: 0.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -322.850681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.850681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.180015 (E_RNA) where: Base-Base interactions energy: -198.333 where: short stacking energy: -88.739 Base-Backbone interact. energy: -1.436 local terms energy: -123.411658 where: bonds (distance) C4'-P energy: -27.446 bonds (distance) P-C4' energy: -27.764 flat angles C4'-P-C4' energy: -38.011 flat angles P-C4'-P energy: -20.103 tors. eta vs tors. theta energy: -10.087 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -283.933015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.933015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.012158 (E_RNA) where: Base-Base interactions energy: -160.519 where: short stacking energy: -73.472 Base-Backbone interact. energy: 1.794 local terms energy: -125.287172 where: bonds (distance) C4'-P energy: -27.208 bonds (distance) P-C4' energy: -32.946 flat angles C4'-P-C4' energy: -37.674 flat angles P-C4'-P energy: -14.463 tors. eta vs tors. theta energy: -12.995 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -579.396582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.396582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.231871 (E_RNA) where: Base-Base interactions energy: -385.117 where: short stacking energy: -177.367 Base-Backbone interact. energy: -0.495 local terms energy: -196.620565 where: bonds (distance) C4'-P energy: -39.998 bonds (distance) P-C4' energy: -33.723 flat angles C4'-P-C4' energy: -41.719 flat angles P-C4'-P energy: -28.934 tors. eta vs tors. theta energy: -52.247 Dist. restrs. and SS energy: 2.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -579.078953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.078953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.202049 (E_RNA) where: Base-Base interactions energy: -398.157 where: short stacking energy: -162.097 Base-Backbone interact. energy: 0.353 local terms energy: -183.397493 where: bonds (distance) C4'-P energy: -38.524 bonds (distance) P-C4' energy: -34.643 flat angles C4'-P-C4' energy: -42.438 flat angles P-C4'-P energy: -27.462 tors. eta vs tors. theta energy: -40.331 Dist. restrs. and SS energy: 2.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -523.151029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.151029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.637587 (E_RNA) where: Base-Base interactions energy: -349.896 where: short stacking energy: -151.619 Base-Backbone interact. energy: 0.685 local terms energy: -175.426597 where: bonds (distance) C4'-P energy: -39.085 bonds (distance) P-C4' energy: -32.692 flat angles C4'-P-C4' energy: -39.672 flat angles P-C4'-P energy: -27.899 tors. eta vs tors. theta energy: -36.078 Dist. restrs. and SS energy: 1.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -465.707471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.707471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.998057 (E_RNA) where: Base-Base interactions energy: -276.505 where: short stacking energy: -142.704 Base-Backbone interact. energy: -0.649 local terms energy: -188.844668 where: bonds (distance) C4'-P energy: -33.174 bonds (distance) P-C4' energy: -43.974 flat angles C4'-P-C4' energy: -45.077 flat angles P-C4'-P energy: -25.403 tors. eta vs tors. theta energy: -41.216 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -445.415144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.415144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.472328 (E_RNA) where: Base-Base interactions energy: -277.550 where: short stacking energy: -112.191 Base-Backbone interact. energy: -1.404 local terms energy: -166.517883 where: bonds (distance) C4'-P energy: -42.115 bonds (distance) P-C4' energy: -34.563 flat angles C4'-P-C4' energy: -37.524 flat angles P-C4'-P energy: -25.081 tors. eta vs tors. theta energy: -27.235 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -346.268644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.268644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.730434 (E_RNA) where: Base-Base interactions energy: -197.715 where: short stacking energy: -99.986 Base-Backbone interact. energy: -0.719 local terms energy: -149.295497 where: bonds (distance) C4'-P energy: -33.911 bonds (distance) P-C4' energy: -30.818 flat angles C4'-P-C4' energy: -31.778 flat angles P-C4'-P energy: -24.757 tors. eta vs tors. theta energy: -28.031 Dist. restrs. and SS energy: 1.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -434.424492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.424492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.824423 (E_RNA) where: Base-Base interactions energy: -282.419 where: short stacking energy: -139.397 Base-Backbone interact. energy: -0.110 local terms energy: -152.295514 where: bonds (distance) C4'-P energy: -33.895 bonds (distance) P-C4' energy: -26.303 flat angles C4'-P-C4' energy: -33.586 flat angles P-C4'-P energy: -25.256 tors. eta vs tors. theta energy: -33.256 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -319.057512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.057512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.139852 (E_RNA) where: Base-Base interactions energy: -172.427 where: short stacking energy: -81.016 Base-Backbone interact. energy: 0.554 local terms energy: -147.267159 where: bonds (distance) C4'-P energy: -31.798 bonds (distance) P-C4' energy: -37.164 flat angles C4'-P-C4' energy: -36.902 flat angles P-C4'-P energy: -25.735 tors. eta vs tors. theta energy: -15.669 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -353.008460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.008460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.658117 (E_RNA) where: Base-Base interactions energy: -234.880 where: short stacking energy: -116.371 Base-Backbone interact. energy: -1.649 local terms energy: -117.128941 where: bonds (distance) C4'-P energy: -24.750 bonds (distance) P-C4' energy: -31.883 flat angles C4'-P-C4' energy: -20.058 flat angles P-C4'-P energy: -16.722 tors. eta vs tors. theta energy: -23.716 Dist. restrs. and SS energy: 0.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -253.498199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.498199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.471253 (E_RNA) where: Base-Base interactions energy: -147.917 where: short stacking energy: -75.593 Base-Backbone interact. energy: -0.350 local terms energy: -106.203810 where: bonds (distance) C4'-P energy: -29.656 bonds (distance) P-C4' energy: -29.160 flat angles C4'-P-C4' energy: -27.594 flat angles P-C4'-P energy: -17.619 tors. eta vs tors. theta energy: -2.175 Dist. restrs. and SS energy: 0.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -595.800763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.800763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.064740 (E_RNA) where: Base-Base interactions energy: -405.854 where: short stacking energy: -169.121 Base-Backbone interact. energy: -1.327 local terms energy: -188.883322 where: bonds (distance) C4'-P energy: -37.221 bonds (distance) P-C4' energy: -39.324 flat angles C4'-P-C4' energy: -37.182 flat angles P-C4'-P energy: -25.705 tors. eta vs tors. theta energy: -49.452 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -601.079086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.079086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.018756 (E_RNA) where: Base-Base interactions energy: -396.427 where: short stacking energy: -183.342 Base-Backbone interact. energy: -0.915 local terms energy: -205.676790 where: bonds (distance) C4'-P energy: -39.583 bonds (distance) P-C4' energy: -38.783 flat angles C4'-P-C4' energy: -43.615 flat angles P-C4'-P energy: -28.374 tors. eta vs tors. theta energy: -55.321 Dist. restrs. and SS energy: 1.940 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -478.835651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.835651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.973406 (E_RNA) where: Base-Base interactions energy: -302.941 where: short stacking energy: -140.238 Base-Backbone interact. energy: -0.418 local terms energy: -175.614920 where: bonds (distance) C4'-P energy: -39.167 bonds (distance) P-C4' energy: -31.613 flat angles C4'-P-C4' energy: -43.292 flat angles P-C4'-P energy: -25.756 tors. eta vs tors. theta energy: -35.786 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -518.495252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.495252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.390503 (E_RNA) where: Base-Base interactions energy: -330.626 where: short stacking energy: -130.473 Base-Backbone interact. energy: -2.327 local terms energy: -186.437497 where: bonds (distance) C4'-P energy: -42.038 bonds (distance) P-C4' energy: -41.467 flat angles C4'-P-C4' energy: -44.460 flat angles P-C4'-P energy: -21.760 tors. eta vs tors. theta energy: -36.713 Dist. restrs. and SS energy: 0.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -386.531912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.531912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.893907 (E_RNA) where: Base-Base interactions energy: -230.390 where: short stacking energy: -105.720 Base-Backbone interact. energy: -0.816 local terms energy: -156.687566 where: bonds (distance) C4'-P energy: -31.559 bonds (distance) P-C4' energy: -30.029 flat angles C4'-P-C4' energy: -38.182 flat angles P-C4'-P energy: -27.213 tors. eta vs tors. theta energy: -29.704 Dist. restrs. and SS energy: 1.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -437.096906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.096906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.317605 (E_RNA) where: Base-Base interactions energy: -280.628 where: short stacking energy: -120.749 Base-Backbone interact. energy: 0.106 local terms energy: -156.795123 where: bonds (distance) C4'-P energy: -32.519 bonds (distance) P-C4' energy: -33.582 flat angles C4'-P-C4' energy: -35.549 flat angles P-C4'-P energy: -23.082 tors. eta vs tors. theta energy: -32.064 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -412.008904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.008904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.135223 (E_RNA) where: Base-Base interactions energy: -256.057 where: short stacking energy: -114.712 Base-Backbone interact. energy: -1.100 local terms energy: -154.978548 where: bonds (distance) C4'-P energy: -33.833 bonds (distance) P-C4' energy: -30.706 flat angles C4'-P-C4' energy: -39.159 flat angles P-C4'-P energy: -25.359 tors. eta vs tors. theta energy: -25.922 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -311.650478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.650478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.744217 (E_RNA) where: Base-Base interactions energy: -167.058 where: short stacking energy: -77.604 Base-Backbone interact. energy: -0.168 local terms energy: -144.517584 where: bonds (distance) C4'-P energy: -34.530 bonds (distance) P-C4' energy: -36.444 flat angles C4'-P-C4' energy: -40.223 flat angles P-C4'-P energy: -17.624 tors. eta vs tors. theta energy: -15.697 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -318.566323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.566323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.114846 (E_RNA) where: Base-Base interactions energy: -169.216 where: short stacking energy: -80.026 Base-Backbone interact. energy: -0.537 local terms energy: -149.362453 where: bonds (distance) C4'-P energy: -42.432 bonds (distance) P-C4' energy: -45.124 flat angles C4'-P-C4' energy: -37.014 flat angles P-C4'-P energy: -9.928 tors. eta vs tors. theta energy: -14.864 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -276.961323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.961323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.997364 (E_RNA) where: Base-Base interactions energy: -160.312 where: short stacking energy: -69.749 Base-Backbone interact. energy: -0.148 local terms energy: -117.537474 where: bonds (distance) C4'-P energy: -29.549 bonds (distance) P-C4' energy: -30.157 flat angles C4'-P-C4' energy: -32.887 flat angles P-C4'-P energy: -19.566 tors. eta vs tors. theta energy: -5.378 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -593.970166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.970166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.233176 (E_RNA) where: Base-Base interactions energy: -405.213 where: short stacking energy: -188.997 Base-Backbone interact. energy: -1.797 local terms energy: -187.222393 where: bonds (distance) C4'-P energy: -34.570 bonds (distance) P-C4' energy: -28.920 flat angles C4'-P-C4' energy: -44.915 flat angles P-C4'-P energy: -28.363 tors. eta vs tors. theta energy: -50.454 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -586.467156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.467156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.552392 (E_RNA) where: Base-Base interactions energy: -388.869 where: short stacking energy: -171.777 Base-Backbone interact. energy: -1.219 local terms energy: -197.464107 where: bonds (distance) C4'-P energy: -43.024 bonds (distance) P-C4' energy: -43.782 flat angles C4'-P-C4' energy: -37.295 flat angles P-C4'-P energy: -29.002 tors. eta vs tors. theta energy: -44.362 Dist. restrs. and SS energy: 1.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -506.572324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.572324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.678890 (E_RNA) where: Base-Base interactions energy: -327.701 where: short stacking energy: -134.721 Base-Backbone interact. energy: -0.402 local terms energy: -178.575194 where: bonds (distance) C4'-P energy: -38.308 bonds (distance) P-C4' energy: -40.197 flat angles C4'-P-C4' energy: -35.616 flat angles P-C4'-P energy: -27.261 tors. eta vs tors. theta energy: -37.194 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -525.177951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.177951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.100152 (E_RNA) where: Base-Base interactions energy: -345.406 where: short stacking energy: -149.245 Base-Backbone interact. energy: -0.299 local terms energy: -180.394901 where: bonds (distance) C4'-P energy: -40.044 bonds (distance) P-C4' energy: -43.120 flat angles C4'-P-C4' energy: -37.334 flat angles P-C4'-P energy: -20.492 tors. eta vs tors. theta energy: -39.404 Dist. restrs. and SS energy: 0.922 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -400.302799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.302799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.525258 (E_RNA) where: Base-Base interactions energy: -245.296 where: short stacking energy: -123.063 Base-Backbone interact. energy: -0.438 local terms energy: -155.791290 where: bonds (distance) C4'-P energy: -31.726 bonds (distance) P-C4' energy: -36.213 flat angles C4'-P-C4' energy: -35.355 flat angles P-C4'-P energy: -19.444 tors. eta vs tors. theta energy: -33.053 Dist. restrs. and SS energy: 1.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -434.166829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.166829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.436203 (E_RNA) where: Base-Base interactions energy: -263.063 where: short stacking energy: -116.130 Base-Backbone interact. energy: 2.869 local terms energy: -174.242385 where: bonds (distance) C4'-P energy: -36.192 bonds (distance) P-C4' energy: -41.608 flat angles C4'-P-C4' energy: -37.826 flat angles P-C4'-P energy: -27.723 tors. eta vs tors. theta energy: -30.893 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -375.294230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.294230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.602232 (E_RNA) where: Base-Base interactions energy: -219.460 where: short stacking energy: -98.503 Base-Backbone interact. energy: 0.796 local terms energy: -156.938357 where: bonds (distance) C4'-P energy: -31.955 bonds (distance) P-C4' energy: -45.218 flat angles C4'-P-C4' energy: -39.960 flat angles P-C4'-P energy: -24.252 tors. eta vs tors. theta energy: -15.553 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -300.383338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.383338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.463319 (E_RNA) where: Base-Base interactions energy: -169.062 where: short stacking energy: -92.782 Base-Backbone interact. energy: -1.728 local terms energy: -130.673351 where: bonds (distance) C4'-P energy: -30.289 bonds (distance) P-C4' energy: -37.477 flat angles C4'-P-C4' energy: -27.975 flat angles P-C4'-P energy: -18.612 tors. eta vs tors. theta energy: -16.321 Dist. restrs. and SS energy: 1.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -267.018473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.018473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.156370 (E_RNA) where: Base-Base interactions energy: -137.618 where: short stacking energy: -70.867 Base-Backbone interact. energy: 0.483 local terms energy: -132.021586 where: bonds (distance) C4'-P energy: -36.723 bonds (distance) P-C4' energy: -27.397 flat angles C4'-P-C4' energy: -36.294 flat angles P-C4'-P energy: -22.808 tors. eta vs tors. theta energy: -8.800 Dist. restrs. and SS energy: 2.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -285.866286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.866286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.052092 (E_RNA) where: Base-Base interactions energy: -158.193 where: short stacking energy: -86.940 Base-Backbone interact. energy: 1.250 local terms energy: -129.108370 where: bonds (distance) C4'-P energy: -30.945 bonds (distance) P-C4' energy: -28.268 flat angles C4'-P-C4' energy: -34.189 flat angles P-C4'-P energy: -22.444 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -578.765192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.765192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.023638 (E_RNA) where: Base-Base interactions energy: -383.956 where: short stacking energy: -180.570 Base-Backbone interact. energy: -0.782 local terms energy: -194.285851 where: bonds (distance) C4'-P energy: -30.994 bonds (distance) P-C4' energy: -42.455 flat angles C4'-P-C4' energy: -44.180 flat angles P-C4'-P energy: -26.378 tors. eta vs tors. theta energy: -50.279 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -592.679352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.679352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.015612 (E_RNA) where: Base-Base interactions energy: -399.191 where: short stacking energy: -178.744 Base-Backbone interact. energy: -0.863 local terms energy: -193.961478 where: bonds (distance) C4'-P energy: -36.669 bonds (distance) P-C4' energy: -36.575 flat angles C4'-P-C4' energy: -45.682 flat angles P-C4'-P energy: -24.878 tors. eta vs tors. theta energy: -50.158 Dist. restrs. and SS energy: 1.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -501.594187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.594187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.678950 (E_RNA) where: Base-Base interactions energy: -322.058 where: short stacking energy: -148.911 Base-Backbone interact. energy: -0.144 local terms energy: -179.477621 where: bonds (distance) C4'-P energy: -35.497 bonds (distance) P-C4' energy: -42.107 flat angles C4'-P-C4' energy: -41.105 flat angles P-C4'-P energy: -25.226 tors. eta vs tors. theta energy: -35.542 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -506.855562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.855562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.833379 (E_RNA) where: Base-Base interactions energy: -330.167 where: short stacking energy: -159.084 Base-Backbone interact. energy: -1.208 local terms energy: -176.458376 where: bonds (distance) C4'-P energy: -38.443 bonds (distance) P-C4' energy: -33.291 flat angles C4'-P-C4' energy: -39.123 flat angles P-C4'-P energy: -28.571 tors. eta vs tors. theta energy: -37.031 Dist. restrs. and SS energy: 0.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -446.925463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.925463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.969997 (E_RNA) where: Base-Base interactions energy: -268.497 where: short stacking energy: -110.528 Base-Backbone interact. energy: -0.373 local terms energy: -178.099758 where: bonds (distance) C4'-P energy: -44.490 bonds (distance) P-C4' energy: -34.125 flat angles C4'-P-C4' energy: -38.143 flat angles P-C4'-P energy: -28.256 tors. eta vs tors. theta energy: -33.085 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -392.473505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.473505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.392146 (E_RNA) where: Base-Base interactions energy: -247.198 where: short stacking energy: -117.115 Base-Backbone interact. energy: -0.277 local terms energy: -146.916673 where: bonds (distance) C4'-P energy: -36.748 bonds (distance) P-C4' energy: -36.918 flat angles C4'-P-C4' energy: -30.053 flat angles P-C4'-P energy: -15.367 tors. eta vs tors. theta energy: -27.831 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -386.102437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.102437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.124243 (E_RNA) where: Base-Base interactions energy: -240.028 where: short stacking energy: -100.636 Base-Backbone interact. energy: -0.130 local terms energy: -145.966494 where: bonds (distance) C4'-P energy: -37.203 bonds (distance) P-C4' energy: -26.939 flat angles C4'-P-C4' energy: -36.872 flat angles P-C4'-P energy: -22.032 tors. eta vs tors. theta energy: -22.922 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -350.746447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.746447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.776743 (E_RNA) where: Base-Base interactions energy: -219.501 where: short stacking energy: -103.131 Base-Backbone interact. energy: -0.299 local terms energy: -130.977222 where: bonds (distance) C4'-P energy: -19.171 bonds (distance) P-C4' energy: -37.968 flat angles C4'-P-C4' energy: -36.877 flat angles P-C4'-P energy: -17.518 tors. eta vs tors. theta energy: -19.443 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -310.859929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.859929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.925449 (E_RNA) where: Base-Base interactions energy: -183.404 where: short stacking energy: -74.843 Base-Backbone interact. energy: 6.266 local terms energy: -133.788236 where: bonds (distance) C4'-P energy: -32.859 bonds (distance) P-C4' energy: -37.832 flat angles C4'-P-C4' energy: -32.478 flat angles P-C4'-P energy: -22.385 tors. eta vs tors. theta energy: -8.234 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -313.308586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.308586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.351051 (E_RNA) where: Base-Base interactions energy: -171.720 where: short stacking energy: -99.367 Base-Backbone interact. energy: 1.019 local terms energy: -142.649424 where: bonds (distance) C4'-P energy: -33.297 bonds (distance) P-C4' energy: -37.825 flat angles C4'-P-C4' energy: -37.775 flat angles P-C4'-P energy: -13.529 tors. eta vs tors. theta energy: -20.222 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -586.000545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.000545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.770567 (E_RNA) where: Base-Base interactions energy: -380.402 where: short stacking energy: -166.948 Base-Backbone interact. energy: -1.025 local terms energy: -205.344219 where: bonds (distance) C4'-P energy: -39.856 bonds (distance) P-C4' energy: -40.291 flat angles C4'-P-C4' energy: -47.015 flat angles P-C4'-P energy: -28.443 tors. eta vs tors. theta energy: -49.739 Dist. restrs. and SS energy: 0.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -576.723358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.723358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.462845 (E_RNA) where: Base-Base interactions energy: -395.995 where: short stacking energy: -165.283 Base-Backbone interact. energy: -0.634 local terms energy: -181.834045 where: bonds (distance) C4'-P energy: -38.051 bonds (distance) P-C4' energy: -36.615 flat angles C4'-P-C4' energy: -37.254 flat angles P-C4'-P energy: -25.190 tors. eta vs tors. theta energy: -44.724 Dist. restrs. and SS energy: 1.739 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -502.616611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.616611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.798863 (E_RNA) where: Base-Base interactions energy: -316.609 where: short stacking energy: -146.456 Base-Backbone interact. energy: -0.171 local terms energy: -186.018439 where: bonds (distance) C4'-P energy: -40.023 bonds (distance) P-C4' energy: -40.337 flat angles C4'-P-C4' energy: -40.825 flat angles P-C4'-P energy: -25.186 tors. eta vs tors. theta energy: -39.648 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -492.907384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.907384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.791874 (E_RNA) where: Base-Base interactions energy: -322.763 where: short stacking energy: -150.224 Base-Backbone interact. energy: -0.589 local terms energy: -170.440059 where: bonds (distance) C4'-P energy: -31.968 bonds (distance) P-C4' energy: -34.603 flat angles C4'-P-C4' energy: -40.082 flat angles P-C4'-P energy: -22.960 tors. eta vs tors. theta energy: -40.826 Dist. restrs. and SS energy: 0.884 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -398.004498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.004498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.945766 (E_RNA) where: Base-Base interactions energy: -256.041 where: short stacking energy: -131.854 Base-Backbone interact. energy: -1.140 local terms energy: -141.765136 where: bonds (distance) C4'-P energy: -26.862 bonds (distance) P-C4' energy: -35.630 flat angles C4'-P-C4' energy: -31.541 flat angles P-C4'-P energy: -24.039 tors. eta vs tors. theta energy: -23.694 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -387.651873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.651873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.717217 (E_RNA) where: Base-Base interactions energy: -228.607 where: short stacking energy: -99.875 Base-Backbone interact. energy: -3.228 local terms energy: -155.882266 where: bonds (distance) C4'-P energy: -37.000 bonds (distance) P-C4' energy: -32.606 flat angles C4'-P-C4' energy: -39.454 flat angles P-C4'-P energy: -18.595 tors. eta vs tors. theta energy: -28.228 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -410.802672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.802672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.046966 (E_RNA) where: Base-Base interactions energy: -274.952 where: short stacking energy: -122.072 Base-Backbone interact. energy: -0.158 local terms energy: -135.937201 where: bonds (distance) C4'-P energy: -23.249 bonds (distance) P-C4' energy: -28.243 flat angles C4'-P-C4' energy: -36.719 flat angles P-C4'-P energy: -22.287 tors. eta vs tors. theta energy: -25.440 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -352.913761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.913761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.009794 (E_RNA) where: Base-Base interactions energy: -210.347 where: short stacking energy: -92.928 Base-Backbone interact. energy: -1.455 local terms energy: -141.207686 where: bonds (distance) C4'-P energy: -42.060 bonds (distance) P-C4' energy: -30.570 flat angles C4'-P-C4' energy: -31.622 flat angles P-C4'-P energy: -17.011 tors. eta vs tors. theta energy: -19.944 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -300.421256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.421256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.752281 (E_RNA) where: Base-Base interactions energy: -172.675 where: short stacking energy: -76.939 Base-Backbone interact. energy: -0.935 local terms energy: -127.142202 where: bonds (distance) C4'-P energy: -34.366 bonds (distance) P-C4' energy: -37.056 flat angles C4'-P-C4' energy: -30.530 flat angles P-C4'-P energy: -20.587 tors. eta vs tors. theta energy: -4.603 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -262.448164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.448164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.759846 (E_RNA) where: Base-Base interactions energy: -150.775 where: short stacking energy: -71.196 Base-Backbone interact. energy: 0.056 local terms energy: -112.040281 where: bonds (distance) C4'-P energy: -26.211 bonds (distance) P-C4' energy: -32.534 flat angles C4'-P-C4' energy: -25.160 flat angles P-C4'-P energy: -23.058 tors. eta vs tors. theta energy: -5.077 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -585.698498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.698498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.928595 (E_RNA) where: Base-Base interactions energy: -392.936 where: short stacking energy: -172.856 Base-Backbone interact. energy: -0.179 local terms energy: -192.813774 where: bonds (distance) C4'-P energy: -38.040 bonds (distance) P-C4' energy: -40.521 flat angles C4'-P-C4' energy: -41.528 flat angles P-C4'-P energy: -23.664 tors. eta vs tors. theta energy: -49.062 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -599.501922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.501922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.543047 (E_RNA) where: Base-Base interactions energy: -417.930 where: short stacking energy: -178.232 Base-Backbone interact. energy: -1.397 local terms energy: -182.215846 where: bonds (distance) C4'-P energy: -43.209 bonds (distance) P-C4' energy: -28.936 flat angles C4'-P-C4' energy: -41.738 flat angles P-C4'-P energy: -29.074 tors. eta vs tors. theta energy: -39.260 Dist. restrs. and SS energy: 2.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -525.474874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.474874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.445907 (E_RNA) where: Base-Base interactions energy: -351.068 where: short stacking energy: -170.366 Base-Backbone interact. energy: -3.285 local terms energy: -172.092351 where: bonds (distance) C4'-P energy: -27.955 bonds (distance) P-C4' energy: -36.124 flat angles C4'-P-C4' energy: -32.789 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: -47.308 Dist. restrs. and SS energy: 0.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -461.365553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.365553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.403049 (E_RNA) where: Base-Base interactions energy: -292.232 where: short stacking energy: -130.124 Base-Backbone interact. energy: -0.129 local terms energy: -169.042536 where: bonds (distance) C4'-P energy: -30.700 bonds (distance) P-C4' energy: -37.624 flat angles C4'-P-C4' energy: -41.900 flat angles P-C4'-P energy: -28.673 tors. eta vs tors. theta energy: -30.146 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -419.259785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.259785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.088419 (E_RNA) where: Base-Base interactions energy: -243.799 where: short stacking energy: -140.001 Base-Backbone interact. energy: 0.218 local terms energy: -176.507682 where: bonds (distance) C4'-P energy: -34.027 bonds (distance) P-C4' energy: -43.194 flat angles C4'-P-C4' energy: -39.830 flat angles P-C4'-P energy: -20.958 tors. eta vs tors. theta energy: -38.497 Dist. restrs. and SS energy: 0.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -415.213128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.213128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.532117 (E_RNA) where: Base-Base interactions energy: -250.011 where: short stacking energy: -125.777 Base-Backbone interact. energy: -0.015 local terms energy: -165.506385 where: bonds (distance) C4'-P energy: -30.477 bonds (distance) P-C4' energy: -41.391 flat angles C4'-P-C4' energy: -35.678 flat angles P-C4'-P energy: -31.601 tors. eta vs tors. theta energy: -26.360 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -437.778709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.778709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.830699 (E_RNA) where: Base-Base interactions energy: -264.516 where: short stacking energy: -116.774 Base-Backbone interact. energy: 1.461 local terms energy: -174.775564 where: bonds (distance) C4'-P energy: -38.098 bonds (distance) P-C4' energy: -42.430 flat angles C4'-P-C4' energy: -34.045 flat angles P-C4'-P energy: -29.045 tors. eta vs tors. theta energy: -31.158 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -349.204758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.204758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.250456 (E_RNA) where: Base-Base interactions energy: -219.278 where: short stacking energy: -108.588 Base-Backbone interact. energy: -0.396 local terms energy: -129.576410 where: bonds (distance) C4'-P energy: -29.931 bonds (distance) P-C4' energy: -31.644 flat angles C4'-P-C4' energy: -33.146 flat angles P-C4'-P energy: -18.563 tors. eta vs tors. theta energy: -16.291 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -357.046034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.046034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.117151 (E_RNA) where: Base-Base interactions energy: -213.790 where: short stacking energy: -98.432 Base-Backbone interact. energy: -1.588 local terms energy: -141.738644 where: bonds (distance) C4'-P energy: -30.565 bonds (distance) P-C4' energy: -40.916 flat angles C4'-P-C4' energy: -35.007 flat angles P-C4'-P energy: -22.086 tors. eta vs tors. theta energy: -13.164 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -296.236955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.236955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.418446 (E_RNA) where: Base-Base interactions energy: -160.241 where: short stacking energy: -75.367 Base-Backbone interact. energy: -1.385 local terms energy: -134.792548 where: bonds (distance) C4'-P energy: -33.771 bonds (distance) P-C4' energy: -33.661 flat angles C4'-P-C4' energy: -40.072 flat angles P-C4'-P energy: -12.904 tors. eta vs tors. theta energy: -14.384 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -595.420740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.420740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.162194 (E_RNA) where: Base-Base interactions energy: -390.948 where: short stacking energy: -171.065 Base-Backbone interact. energy: -0.255 local terms energy: -204.959348 where: bonds (distance) C4'-P energy: -37.527 bonds (distance) P-C4' energy: -36.167 flat angles C4'-P-C4' energy: -44.529 flat angles P-C4'-P energy: -33.205 tors. eta vs tors. theta energy: -53.532 Dist. restrs. and SS energy: 0.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -593.344183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.344183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.375722 (E_RNA) where: Base-Base interactions energy: -401.063 where: short stacking energy: -188.340 Base-Backbone interact. energy: 0.258 local terms energy: -194.569992 where: bonds (distance) C4'-P energy: -37.300 bonds (distance) P-C4' energy: -35.521 flat angles C4'-P-C4' energy: -42.778 flat angles P-C4'-P energy: -29.978 tors. eta vs tors. theta energy: -48.993 Dist. restrs. and SS energy: 2.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -510.990686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.990686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.684482 (E_RNA) where: Base-Base interactions energy: -322.576 where: short stacking energy: -142.788 Base-Backbone interact. energy: -0.975 local terms energy: -188.132605 where: bonds (distance) C4'-P energy: -37.724 bonds (distance) P-C4' energy: -38.023 flat angles C4'-P-C4' energy: -42.177 flat angles P-C4'-P energy: -30.583 tors. eta vs tors. theta energy: -39.625 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -447.908412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.908412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.439252 (E_RNA) where: Base-Base interactions energy: -286.186 where: short stacking energy: -125.054 Base-Backbone interact. energy: 0.282 local terms energy: -162.534959 where: bonds (distance) C4'-P energy: -31.509 bonds (distance) P-C4' energy: -44.202 flat angles C4'-P-C4' energy: -34.860 flat angles P-C4'-P energy: -24.518 tors. eta vs tors. theta energy: -27.446 Dist. restrs. and SS energy: 0.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -423.340349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.340349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.665115 (E_RNA) where: Base-Base interactions energy: -265.446 where: short stacking energy: -116.452 Base-Backbone interact. energy: 1.752 local terms energy: -159.970836 where: bonds (distance) C4'-P energy: -34.100 bonds (distance) P-C4' energy: -35.359 flat angles C4'-P-C4' energy: -38.314 flat angles P-C4'-P energy: -25.331 tors. eta vs tors. theta energy: -26.866 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -421.769915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.769915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.157401 (E_RNA) where: Base-Base interactions energy: -270.162 where: short stacking energy: -130.647 Base-Backbone interact. energy: -0.893 local terms energy: -151.102167 where: bonds (distance) C4'-P energy: -27.217 bonds (distance) P-C4' energy: -33.276 flat angles C4'-P-C4' energy: -38.034 flat angles P-C4'-P energy: -25.497 tors. eta vs tors. theta energy: -27.078 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -402.127416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.127416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.127416 (E_RNA) where: Base-Base interactions energy: -254.476 where: short stacking energy: -113.718 Base-Backbone interact. energy: -0.640 local terms energy: -147.011148 where: bonds (distance) C4'-P energy: -30.806 bonds (distance) P-C4' energy: -34.201 flat angles C4'-P-C4' energy: -31.467 flat angles P-C4'-P energy: -24.731 tors. eta vs tors. theta energy: -25.806 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -360.171619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.171619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.473418 (E_RNA) where: Base-Base interactions energy: -223.067 where: short stacking energy: -99.250 Base-Backbone interact. energy: -1.245 local terms energy: -136.161234 where: bonds (distance) C4'-P energy: -29.176 bonds (distance) P-C4' energy: -38.524 flat angles C4'-P-C4' energy: -29.914 flat angles P-C4'-P energy: -20.352 tors. eta vs tors. theta energy: -18.196 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -327.012092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.012092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.293524 (E_RNA) where: Base-Base interactions energy: -192.387 where: short stacking energy: -68.602 Base-Backbone interact. energy: -1.114 local terms energy: -133.793301 where: bonds (distance) C4'-P energy: -24.240 bonds (distance) P-C4' energy: -38.396 flat angles C4'-P-C4' energy: -44.101 flat angles P-C4'-P energy: -14.163 tors. eta vs tors. theta energy: -12.894 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -258.158572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.158572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.168128 (E_RNA) where: Base-Base interactions energy: -134.627 where: short stacking energy: -65.310 Base-Backbone interact. energy: -1.157 local terms energy: -126.383687 where: bonds (distance) C4'-P energy: -36.460 bonds (distance) P-C4' energy: -37.950 flat angles C4'-P-C4' energy: -28.690 flat angles P-C4'-P energy: -15.862 tors. eta vs tors. theta energy: -7.421 Dist. restrs. and SS energy: 4.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 7 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 8809242 moves confirmed later: 10213747 all moves confirmed: 19022989 percent of confirmed moves: 11.889368 current total energy: -559.020511 recalc. total energy: -559.020511 replica 3 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 7472218 moves confirmed later: 8463999 all moves confirmed: 15936217 percent of confirmed moves: 9.960136 current total energy: -509.700636 recalc. total energy: -509.700636 replica 2 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 7231753 moves confirmed later: 8106569 all moves confirmed: 15338322 percent of confirmed moves: 9.586451 current total energy: -419.065894 recalc. total energy: -419.065894 replica 5 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 9166295 moves confirmed later: 10654136 all moves confirmed: 19820431 percent of confirmed moves: 12.387769 current total energy: -391.716422 recalc. total energy: -391.716422 replica 8 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 9164550 moves confirmed later: 10639355 all moves confirmed: 19803905 percent of confirmed moves: 12.377441 current total energy: -354.675200 recalc. total energy: -354.675200 replica 10 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 10435909 moves confirmed later: 12321858 all moves confirmed: 22757767 percent of confirmed moves: 14.223604 current total energy: -344.213695 recalc. total energy: -344.213695 replica 6 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 8619290 moves confirmed later: 9982200 all moves confirmed: 18601490 percent of confirmed moves: 11.625931 current total energy: -299.603960 recalc. total energy: -299.603960 replica 9 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 12076210 moves confirmed later: 14433076 all moves confirmed: 26509286 percent of confirmed moves: 16.568304 current total energy: -237.673381 recalc. total energy: -237.673381 replica 4 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 11398229 moves confirmed later: 13570638 all moves confirmed: 24968867 percent of confirmed moves: 15.605542 current total energy: -247.555627 recalc. total energy: -247.555627 replica 1 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 10039382 moves confirmed later: 11786283 all moves confirmed: 21825665 percent of confirmed moves: 13.641041 current total energy: -186.094486 recalc. total energy: -186.094486 out arg RESULTS//1/Tetraloop_10_steps-b6bb63ce_01 Time of doing 1600000 iterations: 13971.396 seconds