SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ace9e91a/inputs/seq.fa: 1 curr_seq: _CAAAGAAUUCUCCUUUUGGGCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: CAAAGAAUUCUCCUUUUGGGCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 22 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 115 n_atoms_counter: 115 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...........((....))..._ nucl1: 12, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 11, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 18 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 22.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -42.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -42.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.783826 (E_RNA) where: Base-Base interactions energy: 0.091 where: short stacking energy: 0.091 Base-Backbone interact. energy: -0.000 local terms energy: -81.874810 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -20.577 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -18.477 tors. eta vs tors. theta energy: -5.293 Dist. restrs. and SS energy: 39.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -142.117878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.117878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.849974 (E_RNA) where: Base-Base interactions energy: -76.559 where: short stacking energy: -52.599 Base-Backbone interact. energy: 0.857 local terms energy: -68.148872 where: bonds (distance) C4'-P energy: -14.726 bonds (distance) P-C4' energy: -14.050 flat angles C4'-P-C4' energy: -15.377 flat angles P-C4'-P energy: -10.958 tors. eta vs tors. theta energy: -13.038 Dist. restrs. and SS energy: 1.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -148.010958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.010958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.587400 (E_RNA) where: Base-Base interactions energy: -82.970 where: short stacking energy: -27.307 Base-Backbone interact. energy: -0.207 local terms energy: -65.410933 where: bonds (distance) C4'-P energy: -15.781 bonds (distance) P-C4' energy: -16.597 flat angles C4'-P-C4' energy: -16.722 flat angles P-C4'-P energy: -10.406 tors. eta vs tors. theta energy: -5.904 Dist. restrs. and SS energy: 0.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -138.936309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.936309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.897324 (E_RNA) where: Base-Base interactions energy: -68.409 where: short stacking energy: -49.976 Base-Backbone interact. energy: -0.133 local terms energy: -71.355181 where: bonds (distance) C4'-P energy: -16.126 bonds (distance) P-C4' energy: -18.057 flat angles C4'-P-C4' energy: -16.964 flat angles P-C4'-P energy: -11.122 tors. eta vs tors. theta energy: -9.087 Dist. restrs. and SS energy: 0.961 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -137.289215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.289215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.297697 (E_RNA) where: Base-Base interactions energy: -74.555 where: short stacking energy: -46.261 Base-Backbone interact. energy: 0.004 local terms energy: -62.746444 where: bonds (distance) C4'-P energy: -14.893 bonds (distance) P-C4' energy: -15.919 flat angles C4'-P-C4' energy: -12.162 flat angles P-C4'-P energy: -7.411 tors. eta vs tors. theta energy: -12.362 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -123.507220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.507220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.370140 (E_RNA) where: Base-Base interactions energy: -67.052 where: short stacking energy: -41.376 Base-Backbone interact. energy: -0.310 local terms energy: -57.008423 where: bonds (distance) C4'-P energy: -7.204 bonds (distance) P-C4' energy: -14.254 flat angles C4'-P-C4' energy: -14.216 flat angles P-C4'-P energy: -9.665 tors. eta vs tors. theta energy: -11.669 Dist. restrs. and SS energy: 0.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -159.781859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.781859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.389623 (E_RNA) where: Base-Base interactions energy: -105.041 where: short stacking energy: -54.915 Base-Backbone interact. energy: 1.111 local terms energy: -59.459353 where: bonds (distance) C4'-P energy: -10.978 bonds (distance) P-C4' energy: -14.288 flat angles C4'-P-C4' energy: -13.415 flat angles P-C4'-P energy: -3.102 tors. eta vs tors. theta energy: -17.678 Dist. restrs. and SS energy: 3.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -133.630802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.630802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.630802 (E_RNA) where: Base-Base interactions energy: -69.826 where: short stacking energy: -23.938 Base-Backbone interact. energy: -1.284 local terms energy: -62.521007 where: bonds (distance) C4'-P energy: -13.063 bonds (distance) P-C4' energy: -13.696 flat angles C4'-P-C4' energy: -16.363 flat angles P-C4'-P energy: -11.207 tors. eta vs tors. theta energy: -8.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -108.592160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.592160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.420272 (E_RNA) where: Base-Base interactions energy: -54.694 where: short stacking energy: -20.968 Base-Backbone interact. energy: -0.269 local terms energy: -54.457196 where: bonds (distance) C4'-P energy: -12.383 bonds (distance) P-C4' energy: -17.210 flat angles C4'-P-C4' energy: -11.809 flat angles P-C4'-P energy: -7.872 tors. eta vs tors. theta energy: -5.184 Dist. restrs. and SS energy: 0.828 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -134.667715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.667715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.074451 (E_RNA) where: Base-Base interactions energy: -84.033 where: short stacking energy: -42.601 Base-Backbone interact. energy: -0.784 local terms energy: -52.257426 where: bonds (distance) C4'-P energy: -12.997 bonds (distance) P-C4' energy: -16.262 flat angles C4'-P-C4' energy: -10.607 flat angles P-C4'-P energy: -6.740 tors. eta vs tors. theta energy: -5.651 Dist. restrs. and SS energy: 2.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -113.896088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.896088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.089212 (E_RNA) where: Base-Base interactions energy: -64.030 where: short stacking energy: -29.001 Base-Backbone interact. energy: 3.962 local terms energy: -54.021896 where: bonds (distance) C4'-P energy: -10.910 bonds (distance) P-C4' energy: -16.737 flat angles C4'-P-C4' energy: -16.007 flat angles P-C4'-P energy: -8.428 tors. eta vs tors. theta energy: -1.940 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -154.302727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.302727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.674684 (E_RNA) where: Base-Base interactions energy: -87.085 where: short stacking energy: -41.548 Base-Backbone interact. energy: -0.009 local terms energy: -67.580943 where: bonds (distance) C4'-P energy: -16.897 bonds (distance) P-C4' energy: -14.157 flat angles C4'-P-C4' energy: -14.527 flat angles P-C4'-P energy: -9.952 tors. eta vs tors. theta energy: -12.048 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -165.276950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.276950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.225459 (E_RNA) where: Base-Base interactions energy: -102.007 where: short stacking energy: -55.056 Base-Backbone interact. energy: -0.052 local terms energy: -64.166410 where: bonds (distance) C4'-P energy: -15.606 bonds (distance) P-C4' energy: -15.579 flat angles C4'-P-C4' energy: -12.724 flat angles P-C4'-P energy: -7.928 tors. eta vs tors. theta energy: -12.330 Dist. restrs. and SS energy: 0.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -135.835074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.835074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.930573 (E_RNA) where: Base-Base interactions energy: -73.779 where: short stacking energy: -47.949 Base-Backbone interact. energy: -0.036 local terms energy: -63.115797 where: bonds (distance) C4'-P energy: -12.859 bonds (distance) P-C4' energy: -15.170 flat angles C4'-P-C4' energy: -12.374 flat angles P-C4'-P energy: -8.586 tors. eta vs tors. theta energy: -14.127 Dist. restrs. and SS energy: 1.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -133.001943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.001943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.001943 (E_RNA) where: Base-Base interactions energy: -78.640 where: short stacking energy: -42.725 Base-Backbone interact. energy: -0.717 local terms energy: -53.644639 where: bonds (distance) C4'-P energy: -17.248 bonds (distance) P-C4' energy: -14.998 flat angles C4'-P-C4' energy: -6.719 flat angles P-C4'-P energy: -8.129 tors. eta vs tors. theta energy: -6.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -125.144506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.144506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.417981 (E_RNA) where: Base-Base interactions energy: -71.650 where: short stacking energy: -39.216 Base-Backbone interact. energy: -0.143 local terms energy: -53.624911 where: bonds (distance) C4'-P energy: -12.716 bonds (distance) P-C4' energy: -13.473 flat angles C4'-P-C4' energy: -13.933 flat angles P-C4'-P energy: -8.943 tors. eta vs tors. theta energy: -4.560 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -154.102152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.102152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.099304 (E_RNA) where: Base-Base interactions energy: -95.644 where: short stacking energy: -53.123 Base-Backbone interact. energy: -0.026 local terms energy: -61.429311 where: bonds (distance) C4'-P energy: -13.207 bonds (distance) P-C4' energy: -18.655 flat angles C4'-P-C4' energy: -8.235 flat angles P-C4'-P energy: -5.486 tors. eta vs tors. theta energy: -15.846 Dist. restrs. and SS energy: 2.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -127.910980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.910980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.330350 (E_RNA) where: Base-Base interactions energy: -73.824 where: short stacking energy: -43.741 Base-Backbone interact. energy: -1.217 local terms energy: -54.289299 where: bonds (distance) C4'-P energy: -8.964 bonds (distance) P-C4' energy: -13.202 flat angles C4'-P-C4' energy: -10.405 flat angles P-C4'-P energy: -9.963 tors. eta vs tors. theta energy: -11.755 Dist. restrs. and SS energy: 1.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -131.745473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.745473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.745473 (E_RNA) where: Base-Base interactions energy: -81.855 where: short stacking energy: -43.983 Base-Backbone interact. energy: 0.044 local terms energy: -49.933707 where: bonds (distance) C4'-P energy: -8.618 bonds (distance) P-C4' energy: -15.419 flat angles C4'-P-C4' energy: -12.145 flat angles P-C4'-P energy: -5.399 tors. eta vs tors. theta energy: -8.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -123.497197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.497197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.581549 (E_RNA) where: Base-Base interactions energy: -66.364 where: short stacking energy: -32.164 Base-Backbone interact. energy: 0.494 local terms energy: -58.711299 where: bonds (distance) C4'-P energy: -14.160 bonds (distance) P-C4' energy: -15.819 flat angles C4'-P-C4' energy: -15.194 flat angles P-C4'-P energy: -9.553 tors. eta vs tors. theta energy: -3.986 Dist. restrs. and SS energy: 1.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -136.865797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.865797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.865797 (E_RNA) where: Base-Base interactions energy: -75.491 where: short stacking energy: -32.373 Base-Backbone interact. energy: -0.070 local terms energy: -61.305068 where: bonds (distance) C4'-P energy: -13.791 bonds (distance) P-C4' energy: -14.531 flat angles C4'-P-C4' energy: -15.949 flat angles P-C4'-P energy: -11.457 tors. eta vs tors. theta energy: -5.576 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -162.758139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.758139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.720786 (E_RNA) where: Base-Base interactions energy: -98.630 where: short stacking energy: -46.973 Base-Backbone interact. energy: -0.359 local terms energy: -64.732556 where: bonds (distance) C4'-P energy: -15.029 bonds (distance) P-C4' energy: -12.110 flat angles C4'-P-C4' energy: -17.623 flat angles P-C4'-P energy: -9.108 tors. eta vs tors. theta energy: -10.862 Dist. restrs. and SS energy: 0.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -147.247421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.247421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.894967 (E_RNA) where: Base-Base interactions energy: -82.629 where: short stacking energy: -47.904 Base-Backbone interact. energy: -0.137 local terms energy: -65.128434 where: bonds (distance) C4'-P energy: -15.426 bonds (distance) P-C4' energy: -14.180 flat angles C4'-P-C4' energy: -14.323 flat angles P-C4'-P energy: -11.556 tors. eta vs tors. theta energy: -9.644 Dist. restrs. and SS energy: 0.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -157.843610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.843610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.456810 (E_RNA) where: Base-Base interactions energy: -96.677 where: short stacking energy: -53.795 Base-Backbone interact. energy: -0.002 local terms energy: -61.777369 where: bonds (distance) C4'-P energy: -15.484 bonds (distance) P-C4' energy: -16.060 flat angles C4'-P-C4' energy: -11.749 flat angles P-C4'-P energy: -5.222 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -119.232740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.232740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.702499 (E_RNA) where: Base-Base interactions energy: -57.235 where: short stacking energy: -32.288 Base-Backbone interact. energy: -0.639 local terms energy: -62.828663 where: bonds (distance) C4'-P energy: -18.112 bonds (distance) P-C4' energy: -18.256 flat angles C4'-P-C4' energy: -13.495 flat angles P-C4'-P energy: -6.271 tors. eta vs tors. theta energy: -6.695 Dist. restrs. and SS energy: 1.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -152.397750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.397750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.960350 (E_RNA) where: Base-Base interactions energy: -99.727 where: short stacking energy: -45.000 Base-Backbone interact. energy: 0.298 local terms energy: -55.531796 where: bonds (distance) C4'-P energy: -15.066 bonds (distance) P-C4' energy: -17.914 flat angles C4'-P-C4' energy: -9.875 flat angles P-C4'-P energy: -3.358 tors. eta vs tors. theta energy: -9.319 Dist. restrs. and SS energy: 2.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -124.107185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.107185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.131113 (E_RNA) where: Base-Base interactions energy: -59.912 where: short stacking energy: -41.265 Base-Backbone interact. energy: 0.039 local terms energy: -64.258269 where: bonds (distance) C4'-P energy: -13.501 bonds (distance) P-C4' energy: -17.012 flat angles C4'-P-C4' energy: -15.037 flat angles P-C4'-P energy: -11.334 tors. eta vs tors. theta energy: -7.373 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -128.086364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.086364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.181090 (E_RNA) where: Base-Base interactions energy: -77.807 where: short stacking energy: -32.393 Base-Backbone interact. energy: -0.233 local terms energy: -50.140434 where: bonds (distance) C4'-P energy: -9.410 bonds (distance) P-C4' energy: -16.217 flat angles C4'-P-C4' energy: -10.003 flat angles P-C4'-P energy: -9.409 tors. eta vs tors. theta energy: -5.101 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -103.221453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.221453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.333605 (E_RNA) where: Base-Base interactions energy: -41.981 where: short stacking energy: -37.479 Base-Backbone interact. energy: -0.211 local terms energy: -64.142366 where: bonds (distance) C4'-P energy: -16.353 bonds (distance) P-C4' energy: -15.097 flat angles C4'-P-C4' energy: -15.095 flat angles P-C4'-P energy: -9.544 tors. eta vs tors. theta energy: -8.053 Dist. restrs. and SS energy: 3.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -138.979495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.979495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.223001 (E_RNA) where: Base-Base interactions energy: -76.451 where: short stacking energy: -30.923 Base-Backbone interact. energy: -0.059 local terms energy: -62.713518 where: bonds (distance) C4'-P energy: -13.405 bonds (distance) P-C4' energy: -15.974 flat angles C4'-P-C4' energy: -15.201 flat angles P-C4'-P energy: -8.418 tors. eta vs tors. theta energy: -9.715 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -136.768066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.768066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.794435 (E_RNA) where: Base-Base interactions energy: -76.534 where: short stacking energy: -37.373 Base-Backbone interact. energy: -0.060 local terms energy: -60.200856 where: bonds (distance) C4'-P energy: -16.606 bonds (distance) P-C4' energy: -12.545 flat angles C4'-P-C4' energy: -13.281 flat angles P-C4'-P energy: -8.581 tors. eta vs tors. theta energy: -9.188 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -172.159585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.159585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.913715 (E_RNA) where: Base-Base interactions energy: -101.628 where: short stacking energy: -49.877 Base-Backbone interact. energy: -0.148 local terms energy: -71.137392 where: bonds (distance) C4'-P energy: -12.797 bonds (distance) P-C4' energy: -18.389 flat angles C4'-P-C4' energy: -14.407 flat angles P-C4'-P energy: -12.784 tors. eta vs tors. theta energy: -12.760 Dist. restrs. and SS energy: 0.754 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -173.932813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.932813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.016127 (E_RNA) where: Base-Base interactions energy: -99.981 where: short stacking energy: -58.978 Base-Backbone interact. energy: -0.094 local terms energy: -73.942007 where: bonds (distance) C4'-P energy: -16.084 bonds (distance) P-C4' energy: -16.637 flat angles C4'-P-C4' energy: -14.072 flat angles P-C4'-P energy: -10.312 tors. eta vs tors. theta energy: -16.837 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -132.613848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.613848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.036740 (E_RNA) where: Base-Base interactions energy: -68.901 where: short stacking energy: -41.169 Base-Backbone interact. energy: -1.267 local terms energy: -62.867833 where: bonds (distance) C4'-P energy: -16.470 bonds (distance) P-C4' energy: -16.597 flat angles C4'-P-C4' energy: -13.508 flat angles P-C4'-P energy: -7.812 tors. eta vs tors. theta energy: -8.481 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -165.370313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.370313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.370313 (E_RNA) where: Base-Base interactions energy: -102.809 where: short stacking energy: -52.633 Base-Backbone interact. energy: -0.007 local terms energy: -62.554101 where: bonds (distance) C4'-P energy: -18.163 bonds (distance) P-C4' energy: -11.644 flat angles C4'-P-C4' energy: -13.202 flat angles P-C4'-P energy: -11.205 tors. eta vs tors. theta energy: -8.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -133.941723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.941723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.620513 (E_RNA) where: Base-Base interactions energy: -70.055 where: short stacking energy: -49.669 Base-Backbone interact. energy: 0.561 local terms energy: -65.126786 where: bonds (distance) C4'-P energy: -14.660 bonds (distance) P-C4' energy: -15.687 flat angles C4'-P-C4' energy: -10.626 flat angles P-C4'-P energy: -9.744 tors. eta vs tors. theta energy: -14.410 Dist. restrs. and SS energy: 0.679 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -137.076101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.076101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.076101 (E_RNA) where: Base-Base interactions energy: -91.937 where: short stacking energy: -41.108 Base-Backbone interact. energy: 1.001 local terms energy: -46.140129 where: bonds (distance) C4'-P energy: -12.331 bonds (distance) P-C4' energy: -14.582 flat angles C4'-P-C4' energy: -14.876 flat angles P-C4'-P energy: 1.138 tors. eta vs tors. theta energy: -5.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -119.353189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.353189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.353189 (E_RNA) where: Base-Base interactions energy: -62.565 where: short stacking energy: -35.329 Base-Backbone interact. energy: -0.572 local terms energy: -56.216131 where: bonds (distance) C4'-P energy: -13.031 bonds (distance) P-C4' energy: -17.074 flat angles C4'-P-C4' energy: -13.609 flat angles P-C4'-P energy: -8.317 tors. eta vs tors. theta energy: -4.187 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -141.603966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.603966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.719517 (E_RNA) where: Base-Base interactions energy: -85.895 where: short stacking energy: -48.069 Base-Backbone interact. energy: -0.249 local terms energy: -55.576134 where: bonds (distance) C4'-P energy: -12.782 bonds (distance) P-C4' energy: -11.977 flat angles C4'-P-C4' energy: -10.273 flat angles P-C4'-P energy: -9.214 tors. eta vs tors. theta energy: -11.330 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -93.256796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.256796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.873508 (E_RNA) where: Base-Base interactions energy: -51.984 where: short stacking energy: -26.861 Base-Backbone interact. energy: -0.317 local terms energy: -41.572304 where: bonds (distance) C4'-P energy: -16.133 bonds (distance) P-C4' energy: -11.835 flat angles C4'-P-C4' energy: -11.992 flat angles P-C4'-P energy: -6.067 tors. eta vs tors. theta energy: 4.455 Dist. restrs. and SS energy: 0.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -130.771122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.771122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.792809 (E_RNA) where: Base-Base interactions energy: -72.514 where: short stacking energy: -35.073 Base-Backbone interact. energy: -0.055 local terms energy: -58.224486 where: bonds (distance) C4'-P energy: -13.840 bonds (distance) P-C4' energy: -12.051 flat angles C4'-P-C4' energy: -13.923 flat angles P-C4'-P energy: -8.010 tors. eta vs tors. theta energy: -10.401 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -171.943820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.943820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.976988 (E_RNA) where: Base-Base interactions energy: -104.558 where: short stacking energy: -58.235 Base-Backbone interact. energy: -0.359 local terms energy: -67.060049 where: bonds (distance) C4'-P energy: -15.769 bonds (distance) P-C4' energy: -16.831 flat angles C4'-P-C4' energy: -12.654 flat angles P-C4'-P energy: -8.452 tors. eta vs tors. theta energy: -13.354 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -176.327637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.327637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.331129 (E_RNA) where: Base-Base interactions energy: -106.642 where: short stacking energy: -44.890 Base-Backbone interact. energy: -0.837 local terms energy: -70.851429 where: bonds (distance) C4'-P energy: -16.383 bonds (distance) P-C4' energy: -16.818 flat angles C4'-P-C4' energy: -12.865 flat angles P-C4'-P energy: -12.257 tors. eta vs tors. theta energy: -12.529 Dist. restrs. and SS energy: 2.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -161.275901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.275901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.493796 (E_RNA) where: Base-Base interactions energy: -93.244 where: short stacking energy: -44.246 Base-Backbone interact. energy: -0.019 local terms energy: -68.230812 where: bonds (distance) C4'-P energy: -12.718 bonds (distance) P-C4' energy: -18.697 flat angles C4'-P-C4' energy: -16.490 flat angles P-C4'-P energy: -11.432 tors. eta vs tors. theta energy: -8.894 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -129.596036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.596036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.013981 (E_RNA) where: Base-Base interactions energy: -67.938 where: short stacking energy: -40.329 Base-Backbone interact. energy: -0.294 local terms energy: -61.782163 where: bonds (distance) C4'-P energy: -15.377 bonds (distance) P-C4' energy: -13.861 flat angles C4'-P-C4' energy: -12.853 flat angles P-C4'-P energy: -9.662 tors. eta vs tors. theta energy: -10.029 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -159.001417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.001417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.595156 (E_RNA) where: Base-Base interactions energy: -94.725 where: short stacking energy: -50.171 Base-Backbone interact. energy: -1.091 local terms energy: -63.779287 where: bonds (distance) C4'-P energy: -16.656 bonds (distance) P-C4' energy: -11.815 flat angles C4'-P-C4' energy: -14.618 flat angles P-C4'-P energy: -7.594 tors. eta vs tors. theta energy: -13.097 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -127.273995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.273995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.249434 (E_RNA) where: Base-Base interactions energy: -68.595 where: short stacking energy: -40.581 Base-Backbone interact. energy: -0.176 local terms energy: -59.479062 where: bonds (distance) C4'-P energy: -13.547 bonds (distance) P-C4' energy: -12.596 flat angles C4'-P-C4' energy: -16.778 flat angles P-C4'-P energy: -10.065 tors. eta vs tors. theta energy: -6.492 Dist. restrs. and SS energy: 0.975 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -145.130882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.130882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.130882 (E_RNA) where: Base-Base interactions energy: -94.124 where: short stacking energy: -42.139 Base-Backbone interact. energy: 0.593 local terms energy: -51.600317 where: bonds (distance) C4'-P energy: -9.100 bonds (distance) P-C4' energy: -14.169 flat angles C4'-P-C4' energy: -14.389 flat angles P-C4'-P energy: -5.724 tors. eta vs tors. theta energy: -8.218 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -137.532968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.532968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.535037 (E_RNA) where: Base-Base interactions energy: -75.711 where: short stacking energy: -36.637 Base-Backbone interact. energy: -0.104 local terms energy: -61.720286 where: bonds (distance) C4'-P energy: -17.613 bonds (distance) P-C4' energy: -16.785 flat angles C4'-P-C4' energy: -10.760 flat angles P-C4'-P energy: -9.357 tors. eta vs tors. theta energy: -7.206 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -137.704898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.704898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.884552 (E_RNA) where: Base-Base interactions energy: -86.855 where: short stacking energy: -41.291 Base-Backbone interact. energy: -0.121 local terms energy: -50.909182 where: bonds (distance) C4'-P energy: -14.470 bonds (distance) P-C4' energy: -11.371 flat angles C4'-P-C4' energy: -11.058 flat angles P-C4'-P energy: -4.833 tors. eta vs tors. theta energy: -9.177 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -108.342456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.342456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.993269 (E_RNA) where: Base-Base interactions energy: -60.459 where: short stacking energy: -28.745 Base-Backbone interact. energy: -0.421 local terms energy: -49.113181 where: bonds (distance) C4'-P energy: -12.784 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -11.711 flat angles P-C4'-P energy: -6.224 tors. eta vs tors. theta energy: -2.604 Dist. restrs. and SS energy: 1.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -182.818043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.818043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.360335 (E_RNA) where: Base-Base interactions energy: -112.824 where: short stacking energy: -58.490 Base-Backbone interact. energy: -1.619 local terms energy: -69.917536 where: bonds (distance) C4'-P energy: -15.526 bonds (distance) P-C4' energy: -14.871 flat angles C4'-P-C4' energy: -15.266 flat angles P-C4'-P energy: -9.261 tors. eta vs tors. theta energy: -14.995 Dist. restrs. and SS energy: 1.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -188.117342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.117342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.514285 (E_RNA) where: Base-Base interactions energy: -114.951 where: short stacking energy: -57.519 Base-Backbone interact. energy: 1.055 local terms energy: -74.617663 where: bonds (distance) C4'-P energy: -17.533 bonds (distance) P-C4' energy: -15.483 flat angles C4'-P-C4' energy: -14.190 flat angles P-C4'-P energy: -8.422 tors. eta vs tors. theta energy: -18.989 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -167.415825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.415825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.013353 (E_RNA) where: Base-Base interactions energy: -99.137 where: short stacking energy: -46.634 Base-Backbone interact. energy: -0.031 local terms energy: -68.845468 where: bonds (distance) C4'-P energy: -15.587 bonds (distance) P-C4' energy: -14.079 flat angles C4'-P-C4' energy: -12.559 flat angles P-C4'-P energy: -12.472 tors. eta vs tors. theta energy: -14.149 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -169.468083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.468083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.493070 (E_RNA) where: Base-Base interactions energy: -102.186 where: short stacking energy: -51.447 Base-Backbone interact. energy: -0.143 local terms energy: -67.163869 where: bonds (distance) C4'-P energy: -14.391 bonds (distance) P-C4' energy: -15.239 flat angles C4'-P-C4' energy: -10.928 flat angles P-C4'-P energy: -12.267 tors. eta vs tors. theta energy: -14.339 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -118.647533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.647533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.499340 (E_RNA) where: Base-Base interactions energy: -62.167 where: short stacking energy: -30.912 Base-Backbone interact. energy: -1.838 local terms energy: -55.494219 where: bonds (distance) C4'-P energy: -9.048 bonds (distance) P-C4' energy: -14.620 flat angles C4'-P-C4' energy: -17.168 flat angles P-C4'-P energy: -7.685 tors. eta vs tors. theta energy: -6.974 Dist. restrs. and SS energy: 0.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -135.535450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.535450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.659013 (E_RNA) where: Base-Base interactions energy: -86.214 where: short stacking energy: -42.856 Base-Backbone interact. energy: -0.444 local terms energy: -49.000789 where: bonds (distance) C4'-P energy: -11.345 bonds (distance) P-C4' energy: -12.968 flat angles C4'-P-C4' energy: -12.146 flat angles P-C4'-P energy: -6.315 tors. eta vs tors. theta energy: -6.228 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -122.257353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.257353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.054329 (E_RNA) where: Base-Base interactions energy: -62.587 where: short stacking energy: -40.977 Base-Backbone interact. energy: 0.843 local terms energy: -61.310496 where: bonds (distance) C4'-P energy: -10.999 bonds (distance) P-C4' energy: -16.119 flat angles C4'-P-C4' energy: -16.255 flat angles P-C4'-P energy: -8.247 tors. eta vs tors. theta energy: -9.690 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -136.749979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.749979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.812887 (E_RNA) where: Base-Base interactions energy: -76.681 where: short stacking energy: -40.711 Base-Backbone interact. energy: -0.189 local terms energy: -59.942504 where: bonds (distance) C4'-P energy: -14.794 bonds (distance) P-C4' energy: -15.025 flat angles C4'-P-C4' energy: -13.589 flat angles P-C4'-P energy: -6.672 tors. eta vs tors. theta energy: -9.863 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -130.599028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.599028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.671465 (E_RNA) where: Base-Base interactions energy: -76.677 where: short stacking energy: -34.428 Base-Backbone interact. energy: -1.422 local terms energy: -52.571687 where: bonds (distance) C4'-P energy: -9.051 bonds (distance) P-C4' energy: -13.738 flat angles C4'-P-C4' energy: -12.616 flat angles P-C4'-P energy: -11.903 tors. eta vs tors. theta energy: -5.264 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -89.120623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.120623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.548208 (E_RNA) where: Base-Base interactions energy: -42.173 where: short stacking energy: -24.964 Base-Backbone interact. energy: -1.079 local terms energy: -47.296361 where: bonds (distance) C4'-P energy: -13.692 bonds (distance) P-C4' energy: -8.542 flat angles C4'-P-C4' energy: -14.132 flat angles P-C4'-P energy: -6.797 tors. eta vs tors. theta energy: -4.133 Dist. restrs. and SS energy: 1.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -187.837669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.837669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.087574 (E_RNA) where: Base-Base interactions energy: -114.813 where: short stacking energy: -55.132 Base-Backbone interact. energy: 0.926 local terms energy: -76.199605 where: bonds (distance) C4'-P energy: -16.113 bonds (distance) P-C4' energy: -13.896 flat angles C4'-P-C4' energy: -18.110 flat angles P-C4'-P energy: -11.464 tors. eta vs tors. theta energy: -16.617 Dist. restrs. and SS energy: 2.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -191.157422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.157422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.420494 (E_RNA) where: Base-Base interactions energy: -116.485 where: short stacking energy: -64.224 Base-Backbone interact. energy: -0.330 local terms energy: -74.605236 where: bonds (distance) C4'-P energy: -13.728 bonds (distance) P-C4' energy: -17.625 flat angles C4'-P-C4' energy: -16.233 flat angles P-C4'-P energy: -4.726 tors. eta vs tors. theta energy: -22.292 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -164.125609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.125609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.125609 (E_RNA) where: Base-Base interactions energy: -96.159 where: short stacking energy: -49.217 Base-Backbone interact. energy: -0.058 local terms energy: -67.908684 where: bonds (distance) C4'-P energy: -14.850 bonds (distance) P-C4' energy: -17.241 flat angles C4'-P-C4' energy: -12.377 flat angles P-C4'-P energy: -13.729 tors. eta vs tors. theta energy: -9.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -156.382093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.382093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.803989 (E_RNA) where: Base-Base interactions energy: -89.664 where: short stacking energy: -37.657 Base-Backbone interact. energy: 1.537 local terms energy: -69.677695 where: bonds (distance) C4'-P energy: -16.412 bonds (distance) P-C4' energy: -16.981 flat angles C4'-P-C4' energy: -17.390 flat angles P-C4'-P energy: -9.776 tors. eta vs tors. theta energy: -9.119 Dist. restrs. and SS energy: 1.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -163.786592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.786592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.862615 (E_RNA) where: Base-Base interactions energy: -103.325 where: short stacking energy: -42.853 Base-Backbone interact. energy: -1.165 local terms energy: -59.372223 where: bonds (distance) C4'-P energy: -16.684 bonds (distance) P-C4' energy: -12.589 flat angles C4'-P-C4' energy: -18.547 flat angles P-C4'-P energy: -5.962 tors. eta vs tors. theta energy: -5.591 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -133.529981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.529981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.629902 (E_RNA) where: Base-Base interactions energy: -77.600 where: short stacking energy: -41.689 Base-Backbone interact. energy: -0.055 local terms energy: -56.975623 where: bonds (distance) C4'-P energy: -16.716 bonds (distance) P-C4' energy: -14.365 flat angles C4'-P-C4' energy: -10.498 flat angles P-C4'-P energy: -8.253 tors. eta vs tors. theta energy: -7.144 Dist. restrs. and SS energy: 1.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -144.808193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.808193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.824887 (E_RNA) where: Base-Base interactions energy: -90.180 where: short stacking energy: -44.603 Base-Backbone interact. energy: -0.132 local terms energy: -54.513202 where: bonds (distance) C4'-P energy: -12.455 bonds (distance) P-C4' energy: -13.020 flat angles C4'-P-C4' energy: -15.966 flat angles P-C4'-P energy: -6.619 tors. eta vs tors. theta energy: -6.454 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -105.407020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.407020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.915235 (E_RNA) where: Base-Base interactions energy: -57.608 where: short stacking energy: -32.460 Base-Backbone interact. energy: -0.069 local terms energy: -49.238003 where: bonds (distance) C4'-P energy: -5.895 bonds (distance) P-C4' energy: -15.617 flat angles C4'-P-C4' energy: -12.541 flat angles P-C4'-P energy: -9.945 tors. eta vs tors. theta energy: -5.241 Dist. restrs. and SS energy: 1.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -120.462293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.462293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.462293 (E_RNA) where: Base-Base interactions energy: -68.489 where: short stacking energy: -33.826 Base-Backbone interact. energy: -0.252 local terms energy: -51.721483 where: bonds (distance) C4'-P energy: -13.804 bonds (distance) P-C4' energy: -18.504 flat angles C4'-P-C4' energy: -5.947 flat angles P-C4'-P energy: -6.121 tors. eta vs tors. theta energy: -7.345 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -121.848790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.848790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.805084 (E_RNA) where: Base-Base interactions energy: -72.666 where: short stacking energy: -32.710 Base-Backbone interact. energy: -0.431 local terms energy: -49.707921 where: bonds (distance) C4'-P energy: -6.128 bonds (distance) P-C4' energy: -16.455 flat angles C4'-P-C4' energy: -13.109 flat angles P-C4'-P energy: -7.811 tors. eta vs tors. theta energy: -6.205 Dist. restrs. and SS energy: 0.956 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -178.805640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.805640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.105459 (E_RNA) where: Base-Base interactions energy: -118.753 where: short stacking energy: -55.020 Base-Backbone interact. energy: -0.013 local terms energy: -62.339501 where: bonds (distance) C4'-P energy: -17.359 bonds (distance) P-C4' energy: -15.617 flat angles C4'-P-C4' energy: -17.746 flat angles P-C4'-P energy: -4.996 tors. eta vs tors. theta energy: -6.621 Dist. restrs. and SS energy: 2.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -208.662937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.662937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.810867 (E_RNA) where: Base-Base interactions energy: -132.455 where: short stacking energy: -67.537 Base-Backbone interact. energy: -0.023 local terms energy: -76.333069 where: bonds (distance) C4'-P energy: -16.122 bonds (distance) P-C4' energy: -17.781 flat angles C4'-P-C4' energy: -12.770 flat angles P-C4'-P energy: -12.585 tors. eta vs tors. theta energy: -17.076 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -170.975011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.975011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.369510 (E_RNA) where: Base-Base interactions energy: -100.794 where: short stacking energy: -60.061 Base-Backbone interact. energy: -0.066 local terms energy: -70.508610 where: bonds (distance) C4'-P energy: -13.215 bonds (distance) P-C4' energy: -14.617 flat angles C4'-P-C4' energy: -17.202 flat angles P-C4'-P energy: -10.168 tors. eta vs tors. theta energy: -15.307 Dist. restrs. and SS energy: 0.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -169.241269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.241269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.241269 (E_RNA) where: Base-Base interactions energy: -103.577 where: short stacking energy: -63.762 Base-Backbone interact. energy: -0.394 local terms energy: -65.270226 where: bonds (distance) C4'-P energy: -11.663 bonds (distance) P-C4' energy: -13.909 flat angles C4'-P-C4' energy: -16.231 flat angles P-C4'-P energy: -8.484 tors. eta vs tors. theta energy: -14.984 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -153.984114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.984114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.621596 (E_RNA) where: Base-Base interactions energy: -89.634 where: short stacking energy: -42.302 Base-Backbone interact. energy: -0.920 local terms energy: -64.068082 where: bonds (distance) C4'-P energy: -11.883 bonds (distance) P-C4' energy: -15.920 flat angles C4'-P-C4' energy: -14.249 flat angles P-C4'-P energy: -8.927 tors. eta vs tors. theta energy: -13.090 Dist. restrs. and SS energy: 0.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -164.426839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.426839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.808189 (E_RNA) where: Base-Base interactions energy: -106.955 where: short stacking energy: -56.720 Base-Backbone interact. energy: -0.101 local terms energy: -57.751819 where: bonds (distance) C4'-P energy: -15.803 bonds (distance) P-C4' energy: -12.735 flat angles C4'-P-C4' energy: -14.298 flat angles P-C4'-P energy: -3.420 tors. eta vs tors. theta energy: -11.497 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -138.250744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.250744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.373032 (E_RNA) where: Base-Base interactions energy: -75.241 where: short stacking energy: -43.353 Base-Backbone interact. energy: -0.198 local terms energy: -62.934574 where: bonds (distance) C4'-P energy: -8.409 bonds (distance) P-C4' energy: -18.614 flat angles C4'-P-C4' energy: -12.696 flat angles P-C4'-P energy: -11.970 tors. eta vs tors. theta energy: -11.245 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -126.448362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.448362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.448362 (E_RNA) where: Base-Base interactions energy: -70.806 where: short stacking energy: -32.881 Base-Backbone interact. energy: -0.164 local terms energy: -55.478053 where: bonds (distance) C4'-P energy: -15.537 bonds (distance) P-C4' energy: -15.584 flat angles C4'-P-C4' energy: -12.253 flat angles P-C4'-P energy: -7.329 tors. eta vs tors. theta energy: -4.775 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -92.292788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.292788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.654558 (E_RNA) where: Base-Base interactions energy: -54.049 where: short stacking energy: -16.261 Base-Backbone interact. energy: -0.745 local terms energy: -37.860920 where: bonds (distance) C4'-P energy: -16.043 bonds (distance) P-C4' energy: -14.623 flat angles C4'-P-C4' energy: -12.733 flat angles P-C4'-P energy: -1.645 tors. eta vs tors. theta energy: 7.183 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -129.772198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.772198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.876241 (E_RNA) where: Base-Base interactions energy: -79.909 where: short stacking energy: -24.267 Base-Backbone interact. energy: -0.146 local terms energy: -49.820786 where: bonds (distance) C4'-P energy: -8.517 bonds (distance) P-C4' energy: -12.607 flat angles C4'-P-C4' energy: -17.724 flat angles P-C4'-P energy: -7.138 tors. eta vs tors. theta energy: -3.834 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -182.870807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.870807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.351844 (E_RNA) where: Base-Base interactions energy: -109.157 where: short stacking energy: -63.063 Base-Backbone interact. energy: 0.690 local terms energy: -75.884480 where: bonds (distance) C4'-P energy: -13.857 bonds (distance) P-C4' energy: -17.628 flat angles C4'-P-C4' energy: -14.398 flat angles P-C4'-P energy: -13.502 tors. eta vs tors. theta energy: -16.499 Dist. restrs. and SS energy: 1.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -193.763238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.763238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.247799 (E_RNA) where: Base-Base interactions energy: -127.012 where: short stacking energy: -58.209 Base-Backbone interact. energy: -0.246 local terms energy: -67.989909 where: bonds (distance) C4'-P energy: -14.073 bonds (distance) P-C4' energy: -15.061 flat angles C4'-P-C4' energy: -12.851 flat angles P-C4'-P energy: -13.357 tors. eta vs tors. theta energy: -12.648 Dist. restrs. and SS energy: 1.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -174.088809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.088809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.193959 (E_RNA) where: Base-Base interactions energy: -100.441 where: short stacking energy: -59.062 Base-Backbone interact. energy: -0.052 local terms energy: -73.701579 where: bonds (distance) C4'-P energy: -16.341 bonds (distance) P-C4' energy: -18.260 flat angles C4'-P-C4' energy: -15.510 flat angles P-C4'-P energy: -9.127 tors. eta vs tors. theta energy: -14.464 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -168.460041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.460041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.682366 (E_RNA) where: Base-Base interactions energy: -102.714 where: short stacking energy: -55.277 Base-Backbone interact. energy: -0.161 local terms energy: -65.807774 where: bonds (distance) C4'-P energy: -12.976 bonds (distance) P-C4' energy: -12.840 flat angles C4'-P-C4' energy: -15.652 flat angles P-C4'-P energy: -9.987 tors. eta vs tors. theta energy: -14.353 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -157.862619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.862619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.862619 (E_RNA) where: Base-Base interactions energy: -93.143 where: short stacking energy: -58.102 Base-Backbone interact. energy: -0.101 local terms energy: -64.618084 where: bonds (distance) C4'-P energy: -10.451 bonds (distance) P-C4' energy: -16.202 flat angles C4'-P-C4' energy: -15.447 flat angles P-C4'-P energy: -10.244 tors. eta vs tors. theta energy: -12.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -141.586914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.586914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.251050 (E_RNA) where: Base-Base interactions energy: -88.152 where: short stacking energy: -47.738 Base-Backbone interact. energy: -0.025 local terms energy: -56.074525 where: bonds (distance) C4'-P energy: -15.256 bonds (distance) P-C4' energy: -12.589 flat angles C4'-P-C4' energy: -13.374 flat angles P-C4'-P energy: -6.581 tors. eta vs tors. theta energy: -8.274 Dist. restrs. and SS energy: 2.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -121.118495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.118495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.118495 (E_RNA) where: Base-Base interactions energy: -65.694 where: short stacking energy: -36.356 Base-Backbone interact. energy: -0.229 local terms energy: -55.195186 where: bonds (distance) C4'-P energy: -10.680 bonds (distance) P-C4' energy: -15.279 flat angles C4'-P-C4' energy: -15.269 flat angles P-C4'-P energy: -10.310 tors. eta vs tors. theta energy: -3.656 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -126.292329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.292329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.535887 (E_RNA) where: Base-Base interactions energy: -63.535 where: short stacking energy: -31.294 Base-Backbone interact. energy: -0.433 local terms energy: -62.568260 where: bonds (distance) C4'-P energy: -16.515 bonds (distance) P-C4' energy: -15.589 flat angles C4'-P-C4' energy: -18.321 flat angles P-C4'-P energy: -7.603 tors. eta vs tors. theta energy: -4.540 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -144.852432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.852432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.986034 (E_RNA) where: Base-Base interactions energy: -86.805 where: short stacking energy: -45.809 Base-Backbone interact. energy: -0.037 local terms energy: -58.144702 where: bonds (distance) C4'-P energy: -10.068 bonds (distance) P-C4' energy: -15.761 flat angles C4'-P-C4' energy: -16.553 flat angles P-C4'-P energy: -6.419 tors. eta vs tors. theta energy: -9.343 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -90.666665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.666665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.014782 (E_RNA) where: Base-Base interactions energy: -45.217 where: short stacking energy: -14.392 Base-Backbone interact. energy: -0.449 local terms energy: -45.348157 where: bonds (distance) C4'-P energy: -7.125 bonds (distance) P-C4' energy: -14.992 flat angles C4'-P-C4' energy: -11.875 flat angles P-C4'-P energy: -10.975 tors. eta vs tors. theta energy: -0.380 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -185.581814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.581814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.581814 (E_RNA) where: Base-Base interactions energy: -113.169 where: short stacking energy: -63.470 Base-Backbone interact. energy: -0.001 local terms energy: -72.412122 where: bonds (distance) C4'-P energy: -13.212 bonds (distance) P-C4' energy: -18.880 flat angles C4'-P-C4' energy: -16.835 flat angles P-C4'-P energy: -10.445 tors. eta vs tors. theta energy: -13.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -176.201788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.201788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.253709 (E_RNA) where: Base-Base interactions energy: -104.048 where: short stacking energy: -53.197 Base-Backbone interact. energy: -0.496 local terms energy: -71.710100 where: bonds (distance) C4'-P energy: -16.949 bonds (distance) P-C4' energy: -17.195 flat angles C4'-P-C4' energy: -16.902 flat angles P-C4'-P energy: -12.659 tors. eta vs tors. theta energy: -8.004 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -164.383194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.383194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.383194 (E_RNA) where: Base-Base interactions energy: -96.895 where: short stacking energy: -47.638 Base-Backbone interact. energy: -0.115 local terms energy: -67.372551 where: bonds (distance) C4'-P energy: -16.506 bonds (distance) P-C4' energy: -14.721 flat angles C4'-P-C4' energy: -11.167 flat angles P-C4'-P energy: -12.514 tors. eta vs tors. theta energy: -12.465 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -148.208605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.208605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.134049 (E_RNA) where: Base-Base interactions energy: -90.755 where: short stacking energy: -49.743 Base-Backbone interact. energy: -0.113 local terms energy: -58.265626 where: bonds (distance) C4'-P energy: -10.375 bonds (distance) P-C4' energy: -12.360 flat angles C4'-P-C4' energy: -13.161 flat angles P-C4'-P energy: -8.499 tors. eta vs tors. theta energy: -13.871 Dist. restrs. and SS energy: 0.925 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -155.407400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.407400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.440027 (E_RNA) where: Base-Base interactions energy: -103.379 where: short stacking energy: -49.488 Base-Backbone interact. energy: 0.467 local terms energy: -52.527813 where: bonds (distance) C4'-P energy: -12.361 bonds (distance) P-C4' energy: -7.855 flat angles C4'-P-C4' energy: -13.479 flat angles P-C4'-P energy: -11.030 tors. eta vs tors. theta energy: -7.803 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -150.227924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.227924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.135266 (E_RNA) where: Base-Base interactions energy: -93.174 where: short stacking energy: -35.423 Base-Backbone interact. energy: -0.414 local terms energy: -57.547453 where: bonds (distance) C4'-P energy: -6.403 bonds (distance) P-C4' energy: -14.504 flat angles C4'-P-C4' energy: -16.111 flat angles P-C4'-P energy: -11.037 tors. eta vs tors. theta energy: -9.494 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -123.564579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.564579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.753159 (E_RNA) where: Base-Base interactions energy: -58.413 where: short stacking energy: -35.888 Base-Backbone interact. energy: -0.099 local terms energy: -65.241049 where: bonds (distance) C4'-P energy: -17.500 bonds (distance) P-C4' energy: -17.597 flat angles C4'-P-C4' energy: -14.333 flat angles P-C4'-P energy: -9.760 tors. eta vs tors. theta energy: -6.051 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -146.794309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.794309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.619207 (E_RNA) where: Base-Base interactions energy: -81.413 where: short stacking energy: -41.111 Base-Backbone interact. energy: -0.015 local terms energy: -67.191541 where: bonds (distance) C4'-P energy: -15.757 bonds (distance) P-C4' energy: -15.317 flat angles C4'-P-C4' energy: -15.519 flat angles P-C4'-P energy: -6.655 tors. eta vs tors. theta energy: -13.945 Dist. restrs. and SS energy: 1.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -132.736816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.736816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.775094 (E_RNA) where: Base-Base interactions energy: -73.574 where: short stacking energy: -38.526 Base-Backbone interact. energy: -0.165 local terms energy: -59.035778 where: bonds (distance) C4'-P energy: -15.219 bonds (distance) P-C4' energy: -13.980 flat angles C4'-P-C4' energy: -12.069 flat angles P-C4'-P energy: -8.342 tors. eta vs tors. theta energy: -9.426 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -84.654970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.654970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.401166 (E_RNA) where: Base-Base interactions energy: -44.108 where: short stacking energy: -16.473 Base-Backbone interact. energy: -0.184 local terms energy: -41.109015 where: bonds (distance) C4'-P energy: -13.873 bonds (distance) P-C4' energy: -15.395 flat angles C4'-P-C4' energy: -5.544 flat angles P-C4'-P energy: -6.925 tors. eta vs tors. theta energy: 0.628 Dist. restrs. and SS energy: 0.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -207.473228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.473228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.488942 (E_RNA) where: Base-Base interactions energy: -143.747 where: short stacking energy: -53.738 Base-Backbone interact. energy: -0.409 local terms energy: -63.333189 where: bonds (distance) C4'-P energy: -16.402 bonds (distance) P-C4' energy: -14.508 flat angles C4'-P-C4' energy: -15.262 flat angles P-C4'-P energy: -4.045 tors. eta vs tors. theta energy: -13.116 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -193.508689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.508689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.550011 (E_RNA) where: Base-Base interactions energy: -139.635 where: short stacking energy: -51.025 Base-Backbone interact. energy: -1.177 local terms energy: -52.737420 where: bonds (distance) C4'-P energy: -13.670 bonds (distance) P-C4' energy: -11.269 flat angles C4'-P-C4' energy: -10.973 flat angles P-C4'-P energy: -7.041 tors. eta vs tors. theta energy: -9.784 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -159.810115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.810115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.814017 (E_RNA) where: Base-Base interactions energy: -95.632 where: short stacking energy: -46.932 Base-Backbone interact. energy: -0.109 local terms energy: -64.073593 where: bonds (distance) C4'-P energy: -14.148 bonds (distance) P-C4' energy: -14.367 flat angles C4'-P-C4' energy: -17.320 flat angles P-C4'-P energy: -5.278 tors. eta vs tors. theta energy: -12.961 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -156.648054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.648054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.648054 (E_RNA) where: Base-Base interactions energy: -86.581 where: short stacking energy: -46.256 Base-Backbone interact. energy: -0.055 local terms energy: -70.011202 where: bonds (distance) C4'-P energy: -16.468 bonds (distance) P-C4' energy: -15.265 flat angles C4'-P-C4' energy: -14.411 flat angles P-C4'-P energy: -9.534 tors. eta vs tors. theta energy: -14.334 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -156.959385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.959385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.721352 (E_RNA) where: Base-Base interactions energy: -94.231 where: short stacking energy: -48.016 Base-Backbone interact. energy: -0.064 local terms energy: -64.426449 where: bonds (distance) C4'-P energy: -12.925 bonds (distance) P-C4' energy: -16.664 flat angles C4'-P-C4' energy: -19.397 flat angles P-C4'-P energy: -6.613 tors. eta vs tors. theta energy: -8.827 Dist. restrs. and SS energy: 1.762 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -163.139393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.139393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.330714 (E_RNA) where: Base-Base interactions energy: -103.752 where: short stacking energy: -48.994 Base-Backbone interact. energy: -0.013 local terms energy: -59.565470 where: bonds (distance) C4'-P energy: -11.889 bonds (distance) P-C4' energy: -11.096 flat angles C4'-P-C4' energy: -10.211 flat angles P-C4'-P energy: -9.026 tors. eta vs tors. theta energy: -17.342 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -135.229649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.229649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.428709 (E_RNA) where: Base-Base interactions energy: -72.041 where: short stacking energy: -34.293 Base-Backbone interact. energy: 0.857 local terms energy: -65.244733 where: bonds (distance) C4'-P energy: -16.093 bonds (distance) P-C4' energy: -14.014 flat angles C4'-P-C4' energy: -18.399 flat angles P-C4'-P energy: -13.576 tors. eta vs tors. theta energy: -3.164 Dist. restrs. and SS energy: 1.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -133.195667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.195667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.195667 (E_RNA) where: Base-Base interactions energy: -69.985 where: short stacking energy: -36.407 Base-Backbone interact. energy: 0.126 local terms energy: -63.337304 where: bonds (distance) C4'-P energy: -10.301 bonds (distance) P-C4' energy: -17.009 flat angles C4'-P-C4' energy: -18.039 flat angles P-C4'-P energy: -13.157 tors. eta vs tors. theta energy: -4.831 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -137.871414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.871414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.010656 (E_RNA) where: Base-Base interactions energy: -79.932 where: short stacking energy: -36.452 Base-Backbone interact. energy: -0.217 local terms energy: -57.861830 where: bonds (distance) C4'-P energy: -11.146 bonds (distance) P-C4' energy: -16.424 flat angles C4'-P-C4' energy: -12.940 flat angles P-C4'-P energy: -8.137 tors. eta vs tors. theta energy: -9.214 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -108.599673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.599673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.599673 (E_RNA) where: Base-Base interactions energy: -64.194 where: short stacking energy: -29.440 Base-Backbone interact. energy: 0.975 local terms energy: -45.379786 where: bonds (distance) C4'-P energy: -15.348 bonds (distance) P-C4' energy: -14.725 flat angles C4'-P-C4' energy: -9.732 flat angles P-C4'-P energy: -5.525 tors. eta vs tors. theta energy: -0.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -210.119843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.119843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.119843 (E_RNA) where: Base-Base interactions energy: -138.873 where: short stacking energy: -59.244 Base-Backbone interact. energy: 0.510 local terms energy: -71.756987 where: bonds (distance) C4'-P energy: -15.804 bonds (distance) P-C4' energy: -13.615 flat angles C4'-P-C4' energy: -17.612 flat angles P-C4'-P energy: -11.914 tors. eta vs tors. theta energy: -12.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -173.639745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.639745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.928893 (E_RNA) where: Base-Base interactions energy: -105.611 where: short stacking energy: -45.382 Base-Backbone interact. energy: -0.304 local terms energy: -68.013994 where: bonds (distance) C4'-P energy: -14.388 bonds (distance) P-C4' energy: -17.831 flat angles C4'-P-C4' energy: -16.243 flat angles P-C4'-P energy: -8.598 tors. eta vs tors. theta energy: -10.954 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -197.540587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.540587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.540587 (E_RNA) where: Base-Base interactions energy: -132.690 where: short stacking energy: -57.683 Base-Backbone interact. energy: -0.259 local terms energy: -64.591501 where: bonds (distance) C4'-P energy: -15.500 bonds (distance) P-C4' energy: -18.404 flat angles C4'-P-C4' energy: -11.557 flat angles P-C4'-P energy: -8.995 tors. eta vs tors. theta energy: -10.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -155.947273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.947273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.947273 (E_RNA) where: Base-Base interactions energy: -91.920 where: short stacking energy: -43.441 Base-Backbone interact. energy: -0.059 local terms energy: -63.968643 where: bonds (distance) C4'-P energy: -15.716 bonds (distance) P-C4' energy: -15.345 flat angles C4'-P-C4' energy: -13.205 flat angles P-C4'-P energy: -8.037 tors. eta vs tors. theta energy: -11.666 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -126.258851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.258851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.362622 (E_RNA) where: Base-Base interactions energy: -67.363 where: short stacking energy: -42.549 Base-Backbone interact. energy: -0.248 local terms energy: -59.751268 where: bonds (distance) C4'-P energy: -11.990 bonds (distance) P-C4' energy: -15.272 flat angles C4'-P-C4' energy: -14.114 flat angles P-C4'-P energy: -9.025 tors. eta vs tors. theta energy: -9.350 Dist. restrs. and SS energy: 1.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -143.694473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.694473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.167899 (E_RNA) where: Base-Base interactions energy: -86.378 where: short stacking energy: -45.158 Base-Backbone interact. energy: -0.370 local terms energy: -58.419599 where: bonds (distance) C4'-P energy: -9.834 bonds (distance) P-C4' energy: -17.911 flat angles C4'-P-C4' energy: -17.571 flat angles P-C4'-P energy: -8.053 tors. eta vs tors. theta energy: -5.052 Dist. restrs. and SS energy: 1.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -156.105291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.105291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.124560 (E_RNA) where: Base-Base interactions energy: -96.288 where: short stacking energy: -53.602 Base-Backbone interact. energy: -0.150 local terms energy: -59.687284 where: bonds (distance) C4'-P energy: -11.431 bonds (distance) P-C4' energy: -15.184 flat angles C4'-P-C4' energy: -11.417 flat angles P-C4'-P energy: -8.291 tors. eta vs tors. theta energy: -13.365 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -166.033621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.033621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.074233 (E_RNA) where: Base-Base interactions energy: -101.804 where: short stacking energy: -37.762 Base-Backbone interact. energy: -0.030 local terms energy: -64.240104 where: bonds (distance) C4'-P energy: -16.073 bonds (distance) P-C4' energy: -14.567 flat angles C4'-P-C4' energy: -15.998 flat angles P-C4'-P energy: -4.858 tors. eta vs tors. theta energy: -12.744 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -123.846858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.846858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.846858 (E_RNA) where: Base-Base interactions energy: -71.291 where: short stacking energy: -31.702 Base-Backbone interact. energy: 0.786 local terms energy: -53.341433 where: bonds (distance) C4'-P energy: -12.538 bonds (distance) P-C4' energy: -14.661 flat angles C4'-P-C4' energy: -15.323 flat angles P-C4'-P energy: -9.086 tors. eta vs tors. theta energy: -1.733 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -140.952028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.952028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.006463 (E_RNA) where: Base-Base interactions energy: -89.860 where: short stacking energy: -48.470 Base-Backbone interact. energy: -0.271 local terms energy: -50.876082 where: bonds (distance) C4'-P energy: -12.851 bonds (distance) P-C4' energy: -12.356 flat angles C4'-P-C4' energy: -12.544 flat angles P-C4'-P energy: -2.208 tors. eta vs tors. theta energy: -10.917 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -190.755943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.755943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.880308 (E_RNA) where: Base-Base interactions energy: -124.117 where: short stacking energy: -55.890 Base-Backbone interact. energy: -0.318 local terms energy: -66.445573 where: bonds (distance) C4'-P energy: -12.542 bonds (distance) P-C4' energy: -15.674 flat angles C4'-P-C4' energy: -17.461 flat angles P-C4'-P energy: -5.453 tors. eta vs tors. theta energy: -15.316 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -213.914054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.914054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.822216 (E_RNA) where: Base-Base interactions energy: -147.905 where: short stacking energy: -53.428 Base-Backbone interact. energy: -0.275 local terms energy: -66.641543 where: bonds (distance) C4'-P energy: -15.430 bonds (distance) P-C4' energy: -15.101 flat angles C4'-P-C4' energy: -14.315 flat angles P-C4'-P energy: -13.407 tors. eta vs tors. theta energy: -8.388 Dist. restrs. and SS energy: 0.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -184.089878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.089878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.869017 (E_RNA) where: Base-Base interactions energy: -115.600 where: short stacking energy: -51.997 Base-Backbone interact. energy: -0.118 local terms energy: -69.150261 where: bonds (distance) C4'-P energy: -14.366 bonds (distance) P-C4' energy: -17.890 flat angles C4'-P-C4' energy: -15.884 flat angles P-C4'-P energy: -10.210 tors. eta vs tors. theta energy: -10.802 Dist. restrs. and SS energy: 0.779 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -156.549493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.549493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.170044 (E_RNA) where: Base-Base interactions energy: -85.815 where: short stacking energy: -48.845 Base-Backbone interact. energy: -0.062 local terms energy: -74.293133 where: bonds (distance) C4'-P energy: -17.360 bonds (distance) P-C4' energy: -17.538 flat angles C4'-P-C4' energy: -15.506 flat angles P-C4'-P energy: -9.645 tors. eta vs tors. theta energy: -14.244 Dist. restrs. and SS energy: 3.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -155.330844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.330844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.239584 (E_RNA) where: Base-Base interactions energy: -87.929 where: short stacking energy: -49.826 Base-Backbone interact. energy: -0.131 local terms energy: -70.179159 where: bonds (distance) C4'-P energy: -13.368 bonds (distance) P-C4' energy: -15.970 flat angles C4'-P-C4' energy: -17.161 flat angles P-C4'-P energy: -11.426 tors. eta vs tors. theta energy: -12.253 Dist. restrs. and SS energy: 2.909 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -118.733818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.733818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.604762 (E_RNA) where: Base-Base interactions energy: -64.749 where: short stacking energy: -21.587 Base-Backbone interact. energy: -0.395 local terms energy: -54.461449 where: bonds (distance) C4'-P energy: -14.365 bonds (distance) P-C4' energy: -17.019 flat angles C4'-P-C4' energy: -14.893 flat angles P-C4'-P energy: -8.322 tors. eta vs tors. theta energy: 0.138 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -152.437357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.437357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.450241 (E_RNA) where: Base-Base interactions energy: -98.213 where: short stacking energy: -44.937 Base-Backbone interact. energy: 1.989 local terms energy: -56.225645 where: bonds (distance) C4'-P energy: -9.154 bonds (distance) P-C4' energy: -12.303 flat angles C4'-P-C4' energy: -14.752 flat angles P-C4'-P energy: -10.717 tors. eta vs tors. theta energy: -9.300 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -153.005415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.005415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.005415 (E_RNA) where: Base-Base interactions energy: -100.526 where: short stacking energy: -43.849 Base-Backbone interact. energy: 0.689 local terms energy: -53.168814 where: bonds (distance) C4'-P energy: -12.887 bonds (distance) P-C4' energy: -13.727 flat angles C4'-P-C4' energy: -8.321 flat angles P-C4'-P energy: -5.362 tors. eta vs tors. theta energy: -12.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -125.743967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.743967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.882252 (E_RNA) where: Base-Base interactions energy: -68.732 where: short stacking energy: -32.811 Base-Backbone interact. energy: -0.035 local terms energy: -57.115227 where: bonds (distance) C4'-P energy: -16.895 bonds (distance) P-C4' energy: -11.488 flat angles C4'-P-C4' energy: -15.161 flat angles P-C4'-P energy: -8.648 tors. eta vs tors. theta energy: -4.923 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -125.340905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.340905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.340905 (E_RNA) where: Base-Base interactions energy: -67.036 where: short stacking energy: -28.334 Base-Backbone interact. energy: -0.231 local terms energy: -58.074436 where: bonds (distance) C4'-P energy: -15.708 bonds (distance) P-C4' energy: -15.469 flat angles C4'-P-C4' energy: -13.624 flat angles P-C4'-P energy: -13.489 tors. eta vs tors. theta energy: 0.215 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -202.610211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.610211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.610211 (E_RNA) where: Base-Base interactions energy: -135.277 where: short stacking energy: -53.201 Base-Backbone interact. energy: -0.369 local terms energy: -66.964904 where: bonds (distance) C4'-P energy: -11.505 bonds (distance) P-C4' energy: -19.305 flat angles C4'-P-C4' energy: -13.570 flat angles P-C4'-P energy: -8.771 tors. eta vs tors. theta energy: -13.814 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -226.149539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.149539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.558311 (E_RNA) where: Base-Base interactions energy: -161.554 where: short stacking energy: -57.911 Base-Backbone interact. energy: -0.318 local terms energy: -64.686364 where: bonds (distance) C4'-P energy: -15.887 bonds (distance) P-C4' energy: -12.518 flat angles C4'-P-C4' energy: -14.621 flat angles P-C4'-P energy: -8.890 tors. eta vs tors. theta energy: -12.770 Dist. restrs. and SS energy: 0.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -181.238796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.238796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.532766 (E_RNA) where: Base-Base interactions energy: -113.233 where: short stacking energy: -49.982 Base-Backbone interact. energy: 0.980 local terms energy: -69.279966 where: bonds (distance) C4'-P energy: -14.267 bonds (distance) P-C4' energy: -16.256 flat angles C4'-P-C4' energy: -17.345 flat angles P-C4'-P energy: -9.214 tors. eta vs tors. theta energy: -12.198 Dist. restrs. and SS energy: 0.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -173.445093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.445093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.544306 (E_RNA) where: Base-Base interactions energy: -103.063 where: short stacking energy: -57.019 Base-Backbone interact. energy: -0.124 local terms energy: -70.357553 where: bonds (distance) C4'-P energy: -16.192 bonds (distance) P-C4' energy: -16.268 flat angles C4'-P-C4' energy: -11.731 flat angles P-C4'-P energy: -10.876 tors. eta vs tors. theta energy: -15.291 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -150.329556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.329556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.349282 (E_RNA) where: Base-Base interactions energy: -83.760 where: short stacking energy: -46.405 Base-Backbone interact. energy: -0.123 local terms energy: -66.467155 where: bonds (distance) C4'-P energy: -13.605 bonds (distance) P-C4' energy: -18.657 flat angles C4'-P-C4' energy: -13.710 flat angles P-C4'-P energy: -9.601 tors. eta vs tors. theta energy: -10.894 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -183.742095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.742095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.755161 (E_RNA) where: Base-Base interactions energy: -122.270 where: short stacking energy: -51.296 Base-Backbone interact. energy: -0.344 local terms energy: -61.141090 where: bonds (distance) C4'-P energy: -10.781 bonds (distance) P-C4' energy: -14.073 flat angles C4'-P-C4' energy: -13.009 flat angles P-C4'-P energy: -8.155 tors. eta vs tors. theta energy: -15.124 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -112.312658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.312658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.894046 (E_RNA) where: Base-Base interactions energy: -51.641 where: short stacking energy: -32.427 Base-Backbone interact. energy: -0.008 local terms energy: -61.245614 where: bonds (distance) C4'-P energy: -12.793 bonds (distance) P-C4' energy: -18.334 flat angles C4'-P-C4' energy: -11.024 flat angles P-C4'-P energy: -10.412 tors. eta vs tors. theta energy: -8.683 Dist. restrs. and SS energy: 0.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -134.103675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.103675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.103675 (E_RNA) where: Base-Base interactions energy: -78.646 where: short stacking energy: -39.646 Base-Backbone interact. energy: -0.027 local terms energy: -55.430897 where: bonds (distance) C4'-P energy: -9.573 bonds (distance) P-C4' energy: -18.680 flat angles C4'-P-C4' energy: -17.510 flat angles P-C4'-P energy: -5.280 tors. eta vs tors. theta energy: -4.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -126.267495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.267495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.290417 (E_RNA) where: Base-Base interactions energy: -72.717 where: short stacking energy: -30.338 Base-Backbone interact. energy: -0.062 local terms energy: -53.511742 where: bonds (distance) C4'-P energy: -14.734 bonds (distance) P-C4' energy: -13.440 flat angles C4'-P-C4' energy: -14.242 flat angles P-C4'-P energy: -6.069 tors. eta vs tors. theta energy: -5.027 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -118.114423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.114423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.371761 (E_RNA) where: Base-Base interactions energy: -70.359 where: short stacking energy: -36.930 Base-Backbone interact. energy: -0.238 local terms energy: -48.774802 where: bonds (distance) C4'-P energy: -11.836 bonds (distance) P-C4' energy: -12.343 flat angles C4'-P-C4' energy: -14.295 flat angles P-C4'-P energy: -5.081 tors. eta vs tors. theta energy: -5.219 Dist. restrs. and SS energy: 1.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -230.847089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.847089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.953966 (E_RNA) where: Base-Base interactions energy: -159.323 where: short stacking energy: -61.238 Base-Backbone interact. energy: -0.296 local terms energy: -71.334318 where: bonds (distance) C4'-P energy: -16.272 bonds (distance) P-C4' energy: -16.433 flat angles C4'-P-C4' energy: -15.258 flat angles P-C4'-P energy: -8.219 tors. eta vs tors. theta energy: -15.153 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -197.437617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.437617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.543491 (E_RNA) where: Base-Base interactions energy: -131.285 where: short stacking energy: -60.270 Base-Backbone interact. energy: -0.356 local terms energy: -65.902660 where: bonds (distance) C4'-P energy: -13.738 bonds (distance) P-C4' energy: -15.253 flat angles C4'-P-C4' energy: -14.807 flat angles P-C4'-P energy: -11.996 tors. eta vs tors. theta energy: -10.109 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -174.498484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.498484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.646716 (E_RNA) where: Base-Base interactions energy: -103.882 where: short stacking energy: -57.887 Base-Backbone interact. energy: -0.016 local terms energy: -70.748076 where: bonds (distance) C4'-P energy: -17.740 bonds (distance) P-C4' energy: -19.116 flat angles C4'-P-C4' energy: -13.358 flat angles P-C4'-P energy: -7.835 tors. eta vs tors. theta energy: -12.699 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -167.251792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.251792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.251792 (E_RNA) where: Base-Base interactions energy: -104.348 where: short stacking energy: -30.301 Base-Backbone interact. energy: -0.201 local terms energy: -62.702802 where: bonds (distance) C4'-P energy: -14.374 bonds (distance) P-C4' energy: -18.862 flat angles C4'-P-C4' energy: -15.287 flat angles P-C4'-P energy: -7.742 tors. eta vs tors. theta energy: -6.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -176.559515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.559515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.559515 (E_RNA) where: Base-Base interactions energy: -104.034 where: short stacking energy: -52.258 Base-Backbone interact. energy: -0.191 local terms energy: -72.334398 where: bonds (distance) C4'-P energy: -16.026 bonds (distance) P-C4' energy: -18.057 flat angles C4'-P-C4' energy: -11.584 flat angles P-C4'-P energy: -11.852 tors. eta vs tors. theta energy: -14.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -153.725492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.725492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.736412 (E_RNA) where: Base-Base interactions energy: -86.165 where: short stacking energy: -45.911 Base-Backbone interact. energy: -0.997 local terms energy: -66.574422 where: bonds (distance) C4'-P energy: -11.911 bonds (distance) P-C4' energy: -16.914 flat angles C4'-P-C4' energy: -15.749 flat angles P-C4'-P energy: -10.990 tors. eta vs tors. theta energy: -11.011 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -130.776508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.776508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.036214 (E_RNA) where: Base-Base interactions energy: -72.139 where: short stacking energy: -41.748 Base-Backbone interact. energy: -0.069 local terms energy: -58.828547 where: bonds (distance) C4'-P energy: -12.898 bonds (distance) P-C4' energy: -15.677 flat angles C4'-P-C4' energy: -11.993 flat angles P-C4'-P energy: -8.568 tors. eta vs tors. theta energy: -9.692 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -91.780812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.780812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.058727 (E_RNA) where: Base-Base interactions energy: -41.505 where: short stacking energy: -31.967 Base-Backbone interact. energy: -0.176 local terms energy: -52.377438 where: bonds (distance) C4'-P energy: -16.279 bonds (distance) P-C4' energy: -12.273 flat angles C4'-P-C4' energy: -14.162 flat angles P-C4'-P energy: -5.461 tors. eta vs tors. theta energy: -4.203 Dist. restrs. and SS energy: 2.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -117.156400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.156400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.290756 (E_RNA) where: Base-Base interactions energy: -67.025 where: short stacking energy: -38.601 Base-Backbone interact. energy: -0.298 local terms energy: -49.967871 where: bonds (distance) C4'-P energy: -11.444 bonds (distance) P-C4' energy: -10.183 flat angles C4'-P-C4' energy: -13.679 flat angles P-C4'-P energy: -6.795 tors. eta vs tors. theta energy: -7.867 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -122.838464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.838464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.004278 (E_RNA) where: Base-Base interactions energy: -70.531 where: short stacking energy: -35.820 Base-Backbone interact. energy: -1.179 local terms energy: -51.294784 where: bonds (distance) C4'-P energy: -15.438 bonds (distance) P-C4' energy: -14.182 flat angles C4'-P-C4' energy: -6.819 flat angles P-C4'-P energy: -7.342 tors. eta vs tors. theta energy: -7.514 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -220.407222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.407222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.462449 (E_RNA) where: Base-Base interactions energy: -147.514 where: short stacking energy: -55.492 Base-Backbone interact. energy: 0.092 local terms energy: -73.040469 where: bonds (distance) C4'-P energy: -17.107 bonds (distance) P-C4' energy: -16.755 flat angles C4'-P-C4' energy: -14.891 flat angles P-C4'-P energy: -8.885 tors. eta vs tors. theta energy: -15.403 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -189.372003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.372003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.406102 (E_RNA) where: Base-Base interactions energy: -123.499 where: short stacking energy: -61.481 Base-Backbone interact. energy: -0.013 local terms energy: -65.894021 where: bonds (distance) C4'-P energy: -11.234 bonds (distance) P-C4' energy: -19.113 flat angles C4'-P-C4' energy: -14.824 flat angles P-C4'-P energy: -6.488 tors. eta vs tors. theta energy: -14.235 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -187.821239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.821239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.473681 (E_RNA) where: Base-Base interactions energy: -124.191 where: short stacking energy: -56.414 Base-Backbone interact. energy: -0.609 local terms energy: -64.673596 where: bonds (distance) C4'-P energy: -14.731 bonds (distance) P-C4' energy: -14.685 flat angles C4'-P-C4' energy: -15.772 flat angles P-C4'-P energy: -6.251 tors. eta vs tors. theta energy: -13.235 Dist. restrs. and SS energy: 1.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -179.741234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.741234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.741234 (E_RNA) where: Base-Base interactions energy: -111.612 where: short stacking energy: -50.319 Base-Backbone interact. energy: -0.785 local terms energy: -67.344944 where: bonds (distance) C4'-P energy: -16.660 bonds (distance) P-C4' energy: -14.603 flat angles C4'-P-C4' energy: -14.485 flat angles P-C4'-P energy: -9.537 tors. eta vs tors. theta energy: -12.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -168.379044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.379044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.429971 (E_RNA) where: Base-Base interactions energy: -104.522 where: short stacking energy: -51.449 Base-Backbone interact. energy: -0.186 local terms energy: -63.722116 where: bonds (distance) C4'-P energy: -16.022 bonds (distance) P-C4' energy: -14.793 flat angles C4'-P-C4' energy: -14.241 flat angles P-C4'-P energy: -5.835 tors. eta vs tors. theta energy: -12.831 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -142.122294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.122294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.161793 (E_RNA) where: Base-Base interactions energy: -82.304 where: short stacking energy: -41.880 Base-Backbone interact. energy: -0.125 local terms energy: -59.732320 where: bonds (distance) C4'-P energy: -11.340 bonds (distance) P-C4' energy: -16.681 flat angles C4'-P-C4' energy: -12.553 flat angles P-C4'-P energy: -9.521 tors. eta vs tors. theta energy: -9.637 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -137.493025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.493025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.547033 (E_RNA) where: Base-Base interactions energy: -78.767 where: short stacking energy: -34.143 Base-Backbone interact. energy: -0.335 local terms energy: -58.445662 where: bonds (distance) C4'-P energy: -15.546 bonds (distance) P-C4' energy: -13.697 flat angles C4'-P-C4' energy: -16.460 flat angles P-C4'-P energy: -8.571 tors. eta vs tors. theta energy: -4.172 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -136.209694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.209694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.236255 (E_RNA) where: Base-Base interactions energy: -79.843 where: short stacking energy: -46.036 Base-Backbone interact. energy: -0.574 local terms energy: -55.819588 where: bonds (distance) C4'-P energy: -5.753 bonds (distance) P-C4' energy: -16.783 flat angles C4'-P-C4' energy: -14.059 flat angles P-C4'-P energy: -10.336 tors. eta vs tors. theta energy: -8.890 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -97.353435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.353435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.168288 (E_RNA) where: Base-Base interactions energy: -40.579 where: short stacking energy: -25.935 Base-Backbone interact. energy: -0.098 local terms energy: -58.491261 where: bonds (distance) C4'-P energy: -13.935 bonds (distance) P-C4' energy: -14.148 flat angles C4'-P-C4' energy: -15.689 flat angles P-C4'-P energy: -7.192 tors. eta vs tors. theta energy: -7.527 Dist. restrs. and SS energy: 1.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -122.268719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.268719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.870777 (E_RNA) where: Base-Base interactions energy: -69.716 where: short stacking energy: -32.495 Base-Backbone interact. energy: -0.342 local terms energy: -52.812282 where: bonds (distance) C4'-P energy: -13.232 bonds (distance) P-C4' energy: -16.057 flat angles C4'-P-C4' energy: -7.906 flat angles P-C4'-P energy: -9.470 tors. eta vs tors. theta energy: -6.147 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -225.685939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.685939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.685939 (E_RNA) where: Base-Base interactions energy: -153.412 where: short stacking energy: -66.712 Base-Backbone interact. energy: -0.341 local terms energy: -71.933113 where: bonds (distance) C4'-P energy: -13.249 bonds (distance) P-C4' energy: -14.427 flat angles C4'-P-C4' energy: -17.185 flat angles P-C4'-P energy: -12.256 tors. eta vs tors. theta energy: -14.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -189.983413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.983413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.210297 (E_RNA) where: Base-Base interactions energy: -119.024 where: short stacking energy: -52.804 Base-Backbone interact. energy: -0.591 local terms energy: -71.594540 where: bonds (distance) C4'-P energy: -14.875 bonds (distance) P-C4' energy: -12.725 flat angles C4'-P-C4' energy: -16.208 flat angles P-C4'-P energy: -11.553 tors. eta vs tors. theta energy: -16.234 Dist. restrs. and SS energy: 1.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -193.023775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.023775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.038560 (E_RNA) where: Base-Base interactions energy: -116.222 where: short stacking energy: -53.773 Base-Backbone interact. energy: -0.073 local terms energy: -76.744419 where: bonds (distance) C4'-P energy: -19.056 bonds (distance) P-C4' energy: -19.331 flat angles C4'-P-C4' energy: -12.930 flat angles P-C4'-P energy: -6.159 tors. eta vs tors. theta energy: -19.269 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -199.206681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.206681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.206681 (E_RNA) where: Base-Base interactions energy: -132.342 where: short stacking energy: -62.660 Base-Backbone interact. energy: -1.088 local terms energy: -65.776619 where: bonds (distance) C4'-P energy: -11.513 bonds (distance) P-C4' energy: -15.029 flat angles C4'-P-C4' energy: -12.922 flat angles P-C4'-P energy: -8.961 tors. eta vs tors. theta energy: -17.352 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -155.540937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.540937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.238575 (E_RNA) where: Base-Base interactions energy: -94.872 where: short stacking energy: -50.799 Base-Backbone interact. energy: -0.017 local terms energy: -61.348915 where: bonds (distance) C4'-P energy: -16.966 bonds (distance) P-C4' energy: -10.857 flat angles C4'-P-C4' energy: -13.332 flat angles P-C4'-P energy: -10.681 tors. eta vs tors. theta energy: -9.513 Dist. restrs. and SS energy: 0.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -172.141139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.141139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.254924 (E_RNA) where: Base-Base interactions energy: -111.753 where: short stacking energy: -48.935 Base-Backbone interact. energy: -0.075 local terms energy: -60.427190 where: bonds (distance) C4'-P energy: -10.305 bonds (distance) P-C4' energy: -13.617 flat angles C4'-P-C4' energy: -14.675 flat angles P-C4'-P energy: -9.552 tors. eta vs tors. theta energy: -12.279 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -139.817603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.817603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.865460 (E_RNA) where: Base-Base interactions energy: -82.509 where: short stacking energy: -44.655 Base-Backbone interact. energy: -0.111 local terms energy: -57.244720 where: bonds (distance) C4'-P energy: -10.361 bonds (distance) P-C4' energy: -15.843 flat angles C4'-P-C4' energy: -15.074 flat angles P-C4'-P energy: -4.782 tors. eta vs tors. theta energy: -11.184 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -116.380156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.380156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.116002 (E_RNA) where: Base-Base interactions energy: -75.867 where: short stacking energy: -43.338 Base-Backbone interact. energy: 0.201 local terms energy: -43.449529 where: bonds (distance) C4'-P energy: -6.705 bonds (distance) P-C4' energy: -7.779 flat angles C4'-P-C4' energy: -15.731 flat angles P-C4'-P energy: -7.206 tors. eta vs tors. theta energy: -6.028 Dist. restrs. and SS energy: 2.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -153.254042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.254042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.327857 (E_RNA) where: Base-Base interactions energy: -81.044 where: short stacking energy: -47.108 Base-Backbone interact. energy: -0.812 local terms energy: -71.472247 where: bonds (distance) C4'-P energy: -11.433 bonds (distance) P-C4' energy: -15.179 flat angles C4'-P-C4' energy: -15.815 flat angles P-C4'-P energy: -12.384 tors. eta vs tors. theta energy: -16.661 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -102.057606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.057606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.057606 (E_RNA) where: Base-Base interactions energy: -61.051 where: short stacking energy: -29.770 Base-Backbone interact. energy: -0.268 local terms energy: -40.738130 where: bonds (distance) C4'-P energy: -6.694 bonds (distance) P-C4' energy: -14.042 flat angles C4'-P-C4' energy: -11.943 flat angles P-C4'-P energy: -2.298 tors. eta vs tors. theta energy: -5.760 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -231.528685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.528685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.687157 (E_RNA) where: Base-Base interactions energy: -158.920 where: short stacking energy: -62.180 Base-Backbone interact. energy: -0.289 local terms energy: -72.478228 where: bonds (distance) C4'-P energy: -15.342 bonds (distance) P-C4' energy: -16.349 flat angles C4'-P-C4' energy: -17.124 flat angles P-C4'-P energy: -4.782 tors. eta vs tors. theta energy: -18.880 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -196.910427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.910427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.281437 (E_RNA) where: Base-Base interactions energy: -128.882 where: short stacking energy: -53.646 Base-Backbone interact. energy: 0.107 local terms energy: -68.506993 where: bonds (distance) C4'-P energy: -13.477 bonds (distance) P-C4' energy: -10.618 flat angles C4'-P-C4' energy: -18.317 flat angles P-C4'-P energy: -13.025 tors. eta vs tors. theta energy: -13.071 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -178.496914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.496914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.496914 (E_RNA) where: Base-Base interactions energy: -113.054 where: short stacking energy: -64.777 Base-Backbone interact. energy: -0.028 local terms energy: -65.415757 where: bonds (distance) C4'-P energy: -10.722 bonds (distance) P-C4' energy: -15.074 flat angles C4'-P-C4' energy: -9.435 flat angles P-C4'-P energy: -10.561 tors. eta vs tors. theta energy: -19.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -192.762867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.762867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.810046 (E_RNA) where: Base-Base interactions energy: -123.634 where: short stacking energy: -47.955 Base-Backbone interact. energy: 0.493 local terms energy: -69.669341 where: bonds (distance) C4'-P energy: -13.861 bonds (distance) P-C4' energy: -18.873 flat angles C4'-P-C4' energy: -14.350 flat angles P-C4'-P energy: -9.119 tors. eta vs tors. theta energy: -13.467 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -163.436241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.436241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.896046 (E_RNA) where: Base-Base interactions energy: -100.650 where: short stacking energy: -42.119 Base-Backbone interact. energy: -0.573 local terms energy: -62.672853 where: bonds (distance) C4'-P energy: -11.804 bonds (distance) P-C4' energy: -16.715 flat angles C4'-P-C4' energy: -13.524 flat angles P-C4'-P energy: -10.869 tors. eta vs tors. theta energy: -9.761 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -156.354708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.354708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.383655 (E_RNA) where: Base-Base interactions energy: -96.721 where: short stacking energy: -52.103 Base-Backbone interact. energy: -0.446 local terms energy: -59.217050 where: bonds (distance) C4'-P energy: -11.828 bonds (distance) P-C4' energy: -15.244 flat angles C4'-P-C4' energy: -11.519 flat angles P-C4'-P energy: -9.613 tors. eta vs tors. theta energy: -11.014 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -159.157503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.157503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.360111 (E_RNA) where: Base-Base interactions energy: -96.984 where: short stacking energy: -38.550 Base-Backbone interact. energy: -0.297 local terms energy: -62.079300 where: bonds (distance) C4'-P energy: -12.938 bonds (distance) P-C4' energy: -13.061 flat angles C4'-P-C4' energy: -12.351 flat angles P-C4'-P energy: -7.802 tors. eta vs tors. theta energy: -15.928 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -158.191875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.191875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.529253 (E_RNA) where: Base-Base interactions energy: -91.998 where: short stacking energy: -51.506 Base-Backbone interact. energy: -0.041 local terms energy: -67.489621 where: bonds (distance) C4'-P energy: -13.575 bonds (distance) P-C4' energy: -14.871 flat angles C4'-P-C4' energy: -11.306 flat angles P-C4'-P energy: -12.624 tors. eta vs tors. theta energy: -15.113 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -131.831001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.831001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.914458 (E_RNA) where: Base-Base interactions energy: -80.681 where: short stacking energy: -30.077 Base-Backbone interact. energy: 0.178 local terms energy: -51.411307 where: bonds (distance) C4'-P energy: -12.758 bonds (distance) P-C4' energy: -14.166 flat angles C4'-P-C4' energy: -15.273 flat angles P-C4'-P energy: -8.736 tors. eta vs tors. theta energy: -0.478 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -117.275978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.275978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.309663 (E_RNA) where: Base-Base interactions energy: -65.796 where: short stacking energy: -32.788 Base-Backbone interact. energy: -0.384 local terms energy: -51.128924 where: bonds (distance) C4'-P energy: -6.603 bonds (distance) P-C4' energy: -15.657 flat angles C4'-P-C4' energy: -11.026 flat angles P-C4'-P energy: -10.594 tors. eta vs tors. theta energy: -7.249 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -240.049002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.049002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.079062 (E_RNA) where: Base-Base interactions energy: -158.417 where: short stacking energy: -68.029 Base-Backbone interact. energy: -0.480 local terms energy: -81.182042 where: bonds (distance) C4'-P energy: -18.209 bonds (distance) P-C4' energy: -18.527 flat angles C4'-P-C4' energy: -16.957 flat angles P-C4'-P energy: -7.260 tors. eta vs tors. theta energy: -20.230 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -188.822446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.822446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.822446 (E_RNA) where: Base-Base interactions energy: -113.042 where: short stacking energy: -48.571 Base-Backbone interact. energy: -0.453 local terms energy: -75.326619 where: bonds (distance) C4'-P energy: -18.166 bonds (distance) P-C4' energy: -16.412 flat angles C4'-P-C4' energy: -14.075 flat angles P-C4'-P energy: -10.887 tors. eta vs tors. theta energy: -15.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -201.189141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.189141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.212091 (E_RNA) where: Base-Base interactions energy: -134.196 where: short stacking energy: -53.053 Base-Backbone interact. energy: -1.054 local terms energy: -65.962193 where: bonds (distance) C4'-P energy: -18.104 bonds (distance) P-C4' energy: -12.623 flat angles C4'-P-C4' energy: -10.365 flat angles P-C4'-P energy: -11.382 tors. eta vs tors. theta energy: -13.489 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -164.473547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.473547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.473547 (E_RNA) where: Base-Base interactions energy: -99.588 where: short stacking energy: -50.753 Base-Backbone interact. energy: -0.092 local terms energy: -64.792993 where: bonds (distance) C4'-P energy: -17.685 bonds (distance) P-C4' energy: -12.447 flat angles C4'-P-C4' energy: -12.966 flat angles P-C4'-P energy: -8.518 tors. eta vs tors. theta energy: -13.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -150.948468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.948468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.055817 (E_RNA) where: Base-Base interactions energy: -92.310 where: short stacking energy: -41.684 Base-Backbone interact. energy: -0.517 local terms energy: -59.229444 where: bonds (distance) C4'-P energy: -14.735 bonds (distance) P-C4' energy: -17.402 flat angles C4'-P-C4' energy: -12.965 flat angles P-C4'-P energy: 0.104 tors. eta vs tors. theta energy: -14.232 Dist. restrs. and SS energy: 1.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -176.646750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.646750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.000921 (E_RNA) where: Base-Base interactions energy: -115.614 where: short stacking energy: -49.303 Base-Backbone interact. energy: -0.122 local terms energy: -61.264435 where: bonds (distance) C4'-P energy: -6.659 bonds (distance) P-C4' energy: -18.662 flat angles C4'-P-C4' energy: -12.595 flat angles P-C4'-P energy: -9.571 tors. eta vs tors. theta energy: -13.778 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -153.924058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.924058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.938423 (E_RNA) where: Base-Base interactions energy: -92.349 where: short stacking energy: -49.960 Base-Backbone interact. energy: -0.123 local terms energy: -61.467374 where: bonds (distance) C4'-P energy: -8.885 bonds (distance) P-C4' energy: -15.915 flat angles C4'-P-C4' energy: -15.307 flat angles P-C4'-P energy: -8.535 tors. eta vs tors. theta energy: -12.825 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -146.202214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.202214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.886879 (E_RNA) where: Base-Base interactions energy: -95.092 where: short stacking energy: -37.331 Base-Backbone interact. energy: -0.292 local terms energy: -52.502507 where: bonds (distance) C4'-P energy: -11.597 bonds (distance) P-C4' energy: -13.108 flat angles C4'-P-C4' energy: -11.099 flat angles P-C4'-P energy: -8.336 tors. eta vs tors. theta energy: -8.362 Dist. restrs. and SS energy: 1.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -114.417677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.417677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.417677 (E_RNA) where: Base-Base interactions energy: -70.828 where: short stacking energy: -34.758 Base-Backbone interact. energy: -0.000 local terms energy: -43.589603 where: bonds (distance) C4'-P energy: -11.377 bonds (distance) P-C4' energy: -13.872 flat angles C4'-P-C4' energy: -14.272 flat angles P-C4'-P energy: -3.154 tors. eta vs tors. theta energy: -0.915 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -132.163187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.163187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.174480 (E_RNA) where: Base-Base interactions energy: -78.130 where: short stacking energy: -41.346 Base-Backbone interact. energy: -0.098 local terms energy: -53.946420 where: bonds (distance) C4'-P energy: -11.861 bonds (distance) P-C4' energy: -12.238 flat angles C4'-P-C4' energy: -11.528 flat angles P-C4'-P energy: -11.016 tors. eta vs tors. theta energy: -7.303 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -227.839553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.839553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.862585 (E_RNA) where: Base-Base interactions energy: -157.937 where: short stacking energy: -57.729 Base-Backbone interact. energy: -1.287 local terms energy: -68.638938 where: bonds (distance) C4'-P energy: -14.896 bonds (distance) P-C4' energy: -15.689 flat angles C4'-P-C4' energy: -9.560 flat angles P-C4'-P energy: -9.493 tors. eta vs tors. theta energy: -19.001 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -207.923052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.923052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.963292 (E_RNA) where: Base-Base interactions energy: -143.690 where: short stacking energy: -48.645 Base-Backbone interact. energy: -0.921 local terms energy: -63.351893 where: bonds (distance) C4'-P energy: -15.508 bonds (distance) P-C4' energy: -16.944 flat angles C4'-P-C4' energy: -11.661 flat angles P-C4'-P energy: -4.449 tors. eta vs tors. theta energy: -14.789 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -181.670054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.670054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.323503 (E_RNA) where: Base-Base interactions energy: -107.976 where: short stacking energy: -53.292 Base-Backbone interact. energy: -0.391 local terms energy: -73.956087 where: bonds (distance) C4'-P energy: -13.132 bonds (distance) P-C4' energy: -17.270 flat angles C4'-P-C4' energy: -16.822 flat angles P-C4'-P energy: -11.685 tors. eta vs tors. theta energy: -15.046 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -185.347292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.347292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.451092 (E_RNA) where: Base-Base interactions energy: -116.959 where: short stacking energy: -52.535 Base-Backbone interact. energy: -0.429 local terms energy: -68.063160 where: bonds (distance) C4'-P energy: -15.750 bonds (distance) P-C4' energy: -19.103 flat angles C4'-P-C4' energy: -10.712 flat angles P-C4'-P energy: -5.859 tors. eta vs tors. theta energy: -16.640 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -164.892249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.892249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.892249 (E_RNA) where: Base-Base interactions energy: -108.924 where: short stacking energy: -48.220 Base-Backbone interact. energy: -0.007 local terms energy: -55.961439 where: bonds (distance) C4'-P energy: -12.667 bonds (distance) P-C4' energy: -17.545 flat angles C4'-P-C4' energy: -11.678 flat angles P-C4'-P energy: -1.819 tors. eta vs tors. theta energy: -12.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -166.220362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.220362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.232221 (E_RNA) where: Base-Base interactions energy: -115.108 where: short stacking energy: -46.309 Base-Backbone interact. energy: -1.193 local terms energy: -49.931023 where: bonds (distance) C4'-P energy: -9.445 bonds (distance) P-C4' energy: -8.935 flat angles C4'-P-C4' energy: -13.582 flat angles P-C4'-P energy: -4.718 tors. eta vs tors. theta energy: -13.250 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -134.699524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.699524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.699524 (E_RNA) where: Base-Base interactions energy: -70.999 where: short stacking energy: -39.621 Base-Backbone interact. energy: -0.274 local terms energy: -63.426970 where: bonds (distance) C4'-P energy: -16.551 bonds (distance) P-C4' energy: -13.282 flat angles C4'-P-C4' energy: -14.262 flat angles P-C4'-P energy: -11.161 tors. eta vs tors. theta energy: -8.171 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -134.376854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.376854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.376854 (E_RNA) where: Base-Base interactions energy: -70.808 where: short stacking energy: -35.838 Base-Backbone interact. energy: -0.097 local terms energy: -63.471906 where: bonds (distance) C4'-P energy: -10.990 bonds (distance) P-C4' energy: -17.380 flat angles C4'-P-C4' energy: -18.948 flat angles P-C4'-P energy: -8.819 tors. eta vs tors. theta energy: -7.335 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -137.132391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.132391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.132391 (E_RNA) where: Base-Base interactions energy: -80.543 where: short stacking energy: -40.287 Base-Backbone interact. energy: -0.309 local terms energy: -56.280319 where: bonds (distance) C4'-P energy: -11.895 bonds (distance) P-C4' energy: -13.652 flat angles C4'-P-C4' energy: -13.721 flat angles P-C4'-P energy: -6.970 tors. eta vs tors. theta energy: -10.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -125.207295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.207295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.385948 (E_RNA) where: Base-Base interactions energy: -78.248 where: short stacking energy: -47.816 Base-Backbone interact. energy: -0.004 local terms energy: -47.134077 where: bonds (distance) C4'-P energy: -10.073 bonds (distance) P-C4' energy: -11.856 flat angles C4'-P-C4' energy: -11.213 flat angles P-C4'-P energy: -8.172 tors. eta vs tors. theta energy: -5.819 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -224.521460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.521460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.626044 (E_RNA) where: Base-Base interactions energy: -153.772 where: short stacking energy: -62.785 Base-Backbone interact. energy: 0.044 local terms energy: -70.898071 where: bonds (distance) C4'-P energy: -13.432 bonds (distance) P-C4' energy: -15.972 flat angles C4'-P-C4' energy: -16.865 flat angles P-C4'-P energy: -7.721 tors. eta vs tors. theta energy: -16.908 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -210.513562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.513562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.513562 (E_RNA) where: Base-Base interactions energy: -146.996 where: short stacking energy: -57.375 Base-Backbone interact. energy: -0.681 local terms energy: -62.836877 where: bonds (distance) C4'-P energy: -16.081 bonds (distance) P-C4' energy: -12.955 flat angles C4'-P-C4' energy: -13.321 flat angles P-C4'-P energy: -8.491 tors. eta vs tors. theta energy: -11.988 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -181.435830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.435830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.694878 (E_RNA) where: Base-Base interactions energy: -117.080 where: short stacking energy: -55.829 Base-Backbone interact. energy: -0.241 local terms energy: -64.374309 where: bonds (distance) C4'-P energy: -12.994 bonds (distance) P-C4' energy: -15.281 flat angles C4'-P-C4' energy: -14.112 flat angles P-C4'-P energy: -7.190 tors. eta vs tors. theta energy: -14.798 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -189.436477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.436477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.487130 (E_RNA) where: Base-Base interactions energy: -130.438 where: short stacking energy: -40.698 Base-Backbone interact. energy: -0.295 local terms energy: -58.753603 where: bonds (distance) C4'-P energy: -12.661 bonds (distance) P-C4' energy: -10.904 flat angles C4'-P-C4' energy: -13.509 flat angles P-C4'-P energy: -4.447 tors. eta vs tors. theta energy: -17.232 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -148.850035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.850035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.882326 (E_RNA) where: Base-Base interactions energy: -93.470 where: short stacking energy: -52.643 Base-Backbone interact. energy: 0.624 local terms energy: -57.037169 where: bonds (distance) C4'-P energy: -12.511 bonds (distance) P-C4' energy: -15.338 flat angles C4'-P-C4' energy: -11.375 flat angles P-C4'-P energy: -9.819 tors. eta vs tors. theta energy: -7.994 Dist. restrs. and SS energy: 1.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -156.561342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.561342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.688261 (E_RNA) where: Base-Base interactions energy: -101.941 where: short stacking energy: -50.886 Base-Backbone interact. energy: -0.009 local terms energy: -54.738428 where: bonds (distance) C4'-P energy: -13.754 bonds (distance) P-C4' energy: -16.871 flat angles C4'-P-C4' energy: -10.969 flat angles P-C4'-P energy: -5.731 tors. eta vs tors. theta energy: -7.413 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -156.313529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.313529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.337374 (E_RNA) where: Base-Base interactions energy: -94.113 where: short stacking energy: -41.311 Base-Backbone interact. energy: -1.399 local terms energy: -60.825022 where: bonds (distance) C4'-P energy: -15.856 bonds (distance) P-C4' energy: -15.103 flat angles C4'-P-C4' energy: -17.284 flat angles P-C4'-P energy: -8.685 tors. eta vs tors. theta energy: -3.897 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -133.060101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.060101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.115281 (E_RNA) where: Base-Base interactions energy: -67.536 where: short stacking energy: -42.217 Base-Backbone interact. energy: -0.854 local terms energy: -64.725327 where: bonds (distance) C4'-P energy: -16.283 bonds (distance) P-C4' energy: -16.566 flat angles C4'-P-C4' energy: -11.871 flat angles P-C4'-P energy: -10.233 tors. eta vs tors. theta energy: -9.772 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -143.216240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.216240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.427610 (E_RNA) where: Base-Base interactions energy: -83.305 where: short stacking energy: -36.954 Base-Backbone interact. energy: -0.534 local terms energy: -59.588436 where: bonds (distance) C4'-P energy: -17.517 bonds (distance) P-C4' energy: -16.589 flat angles C4'-P-C4' energy: -9.810 flat angles P-C4'-P energy: -7.002 tors. eta vs tors. theta energy: -8.671 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -124.163257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.163257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.179460 (E_RNA) where: Base-Base interactions energy: -67.285 where: short stacking energy: -31.348 Base-Backbone interact. energy: 0.034 local terms energy: -56.928371 where: bonds (distance) C4'-P energy: -9.862 bonds (distance) P-C4' energy: -17.308 flat angles C4'-P-C4' energy: -11.302 flat angles P-C4'-P energy: -10.550 tors. eta vs tors. theta energy: -7.905 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -222.200648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.200648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.202786 (E_RNA) where: Base-Base interactions energy: -149.045 where: short stacking energy: -64.307 Base-Backbone interact. energy: 0.594 local terms energy: -73.751522 where: bonds (distance) C4'-P energy: -14.006 bonds (distance) P-C4' energy: -15.132 flat angles C4'-P-C4' energy: -16.915 flat angles P-C4'-P energy: -9.827 tors. eta vs tors. theta energy: -17.871 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -209.746576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.746576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.748263 (E_RNA) where: Base-Base interactions energy: -138.932 where: short stacking energy: -64.651 Base-Backbone interact. energy: -0.128 local terms energy: -70.688157 where: bonds (distance) C4'-P energy: -15.294 bonds (distance) P-C4' energy: -16.075 flat angles C4'-P-C4' energy: -16.161 flat angles P-C4'-P energy: -8.041 tors. eta vs tors. theta energy: -15.118 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -180.952850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.952850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.018141 (E_RNA) where: Base-Base interactions energy: -115.706 where: short stacking energy: -47.086 Base-Backbone interact. energy: -0.111 local terms energy: -65.200956 where: bonds (distance) C4'-P energy: -16.220 bonds (distance) P-C4' energy: -16.708 flat angles C4'-P-C4' energy: -11.758 flat angles P-C4'-P energy: -12.222 tors. eta vs tors. theta energy: -8.292 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -197.739214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.739214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.749966 (E_RNA) where: Base-Base interactions energy: -128.134 where: short stacking energy: -64.712 Base-Backbone interact. energy: -0.272 local terms energy: -69.344631 where: bonds (distance) C4'-P energy: -11.640 bonds (distance) P-C4' energy: -18.852 flat angles C4'-P-C4' energy: -14.007 flat angles P-C4'-P energy: -8.686 tors. eta vs tors. theta energy: -16.161 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -153.366029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.366029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.554169 (E_RNA) where: Base-Base interactions energy: -87.562 where: short stacking energy: -40.204 Base-Backbone interact. energy: -0.218 local terms energy: -65.774113 where: bonds (distance) C4'-P energy: -10.767 bonds (distance) P-C4' energy: -18.100 flat angles C4'-P-C4' energy: -14.836 flat angles P-C4'-P energy: -11.506 tors. eta vs tors. theta energy: -10.564 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -149.749761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.749761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.749761 (E_RNA) where: Base-Base interactions energy: -86.244 where: short stacking energy: -38.669 Base-Backbone interact. energy: -0.244 local terms energy: -63.261206 where: bonds (distance) C4'-P energy: -14.900 bonds (distance) P-C4' energy: -14.995 flat angles C4'-P-C4' energy: -16.481 flat angles P-C4'-P energy: -8.461 tors. eta vs tors. theta energy: -8.424 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -161.121798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.121798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.168586 (E_RNA) where: Base-Base interactions energy: -104.941 where: short stacking energy: -49.242 Base-Backbone interact. energy: 0.163 local terms energy: -57.390929 where: bonds (distance) C4'-P energy: -11.079 bonds (distance) P-C4' energy: -16.518 flat angles C4'-P-C4' energy: -12.728 flat angles P-C4'-P energy: -7.390 tors. eta vs tors. theta energy: -9.676 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -134.607801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.607801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.631711 (E_RNA) where: Base-Base interactions energy: -74.009 where: short stacking energy: -37.381 Base-Backbone interact. energy: -0.530 local terms energy: -60.092135 where: bonds (distance) C4'-P energy: -14.400 bonds (distance) P-C4' energy: -14.604 flat angles C4'-P-C4' energy: -14.153 flat angles P-C4'-P energy: -7.740 tors. eta vs tors. theta energy: -9.195 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -120.157251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.157251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.179598 (E_RNA) where: Base-Base interactions energy: -70.352 where: short stacking energy: -31.376 Base-Backbone interact. energy: 0.039 local terms energy: -49.866836 where: bonds (distance) C4'-P energy: -14.206 bonds (distance) P-C4' energy: -7.866 flat angles C4'-P-C4' energy: -10.624 flat angles P-C4'-P energy: -12.905 tors. eta vs tors. theta energy: -4.266 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -124.969240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.969240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.022271 (E_RNA) where: Base-Base interactions energy: -82.972 where: short stacking energy: -41.229 Base-Backbone interact. energy: -0.943 local terms energy: -41.107821 where: bonds (distance) C4'-P energy: -11.336 bonds (distance) P-C4' energy: -11.781 flat angles C4'-P-C4' energy: -8.563 flat angles P-C4'-P energy: -6.498 tors. eta vs tors. theta energy: -2.930 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -222.056849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.056849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.056849 (E_RNA) where: Base-Base interactions energy: -150.811 where: short stacking energy: -58.870 Base-Backbone interact. energy: -0.239 local terms energy: -71.006524 where: bonds (distance) C4'-P energy: -12.205 bonds (distance) P-C4' energy: -16.001 flat angles C4'-P-C4' energy: -13.773 flat angles P-C4'-P energy: -10.540 tors. eta vs tors. theta energy: -18.487 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -221.226490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.226490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.615333 (E_RNA) where: Base-Base interactions energy: -144.344 where: short stacking energy: -63.478 Base-Backbone interact. energy: -0.348 local terms energy: -77.923652 where: bonds (distance) C4'-P energy: -16.743 bonds (distance) P-C4' energy: -16.406 flat angles C4'-P-C4' energy: -18.349 flat angles P-C4'-P energy: -9.600 tors. eta vs tors. theta energy: -16.826 Dist. restrs. and SS energy: 1.389 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -198.089926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.089926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.313879 (E_RNA) where: Base-Base interactions energy: -133.348 where: short stacking energy: -49.051 Base-Backbone interact. energy: -0.914 local terms energy: -64.051432 where: bonds (distance) C4'-P energy: -14.680 bonds (distance) P-C4' energy: -14.305 flat angles C4'-P-C4' energy: -15.471 flat angles P-C4'-P energy: -8.096 tors. eta vs tors. theta energy: -11.500 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -201.984461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.984461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.108007 (E_RNA) where: Base-Base interactions energy: -131.557 where: short stacking energy: -57.367 Base-Backbone interact. energy: -0.301 local terms energy: -70.250142 where: bonds (distance) C4'-P energy: -10.530 bonds (distance) P-C4' energy: -14.494 flat angles C4'-P-C4' energy: -12.926 flat angles P-C4'-P energy: -12.237 tors. eta vs tors. theta energy: -20.063 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -154.136129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.136129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.305262 (E_RNA) where: Base-Base interactions energy: -84.360 where: short stacking energy: -47.446 Base-Backbone interact. energy: -0.102 local terms energy: -69.842890 where: bonds (distance) C4'-P energy: -18.717 bonds (distance) P-C4' energy: -10.094 flat angles C4'-P-C4' energy: -13.379 flat angles P-C4'-P energy: -11.353 tors. eta vs tors. theta energy: -16.299 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -148.402066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.402066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.427646 (E_RNA) where: Base-Base interactions energy: -89.802 where: short stacking energy: -39.578 Base-Backbone interact. energy: -0.203 local terms energy: -58.422174 where: bonds (distance) C4'-P energy: -15.269 bonds (distance) P-C4' energy: -10.146 flat angles C4'-P-C4' energy: -15.269 flat angles P-C4'-P energy: -9.662 tors. eta vs tors. theta energy: -8.077 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -158.907814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.907814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.907814 (E_RNA) where: Base-Base interactions energy: -97.252 where: short stacking energy: -57.951 Base-Backbone interact. energy: -0.225 local terms energy: -61.431205 where: bonds (distance) C4'-P energy: -7.627 bonds (distance) P-C4' energy: -14.272 flat angles C4'-P-C4' energy: -18.461 flat angles P-C4'-P energy: -5.747 tors. eta vs tors. theta energy: -15.324 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -149.368797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.368797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.445710 (E_RNA) where: Base-Base interactions energy: -85.068 where: short stacking energy: -43.458 Base-Backbone interact. energy: -0.191 local terms energy: -64.186647 where: bonds (distance) C4'-P energy: -14.379 bonds (distance) P-C4' energy: -17.975 flat angles C4'-P-C4' energy: -12.068 flat angles P-C4'-P energy: -8.149 tors. eta vs tors. theta energy: -11.614 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -127.631063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.631063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.631063 (E_RNA) where: Base-Base interactions energy: -79.037 where: short stacking energy: -39.780 Base-Backbone interact. energy: 1.855 local terms energy: -50.448570 where: bonds (distance) C4'-P energy: -6.500 bonds (distance) P-C4' energy: -13.769 flat angles C4'-P-C4' energy: -13.614 flat angles P-C4'-P energy: -10.070 tors. eta vs tors. theta energy: -6.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -118.287347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.287347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.287347 (E_RNA) where: Base-Base interactions energy: -65.312 where: short stacking energy: -29.527 Base-Backbone interact. energy: -0.094 local terms energy: -52.881256 where: bonds (distance) C4'-P energy: -10.972 bonds (distance) P-C4' energy: -16.054 flat angles C4'-P-C4' energy: -13.263 flat angles P-C4'-P energy: -11.362 tors. eta vs tors. theta energy: -1.229 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -218.406594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.406594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.431274 (E_RNA) where: Base-Base interactions energy: -148.117 where: short stacking energy: -65.185 Base-Backbone interact. energy: -0.048 local terms energy: -70.266516 where: bonds (distance) C4'-P energy: -17.318 bonds (distance) P-C4' energy: -13.526 flat angles C4'-P-C4' energy: -18.066 flat angles P-C4'-P energy: -4.880 tors. eta vs tors. theta energy: -16.477 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -224.990091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.990091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.192794 (E_RNA) where: Base-Base interactions energy: -155.126 where: short stacking energy: -62.626 Base-Backbone interact. energy: -0.113 local terms energy: -70.954227 where: bonds (distance) C4'-P energy: -13.061 bonds (distance) P-C4' energy: -16.046 flat angles C4'-P-C4' energy: -12.204 flat angles P-C4'-P energy: -11.328 tors. eta vs tors. theta energy: -18.315 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -197.342990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.342990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.342990 (E_RNA) where: Base-Base interactions energy: -124.349 where: short stacking energy: -54.372 Base-Backbone interact. energy: 0.264 local terms energy: -73.257749 where: bonds (distance) C4'-P energy: -14.507 bonds (distance) P-C4' energy: -19.059 flat angles C4'-P-C4' energy: -13.719 flat angles P-C4'-P energy: -10.324 tors. eta vs tors. theta energy: -15.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -202.749061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.749061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.913990 (E_RNA) where: Base-Base interactions energy: -137.596 where: short stacking energy: -45.788 Base-Backbone interact. energy: -0.376 local terms energy: -64.941434 where: bonds (distance) C4'-P energy: -13.655 bonds (distance) P-C4' energy: -15.313 flat angles C4'-P-C4' energy: -13.954 flat angles P-C4'-P energy: -7.918 tors. eta vs tors. theta energy: -14.102 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -154.798263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.798263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.864203 (E_RNA) where: Base-Base interactions energy: -88.354 where: short stacking energy: -51.933 Base-Backbone interact. energy: -0.081 local terms energy: -66.428794 where: bonds (distance) C4'-P energy: -11.335 bonds (distance) P-C4' energy: -17.117 flat angles C4'-P-C4' energy: -14.719 flat angles P-C4'-P energy: -11.622 tors. eta vs tors. theta energy: -11.636 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -154.494750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.494750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.564091 (E_RNA) where: Base-Base interactions energy: -85.925 where: short stacking energy: -43.667 Base-Backbone interact. energy: -0.182 local terms energy: -68.456372 where: bonds (distance) C4'-P energy: -14.875 bonds (distance) P-C4' energy: -17.781 flat angles C4'-P-C4' energy: -12.539 flat angles P-C4'-P energy: -9.915 tors. eta vs tors. theta energy: -13.346 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -144.461543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.461543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.461543 (E_RNA) where: Base-Base interactions energy: -84.509 where: short stacking energy: -38.370 Base-Backbone interact. energy: 0.602 local terms energy: -60.554707 where: bonds (distance) C4'-P energy: -13.248 bonds (distance) P-C4' energy: -16.826 flat angles C4'-P-C4' energy: -14.876 flat angles P-C4'-P energy: -10.358 tors. eta vs tors. theta energy: -5.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -139.555668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.555668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.837513 (E_RNA) where: Base-Base interactions energy: -84.308 where: short stacking energy: -34.666 Base-Backbone interact. energy: -0.217 local terms energy: -56.312538 where: bonds (distance) C4'-P energy: -12.499 bonds (distance) P-C4' energy: -11.922 flat angles C4'-P-C4' energy: -12.847 flat angles P-C4'-P energy: -11.873 tors. eta vs tors. theta energy: -7.171 Dist. restrs. and SS energy: 1.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -142.716515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.716515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.716515 (E_RNA) where: Base-Base interactions energy: -76.207 where: short stacking energy: -35.378 Base-Backbone interact. energy: -0.548 local terms energy: -65.961309 where: bonds (distance) C4'-P energy: -13.364 bonds (distance) P-C4' energy: -19.346 flat angles C4'-P-C4' energy: -15.444 flat angles P-C4'-P energy: -12.554 tors. eta vs tors. theta energy: -5.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -102.049516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.049516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.049516 (E_RNA) where: Base-Base interactions energy: -51.750 where: short stacking energy: -25.914 Base-Backbone interact. energy: -0.165 local terms energy: -50.134023 where: bonds (distance) C4'-P energy: -10.064 bonds (distance) P-C4' energy: -14.751 flat angles C4'-P-C4' energy: -14.105 flat angles P-C4'-P energy: -7.564 tors. eta vs tors. theta energy: -3.650 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -216.745382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.745382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.122587 (E_RNA) where: Base-Base interactions energy: -145.167 where: short stacking energy: -59.231 Base-Backbone interact. energy: -0.113 local terms energy: -71.842428 where: bonds (distance) C4'-P energy: -13.939 bonds (distance) P-C4' energy: -18.091 flat angles C4'-P-C4' energy: -15.207 flat angles P-C4'-P energy: -8.976 tors. eta vs tors. theta energy: -15.630 Dist. restrs. and SS energy: 0.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -228.427594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.427594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.755217 (E_RNA) where: Base-Base interactions energy: -156.231 where: short stacking energy: -69.133 Base-Backbone interact. energy: -0.202 local terms energy: -73.322940 where: bonds (distance) C4'-P energy: -15.253 bonds (distance) P-C4' energy: -17.678 flat angles C4'-P-C4' energy: -12.815 flat angles P-C4'-P energy: -10.971 tors. eta vs tors. theta energy: -16.606 Dist. restrs. and SS energy: 1.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -210.836014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.836014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.859037 (E_RNA) where: Base-Base interactions energy: -143.845 where: short stacking energy: -61.797 Base-Backbone interact. energy: -0.207 local terms energy: -66.807583 where: bonds (distance) C4'-P energy: -16.515 bonds (distance) P-C4' energy: -16.990 flat angles C4'-P-C4' energy: -14.869 flat angles P-C4'-P energy: -2.835 tors. eta vs tors. theta energy: -15.599 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -191.928968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.928968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.928968 (E_RNA) where: Base-Base interactions energy: -115.577 where: short stacking energy: -67.729 Base-Backbone interact. energy: -0.579 local terms energy: -75.773244 where: bonds (distance) C4'-P energy: -18.324 bonds (distance) P-C4' energy: -14.871 flat angles C4'-P-C4' energy: -16.505 flat angles P-C4'-P energy: -7.207 tors. eta vs tors. theta energy: -18.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -157.710381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.710381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.710381 (E_RNA) where: Base-Base interactions energy: -89.838 where: short stacking energy: -43.413 Base-Backbone interact. energy: -0.652 local terms energy: -67.220500 where: bonds (distance) C4'-P energy: -12.383 bonds (distance) P-C4' energy: -16.481 flat angles C4'-P-C4' energy: -14.402 flat angles P-C4'-P energy: -11.724 tors. eta vs tors. theta energy: -12.231 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -164.632281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.632281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.662940 (E_RNA) where: Base-Base interactions energy: -88.305 where: short stacking energy: -56.138 Base-Backbone interact. energy: -0.005 local terms energy: -76.353038 where: bonds (distance) C4'-P energy: -14.667 bonds (distance) P-C4' energy: -16.530 flat angles C4'-P-C4' energy: -15.789 flat angles P-C4'-P energy: -11.614 tors. eta vs tors. theta energy: -17.753 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -157.433603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.433603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.798672 (E_RNA) where: Base-Base interactions energy: -96.379 where: short stacking energy: -51.574 Base-Backbone interact. energy: -0.524 local terms energy: -61.895533 where: bonds (distance) C4'-P energy: -10.468 bonds (distance) P-C4' energy: -18.570 flat angles C4'-P-C4' energy: -13.483 flat angles P-C4'-P energy: -10.537 tors. eta vs tors. theta energy: -8.838 Dist. restrs. and SS energy: 1.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -140.657974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.657974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.924495 (E_RNA) where: Base-Base interactions energy: -80.674 where: short stacking energy: -37.785 Base-Backbone interact. energy: -0.054 local terms energy: -60.196666 where: bonds (distance) C4'-P energy: -10.383 bonds (distance) P-C4' energy: -11.630 flat angles C4'-P-C4' energy: -18.002 flat angles P-C4'-P energy: -11.122 tors. eta vs tors. theta energy: -9.060 Dist. restrs. and SS energy: 0.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -126.405051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.405051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.444820 (E_RNA) where: Base-Base interactions energy: -72.331 where: short stacking energy: -29.546 Base-Backbone interact. energy: 0.749 local terms energy: -54.863129 where: bonds (distance) C4'-P energy: -17.071 bonds (distance) P-C4' energy: -10.440 flat angles C4'-P-C4' energy: -14.345 flat angles P-C4'-P energy: -11.799 tors. eta vs tors. theta energy: -1.208 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -131.469384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.469384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.664313 (E_RNA) where: Base-Base interactions energy: -74.797 where: short stacking energy: -36.179 Base-Backbone interact. energy: 0.484 local terms energy: -57.350767 where: bonds (distance) C4'-P energy: -15.286 bonds (distance) P-C4' energy: -13.592 flat angles C4'-P-C4' energy: -14.025 flat angles P-C4'-P energy: -6.785 tors. eta vs tors. theta energy: -7.662 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -211.400480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.400480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.400480 (E_RNA) where: Base-Base interactions energy: -139.517 where: short stacking energy: -55.627 Base-Backbone interact. energy: -0.535 local terms energy: -71.347540 where: bonds (distance) C4'-P energy: -17.489 bonds (distance) P-C4' energy: -16.427 flat angles C4'-P-C4' energy: -12.629 flat angles P-C4'-P energy: -10.450 tors. eta vs tors. theta energy: -14.353 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -229.435728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.435728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.798965 (E_RNA) where: Base-Base interactions energy: -160.346 where: short stacking energy: -65.004 Base-Backbone interact. energy: 0.294 local terms energy: -69.747415 where: bonds (distance) C4'-P energy: -12.578 bonds (distance) P-C4' energy: -16.498 flat angles C4'-P-C4' energy: -16.379 flat angles P-C4'-P energy: -7.982 tors. eta vs tors. theta energy: -16.311 Dist. restrs. and SS energy: 0.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -230.228789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.228789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.966193 (E_RNA) where: Base-Base interactions energy: -162.930 where: short stacking energy: -60.702 Base-Backbone interact. energy: 0.327 local terms energy: -69.363716 where: bonds (distance) C4'-P energy: -17.658 bonds (distance) P-C4' energy: -15.420 flat angles C4'-P-C4' energy: -8.818 flat angles P-C4'-P energy: -12.841 tors. eta vs tors. theta energy: -14.627 Dist. restrs. and SS energy: 1.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -181.100351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.100351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.191380 (E_RNA) where: Base-Base interactions energy: -115.569 where: short stacking energy: -43.339 Base-Backbone interact. energy: -0.210 local terms energy: -65.412799 where: bonds (distance) C4'-P energy: -13.414 bonds (distance) P-C4' energy: -13.404 flat angles C4'-P-C4' energy: -15.145 flat angles P-C4'-P energy: -9.591 tors. eta vs tors. theta energy: -13.859 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -171.285364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.285364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.353736 (E_RNA) where: Base-Base interactions energy: -104.914 where: short stacking energy: -48.724 Base-Backbone interact. energy: -0.550 local terms energy: -65.889165 where: bonds (distance) C4'-P energy: -14.896 bonds (distance) P-C4' energy: -16.442 flat angles C4'-P-C4' energy: -14.695 flat angles P-C4'-P energy: -5.183 tors. eta vs tors. theta energy: -14.674 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -159.045799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.045799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.107412 (E_RNA) where: Base-Base interactions energy: -89.014 where: short stacking energy: -48.307 Base-Backbone interact. energy: -0.210 local terms energy: -70.883733 where: bonds (distance) C4'-P energy: -13.039 bonds (distance) P-C4' energy: -15.804 flat angles C4'-P-C4' energy: -17.916 flat angles P-C4'-P energy: -10.832 tors. eta vs tors. theta energy: -13.294 Dist. restrs. and SS energy: 1.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -147.281165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.281165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.798516 (E_RNA) where: Base-Base interactions energy: -94.084 where: short stacking energy: -39.137 Base-Backbone interact. energy: -0.591 local terms energy: -54.123336 where: bonds (distance) C4'-P energy: -15.394 bonds (distance) P-C4' energy: -11.539 flat angles C4'-P-C4' energy: -10.038 flat angles P-C4'-P energy: -6.618 tors. eta vs tors. theta energy: -10.534 Dist. restrs. and SS energy: 1.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -145.236477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.236477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.236477 (E_RNA) where: Base-Base interactions energy: -88.268 where: short stacking energy: -47.283 Base-Backbone interact. energy: 1.543 local terms energy: -58.512252 where: bonds (distance) C4'-P energy: -17.173 bonds (distance) P-C4' energy: -11.195 flat angles C4'-P-C4' energy: -10.916 flat angles P-C4'-P energy: -11.241 tors. eta vs tors. theta energy: -7.988 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -160.693904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.693904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.556227 (E_RNA) where: Base-Base interactions energy: -91.394 where: short stacking energy: -41.414 Base-Backbone interact. energy: -0.134 local terms energy: -71.028031 where: bonds (distance) C4'-P energy: -16.156 bonds (distance) P-C4' energy: -16.868 flat angles C4'-P-C4' energy: -16.079 flat angles P-C4'-P energy: -10.590 tors. eta vs tors. theta energy: -11.335 Dist. restrs. and SS energy: 1.862 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -127.255454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.255454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.633846 (E_RNA) where: Base-Base interactions energy: -73.697 where: short stacking energy: -39.904 Base-Backbone interact. energy: -0.186 local terms energy: -53.751433 where: bonds (distance) C4'-P energy: -11.212 bonds (distance) P-C4' energy: -16.554 flat angles C4'-P-C4' energy: -17.529 flat angles P-C4'-P energy: -0.689 tors. eta vs tors. theta energy: -7.768 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -225.785214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.785214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.449535 (E_RNA) where: Base-Base interactions energy: -159.812 where: short stacking energy: -58.344 Base-Backbone interact. energy: -0.134 local terms energy: -67.504010 where: bonds (distance) C4'-P energy: -14.120 bonds (distance) P-C4' energy: -16.617 flat angles C4'-P-C4' energy: -15.144 flat angles P-C4'-P energy: -2.784 tors. eta vs tors. theta energy: -18.839 Dist. restrs. and SS energy: 1.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -224.307043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.307043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.329111 (E_RNA) where: Base-Base interactions energy: -156.061 where: short stacking energy: -56.735 Base-Backbone interact. energy: -0.458 local terms energy: -67.810308 where: bonds (distance) C4'-P energy: -15.517 bonds (distance) P-C4' energy: -17.192 flat angles C4'-P-C4' energy: -14.839 flat angles P-C4'-P energy: -7.328 tors. eta vs tors. theta energy: -12.935 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -233.122515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.122515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.870565 (E_RNA) where: Base-Base interactions energy: -160.660 where: short stacking energy: -69.306 Base-Backbone interact. energy: -0.128 local terms energy: -74.081805 where: bonds (distance) C4'-P energy: -16.681 bonds (distance) P-C4' energy: -17.305 flat angles C4'-P-C4' energy: -14.571 flat angles P-C4'-P energy: -11.184 tors. eta vs tors. theta energy: -14.341 Dist. restrs. and SS energy: 1.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -175.635663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.635663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.635663 (E_RNA) where: Base-Base interactions energy: -110.091 where: short stacking energy: -40.998 Base-Backbone interact. energy: -0.168 local terms energy: -65.377221 where: bonds (distance) C4'-P energy: -15.208 bonds (distance) P-C4' energy: -16.322 flat angles C4'-P-C4' energy: -14.869 flat angles P-C4'-P energy: -9.095 tors. eta vs tors. theta energy: -9.883 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -151.115912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.115912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.115912 (E_RNA) where: Base-Base interactions energy: -89.655 where: short stacking energy: -39.095 Base-Backbone interact. energy: -1.415 local terms energy: -60.045969 where: bonds (distance) C4'-P energy: -15.575 bonds (distance) P-C4' energy: -12.422 flat angles C4'-P-C4' energy: -15.398 flat angles P-C4'-P energy: -6.127 tors. eta vs tors. theta energy: -10.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -169.928852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.928852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.965286 (E_RNA) where: Base-Base interactions energy: -94.938 where: short stacking energy: -56.160 Base-Backbone interact. energy: -0.134 local terms energy: -74.893459 where: bonds (distance) C4'-P energy: -17.559 bonds (distance) P-C4' energy: -15.355 flat angles C4'-P-C4' energy: -15.422 flat angles P-C4'-P energy: -9.698 tors. eta vs tors. theta energy: -16.858 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -144.388543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.388543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.158202 (E_RNA) where: Base-Base interactions energy: -90.438 where: short stacking energy: -40.544 Base-Backbone interact. energy: -1.122 local terms energy: -54.598042 where: bonds (distance) C4'-P energy: -11.204 bonds (distance) P-C4' energy: -10.993 flat angles C4'-P-C4' energy: -15.439 flat angles P-C4'-P energy: -9.640 tors. eta vs tors. theta energy: -7.322 Dist. restrs. and SS energy: 1.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -151.742014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.742014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.747721 (E_RNA) where: Base-Base interactions energy: -95.151 where: short stacking energy: -43.946 Base-Backbone interact. energy: -0.095 local terms energy: -56.501047 where: bonds (distance) C4'-P energy: -13.998 bonds (distance) P-C4' energy: -14.074 flat angles C4'-P-C4' energy: -11.316 flat angles P-C4'-P energy: -8.003 tors. eta vs tors. theta energy: -9.111 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -141.773032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.773032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.517634 (E_RNA) where: Base-Base interactions energy: -84.947 where: short stacking energy: -46.505 Base-Backbone interact. energy: -0.045 local terms energy: -58.525470 where: bonds (distance) C4'-P energy: -11.188 bonds (distance) P-C4' energy: -15.092 flat angles C4'-P-C4' energy: -14.088 flat angles P-C4'-P energy: -8.624 tors. eta vs tors. theta energy: -9.533 Dist. restrs. and SS energy: 1.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -131.665366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.665366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.665366 (E_RNA) where: Base-Base interactions energy: -76.022 where: short stacking energy: -30.678 Base-Backbone interact. energy: -0.250 local terms energy: -55.393172 where: bonds (distance) C4'-P energy: -12.378 bonds (distance) P-C4' energy: -17.202 flat angles C4'-P-C4' energy: -10.973 flat angles P-C4'-P energy: -11.553 tors. eta vs tors. theta energy: -3.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -224.754990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.754990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.237751 (E_RNA) where: Base-Base interactions energy: -146.707 where: short stacking energy: -61.399 Base-Backbone interact. energy: 0.133 local terms energy: -79.663973 where: bonds (distance) C4'-P energy: -17.773 bonds (distance) P-C4' energy: -16.221 flat angles C4'-P-C4' energy: -17.894 flat angles P-C4'-P energy: -11.778 tors. eta vs tors. theta energy: -15.998 Dist. restrs. and SS energy: 1.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -228.030627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.030627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.163418 (E_RNA) where: Base-Base interactions energy: -158.772 where: short stacking energy: -60.955 Base-Backbone interact. energy: -0.085 local terms energy: -69.306676 where: bonds (distance) C4'-P energy: -15.752 bonds (distance) P-C4' energy: -14.598 flat angles C4'-P-C4' energy: -14.651 flat angles P-C4'-P energy: -8.484 tors. eta vs tors. theta energy: -15.822 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -227.443954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.443954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.022378 (E_RNA) where: Base-Base interactions energy: -158.505 where: short stacking energy: -64.249 Base-Backbone interact. energy: -0.341 local terms energy: -71.176885 where: bonds (distance) C4'-P energy: -12.500 bonds (distance) P-C4' energy: -15.812 flat angles C4'-P-C4' energy: -14.368 flat angles P-C4'-P energy: -12.034 tors. eta vs tors. theta energy: -16.464 Dist. restrs. and SS energy: 2.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -176.874994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.874994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.881321 (E_RNA) where: Base-Base interactions energy: -114.074 where: short stacking energy: -48.679 Base-Backbone interact. energy: -0.127 local terms energy: -62.680206 where: bonds (distance) C4'-P energy: -14.820 bonds (distance) P-C4' energy: -16.461 flat angles C4'-P-C4' energy: -18.445 flat angles P-C4'-P energy: -6.542 tors. eta vs tors. theta energy: -6.410 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -180.721261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.721261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.250265 (E_RNA) where: Base-Base interactions energy: -118.284 where: short stacking energy: -58.083 Base-Backbone interact. energy: 0.313 local terms energy: -64.279505 where: bonds (distance) C4'-P energy: -11.116 bonds (distance) P-C4' energy: -14.669 flat angles C4'-P-C4' energy: -17.714 flat angles P-C4'-P energy: -6.720 tors. eta vs tors. theta energy: -14.061 Dist. restrs. and SS energy: 1.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -151.589099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.589099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.591230 (E_RNA) where: Base-Base interactions energy: -86.595 where: short stacking energy: -43.301 Base-Backbone interact. energy: -0.119 local terms energy: -64.877443 where: bonds (distance) C4'-P energy: -16.369 bonds (distance) P-C4' energy: -15.216 flat angles C4'-P-C4' energy: -15.564 flat angles P-C4'-P energy: -6.290 tors. eta vs tors. theta energy: -11.439 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -138.669795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.669795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.685456 (E_RNA) where: Base-Base interactions energy: -73.653 where: short stacking energy: -40.691 Base-Backbone interact. energy: -0.089 local terms energy: -64.943980 where: bonds (distance) C4'-P energy: -16.138 bonds (distance) P-C4' energy: -17.837 flat angles C4'-P-C4' energy: -12.129 flat angles P-C4'-P energy: -10.719 tors. eta vs tors. theta energy: -8.121 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -150.761960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.761960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.812254 (E_RNA) where: Base-Base interactions energy: -95.397 where: short stacking energy: -54.373 Base-Backbone interact. energy: -0.003 local terms energy: -55.411878 where: bonds (distance) C4'-P energy: -6.471 bonds (distance) P-C4' energy: -14.675 flat angles C4'-P-C4' energy: -14.727 flat angles P-C4'-P energy: -6.549 tors. eta vs tors. theta energy: -12.990 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -147.613068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.613068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.613068 (E_RNA) where: Base-Base interactions energy: -93.970 where: short stacking energy: -51.341 Base-Backbone interact. energy: -0.007 local terms energy: -53.636802 where: bonds (distance) C4'-P energy: -13.419 bonds (distance) P-C4' energy: -10.333 flat angles C4'-P-C4' energy: -10.804 flat angles P-C4'-P energy: -6.787 tors. eta vs tors. theta energy: -12.294 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -146.703985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.703985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.911958 (E_RNA) where: Base-Base interactions energy: -85.658 where: short stacking energy: -36.934 Base-Backbone interact. energy: -0.450 local terms energy: -60.803781 where: bonds (distance) C4'-P energy: -10.660 bonds (distance) P-C4' energy: -17.805 flat angles C4'-P-C4' energy: -14.021 flat angles P-C4'-P energy: -6.279 tors. eta vs tors. theta energy: -12.039 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -229.209862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.209862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.057457 (E_RNA) where: Base-Base interactions energy: -157.454 where: short stacking energy: -60.067 Base-Backbone interact. energy: 0.047 local terms energy: -73.650260 where: bonds (distance) C4'-P energy: -14.831 bonds (distance) P-C4' energy: -12.887 flat angles C4'-P-C4' energy: -13.679 flat angles P-C4'-P energy: -14.176 tors. eta vs tors. theta energy: -18.077 Dist. restrs. and SS energy: 1.848 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -228.422498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.422498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.460698 (E_RNA) where: Base-Base interactions energy: -155.055 where: short stacking energy: -62.152 Base-Backbone interact. energy: -0.631 local terms energy: -72.774124 where: bonds (distance) C4'-P energy: -15.893 bonds (distance) P-C4' energy: -15.620 flat angles C4'-P-C4' energy: -16.090 flat angles P-C4'-P energy: -11.400 tors. eta vs tors. theta energy: -13.771 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -228.449264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.449264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.283315 (E_RNA) where: Base-Base interactions energy: -162.756 where: short stacking energy: -64.282 Base-Backbone interact. energy: 0.392 local terms energy: -67.919697 where: bonds (distance) C4'-P energy: -14.843 bonds (distance) P-C4' energy: -13.417 flat angles C4'-P-C4' energy: -13.937 flat angles P-C4'-P energy: -12.398 tors. eta vs tors. theta energy: -13.325 Dist. restrs. and SS energy: 1.834 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -173.951232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.951232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.957151 (E_RNA) where: Base-Base interactions energy: -104.822 where: short stacking energy: -56.293 Base-Backbone interact. energy: -0.722 local terms energy: -68.413429 where: bonds (distance) C4'-P energy: -14.801 bonds (distance) P-C4' energy: -17.312 flat angles C4'-P-C4' energy: -14.074 flat angles P-C4'-P energy: -9.407 tors. eta vs tors. theta energy: -12.819 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -193.968092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.968092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.968092 (E_RNA) where: Base-Base interactions energy: -133.346 where: short stacking energy: -50.809 Base-Backbone interact. energy: 0.577 local terms energy: -61.199419 where: bonds (distance) C4'-P energy: -10.674 bonds (distance) P-C4' energy: -17.273 flat angles C4'-P-C4' energy: -11.226 flat angles P-C4'-P energy: -10.147 tors. eta vs tors. theta energy: -11.879 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -160.024430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.024430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.024430 (E_RNA) where: Base-Base interactions energy: -93.131 where: short stacking energy: -49.157 Base-Backbone interact. energy: -0.006 local terms energy: -66.887272 where: bonds (distance) C4'-P energy: -16.262 bonds (distance) P-C4' energy: -15.613 flat angles C4'-P-C4' energy: -11.202 flat angles P-C4'-P energy: -10.228 tors. eta vs tors. theta energy: -13.582 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -157.542958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.542958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.652352 (E_RNA) where: Base-Base interactions energy: -89.073 where: short stacking energy: -49.772 Base-Backbone interact. energy: 0.754 local terms energy: -69.332638 where: bonds (distance) C4'-P energy: -13.547 bonds (distance) P-C4' energy: -13.738 flat angles C4'-P-C4' energy: -17.662 flat angles P-C4'-P energy: -10.119 tors. eta vs tors. theta energy: -14.267 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -140.194009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.194009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.194009 (E_RNA) where: Base-Base interactions energy: -72.633 where: short stacking energy: -34.578 Base-Backbone interact. energy: 0.191 local terms energy: -67.752108 where: bonds (distance) C4'-P energy: -13.804 bonds (distance) P-C4' energy: -16.798 flat angles C4'-P-C4' energy: -15.959 flat angles P-C4'-P energy: -12.815 tors. eta vs tors. theta energy: -8.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -126.383548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.383548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.434567 (E_RNA) where: Base-Base interactions energy: -76.558 where: short stacking energy: -35.985 Base-Backbone interact. energy: -0.139 local terms energy: -49.737560 where: bonds (distance) C4'-P energy: -7.845 bonds (distance) P-C4' energy: -13.589 flat angles C4'-P-C4' energy: -11.241 flat angles P-C4'-P energy: -5.544 tors. eta vs tors. theta energy: -11.518 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -114.454098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.454098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.454098 (E_RNA) where: Base-Base interactions energy: -58.288 where: short stacking energy: -27.924 Base-Backbone interact. energy: -0.257 local terms energy: -55.909506 where: bonds (distance) C4'-P energy: -9.614 bonds (distance) P-C4' energy: -18.680 flat angles C4'-P-C4' energy: -14.796 flat angles P-C4'-P energy: -8.399 tors. eta vs tors. theta energy: -4.420 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -229.949749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.949749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.042563 (E_RNA) where: Base-Base interactions energy: -163.202 where: short stacking energy: -71.166 Base-Backbone interact. energy: -0.232 local terms energy: -67.609039 where: bonds (distance) C4'-P energy: -11.199 bonds (distance) P-C4' energy: -16.829 flat angles C4'-P-C4' energy: -14.287 flat angles P-C4'-P energy: -8.931 tors. eta vs tors. theta energy: -16.363 Dist. restrs. and SS energy: 1.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -226.688218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.688218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.956506 (E_RNA) where: Base-Base interactions energy: -154.469 where: short stacking energy: -61.318 Base-Backbone interact. energy: -0.278 local terms energy: -73.209230 where: bonds (distance) C4'-P energy: -16.996 bonds (distance) P-C4' energy: -17.202 flat angles C4'-P-C4' energy: -12.471 flat angles P-C4'-P energy: -8.768 tors. eta vs tors. theta energy: -17.773 Dist. restrs. and SS energy: 1.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -213.208025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.208025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.208025 (E_RNA) where: Base-Base interactions energy: -143.997 where: short stacking energy: -61.827 Base-Backbone interact. energy: -0.807 local terms energy: -68.404247 where: bonds (distance) C4'-P energy: -11.517 bonds (distance) P-C4' energy: -15.920 flat angles C4'-P-C4' energy: -15.124 flat angles P-C4'-P energy: -11.993 tors. eta vs tors. theta energy: -13.850 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -198.267895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.267895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.278353 (E_RNA) where: Base-Base interactions energy: -131.119 where: short stacking energy: -45.002 Base-Backbone interact. energy: 0.207 local terms energy: -67.366529 where: bonds (distance) C4'-P energy: -13.344 bonds (distance) P-C4' energy: -15.923 flat angles C4'-P-C4' energy: -17.144 flat angles P-C4'-P energy: -12.734 tors. eta vs tors. theta energy: -8.222 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -153.850286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.850286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.950603 (E_RNA) where: Base-Base interactions energy: -88.507 where: short stacking energy: -41.816 Base-Backbone interact. energy: -0.261 local terms energy: -65.183263 where: bonds (distance) C4'-P energy: -14.714 bonds (distance) P-C4' energy: -17.238 flat angles C4'-P-C4' energy: -9.678 flat angles P-C4'-P energy: -10.347 tors. eta vs tors. theta energy: -13.207 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -181.641916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.641916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.812489 (E_RNA) where: Base-Base interactions energy: -118.077 where: short stacking energy: -43.475 Base-Backbone interact. energy: -0.221 local terms energy: -63.515007 where: bonds (distance) C4'-P energy: -16.954 bonds (distance) P-C4' energy: -16.199 flat angles C4'-P-C4' energy: -14.414 flat angles P-C4'-P energy: -6.257 tors. eta vs tors. theta energy: -9.691 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -137.401464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.401464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.426700 (E_RNA) where: Base-Base interactions energy: -78.788 where: short stacking energy: -40.937 Base-Backbone interact. energy: 0.486 local terms energy: -59.125078 where: bonds (distance) C4'-P energy: -17.070 bonds (distance) P-C4' energy: -14.585 flat angles C4'-P-C4' energy: -13.290 flat angles P-C4'-P energy: -4.462 tors. eta vs tors. theta energy: -9.718 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -137.959729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.959729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.034348 (E_RNA) where: Base-Base interactions energy: -79.053 where: short stacking energy: -47.439 Base-Backbone interact. energy: -0.009 local terms energy: -58.972506 where: bonds (distance) C4'-P energy: -13.262 bonds (distance) P-C4' energy: -12.428 flat angles C4'-P-C4' energy: -15.536 flat angles P-C4'-P energy: -10.415 tors. eta vs tors. theta energy: -7.331 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -104.171723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.171723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.239154 (E_RNA) where: Base-Base interactions energy: -61.178 where: short stacking energy: -26.761 Base-Backbone interact. energy: 0.600 local terms energy: -43.660983 where: bonds (distance) C4'-P energy: -12.424 bonds (distance) P-C4' energy: -16.829 flat angles C4'-P-C4' energy: -11.582 flat angles P-C4'-P energy: -2.951 tors. eta vs tors. theta energy: 0.125 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -109.545445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.545445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.545445 (E_RNA) where: Base-Base interactions energy: -62.178 where: short stacking energy: -24.861 Base-Backbone interact. energy: 0.186 local terms energy: -47.553101 where: bonds (distance) C4'-P energy: -15.066 bonds (distance) P-C4' energy: -9.717 flat angles C4'-P-C4' energy: -11.496 flat angles P-C4'-P energy: -12.010 tors. eta vs tors. theta energy: 0.736 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -226.545118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.545118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.822239 (E_RNA) where: Base-Base interactions energy: -156.476 where: short stacking energy: -65.159 Base-Backbone interact. energy: -0.377 local terms energy: -70.969255 where: bonds (distance) C4'-P energy: -13.319 bonds (distance) P-C4' energy: -16.635 flat angles C4'-P-C4' energy: -16.660 flat angles P-C4'-P energy: -9.017 tors. eta vs tors. theta energy: -15.338 Dist. restrs. and SS energy: 1.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -215.533680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.533680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.961586 (E_RNA) where: Base-Base interactions energy: -145.250 where: short stacking energy: -69.622 Base-Backbone interact. energy: -0.071 local terms energy: -71.639886 where: bonds (distance) C4'-P energy: -16.445 bonds (distance) P-C4' energy: -14.550 flat angles C4'-P-C4' energy: -16.052 flat angles P-C4'-P energy: -8.552 tors. eta vs tors. theta energy: -16.042 Dist. restrs. and SS energy: 1.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -227.744523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.744523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.744523 (E_RNA) where: Base-Base interactions energy: -150.643 where: short stacking energy: -56.123 Base-Backbone interact. energy: -0.373 local terms energy: -76.729305 where: bonds (distance) C4'-P energy: -16.622 bonds (distance) P-C4' energy: -18.157 flat angles C4'-P-C4' energy: -15.786 flat angles P-C4'-P energy: -9.422 tors. eta vs tors. theta energy: -16.742 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -205.208526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.208526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.208526 (E_RNA) where: Base-Base interactions energy: -137.037 where: short stacking energy: -57.202 Base-Backbone interact. energy: 1.772 local terms energy: -69.944201 where: bonds (distance) C4'-P energy: -15.058 bonds (distance) P-C4' energy: -17.767 flat angles C4'-P-C4' energy: -17.211 flat angles P-C4'-P energy: -12.147 tors. eta vs tors. theta energy: -7.761 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -167.967412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.967412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.993173 (E_RNA) where: Base-Base interactions energy: -98.446 where: short stacking energy: -49.354 Base-Backbone interact. energy: -0.152 local terms energy: -69.395429 where: bonds (distance) C4'-P energy: -13.928 bonds (distance) P-C4' energy: -12.766 flat angles C4'-P-C4' energy: -16.780 flat angles P-C4'-P energy: -12.912 tors. eta vs tors. theta energy: -13.009 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -153.198750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.198750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.554287 (E_RNA) where: Base-Base interactions energy: -91.988 where: short stacking energy: -37.497 Base-Backbone interact. energy: -0.086 local terms energy: -61.480746 where: bonds (distance) C4'-P energy: -12.243 bonds (distance) P-C4' energy: -16.118 flat angles C4'-P-C4' energy: -14.062 flat angles P-C4'-P energy: -10.058 tors. eta vs tors. theta energy: -8.999 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -148.492609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.492609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.492609 (E_RNA) where: Base-Base interactions energy: -79.717 where: short stacking energy: -44.836 Base-Backbone interact. energy: 0.166 local terms energy: -68.942005 where: bonds (distance) C4'-P energy: -16.624 bonds (distance) P-C4' energy: -15.150 flat angles C4'-P-C4' energy: -15.273 flat angles P-C4'-P energy: -12.683 tors. eta vs tors. theta energy: -9.213 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -130.163878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.163878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.131583 (E_RNA) where: Base-Base interactions energy: -65.694 where: short stacking energy: -30.364 Base-Backbone interact. energy: -0.283 local terms energy: -65.154838 where: bonds (distance) C4'-P energy: -16.014 bonds (distance) P-C4' energy: -17.960 flat angles C4'-P-C4' energy: -16.334 flat angles P-C4'-P energy: -9.057 tors. eta vs tors. theta energy: -5.790 Dist. restrs. and SS energy: 0.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -119.197705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.197705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.214107 (E_RNA) where: Base-Base interactions energy: -71.173 where: short stacking energy: -31.214 Base-Backbone interact. energy: -0.012 local terms energy: -48.029037 where: bonds (distance) C4'-P energy: -14.472 bonds (distance) P-C4' energy: -16.008 flat angles C4'-P-C4' energy: -17.659 flat angles P-C4'-P energy: -1.913 tors. eta vs tors. theta energy: 2.024 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -135.032609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.032609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.212246 (E_RNA) where: Base-Base interactions energy: -83.533 where: short stacking energy: -37.887 Base-Backbone interact. energy: -0.300 local terms energy: -51.378781 where: bonds (distance) C4'-P energy: -12.405 bonds (distance) P-C4' energy: -8.468 flat angles C4'-P-C4' energy: -14.257 flat angles P-C4'-P energy: -8.839 tors. eta vs tors. theta energy: -7.411 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -214.813152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.813152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.844492 (E_RNA) where: Base-Base interactions energy: -140.805 where: short stacking energy: -57.766 Base-Backbone interact. energy: -0.406 local terms energy: -73.633517 where: bonds (distance) C4'-P energy: -13.936 bonds (distance) P-C4' energy: -17.689 flat angles C4'-P-C4' energy: -14.374 flat angles P-C4'-P energy: -11.191 tors. eta vs tors. theta energy: -16.444 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -231.614618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.614618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.614618 (E_RNA) where: Base-Base interactions energy: -155.447 where: short stacking energy: -59.977 Base-Backbone interact. energy: -0.319 local terms energy: -75.848076 where: bonds (distance) C4'-P energy: -17.632 bonds (distance) P-C4' energy: -17.753 flat angles C4'-P-C4' energy: -14.567 flat angles P-C4'-P energy: -7.038 tors. eta vs tors. theta energy: -18.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -210.571010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.571010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.616292 (E_RNA) where: Base-Base interactions energy: -137.399 where: short stacking energy: -52.721 Base-Backbone interact. energy: -0.345 local terms energy: -72.871651 where: bonds (distance) C4'-P energy: -16.947 bonds (distance) P-C4' energy: -15.153 flat angles C4'-P-C4' energy: -13.260 flat angles P-C4'-P energy: -11.766 tors. eta vs tors. theta energy: -15.747 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -203.020655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.020655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.026652 (E_RNA) where: Base-Base interactions energy: -128.874 where: short stacking energy: -51.886 Base-Backbone interact. energy: -0.275 local terms energy: -73.877637 where: bonds (distance) C4'-P energy: -17.017 bonds (distance) P-C4' energy: -14.878 flat angles C4'-P-C4' energy: -16.510 flat angles P-C4'-P energy: -12.221 tors. eta vs tors. theta energy: -13.251 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -161.162520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.162520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.250769 (E_RNA) where: Base-Base interactions energy: -95.156 where: short stacking energy: -49.875 Base-Backbone interact. energy: -0.235 local terms energy: -65.859363 where: bonds (distance) C4'-P energy: -16.035 bonds (distance) P-C4' energy: -14.466 flat angles C4'-P-C4' energy: -13.128 flat angles P-C4'-P energy: -7.966 tors. eta vs tors. theta energy: -14.264 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -163.251821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.251821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.251821 (E_RNA) where: Base-Base interactions energy: -102.367 where: short stacking energy: -42.422 Base-Backbone interact. energy: -0.414 local terms energy: -60.470669 where: bonds (distance) C4'-P energy: -16.727 bonds (distance) P-C4' energy: -15.586 flat angles C4'-P-C4' energy: -14.408 flat angles P-C4'-P energy: -8.444 tors. eta vs tors. theta energy: -5.305 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -144.521697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.521697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.521697 (E_RNA) where: Base-Base interactions energy: -92.468 where: short stacking energy: -46.534 Base-Backbone interact. energy: -0.348 local terms energy: -51.706594 where: bonds (distance) C4'-P energy: -13.384 bonds (distance) P-C4' energy: -11.484 flat angles C4'-P-C4' energy: -9.623 flat angles P-C4'-P energy: -8.060 tors. eta vs tors. theta energy: -9.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -147.713163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.713163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.717960 (E_RNA) where: Base-Base interactions energy: -95.309 where: short stacking energy: -39.612 Base-Backbone interact. energy: -0.167 local terms energy: -52.240974 where: bonds (distance) C4'-P energy: -11.579 bonds (distance) P-C4' energy: -13.063 flat angles C4'-P-C4' energy: -15.825 flat angles P-C4'-P energy: -1.993 tors. eta vs tors. theta energy: -9.780 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -142.240391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.240391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.511073 (E_RNA) where: Base-Base interactions energy: -84.975 where: short stacking energy: -43.825 Base-Backbone interact. energy: -0.366 local terms energy: -57.170277 where: bonds (distance) C4'-P energy: -11.475 bonds (distance) P-C4' energy: -13.993 flat angles C4'-P-C4' energy: -11.511 flat angles P-C4'-P energy: -9.459 tors. eta vs tors. theta energy: -10.734 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -127.072813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.072813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.131518 (E_RNA) where: Base-Base interactions energy: -75.120 where: short stacking energy: -34.461 Base-Backbone interact. energy: 3.502 local terms energy: -55.513473 where: bonds (distance) C4'-P energy: -10.955 bonds (distance) P-C4' energy: -14.758 flat angles C4'-P-C4' energy: -14.230 flat angles P-C4'-P energy: -8.002 tors. eta vs tors. theta energy: -7.568 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -223.408477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.408477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.514331 (E_RNA) where: Base-Base interactions energy: -147.158 where: short stacking energy: -55.851 Base-Backbone interact. energy: -0.623 local terms energy: -75.733777 where: bonds (distance) C4'-P energy: -16.626 bonds (distance) P-C4' energy: -17.019 flat angles C4'-P-C4' energy: -16.251 flat angles P-C4'-P energy: -8.538 tors. eta vs tors. theta energy: -17.300 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -212.519870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.519870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.519870 (E_RNA) where: Base-Base interactions energy: -143.095 where: short stacking energy: -55.814 Base-Backbone interact. energy: -0.397 local terms energy: -69.028039 where: bonds (distance) C4'-P energy: -13.402 bonds (distance) P-C4' energy: -15.733 flat angles C4'-P-C4' energy: -16.703 flat angles P-C4'-P energy: -7.690 tors. eta vs tors. theta energy: -15.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -223.587126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.587126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.587790 (E_RNA) where: Base-Base interactions energy: -158.665 where: short stacking energy: -51.635 Base-Backbone interact. energy: 0.803 local terms energy: -65.725738 where: bonds (distance) C4'-P energy: -14.433 bonds (distance) P-C4' energy: -12.995 flat angles C4'-P-C4' energy: -14.968 flat angles P-C4'-P energy: -12.385 tors. eta vs tors. theta energy: -10.946 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -188.175022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.175022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.247637 (E_RNA) where: Base-Base interactions energy: -129.440 where: short stacking energy: -45.374 Base-Backbone interact. energy: 0.576 local terms energy: -59.383611 where: bonds (distance) C4'-P energy: -13.269 bonds (distance) P-C4' energy: -15.175 flat angles C4'-P-C4' energy: -11.446 flat angles P-C4'-P energy: -11.968 tors. eta vs tors. theta energy: -7.525 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -155.108710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.108710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.208639 (E_RNA) where: Base-Base interactions energy: -107.199 where: short stacking energy: -44.278 Base-Backbone interact. energy: -0.056 local terms energy: -47.952911 where: bonds (distance) C4'-P energy: -14.301 bonds (distance) P-C4' energy: -11.452 flat angles C4'-P-C4' energy: -14.000 flat angles P-C4'-P energy: -2.132 tors. eta vs tors. theta energy: -6.069 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -153.813253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.813253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.813253 (E_RNA) where: Base-Base interactions energy: -90.445 where: short stacking energy: -41.568 Base-Backbone interact. energy: -0.402 local terms energy: -62.965984 where: bonds (distance) C4'-P energy: -16.391 bonds (distance) P-C4' energy: -12.048 flat angles C4'-P-C4' energy: -14.467 flat angles P-C4'-P energy: -7.805 tors. eta vs tors. theta energy: -12.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -153.639844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.639844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.639844 (E_RNA) where: Base-Base interactions energy: -91.916 where: short stacking energy: -48.835 Base-Backbone interact. energy: -0.327 local terms energy: -61.396394 where: bonds (distance) C4'-P energy: -11.284 bonds (distance) P-C4' energy: -17.678 flat angles C4'-P-C4' energy: -13.634 flat angles P-C4'-P energy: -8.104 tors. eta vs tors. theta energy: -10.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -136.289288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.289288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.342700 (E_RNA) where: Base-Base interactions energy: -76.110 where: short stacking energy: -38.768 Base-Backbone interact. energy: -0.136 local terms energy: -60.096116 where: bonds (distance) C4'-P energy: -15.019 bonds (distance) P-C4' energy: -16.594 flat angles C4'-P-C4' energy: -10.936 flat angles P-C4'-P energy: -7.990 tors. eta vs tors. theta energy: -9.556 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -146.993216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.993216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.035767 (E_RNA) where: Base-Base interactions energy: -84.491 where: short stacking energy: -41.867 Base-Backbone interact. energy: -1.105 local terms energy: -61.439503 where: bonds (distance) C4'-P energy: -13.103 bonds (distance) P-C4' energy: -15.313 flat angles C4'-P-C4' energy: -16.472 flat angles P-C4'-P energy: -6.526 tors. eta vs tors. theta energy: -10.026 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -120.132362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.132362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.184782 (E_RNA) where: Base-Base interactions energy: -65.105 where: short stacking energy: -36.209 Base-Backbone interact. energy: -0.078 local terms energy: -55.001471 where: bonds (distance) C4'-P energy: -14.967 bonds (distance) P-C4' energy: -11.203 flat angles C4'-P-C4' energy: -12.201 flat angles P-C4'-P energy: -10.499 tors. eta vs tors. theta energy: -6.132 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -227.334579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.334579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.457132 (E_RNA) where: Base-Base interactions energy: -150.836 where: short stacking energy: -59.023 Base-Backbone interact. energy: -0.076 local terms energy: -76.544775 where: bonds (distance) C4'-P energy: -17.037 bonds (distance) P-C4' energy: -16.884 flat angles C4'-P-C4' energy: -14.651 flat angles P-C4'-P energy: -7.819 tors. eta vs tors. theta energy: -20.154 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -228.185309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.185309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.214724 (E_RNA) where: Base-Base interactions energy: -144.170 where: short stacking energy: -63.024 Base-Backbone interact. energy: -0.542 local terms energy: -83.501850 where: bonds (distance) C4'-P energy: -16.831 bonds (distance) P-C4' energy: -16.583 flat angles C4'-P-C4' energy: -18.921 flat angles P-C4'-P energy: -13.869 tors. eta vs tors. theta energy: -17.297 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -214.364887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.364887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.581924 (E_RNA) where: Base-Base interactions energy: -146.635 where: short stacking energy: -47.843 Base-Backbone interact. energy: -1.151 local terms energy: -66.796003 where: bonds (distance) C4'-P energy: -16.726 bonds (distance) P-C4' energy: -9.682 flat angles C4'-P-C4' energy: -15.556 flat angles P-C4'-P energy: -9.559 tors. eta vs tors. theta energy: -15.272 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -186.413710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.413710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.413710 (E_RNA) where: Base-Base interactions energy: -135.830 where: short stacking energy: -51.034 Base-Backbone interact. energy: 2.237 local terms energy: -52.820351 where: bonds (distance) C4'-P energy: -12.661 bonds (distance) P-C4' energy: -12.414 flat angles C4'-P-C4' energy: -12.698 flat angles P-C4'-P energy: -10.935 tors. eta vs tors. theta energy: -4.113 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -155.722854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.722854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.815187 (E_RNA) where: Base-Base interactions energy: -99.899 where: short stacking energy: -52.204 Base-Backbone interact. energy: -0.069 local terms energy: -55.846767 where: bonds (distance) C4'-P energy: -15.822 bonds (distance) P-C4' energy: -11.930 flat angles C4'-P-C4' energy: -12.356 flat angles P-C4'-P energy: -2.461 tors. eta vs tors. theta energy: -13.277 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -149.757108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.757108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.757108 (E_RNA) where: Base-Base interactions energy: -82.599 where: short stacking energy: -44.583 Base-Backbone interact. energy: -0.114 local terms energy: -67.043284 where: bonds (distance) C4'-P energy: -15.947 bonds (distance) P-C4' energy: -15.444 flat angles C4'-P-C4' energy: -15.724 flat angles P-C4'-P energy: -8.346 tors. eta vs tors. theta energy: -11.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -162.177549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.177549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.177549 (E_RNA) where: Base-Base interactions energy: -97.449 where: short stacking energy: -31.538 Base-Backbone interact. energy: 0.244 local terms energy: -64.971773 where: bonds (distance) C4'-P energy: -14.330 bonds (distance) P-C4' energy: -15.414 flat angles C4'-P-C4' energy: -15.859 flat angles P-C4'-P energy: -13.847 tors. eta vs tors. theta energy: -5.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -128.971418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.971418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.971418 (E_RNA) where: Base-Base interactions energy: -74.937 where: short stacking energy: -32.303 Base-Backbone interact. energy: -0.037 local terms energy: -53.997284 where: bonds (distance) C4'-P energy: -15.313 bonds (distance) P-C4' energy: -14.775 flat angles C4'-P-C4' energy: -12.655 flat angles P-C4'-P energy: -6.671 tors. eta vs tors. theta energy: -4.583 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -127.222578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.222578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.296263 (E_RNA) where: Base-Base interactions energy: -67.645 where: short stacking energy: -40.232 Base-Backbone interact. energy: -0.207 local terms energy: -59.444681 where: bonds (distance) C4'-P energy: -9.917 bonds (distance) P-C4' energy: -15.487 flat angles C4'-P-C4' energy: -16.433 flat angles P-C4'-P energy: -9.249 tors. eta vs tors. theta energy: -8.358 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -118.637860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.637860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.235130 (E_RNA) where: Base-Base interactions energy: -75.064 where: short stacking energy: -35.770 Base-Backbone interact. energy: 0.618 local terms energy: -44.789179 where: bonds (distance) C4'-P energy: -9.953 bonds (distance) P-C4' energy: -11.282 flat angles C4'-P-C4' energy: -12.653 flat angles P-C4'-P energy: -3.954 tors. eta vs tors. theta energy: -6.948 Dist. restrs. and SS energy: 0.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -228.799423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.799423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.807029 (E_RNA) where: Base-Base interactions energy: -156.783 where: short stacking energy: -67.029 Base-Backbone interact. energy: -0.237 local terms energy: -71.787034 where: bonds (distance) C4'-P energy: -15.340 bonds (distance) P-C4' energy: -17.594 flat angles C4'-P-C4' energy: -18.640 flat angles P-C4'-P energy: -5.386 tors. eta vs tors. theta energy: -14.827 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -218.844480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.844480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.844480 (E_RNA) where: Base-Base interactions energy: -155.230 where: short stacking energy: -63.150 Base-Backbone interact. energy: -1.253 local terms energy: -62.361425 where: bonds (distance) C4'-P energy: -10.449 bonds (distance) P-C4' energy: -13.939 flat angles C4'-P-C4' energy: -18.543 flat angles P-C4'-P energy: -7.071 tors. eta vs tors. theta energy: -12.358 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -207.154482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.154482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.174865 (E_RNA) where: Base-Base interactions energy: -139.451 where: short stacking energy: -62.094 Base-Backbone interact. energy: 0.030 local terms energy: -67.754162 where: bonds (distance) C4'-P energy: -16.387 bonds (distance) P-C4' energy: -15.360 flat angles C4'-P-C4' energy: -14.326 flat angles P-C4'-P energy: -5.336 tors. eta vs tors. theta energy: -16.345 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -168.406391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.406391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.422005 (E_RNA) where: Base-Base interactions energy: -107.435 where: short stacking energy: -48.449 Base-Backbone interact. energy: -0.562 local terms energy: -60.425000 where: bonds (distance) C4'-P energy: -11.286 bonds (distance) P-C4' energy: -15.858 flat angles C4'-P-C4' energy: -15.133 flat angles P-C4'-P energy: -11.410 tors. eta vs tors. theta energy: -6.737 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -160.431334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.431334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.431334 (E_RNA) where: Base-Base interactions energy: -98.304 where: short stacking energy: -55.695 Base-Backbone interact. energy: -0.020 local terms energy: -62.107805 where: bonds (distance) C4'-P energy: -15.451 bonds (distance) P-C4' energy: -12.546 flat angles C4'-P-C4' energy: -11.544 flat angles P-C4'-P energy: -9.209 tors. eta vs tors. theta energy: -13.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -149.575562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.575562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.575562 (E_RNA) where: Base-Base interactions energy: -92.498 where: short stacking energy: -42.474 Base-Backbone interact. energy: -0.181 local terms energy: -56.896255 where: bonds (distance) C4'-P energy: -17.897 bonds (distance) P-C4' energy: -13.317 flat angles C4'-P-C4' energy: -13.129 flat angles P-C4'-P energy: -6.407 tors. eta vs tors. theta energy: -6.146 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -139.674900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.674900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.695111 (E_RNA) where: Base-Base interactions energy: -80.701 where: short stacking energy: -37.109 Base-Backbone interact. energy: -0.107 local terms energy: -58.887328 where: bonds (distance) C4'-P energy: -15.633 bonds (distance) P-C4' energy: -17.843 flat angles C4'-P-C4' energy: -8.074 flat angles P-C4'-P energy: -12.973 tors. eta vs tors. theta energy: -4.365 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -136.467269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.467269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.559331 (E_RNA) where: Base-Base interactions energy: -73.172 where: short stacking energy: -41.216 Base-Backbone interact. energy: -0.336 local terms energy: -63.051758 where: bonds (distance) C4'-P energy: -12.792 bonds (distance) P-C4' energy: -14.343 flat angles C4'-P-C4' energy: -16.805 flat angles P-C4'-P energy: -11.438 tors. eta vs tors. theta energy: -7.674 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -122.445717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.445717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.594060 (E_RNA) where: Base-Base interactions energy: -65.288 where: short stacking energy: -25.741 Base-Backbone interact. energy: -0.074 local terms energy: -57.231779 where: bonds (distance) C4'-P energy: -14.362 bonds (distance) P-C4' energy: -14.631 flat angles C4'-P-C4' energy: -14.870 flat angles P-C4'-P energy: -9.870 tors. eta vs tors. theta energy: -3.498 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -115.411005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.411005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.411005 (E_RNA) where: Base-Base interactions energy: -67.122 where: short stacking energy: -24.335 Base-Backbone interact. energy: -0.644 local terms energy: -47.645498 where: bonds (distance) C4'-P energy: -12.333 bonds (distance) P-C4' energy: -17.445 flat angles C4'-P-C4' energy: -10.669 flat angles P-C4'-P energy: -4.774 tors. eta vs tors. theta energy: -2.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -233.323834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.323834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.323834 (E_RNA) where: Base-Base interactions energy: -157.068 where: short stacking energy: -64.807 Base-Backbone interact. energy: 0.743 local terms energy: -76.998184 where: bonds (distance) C4'-P energy: -16.830 bonds (distance) P-C4' energy: -15.039 flat angles C4'-P-C4' energy: -17.173 flat angles P-C4'-P energy: -9.377 tors. eta vs tors. theta energy: -18.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -215.464210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.464210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.464210 (E_RNA) where: Base-Base interactions energy: -155.971 where: short stacking energy: -54.543 Base-Backbone interact. energy: 0.117 local terms energy: -59.610218 where: bonds (distance) C4'-P energy: -17.512 bonds (distance) P-C4' energy: -6.922 flat angles C4'-P-C4' energy: -12.365 flat angles P-C4'-P energy: -10.426 tors. eta vs tors. theta energy: -12.385 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -200.283954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.283954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.298859 (E_RNA) where: Base-Base interactions energy: -134.711 where: short stacking energy: -63.772 Base-Backbone interact. energy: -0.758 local terms energy: -64.829343 where: bonds (distance) C4'-P energy: -9.650 bonds (distance) P-C4' energy: -14.032 flat angles C4'-P-C4' energy: -16.726 flat angles P-C4'-P energy: -6.411 tors. eta vs tors. theta energy: -18.010 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -157.637705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.637705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.637705 (E_RNA) where: Base-Base interactions energy: -92.482 where: short stacking energy: -49.941 Base-Backbone interact. energy: -0.062 local terms energy: -65.094331 where: bonds (distance) C4'-P energy: -11.866 bonds (distance) P-C4' energy: -13.279 flat angles C4'-P-C4' energy: -17.318 flat angles P-C4'-P energy: -6.824 tors. eta vs tors. theta energy: -15.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -191.348904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.348904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.348904 (E_RNA) where: Base-Base interactions energy: -125.714 where: short stacking energy: -45.858 Base-Backbone interact. energy: -0.106 local terms energy: -65.528918 where: bonds (distance) C4'-P energy: -9.669 bonds (distance) P-C4' energy: -16.750 flat angles C4'-P-C4' energy: -17.779 flat angles P-C4'-P energy: -9.630 tors. eta vs tors. theta energy: -11.700 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -148.105512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.105512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.748636 (E_RNA) where: Base-Base interactions energy: -84.024 where: short stacking energy: -37.521 Base-Backbone interact. energy: -0.206 local terms energy: -64.518512 where: bonds (distance) C4'-P energy: -13.464 bonds (distance) P-C4' energy: -11.637 flat angles C4'-P-C4' energy: -17.540 flat angles P-C4'-P energy: -13.770 tors. eta vs tors. theta energy: -8.108 Dist. restrs. and SS energy: 0.643 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -150.307387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.307387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.307387 (E_RNA) where: Base-Base interactions energy: -86.922 where: short stacking energy: -42.740 Base-Backbone interact. energy: -0.769 local terms energy: -62.615921 where: bonds (distance) C4'-P energy: -13.477 bonds (distance) P-C4' energy: -18.399 flat angles C4'-P-C4' energy: -14.244 flat angles P-C4'-P energy: -6.846 tors. eta vs tors. theta energy: -9.649 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -135.490923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.490923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.160009 (E_RNA) where: Base-Base interactions energy: -79.129 where: short stacking energy: -42.779 Base-Backbone interact. energy: -0.192 local terms energy: -57.838907 where: bonds (distance) C4'-P energy: -10.992 bonds (distance) P-C4' energy: -15.448 flat angles C4'-P-C4' energy: -16.695 flat angles P-C4'-P energy: -6.869 tors. eta vs tors. theta energy: -7.835 Dist. restrs. and SS energy: 1.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -123.296611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.296611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.296611 (E_RNA) where: Base-Base interactions energy: -71.732 where: short stacking energy: -39.600 Base-Backbone interact. energy: -0.144 local terms energy: -51.420844 where: bonds (distance) C4'-P energy: -10.144 bonds (distance) P-C4' energy: -13.800 flat angles C4'-P-C4' energy: -14.104 flat angles P-C4'-P energy: -4.383 tors. eta vs tors. theta energy: -8.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -139.974926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.974926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.994278 (E_RNA) where: Base-Base interactions energy: -87.222 where: short stacking energy: -46.457 Base-Backbone interact. energy: -0.313 local terms energy: -52.459186 where: bonds (distance) C4'-P energy: -7.573 bonds (distance) P-C4' energy: -11.871 flat angles C4'-P-C4' energy: -10.455 flat angles P-C4'-P energy: -13.118 tors. eta vs tors. theta energy: -9.443 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -220.981813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.981813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.014237 (E_RNA) where: Base-Base interactions energy: -151.878 where: short stacking energy: -63.758 Base-Backbone interact. energy: -0.433 local terms energy: -68.702511 where: bonds (distance) C4'-P energy: -14.660 bonds (distance) P-C4' energy: -13.106 flat angles C4'-P-C4' energy: -16.446 flat angles P-C4'-P energy: -9.963 tors. eta vs tors. theta energy: -14.527 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -228.526286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.526286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.541891 (E_RNA) where: Base-Base interactions energy: -158.551 where: short stacking energy: -58.212 Base-Backbone interact. energy: 0.883 local terms energy: -70.873866 where: bonds (distance) C4'-P energy: -14.188 bonds (distance) P-C4' energy: -15.951 flat angles C4'-P-C4' energy: -12.777 flat angles P-C4'-P energy: -10.219 tors. eta vs tors. theta energy: -17.739 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -207.466490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.466490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.589926 (E_RNA) where: Base-Base interactions energy: -136.751 where: short stacking energy: -54.455 Base-Backbone interact. energy: -1.500 local terms energy: -70.338526 where: bonds (distance) C4'-P energy: -13.138 bonds (distance) P-C4' energy: -15.043 flat angles C4'-P-C4' energy: -14.741 flat angles P-C4'-P energy: -13.609 tors. eta vs tors. theta energy: -13.807 Dist. restrs. and SS energy: 1.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -160.811021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.811021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.811021 (E_RNA) where: Base-Base interactions energy: -87.929 where: short stacking energy: -46.665 Base-Backbone interact. energy: -0.582 local terms energy: -72.299265 where: bonds (distance) C4'-P energy: -11.287 bonds (distance) P-C4' energy: -17.858 flat angles C4'-P-C4' energy: -17.593 flat angles P-C4'-P energy: -12.571 tors. eta vs tors. theta energy: -12.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -184.379562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.379562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.379562 (E_RNA) where: Base-Base interactions energy: -114.176 where: short stacking energy: -47.376 Base-Backbone interact. energy: -0.119 local terms energy: -70.084297 where: bonds (distance) C4'-P energy: -14.821 bonds (distance) P-C4' energy: -16.992 flat angles C4'-P-C4' energy: -15.064 flat angles P-C4'-P energy: -11.824 tors. eta vs tors. theta energy: -11.384 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -179.547649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.547649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.689771 (E_RNA) where: Base-Base interactions energy: -116.394 where: short stacking energy: -53.285 Base-Backbone interact. energy: -0.145 local terms energy: -63.151287 where: bonds (distance) C4'-P energy: -13.183 bonds (distance) P-C4' energy: -12.958 flat angles C4'-P-C4' energy: -15.325 flat angles P-C4'-P energy: -7.929 tors. eta vs tors. theta energy: -13.757 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -151.635746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.635746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.742398 (E_RNA) where: Base-Base interactions energy: -85.541 where: short stacking energy: -42.145 Base-Backbone interact. energy: -0.205 local terms energy: -65.996956 where: bonds (distance) C4'-P energy: -16.034 bonds (distance) P-C4' energy: -13.743 flat angles C4'-P-C4' energy: -16.536 flat angles P-C4'-P energy: -10.082 tors. eta vs tors. theta energy: -9.602 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -140.559574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.559574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.577377 (E_RNA) where: Base-Base interactions energy: -79.459 where: short stacking energy: -37.912 Base-Backbone interact. energy: -0.043 local terms energy: -61.075468 where: bonds (distance) C4'-P energy: -13.165 bonds (distance) P-C4' energy: -16.269 flat angles C4'-P-C4' energy: -17.109 flat angles P-C4'-P energy: -7.351 tors. eta vs tors. theta energy: -7.182 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -135.621364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.621364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.621364 (E_RNA) where: Base-Base interactions energy: -79.633 where: short stacking energy: -30.148 Base-Backbone interact. energy: -0.792 local terms energy: -55.196173 where: bonds (distance) C4'-P energy: -15.173 bonds (distance) P-C4' energy: -14.994 flat angles C4'-P-C4' energy: -11.514 flat angles P-C4'-P energy: -10.618 tors. eta vs tors. theta energy: -2.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -131.253680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.253680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.257696 (E_RNA) where: Base-Base interactions energy: -73.267 where: short stacking energy: -35.655 Base-Backbone interact. energy: -0.236 local terms energy: -57.754915 where: bonds (distance) C4'-P energy: -15.898 bonds (distance) P-C4' energy: -14.684 flat angles C4'-P-C4' energy: -13.419 flat angles P-C4'-P energy: -7.143 tors. eta vs tors. theta energy: -6.611 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -217.812692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.812692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.827005 (E_RNA) where: Base-Base interactions energy: -147.461 where: short stacking energy: -56.512 Base-Backbone interact. energy: -0.184 local terms energy: -70.182626 where: bonds (distance) C4'-P energy: -16.723 bonds (distance) P-C4' energy: -14.246 flat angles C4'-P-C4' energy: -17.220 flat angles P-C4'-P energy: -6.813 tors. eta vs tors. theta energy: -15.180 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -221.436303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.436303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.538144 (E_RNA) where: Base-Base interactions energy: -154.068 where: short stacking energy: -60.799 Base-Backbone interact. energy: -0.272 local terms energy: -67.198109 where: bonds (distance) C4'-P energy: -11.766 bonds (distance) P-C4' energy: -15.267 flat angles C4'-P-C4' energy: -13.646 flat angles P-C4'-P energy: -8.940 tors. eta vs tors. theta energy: -17.580 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -224.079395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.079395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.341706 (E_RNA) where: Base-Base interactions energy: -148.216 where: short stacking energy: -63.300 Base-Backbone interact. energy: -1.058 local terms energy: -76.067679 where: bonds (distance) C4'-P energy: -17.905 bonds (distance) P-C4' energy: -14.427 flat angles C4'-P-C4' energy: -13.887 flat angles P-C4'-P energy: -12.196 tors. eta vs tors. theta energy: -17.652 Dist. restrs. and SS energy: 1.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -176.413761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.413761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.466763 (E_RNA) where: Base-Base interactions energy: -108.153 where: short stacking energy: -49.388 Base-Backbone interact. energy: -0.577 local terms energy: -67.736807 where: bonds (distance) C4'-P energy: -17.664 bonds (distance) P-C4' energy: -12.972 flat angles C4'-P-C4' energy: -17.494 flat angles P-C4'-P energy: -11.508 tors. eta vs tors. theta energy: -8.099 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -159.598112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.598112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.902981 (E_RNA) where: Base-Base interactions energy: -95.877 where: short stacking energy: -47.438 Base-Backbone interact. energy: -0.397 local terms energy: -63.629820 where: bonds (distance) C4'-P energy: -15.778 bonds (distance) P-C4' energy: -15.892 flat angles C4'-P-C4' energy: -13.333 flat angles P-C4'-P energy: -7.546 tors. eta vs tors. theta energy: -11.081 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -174.117478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.117478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.117478 (E_RNA) where: Base-Base interactions energy: -101.906 where: short stacking energy: -44.203 Base-Backbone interact. energy: -0.183 local terms energy: -72.029314 where: bonds (distance) C4'-P energy: -15.559 bonds (distance) P-C4' energy: -17.100 flat angles C4'-P-C4' energy: -16.380 flat angles P-C4'-P energy: -12.558 tors. eta vs tors. theta energy: -10.432 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -161.149278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.149278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.234208 (E_RNA) where: Base-Base interactions energy: -100.770 where: short stacking energy: -48.146 Base-Backbone interact. energy: -0.610 local terms energy: -59.854571 where: bonds (distance) C4'-P energy: -12.710 bonds (distance) P-C4' energy: -16.064 flat angles C4'-P-C4' energy: -14.868 flat angles P-C4'-P energy: -7.320 tors. eta vs tors. theta energy: -8.892 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -139.523171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.523171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.528195 (E_RNA) where: Base-Base interactions energy: -79.343 where: short stacking energy: -40.425 Base-Backbone interact. energy: -0.241 local terms energy: -59.944141 where: bonds (distance) C4'-P energy: -14.800 bonds (distance) P-C4' energy: -13.331 flat angles C4'-P-C4' energy: -11.727 flat angles P-C4'-P energy: -10.386 tors. eta vs tors. theta energy: -9.700 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -137.118407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.118407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.142408 (E_RNA) where: Base-Base interactions energy: -78.077 where: short stacking energy: -33.733 Base-Backbone interact. energy: -0.866 local terms energy: -58.199487 where: bonds (distance) C4'-P energy: -13.218 bonds (distance) P-C4' energy: -15.392 flat angles C4'-P-C4' energy: -14.665 flat angles P-C4'-P energy: -7.456 tors. eta vs tors. theta energy: -7.468 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -121.946039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.946039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.946387 (E_RNA) where: Base-Base interactions energy: -69.394 where: short stacking energy: -32.157 Base-Backbone interact. energy: -0.280 local terms energy: -52.271760 where: bonds (distance) C4'-P energy: -16.257 bonds (distance) P-C4' energy: -15.502 flat angles C4'-P-C4' energy: -15.753 flat angles P-C4'-P energy: -2.166 tors. eta vs tors. theta energy: -2.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -221.121360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.121360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.143379 (E_RNA) where: Base-Base interactions energy: -144.494 where: short stacking energy: -58.690 Base-Backbone interact. energy: -0.348 local terms energy: -76.301533 where: bonds (distance) C4'-P energy: -18.341 bonds (distance) P-C4' energy: -17.141 flat angles C4'-P-C4' energy: -15.238 flat angles P-C4'-P energy: -10.655 tors. eta vs tors. theta energy: -14.927 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -212.157473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.157473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.345903 (E_RNA) where: Base-Base interactions energy: -142.331 where: short stacking energy: -56.220 Base-Backbone interact. energy: -0.509 local terms energy: -69.506110 where: bonds (distance) C4'-P energy: -13.388 bonds (distance) P-C4' energy: -11.871 flat angles C4'-P-C4' energy: -18.280 flat angles P-C4'-P energy: -10.631 tors. eta vs tors. theta energy: -15.336 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -222.029067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.029067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.116799 (E_RNA) where: Base-Base interactions energy: -153.537 where: short stacking energy: -60.695 Base-Backbone interact. energy: -0.312 local terms energy: -69.267959 where: bonds (distance) C4'-P energy: -15.827 bonds (distance) P-C4' energy: -13.535 flat angles C4'-P-C4' energy: -15.547 flat angles P-C4'-P energy: -10.194 tors. eta vs tors. theta energy: -14.165 Dist. restrs. and SS energy: 1.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -178.941441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.941441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.941441 (E_RNA) where: Base-Base interactions energy: -112.516 where: short stacking energy: -53.277 Base-Backbone interact. energy: -0.581 local terms energy: -65.844143 where: bonds (distance) C4'-P energy: -17.350 bonds (distance) P-C4' energy: -14.480 flat angles C4'-P-C4' energy: -12.914 flat angles P-C4'-P energy: -10.337 tors. eta vs tors. theta energy: -10.763 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -144.830386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.830386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.830386 (E_RNA) where: Base-Base interactions energy: -84.092 where: short stacking energy: -39.120 Base-Backbone interact. energy: -0.489 local terms energy: -60.249368 where: bonds (distance) C4'-P energy: -17.020 bonds (distance) P-C4' energy: -14.481 flat angles C4'-P-C4' energy: -11.120 flat angles P-C4'-P energy: -9.167 tors. eta vs tors. theta energy: -8.461 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -162.876485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.876485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.291954 (E_RNA) where: Base-Base interactions energy: -92.764 where: short stacking energy: -51.771 Base-Backbone interact. energy: -0.001 local terms energy: -70.527851 where: bonds (distance) C4'-P energy: -17.032 bonds (distance) P-C4' energy: -17.570 flat angles C4'-P-C4' energy: -15.447 flat angles P-C4'-P energy: -6.306 tors. eta vs tors. theta energy: -14.174 Dist. restrs. and SS energy: 0.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -156.325881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.325881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.325881 (E_RNA) where: Base-Base interactions energy: -96.954 where: short stacking energy: -40.825 Base-Backbone interact. energy: -0.311 local terms energy: -59.061413 where: bonds (distance) C4'-P energy: -11.243 bonds (distance) P-C4' energy: -10.920 flat angles C4'-P-C4' energy: -16.616 flat angles P-C4'-P energy: -6.887 tors. eta vs tors. theta energy: -13.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -144.296556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.296556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.308510 (E_RNA) where: Base-Base interactions energy: -87.660 where: short stacking energy: -37.711 Base-Backbone interact. energy: -0.122 local terms energy: -56.526200 where: bonds (distance) C4'-P energy: -15.815 bonds (distance) P-C4' energy: -15.260 flat angles C4'-P-C4' energy: -14.984 flat angles P-C4'-P energy: -6.456 tors. eta vs tors. theta energy: -4.012 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -145.325971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.325971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.325971 (E_RNA) where: Base-Base interactions energy: -85.578 where: short stacking energy: -39.095 Base-Backbone interact. energy: -0.254 local terms energy: -59.493537 where: bonds (distance) C4'-P energy: -13.187 bonds (distance) P-C4' energy: -14.275 flat angles C4'-P-C4' energy: -15.692 flat angles P-C4'-P energy: -12.521 tors. eta vs tors. theta energy: -3.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -124.244445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.244445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.244445 (E_RNA) where: Base-Base interactions energy: -73.407 where: short stacking energy: -31.227 Base-Backbone interact. energy: -0.749 local terms energy: -50.088115 where: bonds (distance) C4'-P energy: -11.945 bonds (distance) P-C4' energy: -12.006 flat angles C4'-P-C4' energy: -13.458 flat angles P-C4'-P energy: -6.395 tors. eta vs tors. theta energy: -6.285 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -213.175794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.175794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.185819 (E_RNA) where: Base-Base interactions energy: -153.005 where: short stacking energy: -55.108 Base-Backbone interact. energy: -0.721 local terms energy: -59.459541 where: bonds (distance) C4'-P energy: -9.456 bonds (distance) P-C4' energy: -17.224 flat angles C4'-P-C4' energy: -15.100 flat angles P-C4'-P energy: -1.342 tors. eta vs tors. theta energy: -16.338 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -205.739661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.739661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.757580 (E_RNA) where: Base-Base interactions energy: -146.944 where: short stacking energy: -62.224 Base-Backbone interact. energy: 1.196 local terms energy: -60.009492 where: bonds (distance) C4'-P energy: -10.805 bonds (distance) P-C4' energy: -16.420 flat angles C4'-P-C4' energy: -9.876 flat angles P-C4'-P energy: -7.524 tors. eta vs tors. theta energy: -15.384 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -214.042678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.042678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.077964 (E_RNA) where: Base-Base interactions energy: -148.942 where: short stacking energy: -57.401 Base-Backbone interact. energy: -0.230 local terms energy: -64.906173 where: bonds (distance) C4'-P energy: -12.246 bonds (distance) P-C4' energy: -15.687 flat angles C4'-P-C4' energy: -16.043 flat angles P-C4'-P energy: -9.132 tors. eta vs tors. theta energy: -11.798 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -166.615666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.615666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.615666 (E_RNA) where: Base-Base interactions energy: -106.498 where: short stacking energy: -50.719 Base-Backbone interact. energy: -0.511 local terms energy: -59.606779 where: bonds (distance) C4'-P energy: -17.426 bonds (distance) P-C4' energy: -12.922 flat angles C4'-P-C4' energy: -14.733 flat angles P-C4'-P energy: -6.880 tors. eta vs tors. theta energy: -7.645 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -176.648987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.648987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.648987 (E_RNA) where: Base-Base interactions energy: -101.272 where: short stacking energy: -60.437 Base-Backbone interact. energy: -0.018 local terms energy: -75.358654 where: bonds (distance) C4'-P energy: -16.772 bonds (distance) P-C4' energy: -19.106 flat angles C4'-P-C4' energy: -13.610 flat angles P-C4'-P energy: -13.309 tors. eta vs tors. theta energy: -12.562 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -161.436928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.436928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.436928 (E_RNA) where: Base-Base interactions energy: -96.196 where: short stacking energy: -44.491 Base-Backbone interact. energy: 0.047 local terms energy: -65.287997 where: bonds (distance) C4'-P energy: -16.317 bonds (distance) P-C4' energy: -15.594 flat angles C4'-P-C4' energy: -15.123 flat angles P-C4'-P energy: -5.160 tors. eta vs tors. theta energy: -13.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -163.986920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.986920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.051791 (E_RNA) where: Base-Base interactions energy: -109.523 where: short stacking energy: -50.541 Base-Backbone interact. energy: -0.125 local terms energy: -54.403351 where: bonds (distance) C4'-P energy: -9.433 bonds (distance) P-C4' energy: -14.958 flat angles C4'-P-C4' energy: -8.129 flat angles P-C4'-P energy: -9.569 tors. eta vs tors. theta energy: -12.314 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -144.383026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.383026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.328360 (E_RNA) where: Base-Base interactions energy: -86.317 where: short stacking energy: -46.455 Base-Backbone interact. energy: -1.228 local terms energy: -57.783384 where: bonds (distance) C4'-P energy: -12.925 bonds (distance) P-C4' energy: -11.400 flat angles C4'-P-C4' energy: -14.849 flat angles P-C4'-P energy: -9.058 tors. eta vs tors. theta energy: -9.551 Dist. restrs. and SS energy: 0.945 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -132.235202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.235202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.303458 (E_RNA) where: Base-Base interactions energy: -75.197 where: short stacking energy: -42.701 Base-Backbone interact. energy: -0.459 local terms energy: -56.647041 where: bonds (distance) C4'-P energy: -11.112 bonds (distance) P-C4' energy: -9.921 flat angles C4'-P-C4' energy: -11.474 flat angles P-C4'-P energy: -11.058 tors. eta vs tors. theta energy: -13.082 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -122.915085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.915085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.512301 (E_RNA) where: Base-Base interactions energy: -77.382 where: short stacking energy: -37.745 Base-Backbone interact. energy: -0.226 local terms energy: -48.904506 where: bonds (distance) C4'-P energy: -9.795 bonds (distance) P-C4' energy: -11.273 flat angles C4'-P-C4' energy: -12.896 flat angles P-C4'-P energy: -6.466 tors. eta vs tors. theta energy: -8.475 Dist. restrs. and SS energy: 3.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -213.311569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.311569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.502749 (E_RNA) where: Base-Base interactions energy: -145.918 where: short stacking energy: -60.421 Base-Backbone interact. energy: -1.190 local terms energy: -66.394489 where: bonds (distance) C4'-P energy: -15.066 bonds (distance) P-C4' energy: -14.661 flat angles C4'-P-C4' energy: -14.058 flat angles P-C4'-P energy: -11.296 tors. eta vs tors. theta energy: -11.314 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -186.799612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.799612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.799612 (E_RNA) where: Base-Base interactions energy: -124.198 where: short stacking energy: -48.297 Base-Backbone interact. energy: -1.016 local terms energy: -61.586162 where: bonds (distance) C4'-P energy: -17.174 bonds (distance) P-C4' energy: -14.018 flat angles C4'-P-C4' energy: -15.392 flat angles P-C4'-P energy: -6.058 tors. eta vs tors. theta energy: -8.945 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -198.434312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.434312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.434312 (E_RNA) where: Base-Base interactions energy: -124.903 where: short stacking energy: -53.701 Base-Backbone interact. energy: 1.586 local terms energy: -75.117549 where: bonds (distance) C4'-P energy: -17.128 bonds (distance) P-C4' energy: -17.837 flat angles C4'-P-C4' energy: -15.953 flat angles P-C4'-P energy: -9.592 tors. eta vs tors. theta energy: -14.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -171.608281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.608281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.608281 (E_RNA) where: Base-Base interactions energy: -104.699 where: short stacking energy: -38.923 Base-Backbone interact. energy: -0.740 local terms energy: -66.169452 where: bonds (distance) C4'-P energy: -13.183 bonds (distance) P-C4' energy: -15.804 flat angles C4'-P-C4' energy: -17.870 flat angles P-C4'-P energy: -6.984 tors. eta vs tors. theta energy: -12.328 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -170.737428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.737428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.946643 (E_RNA) where: Base-Base interactions energy: -111.834 where: short stacking energy: -43.598 Base-Backbone interact. energy: -0.342 local terms energy: -58.770125 where: bonds (distance) C4'-P energy: -10.765 bonds (distance) P-C4' energy: -14.377 flat angles C4'-P-C4' energy: -13.567 flat angles P-C4'-P energy: -11.857 tors. eta vs tors. theta energy: -8.204 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -176.955402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.955402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.971195 (E_RNA) where: Base-Base interactions energy: -123.962 where: short stacking energy: -51.888 Base-Backbone interact. energy: 1.490 local terms energy: -54.498395 where: bonds (distance) C4'-P energy: -9.916 bonds (distance) P-C4' energy: -16.187 flat angles C4'-P-C4' energy: -13.166 flat angles P-C4'-P energy: -7.143 tors. eta vs tors. theta energy: -8.087 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -152.926268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.926268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.228699 (E_RNA) where: Base-Base interactions energy: -88.585 where: short stacking energy: -50.859 Base-Backbone interact. energy: -0.110 local terms energy: -64.533460 where: bonds (distance) C4'-P energy: -15.898 bonds (distance) P-C4' energy: -14.066 flat angles C4'-P-C4' energy: -14.955 flat angles P-C4'-P energy: -6.915 tors. eta vs tors. theta energy: -12.700 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -148.848407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.848407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.939565 (E_RNA) where: Base-Base interactions energy: -84.997 where: short stacking energy: -34.731 Base-Backbone interact. energy: -0.319 local terms energy: -63.623675 where: bonds (distance) C4'-P energy: -17.993 bonds (distance) P-C4' energy: -11.542 flat angles C4'-P-C4' energy: -17.918 flat angles P-C4'-P energy: -9.312 tors. eta vs tors. theta energy: -6.859 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -131.004394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.004394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.015481 (E_RNA) where: Base-Base interactions energy: -80.747 where: short stacking energy: -37.624 Base-Backbone interact. energy: 0.426 local terms energy: -50.694864 where: bonds (distance) C4'-P energy: -10.571 bonds (distance) P-C4' energy: -11.067 flat angles C4'-P-C4' energy: -16.770 flat angles P-C4'-P energy: -6.851 tors. eta vs tors. theta energy: -5.436 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -137.461319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.461319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.509964 (E_RNA) where: Base-Base interactions energy: -79.714 where: short stacking energy: -43.607 Base-Backbone interact. energy: -0.006 local terms energy: -57.790136 where: bonds (distance) C4'-P energy: -12.508 bonds (distance) P-C4' energy: -16.406 flat angles C4'-P-C4' energy: -6.596 flat angles P-C4'-P energy: -11.540 tors. eta vs tors. theta energy: -10.741 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -218.570966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.570966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.330225 (E_RNA) where: Base-Base interactions energy: -149.321 where: short stacking energy: -58.768 Base-Backbone interact. energy: -0.224 local terms energy: -69.785504 where: bonds (distance) C4'-P energy: -12.371 bonds (distance) P-C4' energy: -15.641 flat angles C4'-P-C4' energy: -14.419 flat angles P-C4'-P energy: -11.697 tors. eta vs tors. theta energy: -15.658 Dist. restrs. and SS energy: 0.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -216.777888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.777888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.981110 (E_RNA) where: Base-Base interactions energy: -151.833 where: short stacking energy: -59.135 Base-Backbone interact. energy: -0.264 local terms energy: -64.883769 where: bonds (distance) C4'-P energy: -15.407 bonds (distance) P-C4' energy: -13.206 flat angles C4'-P-C4' energy: -14.892 flat angles P-C4'-P energy: -6.517 tors. eta vs tors. theta energy: -14.863 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -202.177519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.177519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.278159 (E_RNA) where: Base-Base interactions energy: -132.381 where: short stacking energy: -58.047 Base-Backbone interact. energy: 0.540 local terms energy: -70.436750 where: bonds (distance) C4'-P energy: -11.212 bonds (distance) P-C4' energy: -17.477 flat angles C4'-P-C4' energy: -15.334 flat angles P-C4'-P energy: -8.500 tors. eta vs tors. theta energy: -17.914 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -170.705996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.705996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.728444 (E_RNA) where: Base-Base interactions energy: -116.955 where: short stacking energy: -40.223 Base-Backbone interact. energy: -0.871 local terms energy: -52.901905 where: bonds (distance) C4'-P energy: -15.200 bonds (distance) P-C4' energy: -16.474 flat angles C4'-P-C4' energy: -9.367 flat angles P-C4'-P energy: -7.671 tors. eta vs tors. theta energy: -4.190 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -143.551255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.551255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.551255 (E_RNA) where: Base-Base interactions energy: -80.926 where: short stacking energy: -41.449 Base-Backbone interact. energy: -0.101 local terms energy: -62.524997 where: bonds (distance) C4'-P energy: -15.794 bonds (distance) P-C4' energy: -15.319 flat angles C4'-P-C4' energy: -13.035 flat angles P-C4'-P energy: -8.560 tors. eta vs tors. theta energy: -9.817 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -178.589384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.589384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.174563 (E_RNA) where: Base-Base interactions energy: -108.929 where: short stacking energy: -51.942 Base-Backbone interact. energy: -0.050 local terms energy: -71.195947 where: bonds (distance) C4'-P energy: -17.277 bonds (distance) P-C4' energy: -14.674 flat angles C4'-P-C4' energy: -15.836 flat angles P-C4'-P energy: -12.299 tors. eta vs tors. theta energy: -11.109 Dist. restrs. and SS energy: 1.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -145.709372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.709372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.748018 (E_RNA) where: Base-Base interactions energy: -84.898 where: short stacking energy: -39.553 Base-Backbone interact. energy: -0.988 local terms energy: -59.862480 where: bonds (distance) C4'-P energy: -13.688 bonds (distance) P-C4' energy: -14.007 flat angles C4'-P-C4' energy: -17.401 flat angles P-C4'-P energy: -5.995 tors. eta vs tors. theta energy: -8.772 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -136.106463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.106463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.106463 (E_RNA) where: Base-Base interactions energy: -81.392 where: short stacking energy: -37.218 Base-Backbone interact. energy: -0.189 local terms energy: -54.525387 where: bonds (distance) C4'-P energy: -12.529 bonds (distance) P-C4' energy: -14.592 flat angles C4'-P-C4' energy: -15.634 flat angles P-C4'-P energy: -9.285 tors. eta vs tors. theta energy: -2.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -138.845965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.845965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.845965 (E_RNA) where: Base-Base interactions energy: -81.874 where: short stacking energy: -28.759 Base-Backbone interact. energy: -0.101 local terms energy: -56.871250 where: bonds (distance) C4'-P energy: -12.152 bonds (distance) P-C4' energy: -15.586 flat angles C4'-P-C4' energy: -10.388 flat angles P-C4'-P energy: -10.840 tors. eta vs tors. theta energy: -7.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -133.465033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.465033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.467742 (E_RNA) where: Base-Base interactions energy: -76.912 where: short stacking energy: -37.772 Base-Backbone interact. energy: -0.022 local terms energy: -56.533270 where: bonds (distance) C4'-P energy: -12.126 bonds (distance) P-C4' energy: -16.455 flat angles C4'-P-C4' energy: -13.454 flat angles P-C4'-P energy: -8.138 tors. eta vs tors. theta energy: -6.360 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -223.382735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.382735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.398367 (E_RNA) where: Base-Base interactions energy: -144.239 where: short stacking energy: -69.884 Base-Backbone interact. energy: -0.890 local terms energy: -78.269234 where: bonds (distance) C4'-P energy: -17.099 bonds (distance) P-C4' energy: -12.161 flat angles C4'-P-C4' energy: -16.711 flat angles P-C4'-P energy: -13.706 tors. eta vs tors. theta energy: -18.592 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -204.981871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.981871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.201470 (E_RNA) where: Base-Base interactions energy: -141.299 where: short stacking energy: -59.348 Base-Backbone interact. energy: -0.146 local terms energy: -64.756311 where: bonds (distance) C4'-P energy: -13.327 bonds (distance) P-C4' energy: -13.108 flat angles C4'-P-C4' energy: -11.335 flat angles P-C4'-P energy: -12.447 tors. eta vs tors. theta energy: -14.539 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -198.379286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.379286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.445983 (E_RNA) where: Base-Base interactions energy: -131.780 where: short stacking energy: -51.476 Base-Backbone interact. energy: -0.056 local terms energy: -66.610199 where: bonds (distance) C4'-P energy: -13.770 bonds (distance) P-C4' energy: -16.613 flat angles C4'-P-C4' energy: -13.375 flat angles P-C4'-P energy: -7.519 tors. eta vs tors. theta energy: -15.334 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -179.804296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.804296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.808396 (E_RNA) where: Base-Base interactions energy: -122.546 where: short stacking energy: -44.083 Base-Backbone interact. energy: -0.206 local terms energy: -57.056924 where: bonds (distance) C4'-P energy: -15.518 bonds (distance) P-C4' energy: -18.193 flat angles C4'-P-C4' energy: -10.126 flat angles P-C4'-P energy: -3.964 tors. eta vs tors. theta energy: -9.256 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -152.869689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.869689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.928155 (E_RNA) where: Base-Base interactions energy: -92.487 where: short stacking energy: -50.424 Base-Backbone interact. energy: -0.324 local terms energy: -61.117281 where: bonds (distance) C4'-P energy: -13.732 bonds (distance) P-C4' energy: -16.139 flat angles C4'-P-C4' energy: -11.732 flat angles P-C4'-P energy: -6.710 tors. eta vs tors. theta energy: -12.803 Dist. restrs. and SS energy: 1.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -137.022589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.022589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.057018 (E_RNA) where: Base-Base interactions energy: -73.074 where: short stacking energy: -33.697 Base-Backbone interact. energy: -0.170 local terms energy: -63.812263 where: bonds (distance) C4'-P energy: -15.986 bonds (distance) P-C4' energy: -12.554 flat angles C4'-P-C4' energy: -15.313 flat angles P-C4'-P energy: -13.193 tors. eta vs tors. theta energy: -6.766 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -151.481746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.481746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.486754 (E_RNA) where: Base-Base interactions energy: -94.922 where: short stacking energy: -40.218 Base-Backbone interact. energy: -1.296 local terms energy: -55.269033 where: bonds (distance) C4'-P energy: -14.685 bonds (distance) P-C4' energy: -11.331 flat angles C4'-P-C4' energy: -13.609 flat angles P-C4'-P energy: -6.919 tors. eta vs tors. theta energy: -8.724 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -133.252918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.252918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.343747 (E_RNA) where: Base-Base interactions energy: -77.291 where: short stacking energy: -40.396 Base-Backbone interact. energy: -0.102 local terms energy: -55.950953 where: bonds (distance) C4'-P energy: -12.553 bonds (distance) P-C4' energy: -13.923 flat angles C4'-P-C4' energy: -10.764 flat angles P-C4'-P energy: -10.430 tors. eta vs tors. theta energy: -8.282 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -103.417677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.417677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.461461 (E_RNA) where: Base-Base interactions energy: -69.309 where: short stacking energy: -22.794 Base-Backbone interact. energy: 1.209 local terms energy: -43.361246 where: bonds (distance) C4'-P energy: -8.768 bonds (distance) P-C4' energy: -14.378 flat angles C4'-P-C4' energy: -14.159 flat angles P-C4'-P energy: -6.571 tors. eta vs tors. theta energy: 0.516 Dist. restrs. and SS energy: 8.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -136.999259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.999259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.018852 (E_RNA) where: Base-Base interactions energy: -79.812 where: short stacking energy: -30.629 Base-Backbone interact. energy: -0.058 local terms energy: -57.148406 where: bonds (distance) C4'-P energy: -17.426 bonds (distance) P-C4' energy: -15.262 flat angles C4'-P-C4' energy: -7.355 flat angles P-C4'-P energy: -12.770 tors. eta vs tors. theta energy: -4.337 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -223.688369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.688369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.700080 (E_RNA) where: Base-Base interactions energy: -157.471 where: short stacking energy: -63.136 Base-Backbone interact. energy: -0.936 local terms energy: -65.293604 where: bonds (distance) C4'-P energy: -5.745 bonds (distance) P-C4' energy: -14.194 flat angles C4'-P-C4' energy: -16.213 flat angles P-C4'-P energy: -10.838 tors. eta vs tors. theta energy: -18.303 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -212.699680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.699680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.699680 (E_RNA) where: Base-Base interactions energy: -139.015 where: short stacking energy: -61.064 Base-Backbone interact. energy: -0.329 local terms energy: -73.355907 where: bonds (distance) C4'-P energy: -14.693 bonds (distance) P-C4' energy: -15.732 flat angles C4'-P-C4' energy: -13.503 flat angles P-C4'-P energy: -12.184 tors. eta vs tors. theta energy: -17.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -190.967845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.967845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.098083 (E_RNA) where: Base-Base interactions energy: -124.445 where: short stacking energy: -49.099 Base-Backbone interact. energy: -0.014 local terms energy: -66.638476 where: bonds (distance) C4'-P energy: -12.887 bonds (distance) P-C4' energy: -15.449 flat angles C4'-P-C4' energy: -14.751 flat angles P-C4'-P energy: -10.086 tors. eta vs tors. theta energy: -13.465 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -163.849937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.849937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.849937 (E_RNA) where: Base-Base interactions energy: -101.854 where: short stacking energy: -56.802 Base-Backbone interact. energy: -0.112 local terms energy: -61.883069 where: bonds (distance) C4'-P energy: -12.629 bonds (distance) P-C4' energy: -16.391 flat angles C4'-P-C4' energy: -12.231 flat angles P-C4'-P energy: -8.086 tors. eta vs tors. theta energy: -12.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -161.391816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.391816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.391816 (E_RNA) where: Base-Base interactions energy: -104.803 where: short stacking energy: -46.433 Base-Backbone interact. energy: -0.097 local terms energy: -56.491544 where: bonds (distance) C4'-P energy: -12.855 bonds (distance) P-C4' energy: -14.363 flat angles C4'-P-C4' energy: -14.360 flat angles P-C4'-P energy: -5.430 tors. eta vs tors. theta energy: -9.483 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -154.597982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.597982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.810201 (E_RNA) where: Base-Base interactions energy: -97.991 where: short stacking energy: -44.929 Base-Backbone interact. energy: -0.183 local terms energy: -56.636792 where: bonds (distance) C4'-P energy: -10.408 bonds (distance) P-C4' energy: -16.531 flat angles C4'-P-C4' energy: -15.439 flat angles P-C4'-P energy: -6.018 tors. eta vs tors. theta energy: -8.241 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -138.537639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.537639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.558725 (E_RNA) where: Base-Base interactions energy: -89.478 where: short stacking energy: -48.416 Base-Backbone interact. energy: -0.037 local terms energy: -49.044476 where: bonds (distance) C4'-P energy: -10.138 bonds (distance) P-C4' energy: -15.843 flat angles C4'-P-C4' energy: -9.162 flat angles P-C4'-P energy: -6.520 tors. eta vs tors. theta energy: -7.381 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -152.100111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.100111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.103195 (E_RNA) where: Base-Base interactions energy: -82.275 where: short stacking energy: -41.631 Base-Backbone interact. energy: 0.391 local terms energy: -70.219127 where: bonds (distance) C4'-P energy: -15.604 bonds (distance) P-C4' energy: -15.013 flat angles C4'-P-C4' energy: -16.866 flat angles P-C4'-P energy: -12.577 tors. eta vs tors. theta energy: -10.160 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -131.595998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.595998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.595998 (E_RNA) where: Base-Base interactions energy: -73.179 where: short stacking energy: -39.551 Base-Backbone interact. energy: -1.281 local terms energy: -57.136286 where: bonds (distance) C4'-P energy: -7.561 bonds (distance) P-C4' energy: -15.036 flat angles C4'-P-C4' energy: -14.673 flat angles P-C4'-P energy: -9.272 tors. eta vs tors. theta energy: -10.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -144.752622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.752622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.752622 (E_RNA) where: Base-Base interactions energy: -95.286 where: short stacking energy: -38.053 Base-Backbone interact. energy: 2.649 local terms energy: -52.116208 where: bonds (distance) C4'-P energy: -14.482 bonds (distance) P-C4' energy: -14.036 flat angles C4'-P-C4' energy: -8.954 flat angles P-C4'-P energy: -7.123 tors. eta vs tors. theta energy: -7.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -214.997046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.997046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.002346 (E_RNA) where: Base-Base interactions energy: -138.687 where: short stacking energy: -61.178 Base-Backbone interact. energy: -0.896 local terms energy: -75.419427 where: bonds (distance) C4'-P energy: -14.119 bonds (distance) P-C4' energy: -16.405 flat angles C4'-P-C4' energy: -16.961 flat angles P-C4'-P energy: -12.042 tors. eta vs tors. theta energy: -15.891 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -216.707864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.707864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.826581 (E_RNA) where: Base-Base interactions energy: -149.102 where: short stacking energy: -52.688 Base-Backbone interact. energy: 1.627 local terms energy: -69.351420 where: bonds (distance) C4'-P energy: -14.005 bonds (distance) P-C4' energy: -16.085 flat angles C4'-P-C4' energy: -12.891 flat angles P-C4'-P energy: -8.893 tors. eta vs tors. theta energy: -17.477 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -200.795529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.795529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.826511 (E_RNA) where: Base-Base interactions energy: -131.199 where: short stacking energy: -50.445 Base-Backbone interact. energy: -1.673 local terms energy: -67.954293 where: bonds (distance) C4'-P energy: -14.768 bonds (distance) P-C4' energy: -13.945 flat angles C4'-P-C4' energy: -15.551 flat angles P-C4'-P energy: -10.802 tors. eta vs tors. theta energy: -12.889 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -183.423479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.423479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.423479 (E_RNA) where: Base-Base interactions energy: -105.888 where: short stacking energy: -55.783 Base-Backbone interact. energy: 2.035 local terms energy: -79.570728 where: bonds (distance) C4'-P energy: -14.768 bonds (distance) P-C4' energy: -19.045 flat angles C4'-P-C4' energy: -16.300 flat angles P-C4'-P energy: -15.316 tors. eta vs tors. theta energy: -14.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -158.421437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.421437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.425063 (E_RNA) where: Base-Base interactions energy: -95.794 where: short stacking energy: -47.749 Base-Backbone interact. energy: -0.924 local terms energy: -61.706999 where: bonds (distance) C4'-P energy: -15.890 bonds (distance) P-C4' energy: -12.319 flat angles C4'-P-C4' energy: -16.058 flat angles P-C4'-P energy: -9.354 tors. eta vs tors. theta energy: -8.087 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -163.532603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.532603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.934584 (E_RNA) where: Base-Base interactions energy: -91.746 where: short stacking energy: -54.092 Base-Backbone interact. energy: -0.000 local terms energy: -72.188312 where: bonds (distance) C4'-P energy: -17.293 bonds (distance) P-C4' energy: -14.284 flat angles C4'-P-C4' energy: -15.367 flat angles P-C4'-P energy: -8.975 tors. eta vs tors. theta energy: -16.269 Dist. restrs. and SS energy: 0.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -148.017577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.017577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.017577 (E_RNA) where: Base-Base interactions energy: -85.348 where: short stacking energy: -38.663 Base-Backbone interact. energy: -0.909 local terms energy: -61.760396 where: bonds (distance) C4'-P energy: -15.095 bonds (distance) P-C4' energy: -13.942 flat angles C4'-P-C4' energy: -14.849 flat angles P-C4'-P energy: -7.195 tors. eta vs tors. theta energy: -10.679 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -135.498923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.498923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.698714 (E_RNA) where: Base-Base interactions energy: -77.445 where: short stacking energy: -40.456 Base-Backbone interact. energy: -0.209 local terms energy: -58.044416 where: bonds (distance) C4'-P energy: -12.256 bonds (distance) P-C4' energy: -14.135 flat angles C4'-P-C4' energy: -14.127 flat angles P-C4'-P energy: -8.264 tors. eta vs tors. theta energy: -9.263 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -144.239197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.239197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.246101 (E_RNA) where: Base-Base interactions energy: -84.284 where: short stacking energy: -44.036 Base-Backbone interact. energy: -0.058 local terms energy: -60.903865 where: bonds (distance) C4'-P energy: -11.826 bonds (distance) P-C4' energy: -12.016 flat angles C4'-P-C4' energy: -12.626 flat angles P-C4'-P energy: -12.052 tors. eta vs tors. theta energy: -12.383 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -116.827848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.827848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.827848 (E_RNA) where: Base-Base interactions energy: -66.011 where: short stacking energy: -28.782 Base-Backbone interact. energy: -0.261 local terms energy: -50.555955 where: bonds (distance) C4'-P energy: -13.307 bonds (distance) P-C4' energy: -12.817 flat angles C4'-P-C4' energy: -13.381 flat angles P-C4'-P energy: -8.038 tors. eta vs tors. theta energy: -3.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -208.689007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.689007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.710679 (E_RNA) where: Base-Base interactions energy: -140.836 where: short stacking energy: -59.084 Base-Backbone interact. energy: 0.257 local terms energy: -68.132117 where: bonds (distance) C4'-P energy: -15.658 bonds (distance) P-C4' energy: -14.182 flat angles C4'-P-C4' energy: -14.651 flat angles P-C4'-P energy: -8.547 tors. eta vs tors. theta energy: -15.093 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -224.930911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.930911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.042071 (E_RNA) where: Base-Base interactions energy: -146.495 where: short stacking energy: -64.524 Base-Backbone interact. energy: 1.656 local terms energy: -80.203397 where: bonds (distance) C4'-P energy: -15.555 bonds (distance) P-C4' energy: -18.150 flat angles C4'-P-C4' energy: -18.062 flat angles P-C4'-P energy: -12.176 tors. eta vs tors. theta energy: -16.261 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -174.225284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.225284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.225284 (E_RNA) where: Base-Base interactions energy: -110.875 where: short stacking energy: -45.790 Base-Backbone interact. energy: -0.710 local terms energy: -62.640255 where: bonds (distance) C4'-P energy: -12.445 bonds (distance) P-C4' energy: -17.576 flat angles C4'-P-C4' energy: -14.644 flat angles P-C4'-P energy: -10.002 tors. eta vs tors. theta energy: -7.974 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -179.740169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.740169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.319633 (E_RNA) where: Base-Base interactions energy: -113.948 where: short stacking energy: -49.887 Base-Backbone interact. energy: -0.062 local terms energy: -66.309332 where: bonds (distance) C4'-P energy: -14.574 bonds (distance) P-C4' energy: -12.198 flat angles C4'-P-C4' energy: -11.273 flat angles P-C4'-P energy: -9.721 tors. eta vs tors. theta energy: -18.544 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -158.399141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.399141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.502378 (E_RNA) where: Base-Base interactions energy: -84.653 where: short stacking energy: -45.460 Base-Backbone interact. energy: -0.055 local terms energy: -73.794723 where: bonds (distance) C4'-P energy: -15.704 bonds (distance) P-C4' energy: -17.174 flat angles C4'-P-C4' energy: -16.020 flat angles P-C4'-P energy: -12.286 tors. eta vs tors. theta energy: -12.611 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -167.723207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.723207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.792649 (E_RNA) where: Base-Base interactions energy: -100.021 where: short stacking energy: -51.289 Base-Backbone interact. energy: -0.497 local terms energy: -68.274560 where: bonds (distance) C4'-P energy: -14.611 bonds (distance) P-C4' energy: -14.598 flat angles C4'-P-C4' energy: -14.093 flat angles P-C4'-P energy: -11.941 tors. eta vs tors. theta energy: -13.032 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -152.765967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.765967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.105372 (E_RNA) where: Base-Base interactions energy: -83.112 where: short stacking energy: -47.474 Base-Backbone interact. energy: -0.135 local terms energy: -69.858107 where: bonds (distance) C4'-P energy: -16.026 bonds (distance) P-C4' energy: -17.330 flat angles C4'-P-C4' energy: -13.926 flat angles P-C4'-P energy: -8.745 tors. eta vs tors. theta energy: -13.832 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -154.042643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.042643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.042643 (E_RNA) where: Base-Base interactions energy: -102.081 where: short stacking energy: -48.352 Base-Backbone interact. energy: -0.085 local terms energy: -51.876708 where: bonds (distance) C4'-P energy: -11.737 bonds (distance) P-C4' energy: -11.364 flat angles C4'-P-C4' energy: -14.990 flat angles P-C4'-P energy: -4.201 tors. eta vs tors. theta energy: -9.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -133.856743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.856743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.863337 (E_RNA) where: Base-Base interactions energy: -82.798 where: short stacking energy: -25.969 Base-Backbone interact. energy: -0.691 local terms energy: -50.374487 where: bonds (distance) C4'-P energy: -16.255 bonds (distance) P-C4' energy: -15.960 flat angles C4'-P-C4' energy: -7.620 flat angles P-C4'-P energy: -7.606 tors. eta vs tors. theta energy: -2.935 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -117.207070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.207070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.214509 (E_RNA) where: Base-Base interactions energy: -68.776 where: short stacking energy: -36.162 Base-Backbone interact. energy: -0.321 local terms energy: -48.117573 where: bonds (distance) C4'-P energy: -11.280 bonds (distance) P-C4' energy: -10.093 flat angles C4'-P-C4' energy: -14.455 flat angles P-C4'-P energy: -7.589 tors. eta vs tors. theta energy: -4.700 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -223.307023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.307023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.861444 (E_RNA) where: Base-Base interactions energy: -154.207 where: short stacking energy: -60.114 Base-Backbone interact. energy: -0.123 local terms energy: -70.531663 where: bonds (distance) C4'-P energy: -15.146 bonds (distance) P-C4' energy: -17.059 flat angles C4'-P-C4' energy: -16.384 flat angles P-C4'-P energy: -8.793 tors. eta vs tors. theta energy: -13.151 Dist. restrs. and SS energy: 1.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -212.982353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.982353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.015389 (E_RNA) where: Base-Base interactions energy: -138.699 where: short stacking energy: -54.642 Base-Backbone interact. energy: -1.557 local terms energy: -72.760207 where: bonds (distance) C4'-P energy: -14.723 bonds (distance) P-C4' energy: -13.004 flat angles C4'-P-C4' energy: -14.556 flat angles P-C4'-P energy: -13.859 tors. eta vs tors. theta energy: -16.619 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -199.795309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.795309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.907735 (E_RNA) where: Base-Base interactions energy: -124.657 where: short stacking energy: -62.967 Base-Backbone interact. energy: -0.009 local terms energy: -75.242173 where: bonds (distance) C4'-P energy: -14.242 bonds (distance) P-C4' energy: -17.262 flat angles C4'-P-C4' energy: -15.404 flat angles P-C4'-P energy: -11.676 tors. eta vs tors. theta energy: -16.657 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -169.481341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.481341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.481341 (E_RNA) where: Base-Base interactions energy: -102.537 where: short stacking energy: -45.530 Base-Backbone interact. energy: -0.094 local terms energy: -66.850946 where: bonds (distance) C4'-P energy: -18.734 bonds (distance) P-C4' energy: -16.828 flat angles C4'-P-C4' energy: -15.860 flat angles P-C4'-P energy: -0.031 tors. eta vs tors. theta energy: -15.398 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -165.222871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.222871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.222871 (E_RNA) where: Base-Base interactions energy: -100.276 where: short stacking energy: -52.248 Base-Backbone interact. energy: -0.963 local terms energy: -63.983887 where: bonds (distance) C4'-P energy: -13.812 bonds (distance) P-C4' energy: -13.983 flat angles C4'-P-C4' energy: -14.915 flat angles P-C4'-P energy: -7.738 tors. eta vs tors. theta energy: -13.537 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -166.573393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.573393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.692815 (E_RNA) where: Base-Base interactions energy: -98.417 where: short stacking energy: -39.946 Base-Backbone interact. energy: -0.023 local terms energy: -68.253240 where: bonds (distance) C4'-P energy: -15.508 bonds (distance) P-C4' energy: -16.006 flat angles C4'-P-C4' energy: -14.422 flat angles P-C4'-P energy: -8.351 tors. eta vs tors. theta energy: -13.966 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -155.099050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.099050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.591362 (E_RNA) where: Base-Base interactions energy: -98.763 where: short stacking energy: -42.810 Base-Backbone interact. energy: -0.014 local terms energy: -56.815000 where: bonds (distance) C4'-P energy: -14.834 bonds (distance) P-C4' energy: -11.068 flat angles C4'-P-C4' energy: -10.867 flat angles P-C4'-P energy: -10.632 tors. eta vs tors. theta energy: -9.415 Dist. restrs. and SS energy: 0.492 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -170.541614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.541614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.552121 (E_RNA) where: Base-Base interactions energy: -103.411 where: short stacking energy: -52.497 Base-Backbone interact. energy: -0.122 local terms energy: -67.018877 where: bonds (distance) C4'-P energy: -12.735 bonds (distance) P-C4' energy: -18.168 flat angles C4'-P-C4' energy: -10.552 flat angles P-C4'-P energy: -10.582 tors. eta vs tors. theta energy: -14.982 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -133.989108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.989108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.024088 (E_RNA) where: Base-Base interactions energy: -75.286 where: short stacking energy: -31.437 Base-Backbone interact. energy: -0.178 local terms energy: -58.560321 where: bonds (distance) C4'-P energy: -15.660 bonds (distance) P-C4' energy: -13.617 flat angles C4'-P-C4' energy: -13.560 flat angles P-C4'-P energy: -5.124 tors. eta vs tors. theta energy: -10.599 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -120.796239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.796239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.830190 (E_RNA) where: Base-Base interactions energy: -64.700 where: short stacking energy: -27.224 Base-Backbone interact. energy: -0.665 local terms energy: -55.464885 where: bonds (distance) C4'-P energy: -15.956 bonds (distance) P-C4' energy: -14.625 flat angles C4'-P-C4' energy: -12.878 flat angles P-C4'-P energy: -11.388 tors. eta vs tors. theta energy: -0.619 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -228.381088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.381088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.704144 (E_RNA) where: Base-Base interactions energy: -148.278 where: short stacking energy: -63.853 Base-Backbone interact. energy: -0.289 local terms energy: -81.136496 where: bonds (distance) C4'-P energy: -15.504 bonds (distance) P-C4' energy: -18.033 flat angles C4'-P-C4' energy: -18.677 flat angles P-C4'-P energy: -12.589 tors. eta vs tors. theta energy: -16.334 Dist. restrs. and SS energy: 1.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -213.602528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.602528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.612058 (E_RNA) where: Base-Base interactions energy: -142.281 where: short stacking energy: -61.245 Base-Backbone interact. energy: -0.190 local terms energy: -71.141043 where: bonds (distance) C4'-P energy: -16.876 bonds (distance) P-C4' energy: -10.846 flat angles C4'-P-C4' energy: -17.792 flat angles P-C4'-P energy: -9.570 tors. eta vs tors. theta energy: -16.058 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -206.006879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.006879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.030580 (E_RNA) where: Base-Base interactions energy: -134.643 where: short stacking energy: -58.150 Base-Backbone interact. energy: -0.138 local terms energy: -71.249515 where: bonds (distance) C4'-P energy: -11.629 bonds (distance) P-C4' energy: -18.594 flat angles C4'-P-C4' energy: -14.599 flat angles P-C4'-P energy: -10.820 tors. eta vs tors. theta energy: -15.608 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -180.933355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.933355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.933355 (E_RNA) where: Base-Base interactions energy: -106.857 where: short stacking energy: -59.836 Base-Backbone interact. energy: -0.146 local terms energy: -73.930588 where: bonds (distance) C4'-P energy: -14.425 bonds (distance) P-C4' energy: -12.651 flat angles C4'-P-C4' energy: -16.518 flat angles P-C4'-P energy: -14.147 tors. eta vs tors. theta energy: -16.190 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -171.945295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.945295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.998796 (E_RNA) where: Base-Base interactions energy: -107.809 where: short stacking energy: -61.330 Base-Backbone interact. energy: 0.152 local terms energy: -64.341417 where: bonds (distance) C4'-P energy: -11.812 bonds (distance) P-C4' energy: -13.560 flat angles C4'-P-C4' energy: -16.424 flat angles P-C4'-P energy: -9.171 tors. eta vs tors. theta energy: -13.376 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -172.479966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.479966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.482224 (E_RNA) where: Base-Base interactions energy: -107.331 where: short stacking energy: -49.675 Base-Backbone interact. energy: 0.129 local terms energy: -65.279421 where: bonds (distance) C4'-P energy: -12.436 bonds (distance) P-C4' energy: -15.454 flat angles C4'-P-C4' energy: -14.541 flat angles P-C4'-P energy: -12.957 tors. eta vs tors. theta energy: -9.892 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -161.676495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.676495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.837303 (E_RNA) where: Base-Base interactions energy: -98.910 where: short stacking energy: -48.510 Base-Backbone interact. energy: 1.086 local terms energy: -64.013948 where: bonds (distance) C4'-P energy: -15.919 bonds (distance) P-C4' energy: -18.221 flat angles C4'-P-C4' energy: -13.139 flat angles P-C4'-P energy: -5.882 tors. eta vs tors. theta energy: -10.852 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -151.606655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.606655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.650738 (E_RNA) where: Base-Base interactions energy: -91.867 where: short stacking energy: -40.976 Base-Backbone interact. energy: -0.199 local terms energy: -61.584658 where: bonds (distance) C4'-P energy: -11.411 bonds (distance) P-C4' energy: -16.794 flat angles C4'-P-C4' energy: -15.038 flat angles P-C4'-P energy: -8.411 tors. eta vs tors. theta energy: -9.931 Dist. restrs. and SS energy: 2.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -135.810142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.810142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.998002 (E_RNA) where: Base-Base interactions energy: -76.790 where: short stacking energy: -34.367 Base-Backbone interact. energy: -1.224 local terms energy: -57.984028 where: bonds (distance) C4'-P energy: -10.805 bonds (distance) P-C4' energy: -17.636 flat angles C4'-P-C4' energy: -14.011 flat angles P-C4'-P energy: -11.313 tors. eta vs tors. theta energy: -4.220 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -100.534719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.534719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.593208 (E_RNA) where: Base-Base interactions energy: -51.097 where: short stacking energy: -26.104 Base-Backbone interact. energy: -0.242 local terms energy: -49.254872 where: bonds (distance) C4'-P energy: -14.821 bonds (distance) P-C4' energy: -15.294 flat angles C4'-P-C4' energy: -7.568 flat angles P-C4'-P energy: -10.680 tors. eta vs tors. theta energy: -0.891 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -239.137115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.137115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.493735 (E_RNA) where: Base-Base interactions energy: -166.395 where: short stacking energy: -67.774 Base-Backbone interact. energy: -0.293 local terms energy: -74.805356 where: bonds (distance) C4'-P energy: -16.383 bonds (distance) P-C4' energy: -16.474 flat angles C4'-P-C4' energy: -13.653 flat angles P-C4'-P energy: -11.527 tors. eta vs tors. theta energy: -16.769 Dist. restrs. and SS energy: 2.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -214.816084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.816084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.841651 (E_RNA) where: Base-Base interactions energy: -141.887 where: short stacking energy: -57.036 Base-Backbone interact. energy: 0.141 local terms energy: -73.095860 where: bonds (distance) C4'-P energy: -9.911 bonds (distance) P-C4' energy: -16.583 flat angles C4'-P-C4' energy: -15.760 flat angles P-C4'-P energy: -12.620 tors. eta vs tors. theta energy: -18.223 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -195.380002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.380002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.395993 (E_RNA) where: Base-Base interactions energy: -123.874 where: short stacking energy: -61.639 Base-Backbone interact. energy: 0.056 local terms energy: -71.577983 where: bonds (distance) C4'-P energy: -14.193 bonds (distance) P-C4' energy: -16.293 flat angles C4'-P-C4' energy: -13.658 flat angles P-C4'-P energy: -8.189 tors. eta vs tors. theta energy: -19.245 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -185.955284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.955284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.414108 (E_RNA) where: Base-Base interactions energy: -116.444 where: short stacking energy: -59.517 Base-Backbone interact. energy: -0.962 local terms energy: -69.007678 where: bonds (distance) C4'-P energy: -13.439 bonds (distance) P-C4' energy: -12.762 flat angles C4'-P-C4' energy: -14.787 flat angles P-C4'-P energy: -10.727 tors. eta vs tors. theta energy: -17.293 Dist. restrs. and SS energy: 0.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -180.364247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.364247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.884237 (E_RNA) where: Base-Base interactions energy: -113.230 where: short stacking energy: -51.072 Base-Backbone interact. energy: -0.136 local terms energy: -67.518228 where: bonds (distance) C4'-P energy: -17.136 bonds (distance) P-C4' energy: -15.917 flat angles C4'-P-C4' energy: -16.655 flat angles P-C4'-P energy: -7.443 tors. eta vs tors. theta energy: -10.367 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -192.226214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.226214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.226214 (E_RNA) where: Base-Base interactions energy: -126.596 where: short stacking energy: -52.293 Base-Backbone interact. energy: -0.110 local terms energy: -65.520749 where: bonds (distance) C4'-P energy: -15.671 bonds (distance) P-C4' energy: -15.503 flat angles C4'-P-C4' energy: -12.492 flat angles P-C4'-P energy: -7.058 tors. eta vs tors. theta energy: -14.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -128.211638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.211638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.436057 (E_RNA) where: Base-Base interactions energy: -80.619 where: short stacking energy: -27.057 Base-Backbone interact. energy: 0.208 local terms energy: -49.025230 where: bonds (distance) C4'-P energy: -11.647 bonds (distance) P-C4' energy: -15.945 flat angles C4'-P-C4' energy: -10.651 flat angles P-C4'-P energy: -7.919 tors. eta vs tors. theta energy: -2.864 Dist. restrs. and SS energy: 1.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -144.179406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.179406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.182918 (E_RNA) where: Base-Base interactions energy: -86.043 where: short stacking energy: -45.797 Base-Backbone interact. energy: -0.075 local terms energy: -58.065797 where: bonds (distance) C4'-P energy: -8.306 bonds (distance) P-C4' energy: -15.071 flat angles C4'-P-C4' energy: -10.846 flat angles P-C4'-P energy: -7.068 tors. eta vs tors. theta energy: -16.775 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -127.178173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.178173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.178173 (E_RNA) where: Base-Base interactions energy: -69.958 where: short stacking energy: -40.242 Base-Backbone interact. energy: -0.363 local terms energy: -56.857118 where: bonds (distance) C4'-P energy: -14.304 bonds (distance) P-C4' energy: -12.089 flat angles C4'-P-C4' energy: -12.585 flat angles P-C4'-P energy: -9.187 tors. eta vs tors. theta energy: -8.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -110.363180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.363180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.411055 (E_RNA) where: Base-Base interactions energy: -55.866 where: short stacking energy: -27.703 Base-Backbone interact. energy: -0.100 local terms energy: -54.445245 where: bonds (distance) C4'-P energy: -9.767 bonds (distance) P-C4' energy: -15.050 flat angles C4'-P-C4' energy: -15.555 flat angles P-C4'-P energy: -8.014 tors. eta vs tors. theta energy: -6.059 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -229.919965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.919965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.669288 (E_RNA) where: Base-Base interactions energy: -166.807 where: short stacking energy: -60.086 Base-Backbone interact. energy: -0.168 local terms energy: -64.694329 where: bonds (distance) C4'-P energy: -17.737 bonds (distance) P-C4' energy: -15.990 flat angles C4'-P-C4' energy: -10.483 flat angles P-C4'-P energy: -3.970 tors. eta vs tors. theta energy: -16.514 Dist. restrs. and SS energy: 1.749 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -225.625283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.625283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.770228 (E_RNA) where: Base-Base interactions energy: -149.880 where: short stacking energy: -59.913 Base-Backbone interact. energy: -0.377 local terms energy: -75.513402 where: bonds (distance) C4'-P energy: -17.293 bonds (distance) P-C4' energy: -16.064 flat angles C4'-P-C4' energy: -14.260 flat angles P-C4'-P energy: -10.736 tors. eta vs tors. theta energy: -17.159 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -200.300134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.300134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.300134 (E_RNA) where: Base-Base interactions energy: -126.641 where: short stacking energy: -51.104 Base-Backbone interact. energy: -0.089 local terms energy: -73.570414 where: bonds (distance) C4'-P energy: -11.732 bonds (distance) P-C4' energy: -18.848 flat angles C4'-P-C4' energy: -15.428 flat angles P-C4'-P energy: -10.002 tors. eta vs tors. theta energy: -17.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -187.635526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.635526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.664314 (E_RNA) where: Base-Base interactions energy: -117.486 where: short stacking energy: -58.390 Base-Backbone interact. energy: -0.394 local terms energy: -69.785018 where: bonds (distance) C4'-P energy: -14.326 bonds (distance) P-C4' energy: -12.955 flat angles C4'-P-C4' energy: -16.063 flat angles P-C4'-P energy: -10.701 tors. eta vs tors. theta energy: -15.741 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -176.733110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.733110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.070107 (E_RNA) where: Base-Base interactions energy: -115.417 where: short stacking energy: -54.495 Base-Backbone interact. energy: -0.700 local terms energy: -61.953057 where: bonds (distance) C4'-P energy: -11.787 bonds (distance) P-C4' energy: -9.844 flat angles C4'-P-C4' energy: -17.171 flat angles P-C4'-P energy: -7.360 tors. eta vs tors. theta energy: -15.791 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -146.172905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.172905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.191885 (E_RNA) where: Base-Base interactions energy: -76.287 where: short stacking energy: -36.173 Base-Backbone interact. energy: -0.143 local terms energy: -69.761137 where: bonds (distance) C4'-P energy: -12.339 bonds (distance) P-C4' energy: -16.842 flat angles C4'-P-C4' energy: -17.444 flat angles P-C4'-P energy: -9.250 tors. eta vs tors. theta energy: -13.886 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -176.428029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.428029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.495798 (E_RNA) where: Base-Base interactions energy: -114.696 where: short stacking energy: -46.772 Base-Backbone interact. energy: -0.053 local terms energy: -61.747303 where: bonds (distance) C4'-P energy: -12.117 bonds (distance) P-C4' energy: -16.139 flat angles C4'-P-C4' energy: -14.142 flat angles P-C4'-P energy: -6.305 tors. eta vs tors. theta energy: -13.044 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -143.811206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.811206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.833993 (E_RNA) where: Base-Base interactions energy: -84.080 where: short stacking energy: -39.052 Base-Backbone interact. energy: -0.288 local terms energy: -59.466850 where: bonds (distance) C4'-P energy: -14.561 bonds (distance) P-C4' energy: -18.190 flat angles C4'-P-C4' energy: -12.111 flat angles P-C4'-P energy: -4.110 tors. eta vs tors. theta energy: -10.495 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -147.605043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.605043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.605043 (E_RNA) where: Base-Base interactions energy: -85.476 where: short stacking energy: -46.277 Base-Backbone interact. energy: -0.255 local terms energy: -61.873760 where: bonds (distance) C4'-P energy: -10.571 bonds (distance) P-C4' energy: -14.666 flat angles C4'-P-C4' energy: -12.137 flat angles P-C4'-P energy: -8.364 tors. eta vs tors. theta energy: -16.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -119.140721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.140721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.329208 (E_RNA) where: Base-Base interactions energy: -68.021 where: short stacking energy: -37.045 Base-Backbone interact. energy: -0.124 local terms energy: -51.184049 where: bonds (distance) C4'-P energy: -12.988 bonds (distance) P-C4' energy: -13.656 flat angles C4'-P-C4' energy: -12.947 flat angles P-C4'-P energy: -4.866 tors. eta vs tors. theta energy: -6.728 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -217.748308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.748308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.825353 (E_RNA) where: Base-Base interactions energy: -142.012 where: short stacking energy: -57.318 Base-Backbone interact. energy: -0.316 local terms energy: -75.497785 where: bonds (distance) C4'-P energy: -15.848 bonds (distance) P-C4' energy: -16.293 flat angles C4'-P-C4' energy: -10.822 flat angles P-C4'-P energy: -13.768 tors. eta vs tors. theta energy: -18.766 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -222.814232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.814232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.037655 (E_RNA) where: Base-Base interactions energy: -154.132 where: short stacking energy: -64.835 Base-Backbone interact. energy: 0.238 local terms energy: -70.143785 where: bonds (distance) C4'-P energy: -16.584 bonds (distance) P-C4' energy: -14.053 flat angles C4'-P-C4' energy: -14.020 flat angles P-C4'-P energy: -8.897 tors. eta vs tors. theta energy: -16.590 Dist. restrs. and SS energy: 1.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -181.584419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.584419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.584419 (E_RNA) where: Base-Base interactions energy: -109.560 where: short stacking energy: -58.348 Base-Backbone interact. energy: -0.561 local terms energy: -71.463660 where: bonds (distance) C4'-P energy: -15.335 bonds (distance) P-C4' energy: -16.303 flat angles C4'-P-C4' energy: -15.684 flat angles P-C4'-P energy: -10.582 tors. eta vs tors. theta energy: -13.560 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -188.287288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.287288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.287288 (E_RNA) where: Base-Base interactions energy: -121.195 where: short stacking energy: -52.822 Base-Backbone interact. energy: -1.180 local terms energy: -65.911817 where: bonds (distance) C4'-P energy: -11.459 bonds (distance) P-C4' energy: -14.703 flat angles C4'-P-C4' energy: -15.680 flat angles P-C4'-P energy: -6.887 tors. eta vs tors. theta energy: -17.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -167.197952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.197952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.307409 (E_RNA) where: Base-Base interactions energy: -106.283 where: short stacking energy: -46.003 Base-Backbone interact. energy: -0.141 local terms energy: -60.883188 where: bonds (distance) C4'-P energy: -14.466 bonds (distance) P-C4' energy: -14.134 flat angles C4'-P-C4' energy: -16.246 flat angles P-C4'-P energy: -9.369 tors. eta vs tors. theta energy: -6.667 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -152.099010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.099010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.222967 (E_RNA) where: Base-Base interactions energy: -85.573 where: short stacking energy: -51.539 Base-Backbone interact. energy: -0.406 local terms energy: -66.243661 where: bonds (distance) C4'-P energy: -14.081 bonds (distance) P-C4' energy: -17.431 flat angles C4'-P-C4' energy: -14.654 flat angles P-C4'-P energy: -7.530 tors. eta vs tors. theta energy: -12.548 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -155.427723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.427723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.427723 (E_RNA) where: Base-Base interactions energy: -88.139 where: short stacking energy: -42.000 Base-Backbone interact. energy: 0.630 local terms energy: -67.918790 where: bonds (distance) C4'-P energy: -14.987 bonds (distance) P-C4' energy: -18.033 flat angles C4'-P-C4' energy: -16.548 flat angles P-C4'-P energy: -7.414 tors. eta vs tors. theta energy: -10.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -141.048544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.048544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.125579 (E_RNA) where: Base-Base interactions energy: -80.963 where: short stacking energy: -43.283 Base-Backbone interact. energy: -0.032 local terms energy: -60.131308 where: bonds (distance) C4'-P energy: -4.435 bonds (distance) P-C4' energy: -19.103 flat angles C4'-P-C4' energy: -13.263 flat angles P-C4'-P energy: -8.181 tors. eta vs tors. theta energy: -15.150 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -130.215247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.215247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.255743 (E_RNA) where: Base-Base interactions energy: -72.917 where: short stacking energy: -38.363 Base-Backbone interact. energy: 0.311 local terms energy: -57.649288 where: bonds (distance) C4'-P energy: -10.151 bonds (distance) P-C4' energy: -12.846 flat angles C4'-P-C4' energy: -17.636 flat angles P-C4'-P energy: -8.126 tors. eta vs tors. theta energy: -8.890 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -124.827769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.827769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.827769 (E_RNA) where: Base-Base interactions energy: -73.995 where: short stacking energy: -37.369 Base-Backbone interact. energy: 0.443 local terms energy: -51.275431 where: bonds (distance) C4'-P energy: -12.241 bonds (distance) P-C4' energy: -16.798 flat angles C4'-P-C4' energy: -11.449 flat angles P-C4'-P energy: -8.435 tors. eta vs tors. theta energy: -2.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -216.877049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.877049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.905436 (E_RNA) where: Base-Base interactions energy: -144.881 where: short stacking energy: -66.080 Base-Backbone interact. energy: -0.068 local terms energy: -71.956960 where: bonds (distance) C4'-P energy: -15.534 bonds (distance) P-C4' energy: -14.419 flat angles C4'-P-C4' energy: -13.433 flat angles P-C4'-P energy: -11.484 tors. eta vs tors. theta energy: -17.087 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -220.524951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.524951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.545481 (E_RNA) where: Base-Base interactions energy: -147.948 where: short stacking energy: -68.493 Base-Backbone interact. energy: -0.886 local terms energy: -72.711881 where: bonds (distance) C4'-P energy: -13.700 bonds (distance) P-C4' energy: -15.760 flat angles C4'-P-C4' energy: -15.916 flat angles P-C4'-P energy: -11.715 tors. eta vs tors. theta energy: -15.621 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -169.996678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.996678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.087677 (E_RNA) where: Base-Base interactions energy: -104.813 where: short stacking energy: -56.763 Base-Backbone interact. energy: -0.311 local terms energy: -64.963991 where: bonds (distance) C4'-P energy: -13.584 bonds (distance) P-C4' energy: -17.498 flat angles C4'-P-C4' energy: -14.899 flat angles P-C4'-P energy: -8.466 tors. eta vs tors. theta energy: -10.517 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -154.104435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.104435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.104435 (E_RNA) where: Base-Base interactions energy: -93.152 where: short stacking energy: -46.044 Base-Backbone interact. energy: -0.013 local terms energy: -60.940155 where: bonds (distance) C4'-P energy: -14.241 bonds (distance) P-C4' energy: -16.829 flat angles C4'-P-C4' energy: -12.844 flat angles P-C4'-P energy: -9.112 tors. eta vs tors. theta energy: -7.914 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -181.324275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.324275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.350622 (E_RNA) where: Base-Base interactions energy: -113.521 where: short stacking energy: -56.527 Base-Backbone interact. energy: -0.345 local terms energy: -67.484855 where: bonds (distance) C4'-P energy: -11.068 bonds (distance) P-C4' energy: -13.806 flat angles C4'-P-C4' energy: -17.103 flat angles P-C4'-P energy: -12.934 tors. eta vs tors. theta energy: -12.574 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -161.495877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.495877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.568826 (E_RNA) where: Base-Base interactions energy: -102.313 where: short stacking energy: -48.996 Base-Backbone interact. energy: 1.334 local terms energy: -60.589598 where: bonds (distance) C4'-P energy: -12.311 bonds (distance) P-C4' energy: -15.817 flat angles C4'-P-C4' energy: -14.836 flat angles P-C4'-P energy: -8.751 tors. eta vs tors. theta energy: -8.874 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -145.887872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.887872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.944979 (E_RNA) where: Base-Base interactions energy: -86.637 where: short stacking energy: -39.617 Base-Backbone interact. energy: -0.126 local terms energy: -59.181344 where: bonds (distance) C4'-P energy: -11.088 bonds (distance) P-C4' energy: -10.958 flat angles C4'-P-C4' energy: -16.714 flat angles P-C4'-P energy: -10.515 tors. eta vs tors. theta energy: -9.906 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -133.584980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.584980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.584980 (E_RNA) where: Base-Base interactions energy: -84.150 where: short stacking energy: -40.609 Base-Backbone interact. energy: -0.936 local terms energy: -48.498803 where: bonds (distance) C4'-P energy: -14.023 bonds (distance) P-C4' energy: -13.559 flat angles C4'-P-C4' energy: -9.807 flat angles P-C4'-P energy: -3.473 tors. eta vs tors. theta energy: -7.636 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -145.240152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.240152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.240152 (E_RNA) where: Base-Base interactions energy: -84.534 where: short stacking energy: -42.495 Base-Backbone interact. energy: 0.184 local terms energy: -60.890257 where: bonds (distance) C4'-P energy: -11.886 bonds (distance) P-C4' energy: -15.840 flat angles C4'-P-C4' energy: -16.442 flat angles P-C4'-P energy: -9.790 tors. eta vs tors. theta energy: -6.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -141.070557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.070557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.109316 (E_RNA) where: Base-Base interactions energy: -81.662 where: short stacking energy: -35.861 Base-Backbone interact. energy: 2.120 local terms energy: -61.567851 where: bonds (distance) C4'-P energy: -15.381 bonds (distance) P-C4' energy: -14.274 flat angles C4'-P-C4' energy: -15.620 flat angles P-C4'-P energy: -10.841 tors. eta vs tors. theta energy: -5.453 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -233.222247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.222247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.288930 (E_RNA) where: Base-Base interactions energy: -155.462 where: short stacking energy: -69.093 Base-Backbone interact. energy: -0.225 local terms energy: -78.601510 where: bonds (distance) C4'-P energy: -17.265 bonds (distance) P-C4' energy: -15.110 flat angles C4'-P-C4' energy: -16.988 flat angles P-C4'-P energy: -11.176 tors. eta vs tors. theta energy: -18.062 Dist. restrs. and SS energy: 1.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -218.353766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.353766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.950317 (E_RNA) where: Base-Base interactions energy: -144.111 where: short stacking energy: -56.162 Base-Backbone interact. energy: -2.061 local terms energy: -72.777629 where: bonds (distance) C4'-P energy: -13.764 bonds (distance) P-C4' energy: -14.616 flat angles C4'-P-C4' energy: -17.610 flat angles P-C4'-P energy: -8.695 tors. eta vs tors. theta energy: -18.093 Dist. restrs. and SS energy: 0.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -187.811543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.811543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.873882 (E_RNA) where: Base-Base interactions energy: -114.534 where: short stacking energy: -55.175 Base-Backbone interact. energy: -2.575 local terms energy: -70.764778 where: bonds (distance) C4'-P energy: -12.197 bonds (distance) P-C4' energy: -17.545 flat angles C4'-P-C4' energy: -14.293 flat angles P-C4'-P energy: -11.880 tors. eta vs tors. theta energy: -14.850 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -166.034936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.034936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.055422 (E_RNA) where: Base-Base interactions energy: -99.854 where: short stacking energy: -56.989 Base-Backbone interact. energy: -0.012 local terms energy: -66.189359 where: bonds (distance) C4'-P energy: -14.146 bonds (distance) P-C4' energy: -16.171 flat angles C4'-P-C4' energy: -14.983 flat angles P-C4'-P energy: -6.977 tors. eta vs tors. theta energy: -13.913 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -175.004142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.004142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.026441 (E_RNA) where: Base-Base interactions energy: -113.183 where: short stacking energy: -50.177 Base-Backbone interact. energy: -0.378 local terms energy: -61.465167 where: bonds (distance) C4'-P energy: -16.801 bonds (distance) P-C4' energy: -14.247 flat angles C4'-P-C4' energy: -11.069 flat angles P-C4'-P energy: -5.900 tors. eta vs tors. theta energy: -13.447 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -175.545277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.545277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.574912 (E_RNA) where: Base-Base interactions energy: -110.418 where: short stacking energy: -46.751 Base-Backbone interact. energy: -0.451 local terms energy: -64.706081 where: bonds (distance) C4'-P energy: -15.706 bonds (distance) P-C4' energy: -14.563 flat angles C4'-P-C4' energy: -19.092 flat angles P-C4'-P energy: -4.858 tors. eta vs tors. theta energy: -10.486 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -155.432911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.432911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.432911 (E_RNA) where: Base-Base interactions energy: -89.685 where: short stacking energy: -42.588 Base-Backbone interact. energy: -0.180 local terms energy: -65.567330 where: bonds (distance) C4'-P energy: -14.631 bonds (distance) P-C4' energy: -16.161 flat angles C4'-P-C4' energy: -15.746 flat angles P-C4'-P energy: -6.795 tors. eta vs tors. theta energy: -12.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -140.065230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.065230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.065230 (E_RNA) where: Base-Base interactions energy: -79.073 where: short stacking energy: -39.360 Base-Backbone interact. energy: 0.360 local terms energy: -61.352743 where: bonds (distance) C4'-P energy: -14.710 bonds (distance) P-C4' energy: -18.153 flat angles C4'-P-C4' energy: -9.989 flat angles P-C4'-P energy: -9.919 tors. eta vs tors. theta energy: -8.582 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -142.335484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.335484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.335484 (E_RNA) where: Base-Base interactions energy: -81.083 where: short stacking energy: -32.299 Base-Backbone interact. energy: -0.188 local terms energy: -61.064804 where: bonds (distance) C4'-P energy: -12.127 bonds (distance) P-C4' energy: -17.037 flat angles C4'-P-C4' energy: -16.254 flat angles P-C4'-P energy: -6.224 tors. eta vs tors. theta energy: -9.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -133.313886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.313886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.451178 (E_RNA) where: Base-Base interactions energy: -76.279 where: short stacking energy: -36.735 Base-Backbone interact. energy: -0.401 local terms energy: -56.771155 where: bonds (distance) C4'-P energy: -14.854 bonds (distance) P-C4' energy: -11.905 flat angles C4'-P-C4' energy: -15.457 flat angles P-C4'-P energy: -9.126 tors. eta vs tors. theta energy: -5.429 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -233.054832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.054832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.167419 (E_RNA) where: Base-Base interactions energy: -158.286 where: short stacking energy: -68.254 Base-Backbone interact. energy: 1.258 local terms energy: -78.139553 where: bonds (distance) C4'-P energy: -17.160 bonds (distance) P-C4' energy: -15.211 flat angles C4'-P-C4' energy: -16.687 flat angles P-C4'-P energy: -11.020 tors. eta vs tors. theta energy: -18.061 Dist. restrs. and SS energy: 2.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -220.844201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.844201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.853366 (E_RNA) where: Base-Base interactions energy: -147.444 where: short stacking energy: -52.094 Base-Backbone interact. energy: -1.190 local terms energy: -72.219505 where: bonds (distance) C4'-P energy: -17.389 bonds (distance) P-C4' energy: -15.957 flat angles C4'-P-C4' energy: -12.365 flat angles P-C4'-P energy: -12.148 tors. eta vs tors. theta energy: -14.360 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -200.997952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.997952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.022863 (E_RNA) where: Base-Base interactions energy: -125.703 where: short stacking energy: -62.116 Base-Backbone interact. energy: 0.442 local terms energy: -75.761491 where: bonds (distance) C4'-P energy: -11.171 bonds (distance) P-C4' energy: -16.082 flat angles C4'-P-C4' energy: -18.033 flat angles P-C4'-P energy: -12.734 tors. eta vs tors. theta energy: -17.742 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -186.029541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.029541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.052991 (E_RNA) where: Base-Base interactions energy: -121.055 where: short stacking energy: -51.758 Base-Backbone interact. energy: -1.212 local terms energy: -63.786213 where: bonds (distance) C4'-P energy: -16.710 bonds (distance) P-C4' energy: -11.179 flat angles C4'-P-C4' energy: -13.982 flat angles P-C4'-P energy: -10.267 tors. eta vs tors. theta energy: -11.648 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -173.810410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.810410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.071696 (E_RNA) where: Base-Base interactions energy: -110.168 where: short stacking energy: -53.893 Base-Backbone interact. energy: -0.043 local terms energy: -63.860161 where: bonds (distance) C4'-P energy: -10.709 bonds (distance) P-C4' energy: -15.178 flat angles C4'-P-C4' energy: -16.293 flat angles P-C4'-P energy: -5.771 tors. eta vs tors. theta energy: -15.908 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -160.829437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.829437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.906814 (E_RNA) where: Base-Base interactions energy: -92.624 where: short stacking energy: -48.526 Base-Backbone interact. energy: -0.252 local terms energy: -68.031020 where: bonds (distance) C4'-P energy: -15.484 bonds (distance) P-C4' energy: -15.336 flat angles C4'-P-C4' energy: -13.660 flat angles P-C4'-P energy: -10.389 tors. eta vs tors. theta energy: -13.162 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -145.187238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.187238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.244537 (E_RNA) where: Base-Base interactions energy: -80.929 where: short stacking energy: -44.969 Base-Backbone interact. energy: -0.228 local terms energy: -64.087660 where: bonds (distance) C4'-P energy: -16.420 bonds (distance) P-C4' energy: -14.300 flat angles C4'-P-C4' energy: -12.828 flat angles P-C4'-P energy: -11.368 tors. eta vs tors. theta energy: -9.172 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -137.937620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.937620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.937620 (E_RNA) where: Base-Base interactions energy: -79.926 where: short stacking energy: -44.386 Base-Backbone interact. energy: -0.052 local terms energy: -57.959576 where: bonds (distance) C4'-P energy: -13.831 bonds (distance) P-C4' energy: -12.764 flat angles C4'-P-C4' energy: -12.951 flat angles P-C4'-P energy: -8.896 tors. eta vs tors. theta energy: -9.517 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -137.036278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.036278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.893919 (E_RNA) where: Base-Base interactions energy: -75.658 where: short stacking energy: -30.692 Base-Backbone interact. energy: -0.219 local terms energy: -62.017238 where: bonds (distance) C4'-P energy: -12.520 bonds (distance) P-C4' energy: -17.843 flat angles C4'-P-C4' energy: -14.360 flat angles P-C4'-P energy: -10.217 tors. eta vs tors. theta energy: -7.077 Dist. restrs. and SS energy: 0.858 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -128.469714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.469714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.535110 (E_RNA) where: Base-Base interactions energy: -75.175 where: short stacking energy: -34.630 Base-Backbone interact. energy: -0.302 local terms energy: -53.058777 where: bonds (distance) C4'-P energy: -14.962 bonds (distance) P-C4' energy: -16.145 flat angles C4'-P-C4' energy: -6.620 flat angles P-C4'-P energy: -9.905 tors. eta vs tors. theta energy: -5.427 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -223.495873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.495873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.678451 (E_RNA) where: Base-Base interactions energy: -147.805 where: short stacking energy: -56.311 Base-Backbone interact. energy: -0.290 local terms energy: -75.583374 where: bonds (distance) C4'-P energy: -12.665 bonds (distance) P-C4' energy: -18.873 flat angles C4'-P-C4' energy: -18.044 flat angles P-C4'-P energy: -11.614 tors. eta vs tors. theta energy: -14.387 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -228.557603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.557603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.012411 (E_RNA) where: Base-Base interactions energy: -157.660 where: short stacking energy: -58.124 Base-Backbone interact. energy: -0.159 local terms energy: -72.193169 where: bonds (distance) C4'-P energy: -15.082 bonds (distance) P-C4' energy: -16.048 flat angles C4'-P-C4' energy: -14.641 flat angles P-C4'-P energy: -12.265 tors. eta vs tors. theta energy: -14.157 Dist. restrs. and SS energy: 1.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -181.730626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.730626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.352766 (E_RNA) where: Base-Base interactions energy: -115.675 where: short stacking energy: -57.984 Base-Backbone interact. energy: -0.032 local terms energy: -68.645599 where: bonds (distance) C4'-P energy: -13.263 bonds (distance) P-C4' energy: -16.837 flat angles C4'-P-C4' energy: -16.197 flat angles P-C4'-P energy: -9.876 tors. eta vs tors. theta energy: -12.472 Dist. restrs. and SS energy: 2.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -171.814707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.814707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.755755 (E_RNA) where: Base-Base interactions energy: -115.289 where: short stacking energy: -44.913 Base-Backbone interact. energy: -0.348 local terms energy: -57.118504 where: bonds (distance) C4'-P energy: -14.756 bonds (distance) P-C4' energy: -15.792 flat angles C4'-P-C4' energy: -11.846 flat angles P-C4'-P energy: -8.606 tors. eta vs tors. theta energy: -6.118 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -165.008018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.008018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.025334 (E_RNA) where: Base-Base interactions energy: -100.307 where: short stacking energy: -39.551 Base-Backbone interact. energy: -0.298 local terms energy: -64.419960 where: bonds (distance) C4'-P energy: -13.542 bonds (distance) P-C4' energy: -18.383 flat angles C4'-P-C4' energy: -12.542 flat angles P-C4'-P energy: -11.096 tors. eta vs tors. theta energy: -8.857 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -144.096879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.096879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.191917 (E_RNA) where: Base-Base interactions energy: -82.393 where: short stacking energy: -43.191 Base-Backbone interact. energy: -0.076 local terms energy: -61.722906 where: bonds (distance) C4'-P energy: -13.869 bonds (distance) P-C4' energy: -10.094 flat angles C4'-P-C4' energy: -17.765 flat angles P-C4'-P energy: -10.024 tors. eta vs tors. theta energy: -9.971 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -150.059446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.059446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.151190 (E_RNA) where: Base-Base interactions energy: -93.467 where: short stacking energy: -40.035 Base-Backbone interact. energy: 0.088 local terms energy: -56.771552 where: bonds (distance) C4'-P energy: -13.203 bonds (distance) P-C4' energy: -13.820 flat angles C4'-P-C4' energy: -9.963 flat angles P-C4'-P energy: -7.249 tors. eta vs tors. theta energy: -12.537 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -129.302510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.302510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.347528 (E_RNA) where: Base-Base interactions energy: -71.068 where: short stacking energy: -34.669 Base-Backbone interact. energy: -0.208 local terms energy: -58.071182 where: bonds (distance) C4'-P energy: -15.475 bonds (distance) P-C4' energy: -15.644 flat angles C4'-P-C4' energy: -14.397 flat angles P-C4'-P energy: -5.206 tors. eta vs tors. theta energy: -7.349 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -142.455744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.455744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.328694 (E_RNA) where: Base-Base interactions energy: -87.942 where: short stacking energy: -38.972 Base-Backbone interact. energy: 1.029 local terms energy: -56.415423 where: bonds (distance) C4'-P energy: -12.927 bonds (distance) P-C4' energy: -16.689 flat angles C4'-P-C4' energy: -12.181 flat angles P-C4'-P energy: -4.654 tors. eta vs tors. theta energy: -9.964 Dist. restrs. and SS energy: 0.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -133.723507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.723507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.938289 (E_RNA) where: Base-Base interactions energy: -81.568 where: short stacking energy: -37.869 Base-Backbone interact. energy: -0.135 local terms energy: -52.234844 where: bonds (distance) C4'-P energy: -13.424 bonds (distance) P-C4' energy: -9.091 flat angles C4'-P-C4' energy: -13.673 flat angles P-C4'-P energy: -9.052 tors. eta vs tors. theta energy: -6.995 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -221.217836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.217836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.227702 (E_RNA) where: Base-Base interactions energy: -148.734 where: short stacking energy: -57.205 Base-Backbone interact. energy: -1.360 local terms energy: -71.134047 where: bonds (distance) C4'-P energy: -11.933 bonds (distance) P-C4' energy: -16.534 flat angles C4'-P-C4' energy: -14.888 flat angles P-C4'-P energy: -9.285 tors. eta vs tors. theta energy: -18.494 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -227.164213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.164213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.489182 (E_RNA) where: Base-Base interactions energy: -158.809 where: short stacking energy: -63.311 Base-Backbone interact. energy: -0.387 local terms energy: -69.293859 where: bonds (distance) C4'-P energy: -10.537 bonds (distance) P-C4' energy: -18.165 flat angles C4'-P-C4' energy: -18.101 flat angles P-C4'-P energy: -6.357 tors. eta vs tors. theta energy: -16.134 Dist. restrs. and SS energy: 1.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -174.155061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.155061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.178142 (E_RNA) where: Base-Base interactions energy: -121.096 where: short stacking energy: -50.782 Base-Backbone interact. energy: -0.089 local terms energy: -52.993013 where: bonds (distance) C4'-P energy: -9.680 bonds (distance) P-C4' energy: -9.542 flat angles C4'-P-C4' energy: -11.646 flat angles P-C4'-P energy: -9.711 tors. eta vs tors. theta energy: -12.414 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -216.168642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.168642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.102173 (E_RNA) where: Base-Base interactions energy: -154.106 where: short stacking energy: -60.774 Base-Backbone interact. energy: -0.112 local terms energy: -62.883399 where: bonds (distance) C4'-P energy: -14.396 bonds (distance) P-C4' energy: -12.735 flat angles C4'-P-C4' energy: -8.434 flat angles P-C4'-P energy: -11.765 tors. eta vs tors. theta energy: -15.552 Dist. restrs. and SS energy: 0.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -166.269640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.269640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.688092 (E_RNA) where: Base-Base interactions energy: -98.084 where: short stacking energy: -45.002 Base-Backbone interact. energy: -1.188 local terms energy: -67.415300 where: bonds (distance) C4'-P energy: -13.382 bonds (distance) P-C4' energy: -19.094 flat angles C4'-P-C4' energy: -16.105 flat angles P-C4'-P energy: -9.144 tors. eta vs tors. theta energy: -9.690 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -177.294218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.294218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.391334 (E_RNA) where: Base-Base interactions energy: -105.890 where: short stacking energy: -55.245 Base-Backbone interact. energy: -0.249 local terms energy: -71.251865 where: bonds (distance) C4'-P energy: -9.819 bonds (distance) P-C4' energy: -14.026 flat angles C4'-P-C4' energy: -18.574 flat angles P-C4'-P energy: -11.543 tors. eta vs tors. theta energy: -17.290 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -141.616058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.616058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.931733 (E_RNA) where: Base-Base interactions energy: -73.489 where: short stacking energy: -33.294 Base-Backbone interact. energy: -0.123 local terms energy: -68.319974 where: bonds (distance) C4'-P energy: -17.003 bonds (distance) P-C4' energy: -19.070 flat angles C4'-P-C4' energy: -14.156 flat angles P-C4'-P energy: -12.062 tors. eta vs tors. theta energy: -6.029 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -132.723761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.723761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.723761 (E_RNA) where: Base-Base interactions energy: -78.377 where: short stacking energy: -36.040 Base-Backbone interact. energy: -0.641 local terms energy: -53.705026 where: bonds (distance) C4'-P energy: -12.453 bonds (distance) P-C4' energy: -13.226 flat angles C4'-P-C4' energy: -16.954 flat angles P-C4'-P energy: -8.754 tors. eta vs tors. theta energy: -2.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -139.369394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.369394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.369394 (E_RNA) where: Base-Base interactions energy: -83.719 where: short stacking energy: -38.740 Base-Backbone interact. energy: -0.075 local terms energy: -55.574790 where: bonds (distance) C4'-P energy: -9.793 bonds (distance) P-C4' energy: -16.543 flat angles C4'-P-C4' energy: -13.628 flat angles P-C4'-P energy: -8.480 tors. eta vs tors. theta energy: -7.131 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -118.040725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.040725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.040725 (E_RNA) where: Base-Base interactions energy: -57.102 where: short stacking energy: -27.420 Base-Backbone interact. energy: 0.380 local terms energy: -61.318496 where: bonds (distance) C4'-P energy: -18.005 bonds (distance) P-C4' energy: -13.706 flat angles C4'-P-C4' energy: -14.741 flat angles P-C4'-P energy: -8.565 tors. eta vs tors. theta energy: -6.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -232.412417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.412417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.609447 (E_RNA) where: Base-Base interactions energy: -161.698 where: short stacking energy: -64.005 Base-Backbone interact. energy: -0.948 local terms energy: -69.963769 where: bonds (distance) C4'-P energy: -15.259 bonds (distance) P-C4' energy: -15.915 flat angles C4'-P-C4' energy: -17.399 flat angles P-C4'-P energy: -2.735 tors. eta vs tors. theta energy: -18.656 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -218.317576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.317576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.130892 (E_RNA) where: Base-Base interactions energy: -150.006 where: short stacking energy: -62.390 Base-Backbone interact. energy: -0.152 local terms energy: -68.973070 where: bonds (distance) C4'-P energy: -13.133 bonds (distance) P-C4' energy: -17.491 flat angles C4'-P-C4' energy: -14.724 flat angles P-C4'-P energy: -9.352 tors. eta vs tors. theta energy: -14.273 Dist. restrs. and SS energy: 0.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -218.906157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.906157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.846555 (E_RNA) where: Base-Base interactions energy: -148.810 where: short stacking energy: -59.880 Base-Backbone interact. energy: -0.191 local terms energy: -71.844835 where: bonds (distance) C4'-P energy: -17.517 bonds (distance) P-C4' energy: -18.569 flat angles C4'-P-C4' energy: -16.009 flat angles P-C4'-P energy: -8.752 tors. eta vs tors. theta energy: -10.998 Dist. restrs. and SS energy: 1.940 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -192.656487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.656487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.642522 (E_RNA) where: Base-Base interactions energy: -117.880 where: short stacking energy: -52.464 Base-Backbone interact. energy: 1.295 local terms energy: -77.057559 where: bonds (distance) C4'-P energy: -18.895 bonds (distance) P-C4' energy: -14.939 flat angles C4'-P-C4' energy: -14.436 flat angles P-C4'-P energy: -11.648 tors. eta vs tors. theta energy: -17.139 Dist. restrs. and SS energy: 0.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -179.151669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.151669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.297599 (E_RNA) where: Base-Base interactions energy: -117.173 where: short stacking energy: -52.638 Base-Backbone interact. energy: -0.878 local terms energy: -62.247276 where: bonds (distance) C4'-P energy: -12.201 bonds (distance) P-C4' energy: -12.426 flat angles C4'-P-C4' energy: -18.440 flat angles P-C4'-P energy: -5.989 tors. eta vs tors. theta energy: -13.192 Dist. restrs. and SS energy: 1.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -131.541939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.541939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.547099 (E_RNA) where: Base-Base interactions energy: -67.702 where: short stacking energy: -32.581 Base-Backbone interact. energy: -1.714 local terms energy: -62.131068 where: bonds (distance) C4'-P energy: -11.173 bonds (distance) P-C4' energy: -15.383 flat angles C4'-P-C4' energy: -16.943 flat angles P-C4'-P energy: -10.146 tors. eta vs tors. theta energy: -8.486 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -146.520506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.520506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.520506 (E_RNA) where: Base-Base interactions energy: -86.247 where: short stacking energy: -42.719 Base-Backbone interact. energy: -0.073 local terms energy: -60.200197 where: bonds (distance) C4'-P energy: -14.005 bonds (distance) P-C4' energy: -15.368 flat angles C4'-P-C4' energy: -9.480 flat angles P-C4'-P energy: -10.018 tors. eta vs tors. theta energy: -11.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -137.572531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.572531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.607009 (E_RNA) where: Base-Base interactions energy: -83.044 where: short stacking energy: -43.798 Base-Backbone interact. energy: 0.385 local terms energy: -54.948317 where: bonds (distance) C4'-P energy: -9.137 bonds (distance) P-C4' energy: -13.775 flat angles C4'-P-C4' energy: -11.803 flat angles P-C4'-P energy: -11.883 tors. eta vs tors. theta energy: -8.350 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -134.196024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.196024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.199359 (E_RNA) where: Base-Base interactions energy: -81.386 where: short stacking energy: -47.184 Base-Backbone interact. energy: -0.196 local terms energy: -52.617436 where: bonds (distance) C4'-P energy: -15.877 bonds (distance) P-C4' energy: -11.868 flat angles C4'-P-C4' energy: -11.049 flat angles P-C4'-P energy: -6.074 tors. eta vs tors. theta energy: -7.749 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -135.953860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.953860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.003962 (E_RNA) where: Base-Base interactions energy: -86.712 where: short stacking energy: -42.200 Base-Backbone interact. energy: -0.288 local terms energy: -49.004240 where: bonds (distance) C4'-P energy: -6.521 bonds (distance) P-C4' energy: -16.638 flat angles C4'-P-C4' energy: -5.815 flat angles P-C4'-P energy: -9.122 tors. eta vs tors. theta energy: -10.909 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -224.930131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.930131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.712663 (E_RNA) where: Base-Base interactions energy: -153.750 where: short stacking energy: -58.326 Base-Backbone interact. energy: -0.560 local terms energy: -72.402843 where: bonds (distance) C4'-P energy: -16.125 bonds (distance) P-C4' energy: -15.133 flat angles C4'-P-C4' energy: -15.969 flat angles P-C4'-P energy: -9.762 tors. eta vs tors. theta energy: -15.414 Dist. restrs. and SS energy: 1.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -216.902755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.902755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.678119 (E_RNA) where: Base-Base interactions energy: -151.972 where: short stacking energy: -58.923 Base-Backbone interact. energy: 3.090 local terms energy: -69.796642 where: bonds (distance) C4'-P energy: -15.862 bonds (distance) P-C4' energy: -14.800 flat angles C4'-P-C4' energy: -17.146 flat angles P-C4'-P energy: -9.635 tors. eta vs tors. theta energy: -12.353 Dist. restrs. and SS energy: 1.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -207.846464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.846464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.684901 (E_RNA) where: Base-Base interactions energy: -143.403 where: short stacking energy: -60.871 Base-Backbone interact. energy: -0.370 local terms energy: -64.912719 where: bonds (distance) C4'-P energy: -14.560 bonds (distance) P-C4' energy: -10.793 flat angles C4'-P-C4' energy: -15.177 flat angles P-C4'-P energy: -9.854 tors. eta vs tors. theta energy: -14.529 Dist. restrs. and SS energy: 0.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -201.216027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.216027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.778077 (E_RNA) where: Base-Base interactions energy: -140.297 where: short stacking energy: -53.031 Base-Backbone interact. energy: 0.269 local terms energy: -62.750199 where: bonds (distance) C4'-P energy: -13.877 bonds (distance) P-C4' energy: -14.318 flat angles C4'-P-C4' energy: -15.432 flat angles P-C4'-P energy: -7.736 tors. eta vs tors. theta energy: -11.387 Dist. restrs. and SS energy: 1.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -182.746240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.746240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.326502 (E_RNA) where: Base-Base interactions energy: -124.617 where: short stacking energy: -52.346 Base-Backbone interact. energy: -0.118 local terms energy: -58.591479 where: bonds (distance) C4'-P energy: -12.378 bonds (distance) P-C4' energy: -11.609 flat angles C4'-P-C4' energy: -14.937 flat angles P-C4'-P energy: -8.747 tors. eta vs tors. theta energy: -10.920 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -144.560131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.560131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.567654 (E_RNA) where: Base-Base interactions energy: -85.079 where: short stacking energy: -42.727 Base-Backbone interact. energy: -0.338 local terms energy: -59.150565 where: bonds (distance) C4'-P energy: -12.068 bonds (distance) P-C4' energy: -15.394 flat angles C4'-P-C4' energy: -17.130 flat angles P-C4'-P energy: -7.869 tors. eta vs tors. theta energy: -6.689 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -150.413714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.413714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.413714 (E_RNA) where: Base-Base interactions energy: -91.917 where: short stacking energy: -45.950 Base-Backbone interact. energy: 0.119 local terms energy: -58.615847 where: bonds (distance) C4'-P energy: -10.217 bonds (distance) P-C4' energy: -17.119 flat angles C4'-P-C4' energy: -13.186 flat angles P-C4'-P energy: -12.829 tors. eta vs tors. theta energy: -5.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -137.406119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.406119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.054346 (E_RNA) where: Base-Base interactions energy: -80.176 where: short stacking energy: -34.202 Base-Backbone interact. energy: -0.326 local terms energy: -57.551873 where: bonds (distance) C4'-P energy: -11.646 bonds (distance) P-C4' energy: -17.929 flat angles C4'-P-C4' energy: -13.586 flat angles P-C4'-P energy: -9.032 tors. eta vs tors. theta energy: -5.359 Dist. restrs. and SS energy: 0.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -135.789169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.789169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.789169 (E_RNA) where: Base-Base interactions energy: -81.923 where: short stacking energy: -33.481 Base-Backbone interact. energy: -0.199 local terms energy: -53.666821 where: bonds (distance) C4'-P energy: -14.109 bonds (distance) P-C4' energy: -16.320 flat angles C4'-P-C4' energy: -8.850 flat angles P-C4'-P energy: -7.874 tors. eta vs tors. theta energy: -6.513 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -136.483135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.483135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.483135 (E_RNA) where: Base-Base interactions energy: -84.939 where: short stacking energy: -37.774 Base-Backbone interact. energy: -0.217 local terms energy: -51.326464 where: bonds (distance) C4'-P energy: -12.847 bonds (distance) P-C4' energy: -15.631 flat angles C4'-P-C4' energy: -11.202 flat angles P-C4'-P energy: -5.189 tors. eta vs tors. theta energy: -6.458 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -229.450168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.450168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.047739 (E_RNA) where: Base-Base interactions energy: -154.326 where: short stacking energy: -59.547 Base-Backbone interact. energy: -0.291 local terms energy: -76.431075 where: bonds (distance) C4'-P energy: -17.225 bonds (distance) P-C4' energy: -17.883 flat angles C4'-P-C4' energy: -15.559 flat angles P-C4'-P energy: -9.022 tors. eta vs tors. theta energy: -16.742 Dist. restrs. and SS energy: 1.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -226.418429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.418429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.839385 (E_RNA) where: Base-Base interactions energy: -159.552 where: short stacking energy: -62.740 Base-Backbone interact. energy: -0.668 local terms energy: -67.619328 where: bonds (distance) C4'-P energy: -14.607 bonds (distance) P-C4' energy: -16.065 flat angles C4'-P-C4' energy: -12.421 flat angles P-C4'-P energy: -8.452 tors. eta vs tors. theta energy: -16.074 Dist. restrs. and SS energy: 1.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -222.281476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.281476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.922562 (E_RNA) where: Base-Base interactions energy: -155.572 where: short stacking energy: -66.707 Base-Backbone interact. energy: 2.299 local terms energy: -70.649621 where: bonds (distance) C4'-P energy: -14.353 bonds (distance) P-C4' energy: -15.831 flat angles C4'-P-C4' energy: -11.263 flat angles P-C4'-P energy: -12.013 tors. eta vs tors. theta energy: -17.189 Dist. restrs. and SS energy: 1.641 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -167.548352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.548352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.600642 (E_RNA) where: Base-Base interactions energy: -105.883 where: short stacking energy: -50.269 Base-Backbone interact. energy: -0.934 local terms energy: -60.783636 where: bonds (distance) C4'-P energy: -13.663 bonds (distance) P-C4' energy: -15.885 flat angles C4'-P-C4' energy: -13.615 flat angles P-C4'-P energy: -8.493 tors. eta vs tors. theta energy: -9.128 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -167.786867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.786867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.786867 (E_RNA) where: Base-Base interactions energy: -105.277 where: short stacking energy: -50.087 Base-Backbone interact. energy: -0.775 local terms energy: -61.734918 where: bonds (distance) C4'-P energy: -14.351 bonds (distance) P-C4' energy: -15.945 flat angles C4'-P-C4' energy: -12.297 flat angles P-C4'-P energy: -7.022 tors. eta vs tors. theta energy: -12.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -151.692525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.692525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.751340 (E_RNA) where: Base-Base interactions energy: -84.127 where: short stacking energy: -44.293 Base-Backbone interact. energy: 0.446 local terms energy: -68.070207 where: bonds (distance) C4'-P energy: -12.837 bonds (distance) P-C4' energy: -18.802 flat angles C4'-P-C4' energy: -16.339 flat angles P-C4'-P energy: -9.818 tors. eta vs tors. theta energy: -10.274 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -170.585097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.585097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.585097 (E_RNA) where: Base-Base interactions energy: -116.236 where: short stacking energy: -43.892 Base-Backbone interact. energy: -0.031 local terms energy: -54.318687 where: bonds (distance) C4'-P energy: -13.726 bonds (distance) P-C4' energy: -13.368 flat angles C4'-P-C4' energy: -9.039 flat angles P-C4'-P energy: -3.541 tors. eta vs tors. theta energy: -14.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -127.380842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.380842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.380842 (E_RNA) where: Base-Base interactions energy: -71.743 where: short stacking energy: -37.443 Base-Backbone interact. energy: -0.092 local terms energy: -55.546145 where: bonds (distance) C4'-P energy: -14.469 bonds (distance) P-C4' energy: -15.032 flat angles C4'-P-C4' energy: -8.508 flat angles P-C4'-P energy: -7.751 tors. eta vs tors. theta energy: -9.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -145.763545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.763545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.205850 (E_RNA) where: Base-Base interactions energy: -89.991 where: short stacking energy: -45.034 Base-Backbone interact. energy: -0.278 local terms energy: -56.937349 where: bonds (distance) C4'-P energy: -17.350 bonds (distance) P-C4' energy: -14.659 flat angles C4'-P-C4' energy: -12.017 flat angles P-C4'-P energy: -3.913 tors. eta vs tors. theta energy: -8.998 Dist. restrs. and SS energy: 1.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -131.714459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.714459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.714459 (E_RNA) where: Base-Base interactions energy: -75.259 where: short stacking energy: -31.214 Base-Backbone interact. energy: -0.202 local terms energy: -56.253778 where: bonds (distance) C4'-P energy: -10.730 bonds (distance) P-C4' energy: -17.116 flat angles C4'-P-C4' energy: -14.155 flat angles P-C4'-P energy: -9.596 tors. eta vs tors. theta energy: -4.657 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -221.897307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.897307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.935575 (E_RNA) where: Base-Base interactions energy: -145.873 where: short stacking energy: -61.615 Base-Backbone interact. energy: 0.168 local terms energy: -76.230561 where: bonds (distance) C4'-P energy: -12.967 bonds (distance) P-C4' energy: -15.932 flat angles C4'-P-C4' energy: -14.803 flat angles P-C4'-P energy: -12.023 tors. eta vs tors. theta energy: -20.506 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -225.031251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.031251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.582523 (E_RNA) where: Base-Base interactions energy: -156.042 where: short stacking energy: -60.707 Base-Backbone interact. energy: -0.354 local terms energy: -71.186718 where: bonds (distance) C4'-P energy: -15.401 bonds (distance) P-C4' energy: -16.329 flat angles C4'-P-C4' energy: -14.511 flat angles P-C4'-P energy: -10.604 tors. eta vs tors. theta energy: -14.342 Dist. restrs. and SS energy: 2.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -221.888405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.888405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.268178 (E_RNA) where: Base-Base interactions energy: -158.285 where: short stacking energy: -55.843 Base-Backbone interact. energy: -0.295 local terms energy: -65.688286 where: bonds (distance) C4'-P energy: -17.285 bonds (distance) P-C4' energy: -13.216 flat angles C4'-P-C4' energy: -13.473 flat angles P-C4'-P energy: -8.432 tors. eta vs tors. theta energy: -13.283 Dist. restrs. and SS energy: 2.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -172.035659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.035659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.083575 (E_RNA) where: Base-Base interactions energy: -97.632 where: short stacking energy: -53.403 Base-Backbone interact. energy: -2.644 local terms energy: -71.806882 where: bonds (distance) C4'-P energy: -17.525 bonds (distance) P-C4' energy: -16.653 flat angles C4'-P-C4' energy: -15.098 flat angles P-C4'-P energy: -8.669 tors. eta vs tors. theta energy: -13.862 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -168.847864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.847864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.869594 (E_RNA) where: Base-Base interactions energy: -104.992 where: short stacking energy: -50.142 Base-Backbone interact. energy: -0.090 local terms energy: -63.787604 where: bonds (distance) C4'-P energy: -12.268 bonds (distance) P-C4' energy: -15.502 flat angles C4'-P-C4' energy: -15.917 flat angles P-C4'-P energy: -7.199 tors. eta vs tors. theta energy: -12.902 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -154.019713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.019713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.071473 (E_RNA) where: Base-Base interactions energy: -90.439 where: short stacking energy: -52.304 Base-Backbone interact. energy: -0.019 local terms energy: -63.613189 where: bonds (distance) C4'-P energy: -15.990 bonds (distance) P-C4' energy: -13.252 flat angles C4'-P-C4' energy: -13.085 flat angles P-C4'-P energy: -6.618 tors. eta vs tors. theta energy: -14.668 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -150.915382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.915382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.931992 (E_RNA) where: Base-Base interactions energy: -90.417 where: short stacking energy: -43.412 Base-Backbone interact. energy: -0.004 local terms energy: -60.510465 where: bonds (distance) C4'-P energy: -11.638 bonds (distance) P-C4' energy: -12.465 flat angles C4'-P-C4' energy: -10.650 flat angles P-C4'-P energy: -12.117 tors. eta vs tors. theta energy: -13.641 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -152.629898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.629898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.169938 (E_RNA) where: Base-Base interactions energy: -89.373 where: short stacking energy: -43.825 Base-Backbone interact. energy: -0.779 local terms energy: -63.017457 where: bonds (distance) C4'-P energy: -11.903 bonds (distance) P-C4' energy: -17.308 flat angles C4'-P-C4' energy: -17.528 flat angles P-C4'-P energy: -4.167 tors. eta vs tors. theta energy: -12.110 Dist. restrs. and SS energy: 0.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -129.351081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.351081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.351995 (E_RNA) where: Base-Base interactions energy: -85.931 where: short stacking energy: -34.863 Base-Backbone interact. energy: -0.229 local terms energy: -43.192026 where: bonds (distance) C4'-P energy: -13.377 bonds (distance) P-C4' energy: -9.851 flat angles C4'-P-C4' energy: -12.911 flat angles P-C4'-P energy: -1.915 tors. eta vs tors. theta energy: -5.137 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -103.659175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.659175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.512415 (E_RNA) where: Base-Base interactions energy: -63.521 where: short stacking energy: -24.132 Base-Backbone interact. energy: 2.988 local terms energy: -44.979038 where: bonds (distance) C4'-P energy: -15.368 bonds (distance) P-C4' energy: -14.603 flat angles C4'-P-C4' energy: -5.198 flat angles P-C4'-P energy: -5.033 tors. eta vs tors. theta energy: -4.778 Dist. restrs. and SS energy: 1.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -222.757758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.757758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.805866 (E_RNA) where: Base-Base interactions energy: -151.032 where: short stacking energy: -61.694 Base-Backbone interact. energy: -0.393 local terms energy: -71.380701 where: bonds (distance) C4'-P energy: -16.424 bonds (distance) P-C4' energy: -16.897 flat angles C4'-P-C4' energy: -14.982 flat angles P-C4'-P energy: -8.615 tors. eta vs tors. theta energy: -14.463 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -222.734092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.734092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.319999 (E_RNA) where: Base-Base interactions energy: -152.376 where: short stacking energy: -60.792 Base-Backbone interact. energy: -0.263 local terms energy: -71.680881 where: bonds (distance) C4'-P energy: -15.307 bonds (distance) P-C4' energy: -16.889 flat angles C4'-P-C4' energy: -15.446 flat angles P-C4'-P energy: -9.154 tors. eta vs tors. theta energy: -14.885 Dist. restrs. and SS energy: 1.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -231.903739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.903739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.868454 (E_RNA) where: Base-Base interactions energy: -157.426 where: short stacking energy: -63.752 Base-Backbone interact. energy: -0.333 local terms energy: -76.110419 where: bonds (distance) C4'-P energy: -14.703 bonds (distance) P-C4' energy: -17.569 flat angles C4'-P-C4' energy: -15.891 flat angles P-C4'-P energy: -10.564 tors. eta vs tors. theta energy: -17.383 Dist. restrs. and SS energy: 1.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -149.966371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.966371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.966371 (E_RNA) where: Base-Base interactions energy: -80.362 where: short stacking energy: -41.630 Base-Backbone interact. energy: -0.832 local terms energy: -68.771970 where: bonds (distance) C4'-P energy: -16.399 bonds (distance) P-C4' energy: -14.994 flat angles C4'-P-C4' energy: -15.206 flat angles P-C4'-P energy: -14.349 tors. eta vs tors. theta energy: -7.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -162.065675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.065675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.065675 (E_RNA) where: Base-Base interactions energy: -88.783 where: short stacking energy: -49.449 Base-Backbone interact. energy: -0.481 local terms energy: -72.802045 where: bonds (distance) C4'-P energy: -14.205 bonds (distance) P-C4' energy: -19.095 flat angles C4'-P-C4' energy: -15.669 flat angles P-C4'-P energy: -7.543 tors. eta vs tors. theta energy: -16.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -150.916949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.916949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.919493 (E_RNA) where: Base-Base interactions energy: -96.534 where: short stacking energy: -43.602 Base-Backbone interact. energy: -0.188 local terms energy: -54.198049 where: bonds (distance) C4'-P energy: -13.274 bonds (distance) P-C4' energy: -14.636 flat angles C4'-P-C4' energy: -11.285 flat angles P-C4'-P energy: -9.948 tors. eta vs tors. theta energy: -5.056 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -144.928484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.928484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.055690 (E_RNA) where: Base-Base interactions energy: -80.248 where: short stacking energy: -42.497 Base-Backbone interact. energy: -0.497 local terms energy: -64.311331 where: bonds (distance) C4'-P energy: -13.903 bonds (distance) P-C4' energy: -14.004 flat angles C4'-P-C4' energy: -14.420 flat angles P-C4'-P energy: -9.814 tors. eta vs tors. theta energy: -12.170 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -138.939111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.939111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.981979 (E_RNA) where: Base-Base interactions energy: -84.610 where: short stacking energy: -49.874 Base-Backbone interact. energy: -0.398 local terms energy: -53.973615 where: bonds (distance) C4'-P energy: -11.216 bonds (distance) P-C4' energy: -13.668 flat angles C4'-P-C4' energy: -12.020 flat angles P-C4'-P energy: -4.446 tors. eta vs tors. theta energy: -12.624 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -145.420891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.420891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.426803 (E_RNA) where: Base-Base interactions energy: -84.598 where: short stacking energy: -40.025 Base-Backbone interact. energy: -0.058 local terms energy: -60.771391 where: bonds (distance) C4'-P energy: -13.704 bonds (distance) P-C4' energy: -10.151 flat angles C4'-P-C4' energy: -14.896 flat angles P-C4'-P energy: -7.047 tors. eta vs tors. theta energy: -14.974 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -95.296394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.296394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.245595 (E_RNA) where: Base-Base interactions energy: -44.541 where: short stacking energy: -23.558 Base-Backbone interact. energy: -0.361 local terms energy: -51.344071 where: bonds (distance) C4'-P energy: -11.701 bonds (distance) P-C4' energy: -14.899 flat angles C4'-P-C4' energy: -12.162 flat angles P-C4'-P energy: -10.680 tors. eta vs tors. theta energy: -1.902 Dist. restrs. and SS energy: 0.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -236.533736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.533736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.355946 (E_RNA) where: Base-Base interactions energy: -158.884 where: short stacking energy: -65.314 Base-Backbone interact. energy: -0.910 local terms energy: -78.561905 where: bonds (distance) C4'-P energy: -16.946 bonds (distance) P-C4' energy: -15.019 flat angles C4'-P-C4' energy: -17.190 flat angles P-C4'-P energy: -12.264 tors. eta vs tors. theta energy: -17.144 Dist. restrs. and SS energy: 1.822 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -221.054580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.054580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.054580 (E_RNA) where: Base-Base interactions energy: -151.981 where: short stacking energy: -57.222 Base-Backbone interact. energy: -0.860 local terms energy: -68.213294 where: bonds (distance) C4'-P energy: -15.463 bonds (distance) P-C4' energy: -16.352 flat angles C4'-P-C4' energy: -14.130 flat angles P-C4'-P energy: -8.219 tors. eta vs tors. theta energy: -14.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -232.158157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.158157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.355025 (E_RNA) where: Base-Base interactions energy: -159.085 where: short stacking energy: -68.648 Base-Backbone interact. energy: 1.578 local terms energy: -76.848491 where: bonds (distance) C4'-P energy: -14.019 bonds (distance) P-C4' energy: -17.964 flat angles C4'-P-C4' energy: -17.471 flat angles P-C4'-P energy: -13.004 tors. eta vs tors. theta energy: -14.392 Dist. restrs. and SS energy: 2.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -182.897180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.897180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.941575 (E_RNA) where: Base-Base interactions energy: -111.956 where: short stacking energy: -52.770 Base-Backbone interact. energy: 0.066 local terms energy: -71.051064 where: bonds (distance) C4'-P energy: -17.755 bonds (distance) P-C4' energy: -12.257 flat angles C4'-P-C4' energy: -15.185 flat angles P-C4'-P energy: -7.607 tors. eta vs tors. theta energy: -18.247 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -145.384421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.384421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.396102 (E_RNA) where: Base-Base interactions energy: -83.270 where: short stacking energy: -44.365 Base-Backbone interact. energy: -0.219 local terms energy: -61.907670 where: bonds (distance) C4'-P energy: -14.030 bonds (distance) P-C4' energy: -15.981 flat angles C4'-P-C4' energy: -14.807 flat angles P-C4'-P energy: -9.688 tors. eta vs tors. theta energy: -7.401 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -148.831020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.831020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.875312 (E_RNA) where: Base-Base interactions energy: -91.995 where: short stacking energy: -41.772 Base-Backbone interact. energy: -0.809 local terms energy: -56.071425 where: bonds (distance) C4'-P energy: -16.772 bonds (distance) P-C4' energy: -10.316 flat angles C4'-P-C4' energy: -14.114 flat angles P-C4'-P energy: -6.434 tors. eta vs tors. theta energy: -8.435 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -159.990586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.990586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.990586 (E_RNA) where: Base-Base interactions energy: -98.924 where: short stacking energy: -55.334 Base-Backbone interact. energy: -0.339 local terms energy: -60.727982 where: bonds (distance) C4'-P energy: -9.022 bonds (distance) P-C4' energy: -15.010 flat angles C4'-P-C4' energy: -11.602 flat angles P-C4'-P energy: -11.476 tors. eta vs tors. theta energy: -13.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -143.535365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.535365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.712994 (E_RNA) where: Base-Base interactions energy: -80.199 where: short stacking energy: -35.520 Base-Backbone interact. energy: -1.197 local terms energy: -62.316889 where: bonds (distance) C4'-P energy: -11.854 bonds (distance) P-C4' energy: -16.145 flat angles C4'-P-C4' energy: -17.226 flat angles P-C4'-P energy: -8.117 tors. eta vs tors. theta energy: -8.975 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -142.739644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.739644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.756255 (E_RNA) where: Base-Base interactions energy: -85.671 where: short stacking energy: -39.876 Base-Backbone interact. energy: -0.175 local terms energy: -56.910684 where: bonds (distance) C4'-P energy: -15.428 bonds (distance) P-C4' energy: -16.138 flat angles C4'-P-C4' energy: -10.510 flat angles P-C4'-P energy: -5.108 tors. eta vs tors. theta energy: -9.727 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -100.351489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.351489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.996994 (E_RNA) where: Base-Base interactions energy: -41.546 where: short stacking energy: -27.846 Base-Backbone interact. energy: 0.721 local terms energy: -60.172419 where: bonds (distance) C4'-P energy: -13.786 bonds (distance) P-C4' energy: -19.793 flat angles C4'-P-C4' energy: -10.505 flat angles P-C4'-P energy: -8.742 tors. eta vs tors. theta energy: -7.347 Dist. restrs. and SS energy: 0.646 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -220.790267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.790267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.846046 (E_RNA) where: Base-Base interactions energy: -144.691 where: short stacking energy: -58.746 Base-Backbone interact. energy: -0.952 local terms energy: -75.203449 where: bonds (distance) C4'-P energy: -15.615 bonds (distance) P-C4' energy: -18.017 flat angles C4'-P-C4' energy: -13.670 flat angles P-C4'-P energy: -9.558 tors. eta vs tors. theta energy: -18.344 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -220.475660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.475660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.428978 (E_RNA) where: Base-Base interactions energy: -152.224 where: short stacking energy: -55.157 Base-Backbone interact. energy: -0.243 local terms energy: -69.961959 where: bonds (distance) C4'-P energy: -14.454 bonds (distance) P-C4' energy: -16.314 flat angles C4'-P-C4' energy: -16.709 flat angles P-C4'-P energy: -8.052 tors. eta vs tors. theta energy: -14.433 Dist. restrs. and SS energy: 1.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -230.215945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.215945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.619971 (E_RNA) where: Base-Base interactions energy: -155.177 where: short stacking energy: -60.999 Base-Backbone interact. energy: -0.309 local terms energy: -76.133920 where: bonds (distance) C4'-P energy: -14.452 bonds (distance) P-C4' energy: -17.989 flat angles C4'-P-C4' energy: -16.537 flat angles P-C4'-P energy: -11.815 tors. eta vs tors. theta energy: -15.342 Dist. restrs. and SS energy: 1.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -184.699548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.699548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.699548 (E_RNA) where: Base-Base interactions energy: -121.034 where: short stacking energy: -50.227 Base-Backbone interact. energy: -0.174 local terms energy: -63.490724 where: bonds (distance) C4'-P energy: -10.368 bonds (distance) P-C4' energy: -14.898 flat angles C4'-P-C4' energy: -16.407 flat angles P-C4'-P energy: -8.913 tors. eta vs tors. theta energy: -12.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -165.410471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.410471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.810812 (E_RNA) where: Base-Base interactions energy: -90.875 where: short stacking energy: -45.286 Base-Backbone interact. energy: -0.282 local terms energy: -75.653237 where: bonds (distance) C4'-P energy: -15.529 bonds (distance) P-C4' energy: -19.563 flat angles C4'-P-C4' energy: -14.966 flat angles P-C4'-P energy: -11.650 tors. eta vs tors. theta energy: -13.945 Dist. restrs. and SS energy: 1.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -145.850426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.850426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.850426 (E_RNA) where: Base-Base interactions energy: -83.810 where: short stacking energy: -41.102 Base-Backbone interact. energy: -0.122 local terms energy: -61.917550 where: bonds (distance) C4'-P energy: -13.220 bonds (distance) P-C4' energy: -14.084 flat angles C4'-P-C4' energy: -14.055 flat angles P-C4'-P energy: -13.788 tors. eta vs tors. theta energy: -6.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -149.588277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.588277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.601431 (E_RNA) where: Base-Base interactions energy: -89.528 where: short stacking energy: -50.722 Base-Backbone interact. energy: -0.194 local terms energy: -59.879142 where: bonds (distance) C4'-P energy: -14.752 bonds (distance) P-C4' energy: -11.916 flat angles C4'-P-C4' energy: -16.412 flat angles P-C4'-P energy: -3.908 tors. eta vs tors. theta energy: -12.891 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -109.717192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.717192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.717192 (E_RNA) where: Base-Base interactions energy: -58.506 where: short stacking energy: -27.152 Base-Backbone interact. energy: -0.280 local terms energy: -50.931427 where: bonds (distance) C4'-P energy: -14.909 bonds (distance) P-C4' energy: -12.901 flat angles C4'-P-C4' energy: -10.414 flat angles P-C4'-P energy: -11.552 tors. eta vs tors. theta energy: -1.155 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -95.022196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.022196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.873365 (E_RNA) where: Base-Base interactions energy: -47.722 where: short stacking energy: -24.017 Base-Backbone interact. energy: -0.129 local terms energy: -48.022718 where: bonds (distance) C4'-P energy: -10.885 bonds (distance) P-C4' energy: -17.343 flat angles C4'-P-C4' energy: -11.422 flat angles P-C4'-P energy: -9.600 tors. eta vs tors. theta energy: 1.227 Dist. restrs. and SS energy: 0.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -140.324600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.324600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.324600 (E_RNA) where: Base-Base interactions energy: -85.965 where: short stacking energy: -32.526 Base-Backbone interact. energy: -1.980 local terms energy: -52.380059 where: bonds (distance) C4'-P energy: -12.757 bonds (distance) P-C4' energy: -11.760 flat angles C4'-P-C4' energy: -13.605 flat angles P-C4'-P energy: -5.501 tors. eta vs tors. theta energy: -8.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -227.731882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.731882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.731882 (E_RNA) where: Base-Base interactions energy: -151.701 where: short stacking energy: -69.434 Base-Backbone interact. energy: -1.133 local terms energy: -74.898450 where: bonds (distance) C4'-P energy: -15.377 bonds (distance) P-C4' energy: -18.870 flat angles C4'-P-C4' energy: -16.185 flat angles P-C4'-P energy: -8.135 tors. eta vs tors. theta energy: -16.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -224.135470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.135470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.241680 (E_RNA) where: Base-Base interactions energy: -152.406 where: short stacking energy: -59.398 Base-Backbone interact. energy: -0.287 local terms energy: -72.548779 where: bonds (distance) C4'-P energy: -11.650 bonds (distance) P-C4' energy: -18.873 flat angles C4'-P-C4' energy: -16.816 flat angles P-C4'-P energy: -9.625 tors. eta vs tors. theta energy: -15.584 Dist. restrs. and SS energy: 1.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -228.909996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.909996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.278966 (E_RNA) where: Base-Base interactions energy: -154.173 where: short stacking energy: -63.111 Base-Backbone interact. energy: -0.144 local terms energy: -75.961667 where: bonds (distance) C4'-P energy: -14.188 bonds (distance) P-C4' energy: -16.329 flat angles C4'-P-C4' energy: -19.146 flat angles P-C4'-P energy: -10.964 tors. eta vs tors. theta energy: -15.335 Dist. restrs. and SS energy: 1.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -195.433878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.433878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.433878 (E_RNA) where: Base-Base interactions energy: -134.539 where: short stacking energy: -52.249 Base-Backbone interact. energy: -0.482 local terms energy: -60.412979 where: bonds (distance) C4'-P energy: -13.070 bonds (distance) P-C4' energy: -12.971 flat angles C4'-P-C4' energy: -16.689 flat angles P-C4'-P energy: -9.279 tors. eta vs tors. theta energy: -8.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -171.371773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.371773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.371773 (E_RNA) where: Base-Base interactions energy: -98.956 where: short stacking energy: -53.602 Base-Backbone interact. energy: -0.573 local terms energy: -71.843193 where: bonds (distance) C4'-P energy: -18.298 bonds (distance) P-C4' energy: -18.655 flat angles C4'-P-C4' energy: -11.622 flat angles P-C4'-P energy: -11.364 tors. eta vs tors. theta energy: -11.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -145.772782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.772782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.772782 (E_RNA) where: Base-Base interactions energy: -92.728 where: short stacking energy: -51.509 Base-Backbone interact. energy: -0.474 local terms energy: -52.570670 where: bonds (distance) C4'-P energy: -7.891 bonds (distance) P-C4' energy: -11.589 flat angles C4'-P-C4' energy: -14.847 flat angles P-C4'-P energy: -7.299 tors. eta vs tors. theta energy: -10.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -147.967643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.967643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.060669 (E_RNA) where: Base-Base interactions energy: -79.998 where: short stacking energy: -42.783 Base-Backbone interact. energy: -0.041 local terms energy: -68.022403 where: bonds (distance) C4'-P energy: -17.836 bonds (distance) P-C4' energy: -15.454 flat angles C4'-P-C4' energy: -16.170 flat angles P-C4'-P energy: -9.525 tors. eta vs tors. theta energy: -9.036 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -95.139141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.139141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.305001 (E_RNA) where: Base-Base interactions energy: -37.086 where: short stacking energy: -25.747 Base-Backbone interact. energy: -0.808 local terms energy: -60.410460 where: bonds (distance) C4'-P energy: -15.873 bonds (distance) P-C4' energy: -17.100 flat angles C4'-P-C4' energy: -9.059 flat angles P-C4'-P energy: -10.433 tors. eta vs tors. theta energy: -7.945 Dist. restrs. and SS energy: 3.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -123.881422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.881422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.881422 (E_RNA) where: Base-Base interactions energy: -70.296 where: short stacking energy: -37.333 Base-Backbone interact. energy: -0.858 local terms energy: -52.728283 where: bonds (distance) C4'-P energy: -13.899 bonds (distance) P-C4' energy: -17.352 flat angles C4'-P-C4' energy: -9.802 flat angles P-C4'-P energy: -8.107 tors. eta vs tors. theta energy: -3.569 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -126.776947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.776947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.095274 (E_RNA) where: Base-Base interactions energy: -72.764 where: short stacking energy: -36.212 Base-Backbone interact. energy: -1.426 local terms energy: -52.904688 where: bonds (distance) C4'-P energy: -15.546 bonds (distance) P-C4' energy: -17.411 flat angles C4'-P-C4' energy: -11.643 flat angles P-C4'-P energy: -4.393 tors. eta vs tors. theta energy: -3.913 Dist. restrs. and SS energy: 0.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -227.590432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.590432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.595028 (E_RNA) where: Base-Base interactions energy: -156.193 where: short stacking energy: -63.421 Base-Backbone interact. energy: -0.407 local terms energy: -70.994389 where: bonds (distance) C4'-P energy: -15.324 bonds (distance) P-C4' energy: -16.647 flat angles C4'-P-C4' energy: -14.901 flat angles P-C4'-P energy: -6.536 tors. eta vs tors. theta energy: -17.586 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -230.639015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.639015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.476796 (E_RNA) where: Base-Base interactions energy: -162.602 where: short stacking energy: -66.469 Base-Backbone interact. energy: -0.197 local terms energy: -68.678267 where: bonds (distance) C4'-P energy: -12.579 bonds (distance) P-C4' energy: -13.286 flat angles C4'-P-C4' energy: -18.785 flat angles P-C4'-P energy: -6.573 tors. eta vs tors. theta energy: -17.455 Dist. restrs. and SS energy: 0.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -237.830748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.830748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.035755 (E_RNA) where: Base-Base interactions energy: -161.663 where: short stacking energy: -59.809 Base-Backbone interact. energy: -0.210 local terms energy: -78.162504 where: bonds (distance) C4'-P energy: -16.975 bonds (distance) P-C4' energy: -18.594 flat angles C4'-P-C4' energy: -13.944 flat angles P-C4'-P energy: -12.633 tors. eta vs tors. theta energy: -16.017 Dist. restrs. and SS energy: 2.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -200.614866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.614866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.616571 (E_RNA) where: Base-Base interactions energy: -132.668 where: short stacking energy: -56.291 Base-Backbone interact. energy: -1.122 local terms energy: -66.827185 where: bonds (distance) C4'-P energy: -16.585 bonds (distance) P-C4' energy: -13.598 flat angles C4'-P-C4' energy: -12.306 flat angles P-C4'-P energy: -7.712 tors. eta vs tors. theta energy: -16.626 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -174.076862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.076862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.098851 (E_RNA) where: Base-Base interactions energy: -104.028 where: short stacking energy: -46.659 Base-Backbone interact. energy: 0.304 local terms energy: -70.375592 where: bonds (distance) C4'-P energy: -12.060 bonds (distance) P-C4' energy: -16.913 flat angles C4'-P-C4' energy: -15.791 flat angles P-C4'-P energy: -10.711 tors. eta vs tors. theta energy: -14.901 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -134.140293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.140293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.171584 (E_RNA) where: Base-Base interactions energy: -76.744 where: short stacking energy: -38.272 Base-Backbone interact. energy: -0.684 local terms energy: -56.743858 where: bonds (distance) C4'-P energy: -15.722 bonds (distance) P-C4' energy: -11.904 flat angles C4'-P-C4' energy: -14.041 flat angles P-C4'-P energy: -11.061 tors. eta vs tors. theta energy: -4.016 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -142.104373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.104373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.173849 (E_RNA) where: Base-Base interactions energy: -84.036 where: short stacking energy: -44.937 Base-Backbone interact. energy: -0.194 local terms energy: -61.943844 where: bonds (distance) C4'-P energy: -16.159 bonds (distance) P-C4' energy: -13.666 flat angles C4'-P-C4' energy: -14.973 flat angles P-C4'-P energy: -8.829 tors. eta vs tors. theta energy: -8.317 Dist. restrs. and SS energy: 4.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -98.917381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.917381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.099868 (E_RNA) where: Base-Base interactions energy: -47.630 where: short stacking energy: -23.441 Base-Backbone interact. energy: -0.203 local terms energy: -51.267355 where: bonds (distance) C4'-P energy: -17.368 bonds (distance) P-C4' energy: -10.645 flat angles C4'-P-C4' energy: -16.205 flat angles P-C4'-P energy: -7.544 tors. eta vs tors. theta energy: 0.494 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -130.846953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.846953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.964901 (E_RNA) where: Base-Base interactions energy: -76.275 where: short stacking energy: -32.597 Base-Backbone interact. energy: -0.349 local terms energy: -54.341569 where: bonds (distance) C4'-P energy: -11.571 bonds (distance) P-C4' energy: -12.870 flat angles C4'-P-C4' energy: -15.101 flat angles P-C4'-P energy: -7.571 tors. eta vs tors. theta energy: -7.229 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -126.270229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.270229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.270229 (E_RNA) where: Base-Base interactions energy: -79.220 where: short stacking energy: -37.118 Base-Backbone interact. energy: 0.779 local terms energy: -47.829276 where: bonds (distance) C4'-P energy: -12.955 bonds (distance) P-C4' energy: -15.945 flat angles C4'-P-C4' energy: -9.514 flat angles P-C4'-P energy: -7.884 tors. eta vs tors. theta energy: -1.531 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -239.700881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.700881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.064560 (E_RNA) where: Base-Base interactions energy: -170.455 where: short stacking energy: -66.666 Base-Backbone interact. energy: -1.223 local terms energy: -68.386062 where: bonds (distance) C4'-P energy: -13.728 bonds (distance) P-C4' energy: -12.414 flat angles C4'-P-C4' energy: -14.936 flat angles P-C4'-P energy: -9.405 tors. eta vs tors. theta energy: -17.903 Dist. restrs. and SS energy: 0.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -234.855700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.855700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.257830 (E_RNA) where: Base-Base interactions energy: -163.164 where: short stacking energy: -67.496 Base-Backbone interact. energy: 0.418 local terms energy: -73.512132 where: bonds (distance) C4'-P energy: -14.863 bonds (distance) P-C4' energy: -15.377 flat angles C4'-P-C4' energy: -14.070 flat angles P-C4'-P energy: -10.919 tors. eta vs tors. theta energy: -18.284 Dist. restrs. and SS energy: 1.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -219.424897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.424897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.634617 (E_RNA) where: Base-Base interactions energy: -154.280 where: short stacking energy: -61.307 Base-Backbone interact. energy: -0.702 local terms energy: -65.652899 where: bonds (distance) C4'-P energy: -13.798 bonds (distance) P-C4' energy: -15.258 flat angles C4'-P-C4' energy: -14.192 flat angles P-C4'-P energy: -8.810 tors. eta vs tors. theta energy: -13.595 Dist. restrs. and SS energy: 1.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -211.820668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.820668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.570696 (E_RNA) where: Base-Base interactions energy: -147.443 where: short stacking energy: -63.097 Base-Backbone interact. energy: -0.913 local terms energy: -65.214918 where: bonds (distance) C4'-P energy: -10.970 bonds (distance) P-C4' energy: -18.343 flat angles C4'-P-C4' energy: -9.500 flat angles P-C4'-P energy: -8.139 tors. eta vs tors. theta energy: -18.262 Dist. restrs. and SS energy: 1.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -177.325051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.325051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.328935 (E_RNA) where: Base-Base interactions energy: -109.827 where: short stacking energy: -48.462 Base-Backbone interact. energy: 0.028 local terms energy: -67.530133 where: bonds (distance) C4'-P energy: -16.117 bonds (distance) P-C4' energy: -15.088 flat angles C4'-P-C4' energy: -17.822 flat angles P-C4'-P energy: -9.758 tors. eta vs tors. theta energy: -8.744 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -155.101462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.101462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.101462 (E_RNA) where: Base-Base interactions energy: -95.427 where: short stacking energy: -44.008 Base-Backbone interact. energy: -0.058 local terms energy: -59.616194 where: bonds (distance) C4'-P energy: -12.905 bonds (distance) P-C4' energy: -12.631 flat angles C4'-P-C4' energy: -11.891 flat angles P-C4'-P energy: -13.115 tors. eta vs tors. theta energy: -9.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -153.875148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.875148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.892392 (E_RNA) where: Base-Base interactions energy: -98.847 where: short stacking energy: -45.353 Base-Backbone interact. energy: -0.149 local terms energy: -54.896995 where: bonds (distance) C4'-P energy: -9.950 bonds (distance) P-C4' energy: -15.443 flat angles C4'-P-C4' energy: -11.523 flat angles P-C4'-P energy: -5.924 tors. eta vs tors. theta energy: -12.057 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -133.202120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.202120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.215033 (E_RNA) where: Base-Base interactions energy: -76.900 where: short stacking energy: -38.663 Base-Backbone interact. energy: -0.015 local terms energy: -56.299571 where: bonds (distance) C4'-P energy: -15.199 bonds (distance) P-C4' energy: -14.668 flat angles C4'-P-C4' energy: -16.263 flat angles P-C4'-P energy: -5.809 tors. eta vs tors. theta energy: -4.360 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -110.089859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.089859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.542608 (E_RNA) where: Base-Base interactions energy: -50.486 where: short stacking energy: -29.713 Base-Backbone interact. energy: -0.061 local terms energy: -59.995966 where: bonds (distance) C4'-P energy: -17.305 bonds (distance) P-C4' energy: -15.554 flat angles C4'-P-C4' energy: -16.308 flat angles P-C4'-P energy: -9.947 tors. eta vs tors. theta energy: -0.881 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -120.313547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.313547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.365055 (E_RNA) where: Base-Base interactions energy: -75.996 where: short stacking energy: -37.107 Base-Backbone interact. energy: -0.749 local terms energy: -46.620888 where: bonds (distance) C4'-P energy: -9.828 bonds (distance) P-C4' energy: -15.808 flat angles C4'-P-C4' energy: -9.352 flat angles P-C4'-P energy: -8.021 tors. eta vs tors. theta energy: -3.611 Dist. restrs. and SS energy: 3.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -237.440211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.440211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.923358 (E_RNA) where: Base-Base interactions energy: -160.080 where: short stacking energy: -67.410 Base-Backbone interact. energy: 0.033 local terms energy: -79.876920 where: bonds (distance) C4'-P energy: -14.943 bonds (distance) P-C4' energy: -19.094 flat angles C4'-P-C4' energy: -15.488 flat angles P-C4'-P energy: -12.371 tors. eta vs tors. theta energy: -17.981 Dist. restrs. and SS energy: 2.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -228.028857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.028857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.544932 (E_RNA) where: Base-Base interactions energy: -166.430 where: short stacking energy: -61.629 Base-Backbone interact. energy: 0.824 local terms energy: -62.938678 where: bonds (distance) C4'-P energy: -15.278 bonds (distance) P-C4' energy: -9.132 flat angles C4'-P-C4' energy: -15.478 flat angles P-C4'-P energy: -8.237 tors. eta vs tors. theta energy: -14.814 Dist. restrs. and SS energy: 0.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -222.917363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.917363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.590524 (E_RNA) where: Base-Base interactions energy: -151.649 where: short stacking energy: -62.423 Base-Backbone interact. energy: -0.569 local terms energy: -72.373119 where: bonds (distance) C4'-P energy: -13.941 bonds (distance) P-C4' energy: -16.332 flat angles C4'-P-C4' energy: -17.815 flat angles P-C4'-P energy: -8.992 tors. eta vs tors. theta energy: -15.294 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -225.773978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.773978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.112593 (E_RNA) where: Base-Base interactions energy: -156.809 where: short stacking energy: -65.297 Base-Backbone interact. energy: 0.336 local terms energy: -70.639710 where: bonds (distance) C4'-P energy: -14.445 bonds (distance) P-C4' energy: -17.315 flat angles C4'-P-C4' energy: -9.036 flat angles P-C4'-P energy: -12.601 tors. eta vs tors. theta energy: -17.243 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -151.174534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.174534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.174616 (E_RNA) where: Base-Base interactions energy: -88.080 where: short stacking energy: -43.482 Base-Backbone interact. energy: -0.184 local terms energy: -62.910624 where: bonds (distance) C4'-P energy: -16.445 bonds (distance) P-C4' energy: -13.951 flat angles C4'-P-C4' energy: -15.128 flat angles P-C4'-P energy: -10.575 tors. eta vs tors. theta energy: -6.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -156.513783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.513783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.929754 (E_RNA) where: Base-Base interactions energy: -96.806 where: short stacking energy: -43.450 Base-Backbone interact. energy: -0.318 local terms energy: -59.805520 where: bonds (distance) C4'-P energy: -11.873 bonds (distance) P-C4' energy: -15.459 flat angles C4'-P-C4' energy: -13.352 flat angles P-C4'-P energy: -9.236 tors. eta vs tors. theta energy: -9.885 Dist. restrs. and SS energy: 0.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -146.180449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.180449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.253712 (E_RNA) where: Base-Base interactions energy: -80.318 where: short stacking energy: -35.911 Base-Backbone interact. energy: -0.215 local terms energy: -66.720311 where: bonds (distance) C4'-P energy: -16.983 bonds (distance) P-C4' energy: -17.022 flat angles C4'-P-C4' energy: -16.640 flat angles P-C4'-P energy: -11.666 tors. eta vs tors. theta energy: -4.409 Dist. restrs. and SS energy: 1.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -129.103294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.103294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.647681 (E_RNA) where: Base-Base interactions energy: -67.496 where: short stacking energy: -28.908 Base-Backbone interact. energy: -0.225 local terms energy: -61.926643 where: bonds (distance) C4'-P energy: -17.749 bonds (distance) P-C4' energy: -17.069 flat angles C4'-P-C4' energy: -11.629 flat angles P-C4'-P energy: -8.741 tors. eta vs tors. theta energy: -6.739 Dist. restrs. and SS energy: 0.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -121.593859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.593859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.611014 (E_RNA) where: Base-Base interactions energy: -72.167 where: short stacking energy: -43.203 Base-Backbone interact. energy: -0.170 local terms energy: -49.273884 where: bonds (distance) C4'-P energy: -12.794 bonds (distance) P-C4' energy: -18.811 flat angles C4'-P-C4' energy: -10.472 flat angles P-C4'-P energy: -1.114 tors. eta vs tors. theta energy: -6.083 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -85.003468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.003468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.922518 (E_RNA) where: Base-Base interactions energy: -38.651 where: short stacking energy: -25.133 Base-Backbone interact. energy: 0.925 local terms energy: -49.197129 where: bonds (distance) C4'-P energy: -8.259 bonds (distance) P-C4' energy: -17.111 flat angles C4'-P-C4' energy: -11.232 flat angles P-C4'-P energy: -8.782 tors. eta vs tors. theta energy: -3.814 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -234.568099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.568099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.110590 (E_RNA) where: Base-Base interactions energy: -165.399 where: short stacking energy: -64.917 Base-Backbone interact. energy: -0.306 local terms energy: -70.406266 where: bonds (distance) C4'-P energy: -12.549 bonds (distance) P-C4' energy: -15.908 flat angles C4'-P-C4' energy: -13.082 flat angles P-C4'-P energy: -11.825 tors. eta vs tors. theta energy: -17.042 Dist. restrs. and SS energy: 1.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -221.518394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.518394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.740506 (E_RNA) where: Base-Base interactions energy: -152.625 where: short stacking energy: -68.268 Base-Backbone interact. energy: -0.332 local terms energy: -68.783476 where: bonds (distance) C4'-P energy: -11.179 bonds (distance) P-C4' energy: -15.383 flat angles C4'-P-C4' energy: -15.565 flat angles P-C4'-P energy: -7.956 tors. eta vs tors. theta energy: -18.701 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -200.383848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.383848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.644848 (E_RNA) where: Base-Base interactions energy: -135.561 where: short stacking energy: -57.230 Base-Backbone interact. energy: -0.446 local terms energy: -66.638417 where: bonds (distance) C4'-P energy: -15.324 bonds (distance) P-C4' energy: -13.585 flat angles C4'-P-C4' energy: -14.424 flat angles P-C4'-P energy: -8.360 tors. eta vs tors. theta energy: -14.945 Dist. restrs. and SS energy: 2.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -216.189699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.189699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.558906 (E_RNA) where: Base-Base interactions energy: -147.781 where: short stacking energy: -57.277 Base-Backbone interact. energy: 1.452 local terms energy: -71.229210 where: bonds (distance) C4'-P energy: -15.819 bonds (distance) P-C4' energy: -15.964 flat angles C4'-P-C4' energy: -14.422 flat angles P-C4'-P energy: -11.133 tors. eta vs tors. theta energy: -13.891 Dist. restrs. and SS energy: 1.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -154.613861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.613861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.919773 (E_RNA) where: Base-Base interactions energy: -94.287 where: short stacking energy: -53.753 Base-Backbone interact. energy: -0.257 local terms energy: -61.376040 where: bonds (distance) C4'-P energy: -11.849 bonds (distance) P-C4' energy: -13.927 flat angles C4'-P-C4' energy: -13.224 flat angles P-C4'-P energy: -12.077 tors. eta vs tors. theta energy: -10.300 Dist. restrs. and SS energy: 1.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -152.533602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.533602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.316400 (E_RNA) where: Base-Base interactions energy: -87.354 where: short stacking energy: -45.999 Base-Backbone interact. energy: -0.640 local terms energy: -66.321993 where: bonds (distance) C4'-P energy: -13.726 bonds (distance) P-C4' energy: -18.326 flat angles C4'-P-C4' energy: -14.782 flat angles P-C4'-P energy: -12.100 tors. eta vs tors. theta energy: -7.388 Dist. restrs. and SS energy: 1.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -148.270138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.270138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.270138 (E_RNA) where: Base-Base interactions energy: -77.838 where: short stacking energy: -37.747 Base-Backbone interact. energy: -0.028 local terms energy: -70.403765 where: bonds (distance) C4'-P energy: -16.863 bonds (distance) P-C4' energy: -17.128 flat angles C4'-P-C4' energy: -14.175 flat angles P-C4'-P energy: -11.502 tors. eta vs tors. theta energy: -10.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -144.311895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.311895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.311895 (E_RNA) where: Base-Base interactions energy: -87.136 where: short stacking energy: -32.500 Base-Backbone interact. energy: -0.166 local terms energy: -57.010193 where: bonds (distance) C4'-P energy: -13.939 bonds (distance) P-C4' energy: -15.893 flat angles C4'-P-C4' energy: -15.819 flat angles P-C4'-P energy: -7.132 tors. eta vs tors. theta energy: -4.228 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -134.204103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.204103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.204103 (E_RNA) where: Base-Base interactions energy: -73.784 where: short stacking energy: -28.987 Base-Backbone interact. energy: -0.921 local terms energy: -59.499656 where: bonds (distance) C4'-P energy: -17.507 bonds (distance) P-C4' energy: -13.120 flat angles C4'-P-C4' energy: -11.926 flat angles P-C4'-P energy: -12.317 tors. eta vs tors. theta energy: -4.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -103.452518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.452518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -103.452518 (E_RNA) where: Base-Base interactions energy: -62.190 where: short stacking energy: -29.991 Base-Backbone interact. energy: 0.243 local terms energy: -41.505803 where: bonds (distance) C4'-P energy: -12.449 bonds (distance) P-C4' energy: -12.295 flat angles C4'-P-C4' energy: -9.424 flat angles P-C4'-P energy: -4.853 tors. eta vs tors. theta energy: -2.484 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -241.995624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.995624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.127839 (E_RNA) where: Base-Base interactions energy: -176.177 where: short stacking energy: -72.233 Base-Backbone interact. energy: -0.349 local terms energy: -67.602148 where: bonds (distance) C4'-P energy: -13.342 bonds (distance) P-C4' energy: -15.980 flat angles C4'-P-C4' energy: -14.546 flat angles P-C4'-P energy: -7.239 tors. eta vs tors. theta energy: -16.495 Dist. restrs. and SS energy: 2.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -229.304875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.304875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.434043 (E_RNA) where: Base-Base interactions energy: -151.873 where: short stacking energy: -55.592 Base-Backbone interact. energy: -0.589 local terms energy: -76.971849 where: bonds (distance) C4'-P energy: -16.983 bonds (distance) P-C4' energy: -16.146 flat angles C4'-P-C4' energy: -13.482 flat angles P-C4'-P energy: -11.081 tors. eta vs tors. theta energy: -19.280 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -224.944823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.944823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.145939 (E_RNA) where: Base-Base interactions energy: -153.285 where: short stacking energy: -60.908 Base-Backbone interact. energy: -0.243 local terms energy: -72.618217 where: bonds (distance) C4'-P energy: -16.131 bonds (distance) P-C4' energy: -16.357 flat angles C4'-P-C4' energy: -15.942 flat angles P-C4'-P energy: -8.634 tors. eta vs tors. theta energy: -15.553 Dist. restrs. and SS energy: 1.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -197.058835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.058835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.763056 (E_RNA) where: Base-Base interactions energy: -134.477 where: short stacking energy: -57.616 Base-Backbone interact. energy: -0.575 local terms energy: -63.710623 where: bonds (distance) C4'-P energy: -7.633 bonds (distance) P-C4' energy: -15.651 flat angles C4'-P-C4' energy: -17.033 flat angles P-C4'-P energy: -8.995 tors. eta vs tors. theta energy: -14.399 Dist. restrs. and SS energy: 1.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -180.024429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.024429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.024429 (E_RNA) where: Base-Base interactions energy: -122.737 where: short stacking energy: -46.041 Base-Backbone interact. energy: -0.171 local terms energy: -57.116592 where: bonds (distance) C4'-P energy: -12.465 bonds (distance) P-C4' energy: -15.992 flat angles C4'-P-C4' energy: -13.306 flat angles P-C4'-P energy: -6.452 tors. eta vs tors. theta energy: -8.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -149.730540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.730540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.789579 (E_RNA) where: Base-Base interactions energy: -88.036 where: short stacking energy: -47.522 Base-Backbone interact. energy: -0.101 local terms energy: -61.652594 where: bonds (distance) C4'-P energy: -14.511 bonds (distance) P-C4' energy: -14.641 flat angles C4'-P-C4' energy: -15.760 flat angles P-C4'-P energy: -8.334 tors. eta vs tors. theta energy: -8.407 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -138.003799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.003799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.097506 (E_RNA) where: Base-Base interactions energy: -77.580 where: short stacking energy: -39.760 Base-Backbone interact. energy: -0.153 local terms energy: -60.364402 where: bonds (distance) C4'-P energy: -13.551 bonds (distance) P-C4' energy: -14.234 flat angles C4'-P-C4' energy: -15.310 flat angles P-C4'-P energy: -8.969 tors. eta vs tors. theta energy: -8.300 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -142.731832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.731832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.731832 (E_RNA) where: Base-Base interactions energy: -85.684 where: short stacking energy: -50.853 Base-Backbone interact. energy: -0.043 local terms energy: -57.004317 where: bonds (distance) C4'-P energy: -15.327 bonds (distance) P-C4' energy: -5.928 flat angles C4'-P-C4' energy: -14.712 flat angles P-C4'-P energy: -8.628 tors. eta vs tors. theta energy: -12.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -127.737383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.737383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.525592 (E_RNA) where: Base-Base interactions energy: -73.465 where: short stacking energy: -31.174 Base-Backbone interact. energy: -0.117 local terms energy: -54.943344 where: bonds (distance) C4'-P energy: -5.256 bonds (distance) P-C4' energy: -18.877 flat angles C4'-P-C4' energy: -14.065 flat angles P-C4'-P energy: -9.150 tors. eta vs tors. theta energy: -7.596 Dist. restrs. and SS energy: 0.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -123.722250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.722250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.845583 (E_RNA) where: Base-Base interactions energy: -72.013 where: short stacking energy: -30.905 Base-Backbone interact. energy: -0.070 local terms energy: -51.761959 where: bonds (distance) C4'-P energy: -13.136 bonds (distance) P-C4' energy: -15.815 flat angles C4'-P-C4' energy: -17.731 flat angles P-C4'-P energy: -2.167 tors. eta vs tors. theta energy: -2.913 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -250.030846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.030846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.922638 (E_RNA) where: Base-Base interactions energy: -169.466 where: short stacking energy: -68.184 Base-Backbone interact. energy: -0.431 local terms energy: -82.025568 where: bonds (distance) C4'-P energy: -17.845 bonds (distance) P-C4' energy: -19.360 flat angles C4'-P-C4' energy: -18.331 flat angles P-C4'-P energy: -11.498 tors. eta vs tors. theta energy: -14.992 Dist. restrs. and SS energy: 1.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -224.813578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.813578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.437195 (E_RNA) where: Base-Base interactions energy: -154.041 where: short stacking energy: -58.085 Base-Backbone interact. energy: 0.772 local terms energy: -73.168655 where: bonds (distance) C4'-P energy: -17.835 bonds (distance) P-C4' energy: -17.832 flat angles C4'-P-C4' energy: -13.709 flat angles P-C4'-P energy: -8.630 tors. eta vs tors. theta energy: -15.163 Dist. restrs. and SS energy: 1.624 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -212.595183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.595183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.106241 (E_RNA) where: Base-Base interactions energy: -141.440 where: short stacking energy: -55.736 Base-Backbone interact. energy: -0.039 local terms energy: -71.626873 where: bonds (distance) C4'-P energy: -13.980 bonds (distance) P-C4' energy: -11.943 flat angles C4'-P-C4' energy: -14.027 flat angles P-C4'-P energy: -12.830 tors. eta vs tors. theta energy: -18.846 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -205.739973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.739973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.508666 (E_RNA) where: Base-Base interactions energy: -135.065 where: short stacking energy: -50.100 Base-Backbone interact. energy: -0.097 local terms energy: -71.346782 where: bonds (distance) C4'-P energy: -17.810 bonds (distance) P-C4' energy: -16.821 flat angles C4'-P-C4' energy: -16.931 flat angles P-C4'-P energy: -10.262 tors. eta vs tors. theta energy: -9.522 Dist. restrs. and SS energy: 0.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -189.449481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.449481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.484133 (E_RNA) where: Base-Base interactions energy: -116.714 where: short stacking energy: -47.912 Base-Backbone interact. energy: -0.635 local terms energy: -72.135340 where: bonds (distance) C4'-P energy: -17.508 bonds (distance) P-C4' energy: -20.032 flat angles C4'-P-C4' energy: -15.615 flat angles P-C4'-P energy: -6.142 tors. eta vs tors. theta energy: -12.838 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -156.389534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.389534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.389534 (E_RNA) where: Base-Base interactions energy: -91.715 where: short stacking energy: -38.625 Base-Backbone interact. energy: -0.132 local terms energy: -64.542310 where: bonds (distance) C4'-P energy: -15.960 bonds (distance) P-C4' energy: -15.364 flat angles C4'-P-C4' energy: -11.776 flat angles P-C4'-P energy: -10.973 tors. eta vs tors. theta energy: -10.470 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -141.671069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.671069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.671069 (E_RNA) where: Base-Base interactions energy: -81.600 where: short stacking energy: -25.100 Base-Backbone interact. energy: -0.126 local terms energy: -59.944890 where: bonds (distance) C4'-P energy: -13.418 bonds (distance) P-C4' energy: -17.435 flat angles C4'-P-C4' energy: -15.917 flat angles P-C4'-P energy: -10.277 tors. eta vs tors. theta energy: -2.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -156.613169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.613169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.842358 (E_RNA) where: Base-Base interactions energy: -93.945 where: short stacking energy: -49.450 Base-Backbone interact. energy: -0.238 local terms energy: -62.659591 where: bonds (distance) C4'-P energy: -16.530 bonds (distance) P-C4' energy: -14.289 flat angles C4'-P-C4' energy: -10.116 flat angles P-C4'-P energy: -9.756 tors. eta vs tors. theta energy: -11.969 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -128.234826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.234826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.382632 (E_RNA) where: Base-Base interactions energy: -82.169 where: short stacking energy: -41.241 Base-Backbone interact. energy: -0.084 local terms energy: -46.130158 where: bonds (distance) C4'-P energy: -15.071 bonds (distance) P-C4' energy: -8.101 flat angles C4'-P-C4' energy: -11.948 flat angles P-C4'-P energy: -5.019 tors. eta vs tors. theta energy: -5.991 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -133.146541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.146541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.292351 (E_RNA) where: Base-Base interactions energy: -77.652 where: short stacking energy: -33.996 Base-Backbone interact. energy: -0.716 local terms energy: -54.924525 where: bonds (distance) C4'-P energy: -13.671 bonds (distance) P-C4' energy: -13.182 flat angles C4'-P-C4' energy: -14.724 flat angles P-C4'-P energy: -4.656 tors. eta vs tors. theta energy: -8.691 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -235.442771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.442771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.659540 (E_RNA) where: Base-Base interactions energy: -170.953 where: short stacking energy: -66.361 Base-Backbone interact. energy: 0.126 local terms energy: -65.832485 where: bonds (distance) C4'-P energy: -12.233 bonds (distance) P-C4' energy: -13.770 flat angles C4'-P-C4' energy: -17.962 flat angles P-C4'-P energy: -5.278 tors. eta vs tors. theta energy: -16.589 Dist. restrs. and SS energy: 1.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -233.929626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.929626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.373507 (E_RNA) where: Base-Base interactions energy: -170.226 where: short stacking energy: -64.841 Base-Backbone interact. energy: 0.230 local terms energy: -65.377860 where: bonds (distance) C4'-P energy: -10.950 bonds (distance) P-C4' energy: -17.021 flat angles C4'-P-C4' energy: -14.258 flat angles P-C4'-P energy: -8.965 tors. eta vs tors. theta energy: -14.184 Dist. restrs. and SS energy: 1.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -195.807897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.807897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.842330 (E_RNA) where: Base-Base interactions energy: -128.087 where: short stacking energy: -58.716 Base-Backbone interact. energy: -0.724 local terms energy: -67.031754 where: bonds (distance) C4'-P energy: -14.267 bonds (distance) P-C4' energy: -15.680 flat angles C4'-P-C4' energy: -15.388 flat angles P-C4'-P energy: -6.643 tors. eta vs tors. theta energy: -15.053 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -201.638451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.638451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.316983 (E_RNA) where: Base-Base interactions energy: -134.937 where: short stacking energy: -55.854 Base-Backbone interact. energy: -0.303 local terms energy: -67.077553 where: bonds (distance) C4'-P energy: -11.091 bonds (distance) P-C4' energy: -15.981 flat angles C4'-P-C4' energy: -16.103 flat angles P-C4'-P energy: -9.602 tors. eta vs tors. theta energy: -14.301 Dist. restrs. and SS energy: 0.679 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -199.219916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.219916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.219916 (E_RNA) where: Base-Base interactions energy: -139.626 where: short stacking energy: -48.289 Base-Backbone interact. energy: -0.189 local terms energy: -59.405691 where: bonds (distance) C4'-P energy: -13.020 bonds (distance) P-C4' energy: -15.579 flat angles C4'-P-C4' energy: -9.309 flat angles P-C4'-P energy: -10.376 tors. eta vs tors. theta energy: -11.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -156.433547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.433547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.133890 (E_RNA) where: Base-Base interactions energy: -84.198 where: short stacking energy: -46.645 Base-Backbone interact. energy: -0.036 local terms energy: -73.899723 where: bonds (distance) C4'-P energy: -14.266 bonds (distance) P-C4' energy: -18.228 flat angles C4'-P-C4' energy: -19.376 flat angles P-C4'-P energy: -12.846 tors. eta vs tors. theta energy: -9.184 Dist. restrs. and SS energy: 1.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -147.473867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.473867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.516500 (E_RNA) where: Base-Base interactions energy: -85.847 where: short stacking energy: -41.327 Base-Backbone interact. energy: -0.048 local terms energy: -61.621517 where: bonds (distance) C4'-P energy: -16.704 bonds (distance) P-C4' energy: -17.065 flat angles C4'-P-C4' energy: -15.674 flat angles P-C4'-P energy: -6.561 tors. eta vs tors. theta energy: -5.617 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -140.355254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.355254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.367003 (E_RNA) where: Base-Base interactions energy: -83.845 where: short stacking energy: -37.573 Base-Backbone interact. energy: -0.929 local terms energy: -55.593089 where: bonds (distance) C4'-P energy: -14.209 bonds (distance) P-C4' energy: -15.398 flat angles C4'-P-C4' energy: -14.854 flat angles P-C4'-P energy: -6.232 tors. eta vs tors. theta energy: -4.900 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -137.254264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.254264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.254264 (E_RNA) where: Base-Base interactions energy: -82.572 where: short stacking energy: -41.515 Base-Backbone interact. energy: -0.192 local terms energy: -54.490460 where: bonds (distance) C4'-P energy: -12.921 bonds (distance) P-C4' energy: -17.368 flat angles C4'-P-C4' energy: -12.115 flat angles P-C4'-P energy: -6.351 tors. eta vs tors. theta energy: -5.735 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -138.378659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.378659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.231454 (E_RNA) where: Base-Base interactions energy: -82.156 where: short stacking energy: -48.327 Base-Backbone interact. energy: 0.357 local terms energy: -57.432097 where: bonds (distance) C4'-P energy: -7.274 bonds (distance) P-C4' energy: -14.656 flat angles C4'-P-C4' energy: -12.905 flat angles P-C4'-P energy: -10.414 tors. eta vs tors. theta energy: -12.183 Dist. restrs. and SS energy: 0.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -237.196835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.196835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.476285 (E_RNA) where: Base-Base interactions energy: -160.437 where: short stacking energy: -67.806 Base-Backbone interact. energy: -0.228 local terms energy: -77.811519 where: bonds (distance) C4'-P energy: -17.429 bonds (distance) P-C4' energy: -16.346 flat angles C4'-P-C4' energy: -16.088 flat angles P-C4'-P energy: -10.911 tors. eta vs tors. theta energy: -17.037 Dist. restrs. and SS energy: 1.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -224.904547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.904547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.688610 (E_RNA) where: Base-Base interactions energy: -155.194 where: short stacking energy: -61.020 Base-Backbone interact. energy: -0.306 local terms energy: -71.188785 where: bonds (distance) C4'-P energy: -15.935 bonds (distance) P-C4' energy: -14.704 flat angles C4'-P-C4' energy: -16.886 flat angles P-C4'-P energy: -10.550 tors. eta vs tors. theta energy: -13.114 Dist. restrs. and SS energy: 1.784 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -197.794305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.794305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.807167 (E_RNA) where: Base-Base interactions energy: -125.907 where: short stacking energy: -61.182 Base-Backbone interact. energy: -0.871 local terms energy: -71.028974 where: bonds (distance) C4'-P energy: -14.607 bonds (distance) P-C4' energy: -15.339 flat angles C4'-P-C4' energy: -12.544 flat angles P-C4'-P energy: -12.487 tors. eta vs tors. theta energy: -16.052 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -198.172969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.172969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.200155 (E_RNA) where: Base-Base interactions energy: -134.349 where: short stacking energy: -51.609 Base-Backbone interact. energy: -0.130 local terms energy: -63.721363 where: bonds (distance) C4'-P energy: -16.706 bonds (distance) P-C4' energy: -15.853 flat angles C4'-P-C4' energy: -11.241 flat angles P-C4'-P energy: -11.188 tors. eta vs tors. theta energy: -8.734 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -188.560570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.560570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.578100 (E_RNA) where: Base-Base interactions energy: -119.075 where: short stacking energy: -51.336 Base-Backbone interact. energy: 0.228 local terms energy: -69.730508 where: bonds (distance) C4'-P energy: -13.386 bonds (distance) P-C4' energy: -16.515 flat angles C4'-P-C4' energy: -15.402 flat angles P-C4'-P energy: -6.312 tors. eta vs tors. theta energy: -18.115 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -151.798907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.798907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.337438 (E_RNA) where: Base-Base interactions energy: -89.046 where: short stacking energy: -45.461 Base-Backbone interact. energy: 0.382 local terms energy: -64.673208 where: bonds (distance) C4'-P energy: -11.867 bonds (distance) P-C4' energy: -14.801 flat angles C4'-P-C4' energy: -13.589 flat angles P-C4'-P energy: -12.291 tors. eta vs tors. theta energy: -12.125 Dist. restrs. and SS energy: 1.539 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -136.059324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.059324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.284632 (E_RNA) where: Base-Base interactions energy: -77.505 where: short stacking energy: -38.493 Base-Backbone interact. energy: -0.684 local terms energy: -58.095327 where: bonds (distance) C4'-P energy: -14.539 bonds (distance) P-C4' energy: -12.408 flat angles C4'-P-C4' energy: -12.537 flat angles P-C4'-P energy: -10.011 tors. eta vs tors. theta energy: -8.599 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -143.751909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.751909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.751909 (E_RNA) where: Base-Base interactions energy: -79.028 where: short stacking energy: -39.834 Base-Backbone interact. energy: -0.189 local terms energy: -64.534022 where: bonds (distance) C4'-P energy: -15.318 bonds (distance) P-C4' energy: -16.794 flat angles C4'-P-C4' energy: -12.713 flat angles P-C4'-P energy: -11.227 tors. eta vs tors. theta energy: -8.482 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -137.585492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.585492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.746776 (E_RNA) where: Base-Base interactions energy: -90.559 where: short stacking energy: -37.330 Base-Backbone interact. energy: -0.738 local terms energy: -46.449484 where: bonds (distance) C4'-P energy: -16.176 bonds (distance) P-C4' energy: -11.816 flat angles C4'-P-C4' energy: -10.553 flat angles P-C4'-P energy: -6.941 tors. eta vs tors. theta energy: -0.965 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -143.572002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.572002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.572002 (E_RNA) where: Base-Base interactions energy: -80.728 where: short stacking energy: -32.069 Base-Backbone interact. energy: -1.014 local terms energy: -61.830205 where: bonds (distance) C4'-P energy: -13.299 bonds (distance) P-C4' energy: -19.304 flat angles C4'-P-C4' energy: -12.147 flat angles P-C4'-P energy: -8.577 tors. eta vs tors. theta energy: -8.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -236.037123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.037123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.452448 (E_RNA) where: Base-Base interactions energy: -166.294 where: short stacking energy: -70.215 Base-Backbone interact. energy: -0.277 local terms energy: -70.881420 where: bonds (distance) C4'-P energy: -16.068 bonds (distance) P-C4' energy: -15.506 flat angles C4'-P-C4' energy: -15.138 flat angles P-C4'-P energy: -7.182 tors. eta vs tors. theta energy: -16.986 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -227.810670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.810670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.980999 (E_RNA) where: Base-Base interactions energy: -165.908 where: short stacking energy: -63.395 Base-Backbone interact. energy: 0.591 local terms energy: -64.664194 where: bonds (distance) C4'-P energy: -11.796 bonds (distance) P-C4' energy: -13.666 flat angles C4'-P-C4' energy: -19.684 flat angles P-C4'-P energy: -7.963 tors. eta vs tors. theta energy: -11.556 Dist. restrs. and SS energy: 2.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -207.617793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.617793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.694321 (E_RNA) where: Base-Base interactions energy: -140.636 where: short stacking energy: -55.290 Base-Backbone interact. energy: -0.388 local terms energy: -67.670047 where: bonds (distance) C4'-P energy: -12.942 bonds (distance) P-C4' energy: -14.206 flat angles C4'-P-C4' energy: -15.480 flat angles P-C4'-P energy: -10.329 tors. eta vs tors. theta energy: -14.712 Dist. restrs. and SS energy: 1.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -199.770997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.770997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.804213 (E_RNA) where: Base-Base interactions energy: -133.186 where: short stacking energy: -57.123 Base-Backbone interact. energy: 0.525 local terms energy: -67.143350 where: bonds (distance) C4'-P energy: -12.677 bonds (distance) P-C4' energy: -14.813 flat angles C4'-P-C4' energy: -14.427 flat angles P-C4'-P energy: -11.583 tors. eta vs tors. theta energy: -13.643 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -155.965458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.965458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.965458 (E_RNA) where: Base-Base interactions energy: -87.423 where: short stacking energy: -48.615 Base-Backbone interact. energy: -0.012 local terms energy: -68.530827 where: bonds (distance) C4'-P energy: -16.329 bonds (distance) P-C4' energy: -15.261 flat angles C4'-P-C4' energy: -16.328 flat angles P-C4'-P energy: -6.770 tors. eta vs tors. theta energy: -13.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -149.812484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.812484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.824403 (E_RNA) where: Base-Base interactions energy: -90.559 where: short stacking energy: -44.047 Base-Backbone interact. energy: -0.294 local terms energy: -58.971406 where: bonds (distance) C4'-P energy: -12.350 bonds (distance) P-C4' energy: -15.917 flat angles C4'-P-C4' energy: -13.201 flat angles P-C4'-P energy: -5.060 tors. eta vs tors. theta energy: -12.443 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -150.446482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.446482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.458668 (E_RNA) where: Base-Base interactions energy: -89.401 where: short stacking energy: -42.394 Base-Backbone interact. energy: -0.020 local terms energy: -61.037989 where: bonds (distance) C4'-P energy: -13.530 bonds (distance) P-C4' energy: -17.126 flat angles C4'-P-C4' energy: -14.061 flat angles P-C4'-P energy: -9.055 tors. eta vs tors. theta energy: -7.266 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -131.402043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.402043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.509645 (E_RNA) where: Base-Base interactions energy: -84.539 where: short stacking energy: -31.144 Base-Backbone interact. energy: -0.144 local terms energy: -49.826066 where: bonds (distance) C4'-P energy: -12.846 bonds (distance) P-C4' energy: -11.570 flat angles C4'-P-C4' energy: -17.708 flat angles P-C4'-P energy: -3.095 tors. eta vs tors. theta energy: -4.606 Dist. restrs. and SS energy: 3.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -137.367785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.367785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.409738 (E_RNA) where: Base-Base interactions energy: -77.705 where: short stacking energy: -35.289 Base-Backbone interact. energy: 0.124 local terms energy: -59.829079 where: bonds (distance) C4'-P energy: -14.122 bonds (distance) P-C4' energy: -17.812 flat angles C4'-P-C4' energy: -15.911 flat angles P-C4'-P energy: -8.725 tors. eta vs tors. theta energy: -3.258 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -136.345315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.345315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.406984 (E_RNA) where: Base-Base interactions energy: -76.476 where: short stacking energy: -34.665 Base-Backbone interact. energy: 0.168 local terms energy: -60.098366 where: bonds (distance) C4'-P energy: -13.219 bonds (distance) P-C4' energy: -16.179 flat angles C4'-P-C4' energy: -12.057 flat angles P-C4'-P energy: -10.491 tors. eta vs tors. theta energy: -8.151 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -236.071127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.071127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.419879 (E_RNA) where: Base-Base interactions energy: -158.665 where: short stacking energy: -62.788 Base-Backbone interact. energy: -0.217 local terms energy: -78.538190 where: bonds (distance) C4'-P energy: -16.150 bonds (distance) P-C4' energy: -17.067 flat angles C4'-P-C4' energy: -18.525 flat angles P-C4'-P energy: -10.829 tors. eta vs tors. theta energy: -15.968 Dist. restrs. and SS energy: 1.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -227.511711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.511711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.502833 (E_RNA) where: Base-Base interactions energy: -157.124 where: short stacking energy: -62.039 Base-Backbone interact. energy: -0.281 local terms energy: -73.097788 where: bonds (distance) C4'-P energy: -15.928 bonds (distance) P-C4' energy: -15.833 flat angles C4'-P-C4' energy: -15.551 flat angles P-C4'-P energy: -9.774 tors. eta vs tors. theta energy: -16.012 Dist. restrs. and SS energy: 2.991 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -221.107825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.107825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.119241 (E_RNA) where: Base-Base interactions energy: -148.536 where: short stacking energy: -60.790 Base-Backbone interact. energy: -0.324 local terms energy: -72.259297 where: bonds (distance) C4'-P energy: -12.462 bonds (distance) P-C4' energy: -15.325 flat angles C4'-P-C4' energy: -16.239 flat angles P-C4'-P energy: -9.843 tors. eta vs tors. theta energy: -18.391 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -191.589440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.589440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.027212 (E_RNA) where: Base-Base interactions energy: -129.898 where: short stacking energy: -54.792 Base-Backbone interact. energy: 0.087 local terms energy: -63.216401 where: bonds (distance) C4'-P energy: -9.302 bonds (distance) P-C4' energy: -16.922 flat angles C4'-P-C4' energy: -13.716 flat angles P-C4'-P energy: -8.913 tors. eta vs tors. theta energy: -14.363 Dist. restrs. and SS energy: 1.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -174.606164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.606164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.606164 (E_RNA) where: Base-Base interactions energy: -108.622 where: short stacking energy: -50.560 Base-Backbone interact. energy: -0.068 local terms energy: -65.916910 where: bonds (distance) C4'-P energy: -14.638 bonds (distance) P-C4' energy: -12.483 flat angles C4'-P-C4' energy: -15.299 flat angles P-C4'-P energy: -9.585 tors. eta vs tors. theta energy: -13.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -139.482696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.482696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.498410 (E_RNA) where: Base-Base interactions energy: -95.696 where: short stacking energy: -42.998 Base-Backbone interact. energy: -0.516 local terms energy: -43.286942 where: bonds (distance) C4'-P energy: -10.318 bonds (distance) P-C4' energy: -10.445 flat angles C4'-P-C4' energy: -14.254 flat angles P-C4'-P energy: -7.065 tors. eta vs tors. theta energy: -1.204 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -141.707348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.707348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.031380 (E_RNA) where: Base-Base interactions energy: -81.788 where: short stacking energy: -49.253 Base-Backbone interact. energy: 3.103 local terms energy: -63.346793 where: bonds (distance) C4'-P energy: -13.568 bonds (distance) P-C4' energy: -15.526 flat angles C4'-P-C4' energy: -14.724 flat angles P-C4'-P energy: -6.430 tors. eta vs tors. theta energy: -13.099 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -133.114277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.114277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.114277 (E_RNA) where: Base-Base interactions energy: -79.588 where: short stacking energy: -33.468 Base-Backbone interact. energy: 0.230 local terms energy: -53.757099 where: bonds (distance) C4'-P energy: -12.074 bonds (distance) P-C4' energy: -14.318 flat angles C4'-P-C4' energy: -12.914 flat angles P-C4'-P energy: -10.419 tors. eta vs tors. theta energy: -4.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -128.794417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.794417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.796030 (E_RNA) where: Base-Base interactions energy: -80.030 where: short stacking energy: -33.943 Base-Backbone interact. energy: 0.874 local terms energy: -49.639415 where: bonds (distance) C4'-P energy: -12.205 bonds (distance) P-C4' energy: -15.671 flat angles C4'-P-C4' energy: -12.836 flat angles P-C4'-P energy: -7.358 tors. eta vs tors. theta energy: -1.570 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -123.893975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.893975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.913415 (E_RNA) where: Base-Base interactions energy: -65.998 where: short stacking energy: -34.308 Base-Backbone interact. energy: -0.084 local terms energy: -57.831244 where: bonds (distance) C4'-P energy: -14.205 bonds (distance) P-C4' energy: -15.244 flat angles C4'-P-C4' energy: -14.361 flat angles P-C4'-P energy: -9.636 tors. eta vs tors. theta energy: -4.386 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -234.789639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.789639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.858843 (E_RNA) where: Base-Base interactions energy: -165.318 where: short stacking energy: -64.216 Base-Backbone interact. energy: -0.241 local terms energy: -71.299490 where: bonds (distance) C4'-P energy: -14.875 bonds (distance) P-C4' energy: -16.332 flat angles C4'-P-C4' energy: -15.989 flat angles P-C4'-P energy: -8.703 tors. eta vs tors. theta energy: -15.401 Dist. restrs. and SS energy: 2.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -233.713448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.713448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.875150 (E_RNA) where: Base-Base interactions energy: -161.134 where: short stacking energy: -61.080 Base-Backbone interact. energy: -0.126 local terms energy: -73.615390 where: bonds (distance) C4'-P energy: -14.300 bonds (distance) P-C4' energy: -15.469 flat angles C4'-P-C4' energy: -18.868 flat angles P-C4'-P energy: -10.584 tors. eta vs tors. theta energy: -14.394 Dist. restrs. and SS energy: 1.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -208.642443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.642443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.452582 (E_RNA) where: Base-Base interactions energy: -145.440 where: short stacking energy: -57.865 Base-Backbone interact. energy: -0.732 local terms energy: -64.279989 where: bonds (distance) C4'-P energy: -16.234 bonds (distance) P-C4' energy: -13.586 flat angles C4'-P-C4' energy: -15.203 flat angles P-C4'-P energy: -1.928 tors. eta vs tors. theta energy: -17.329 Dist. restrs. and SS energy: 1.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -214.981462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.981462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.316206 (E_RNA) where: Base-Base interactions energy: -143.457 where: short stacking energy: -63.191 Base-Backbone interact. energy: -1.028 local terms energy: -70.831546 where: bonds (distance) C4'-P energy: -16.486 bonds (distance) P-C4' energy: -15.512 flat angles C4'-P-C4' energy: -15.700 flat angles P-C4'-P energy: -8.613 tors. eta vs tors. theta energy: -14.521 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -168.757890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.757890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.766664 (E_RNA) where: Base-Base interactions energy: -109.299 where: short stacking energy: -43.178 Base-Backbone interact. energy: 1.053 local terms energy: -60.520837 where: bonds (distance) C4'-P energy: -11.166 bonds (distance) P-C4' energy: -13.354 flat angles C4'-P-C4' energy: -15.017 flat angles P-C4'-P energy: -5.798 tors. eta vs tors. theta energy: -15.185 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -170.605012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.605012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.624785 (E_RNA) where: Base-Base interactions energy: -103.255 where: short stacking energy: -47.578 Base-Backbone interact. energy: -0.206 local terms energy: -67.164550 where: bonds (distance) C4'-P energy: -17.810 bonds (distance) P-C4' energy: -18.133 flat angles C4'-P-C4' energy: -12.718 flat angles P-C4'-P energy: -9.254 tors. eta vs tors. theta energy: -9.249 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -137.609526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.609526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.503082 (E_RNA) where: Base-Base interactions energy: -79.266 where: short stacking energy: -35.481 Base-Backbone interact. energy: -0.757 local terms energy: -60.479865 where: bonds (distance) C4'-P energy: -14.838 bonds (distance) P-C4' energy: -14.909 flat angles C4'-P-C4' energy: -14.656 flat angles P-C4'-P energy: -7.133 tors. eta vs tors. theta energy: -8.944 Dist. restrs. and SS energy: 2.894 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -135.170917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.170917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.664658 (E_RNA) where: Base-Base interactions energy: -76.813 where: short stacking energy: -35.135 Base-Backbone interact. energy: -0.059 local terms energy: -58.792833 where: bonds (distance) C4'-P energy: -18.432 bonds (distance) P-C4' energy: -15.091 flat angles C4'-P-C4' energy: -8.665 flat angles P-C4'-P energy: -12.930 tors. eta vs tors. theta energy: -3.674 Dist. restrs. and SS energy: 0.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -134.554415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.554415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.566319 (E_RNA) where: Base-Base interactions energy: -76.342 where: short stacking energy: -37.869 Base-Backbone interact. energy: -0.082 local terms energy: -58.142460 where: bonds (distance) C4'-P energy: -11.746 bonds (distance) P-C4' energy: -16.632 flat angles C4'-P-C4' energy: -11.333 flat angles P-C4'-P energy: -12.662 tors. eta vs tors. theta energy: -5.770 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -118.733190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.733190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.755858 (E_RNA) where: Base-Base interactions energy: -72.270 where: short stacking energy: -29.215 Base-Backbone interact. energy: -1.322 local terms energy: -45.164317 where: bonds (distance) C4'-P energy: -10.855 bonds (distance) P-C4' energy: -15.424 flat angles C4'-P-C4' energy: -3.556 flat angles P-C4'-P energy: -6.487 tors. eta vs tors. theta energy: -8.841 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -232.625455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.625455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.699220 (E_RNA) where: Base-Base interactions energy: -154.784 where: short stacking energy: -68.618 Base-Backbone interact. energy: -0.399 local terms energy: -79.516301 where: bonds (distance) C4'-P energy: -18.254 bonds (distance) P-C4' energy: -15.223 flat angles C4'-P-C4' energy: -14.499 flat angles P-C4'-P energy: -12.674 tors. eta vs tors. theta energy: -18.866 Dist. restrs. and SS energy: 2.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -212.593399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.593399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.019058 (E_RNA) where: Base-Base interactions energy: -147.649 where: short stacking energy: -64.957 Base-Backbone interact. energy: -0.596 local terms energy: -66.773932 where: bonds (distance) C4'-P energy: -11.142 bonds (distance) P-C4' energy: -15.613 flat angles C4'-P-C4' energy: -14.918 flat angles P-C4'-P energy: -10.560 tors. eta vs tors. theta energy: -14.541 Dist. restrs. and SS energy: 2.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -229.128700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.128700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.007633 (E_RNA) where: Base-Base interactions energy: -149.332 where: short stacking energy: -63.837 Base-Backbone interact. energy: -0.299 local terms energy: -81.376414 where: bonds (distance) C4'-P energy: -18.484 bonds (distance) P-C4' energy: -16.579 flat angles C4'-P-C4' energy: -17.243 flat angles P-C4'-P energy: -11.173 tors. eta vs tors. theta energy: -17.897 Dist. restrs. and SS energy: 1.879 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -199.174240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.174240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.174240 (E_RNA) where: Base-Base interactions energy: -137.228 where: short stacking energy: -51.344 Base-Backbone interact. energy: -0.412 local terms energy: -61.534201 where: bonds (distance) C4'-P energy: -13.645 bonds (distance) P-C4' energy: -12.455 flat angles C4'-P-C4' energy: -14.340 flat angles P-C4'-P energy: -7.259 tors. eta vs tors. theta energy: -13.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -172.889036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.889036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.010505 (E_RNA) where: Base-Base interactions energy: -102.315 where: short stacking energy: -46.561 Base-Backbone interact. energy: -0.128 local terms energy: -70.566899 where: bonds (distance) C4'-P energy: -15.845 bonds (distance) P-C4' energy: -17.692 flat angles C4'-P-C4' energy: -11.969 flat angles P-C4'-P energy: -11.089 tors. eta vs tors. theta energy: -13.971 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -147.828658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.828658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.562206 (E_RNA) where: Base-Base interactions energy: -93.220 where: short stacking energy: -34.294 Base-Backbone interact. energy: -0.114 local terms energy: -56.227724 where: bonds (distance) C4'-P energy: -16.992 bonds (distance) P-C4' energy: -14.638 flat angles C4'-P-C4' energy: -12.551 flat angles P-C4'-P energy: -9.206 tors. eta vs tors. theta energy: -2.841 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -133.271481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.271481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.501306 (E_RNA) where: Base-Base interactions energy: -78.904 where: short stacking energy: -39.826 Base-Backbone interact. energy: -0.189 local terms energy: -54.407744 where: bonds (distance) C4'-P energy: -12.727 bonds (distance) P-C4' energy: -14.214 flat angles C4'-P-C4' energy: -13.445 flat angles P-C4'-P energy: -5.449 tors. eta vs tors. theta energy: -8.573 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -119.659482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.659482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.659482 (E_RNA) where: Base-Base interactions energy: -61.548 where: short stacking energy: -33.697 Base-Backbone interact. energy: 1.416 local terms energy: -59.526692 where: bonds (distance) C4'-P energy: -17.027 bonds (distance) P-C4' energy: -16.969 flat angles C4'-P-C4' energy: -12.977 flat angles P-C4'-P energy: -10.632 tors. eta vs tors. theta energy: -1.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -126.302752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.302752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.379040 (E_RNA) where: Base-Base interactions energy: -77.600 where: short stacking energy: -40.912 Base-Backbone interact. energy: -0.480 local terms energy: -48.299528 where: bonds (distance) C4'-P energy: -12.826 bonds (distance) P-C4' energy: -11.899 flat angles C4'-P-C4' energy: -14.269 flat angles P-C4'-P energy: -5.825 tors. eta vs tors. theta energy: -3.480 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -126.794061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.794061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.794061 (E_RNA) where: Base-Base interactions energy: -66.790 where: short stacking energy: -34.026 Base-Backbone interact. energy: -0.139 local terms energy: -59.865244 where: bonds (distance) C4'-P energy: -13.853 bonds (distance) P-C4' energy: -11.486 flat angles C4'-P-C4' energy: -14.625 flat angles P-C4'-P energy: -9.623 tors. eta vs tors. theta energy: -10.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -241.267453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.267453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.398214 (E_RNA) where: Base-Base interactions energy: -171.064 where: short stacking energy: -72.975 Base-Backbone interact. energy: -0.153 local terms energy: -72.181648 where: bonds (distance) C4'-P energy: -12.942 bonds (distance) P-C4' energy: -16.443 flat angles C4'-P-C4' energy: -17.049 flat angles P-C4'-P energy: -10.611 tors. eta vs tors. theta energy: -15.136 Dist. restrs. and SS energy: 2.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -218.016084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.016084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.426978 (E_RNA) where: Base-Base interactions energy: -150.954 where: short stacking energy: -62.887 Base-Backbone interact. energy: 0.741 local terms energy: -69.213975 where: bonds (distance) C4'-P energy: -14.098 bonds (distance) P-C4' energy: -18.883 flat angles C4'-P-C4' energy: -11.250 flat angles P-C4'-P energy: -6.512 tors. eta vs tors. theta energy: -18.471 Dist. restrs. and SS energy: 1.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -217.927578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.927578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.546807 (E_RNA) where: Base-Base interactions energy: -149.893 where: short stacking energy: -58.568 Base-Backbone interact. energy: 0.743 local terms energy: -70.396543 where: bonds (distance) C4'-P energy: -12.904 bonds (distance) P-C4' energy: -15.542 flat angles C4'-P-C4' energy: -18.059 flat angles P-C4'-P energy: -7.673 tors. eta vs tors. theta energy: -16.219 Dist. restrs. and SS energy: 1.619 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -214.617921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.617921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.887085 (E_RNA) where: Base-Base interactions energy: -139.995 where: short stacking energy: -61.254 Base-Backbone interact. energy: -0.321 local terms energy: -75.571247 where: bonds (distance) C4'-P energy: -18.254 bonds (distance) P-C4' energy: -15.110 flat angles C4'-P-C4' energy: -15.259 flat angles P-C4'-P energy: -7.191 tors. eta vs tors. theta energy: -19.757 Dist. restrs. and SS energy: 1.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -180.369679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.369679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.088823 (E_RNA) where: Base-Base interactions energy: -110.615 where: short stacking energy: -50.240 Base-Backbone interact. energy: -0.523 local terms energy: -69.950747 where: bonds (distance) C4'-P energy: -17.685 bonds (distance) P-C4' energy: -11.886 flat angles C4'-P-C4' energy: -15.629 flat angles P-C4'-P energy: -15.014 tors. eta vs tors. theta energy: -9.736 Dist. restrs. and SS energy: 0.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -147.334186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.334186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.496443 (E_RNA) where: Base-Base interactions energy: -84.654 where: short stacking energy: -46.154 Base-Backbone interact. energy: -0.049 local terms energy: -62.793938 where: bonds (distance) C4'-P energy: -15.836 bonds (distance) P-C4' energy: -15.346 flat angles C4'-P-C4' energy: -12.694 flat angles P-C4'-P energy: -9.626 tors. eta vs tors. theta energy: -9.291 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -132.405216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.405216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.413735 (E_RNA) where: Base-Base interactions energy: -76.180 where: short stacking energy: -39.973 Base-Backbone interact. energy: -0.020 local terms energy: -56.213758 where: bonds (distance) C4'-P energy: -11.257 bonds (distance) P-C4' energy: -15.116 flat angles C4'-P-C4' energy: -14.243 flat angles P-C4'-P energy: -9.690 tors. eta vs tors. theta energy: -5.908 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -120.279812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.279812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.279812 (E_RNA) where: Base-Base interactions energy: -71.430 where: short stacking energy: -31.174 Base-Backbone interact. energy: -0.712 local terms energy: -48.137645 where: bonds (distance) C4'-P energy: -8.240 bonds (distance) P-C4' energy: -16.064 flat angles C4'-P-C4' energy: -10.903 flat angles P-C4'-P energy: -8.363 tors. eta vs tors. theta energy: -4.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -125.690108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.690108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.798169 (E_RNA) where: Base-Base interactions energy: -75.747 where: short stacking energy: -34.830 Base-Backbone interact. energy: -0.177 local terms energy: -49.874164 where: bonds (distance) C4'-P energy: -15.483 bonds (distance) P-C4' energy: -14.146 flat angles C4'-P-C4' energy: -10.075 flat angles P-C4'-P energy: -6.296 tors. eta vs tors. theta energy: -3.876 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -138.218041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.218041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.116889 (E_RNA) where: Base-Base interactions energy: -87.170 where: short stacking energy: -42.373 Base-Backbone interact. energy: -0.092 local terms energy: -51.855127 where: bonds (distance) C4'-P energy: -9.224 bonds (distance) P-C4' energy: -12.621 flat angles C4'-P-C4' energy: -15.393 flat angles P-C4'-P energy: -8.980 tors. eta vs tors. theta energy: -5.637 Dist. restrs. and SS energy: 0.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -251.755208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.755208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.805423 (E_RNA) where: Base-Base interactions energy: -176.743 where: short stacking energy: -67.833 Base-Backbone interact. energy: -0.419 local terms energy: -76.644197 where: bonds (distance) C4'-P energy: -14.239 bonds (distance) P-C4' energy: -19.557 flat angles C4'-P-C4' energy: -16.965 flat angles P-C4'-P energy: -9.217 tors. eta vs tors. theta energy: -16.667 Dist. restrs. and SS energy: 2.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -224.664519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.664519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.599214 (E_RNA) where: Base-Base interactions energy: -150.786 where: short stacking energy: -55.833 Base-Backbone interact. energy: -0.345 local terms energy: -75.467997 where: bonds (distance) C4'-P energy: -18.920 bonds (distance) P-C4' energy: -16.038 flat angles C4'-P-C4' energy: -17.210 flat angles P-C4'-P energy: -8.335 tors. eta vs tors. theta energy: -14.966 Dist. restrs. and SS energy: 1.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -234.540438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.540438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.747581 (E_RNA) where: Base-Base interactions energy: -165.643 where: short stacking energy: -65.830 Base-Backbone interact. energy: -0.265 local terms energy: -69.839463 where: bonds (distance) C4'-P energy: -18.229 bonds (distance) P-C4' energy: -13.345 flat angles C4'-P-C4' energy: -13.504 flat angles P-C4'-P energy: -7.953 tors. eta vs tors. theta energy: -16.808 Dist. restrs. and SS energy: 1.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -211.731428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.731428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.206800 (E_RNA) where: Base-Base interactions energy: -147.255 where: short stacking energy: -59.267 Base-Backbone interact. energy: -0.162 local terms energy: -65.789791 where: bonds (distance) C4'-P energy: -15.853 bonds (distance) P-C4' energy: -14.023 flat angles C4'-P-C4' energy: -12.415 flat angles P-C4'-P energy: -7.568 tors. eta vs tors. theta energy: -15.930 Dist. restrs. and SS energy: 1.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -176.013292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.013292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.270653 (E_RNA) where: Base-Base interactions energy: -107.989 where: short stacking energy: -52.831 Base-Backbone interact. energy: -0.183 local terms energy: -70.098970 where: bonds (distance) C4'-P energy: -16.603 bonds (distance) P-C4' energy: -14.113 flat angles C4'-P-C4' energy: -15.341 flat angles P-C4'-P energy: -7.798 tors. eta vs tors. theta energy: -16.244 Dist. restrs. and SS energy: 2.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -150.253259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.253259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.678050 (E_RNA) where: Base-Base interactions energy: -82.556 where: short stacking energy: -38.210 Base-Backbone interact. energy: 0.421 local terms energy: -68.542488 where: bonds (distance) C4'-P energy: -18.672 bonds (distance) P-C4' energy: -15.517 flat angles C4'-P-C4' energy: -14.938 flat angles P-C4'-P energy: -10.585 tors. eta vs tors. theta energy: -8.831 Dist. restrs. and SS energy: 0.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -149.788795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.788795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.909388 (E_RNA) where: Base-Base interactions energy: -87.688 where: short stacking energy: -44.818 Base-Backbone interact. energy: -0.083 local terms energy: -62.138435 where: bonds (distance) C4'-P energy: -13.000 bonds (distance) P-C4' energy: -15.999 flat angles C4'-P-C4' energy: -13.569 flat angles P-C4'-P energy: -8.487 tors. eta vs tors. theta energy: -11.084 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -138.044062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.044062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.540984 (E_RNA) where: Base-Base interactions energy: -85.602 where: short stacking energy: -44.806 Base-Backbone interact. energy: -0.197 local terms energy: -52.742014 where: bonds (distance) C4'-P energy: -11.237 bonds (distance) P-C4' energy: -12.373 flat angles C4'-P-C4' energy: -12.261 flat angles P-C4'-P energy: -9.713 tors. eta vs tors. theta energy: -7.158 Dist. restrs. and SS energy: 0.497 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -119.537154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.537154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.770278 (E_RNA) where: Base-Base interactions energy: -59.770 where: short stacking energy: -29.852 Base-Backbone interact. energy: -0.195 local terms energy: -59.804951 where: bonds (distance) C4'-P energy: -11.383 bonds (distance) P-C4' energy: -14.355 flat angles C4'-P-C4' energy: -13.000 flat angles P-C4'-P energy: -12.139 tors. eta vs tors. theta energy: -8.929 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -132.783377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.783377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.783377 (E_RNA) where: Base-Base interactions energy: -83.078 where: short stacking energy: -44.892 Base-Backbone interact. energy: -0.402 local terms energy: -49.303445 where: bonds (distance) C4'-P energy: -15.534 bonds (distance) P-C4' energy: -5.075 flat angles C4'-P-C4' energy: -15.313 flat angles P-C4'-P energy: -7.525 tors. eta vs tors. theta energy: -5.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -240.738035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.738035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.775596 (E_RNA) where: Base-Base interactions energy: -164.461 where: short stacking energy: -64.920 Base-Backbone interact. energy: -0.564 local terms energy: -77.750920 where: bonds (distance) C4'-P energy: -14.664 bonds (distance) P-C4' energy: -16.399 flat angles C4'-P-C4' energy: -16.988 flat angles P-C4'-P energy: -12.643 tors. eta vs tors. theta energy: -17.057 Dist. restrs. and SS energy: 2.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -231.734667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.734667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.085154 (E_RNA) where: Base-Base interactions energy: -161.679 where: short stacking energy: -63.414 Base-Backbone interact. energy: -0.187 local terms energy: -71.218321 where: bonds (distance) C4'-P energy: -12.871 bonds (distance) P-C4' energy: -15.927 flat angles C4'-P-C4' energy: -15.717 flat angles P-C4'-P energy: -11.353 tors. eta vs tors. theta energy: -15.350 Dist. restrs. and SS energy: 1.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -224.581755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.581755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.996589 (E_RNA) where: Base-Base interactions energy: -159.232 where: short stacking energy: -66.512 Base-Backbone interact. energy: -0.177 local terms energy: -66.587957 where: bonds (distance) C4'-P energy: -7.974 bonds (distance) P-C4' energy: -13.799 flat angles C4'-P-C4' energy: -16.642 flat angles P-C4'-P energy: -10.793 tors. eta vs tors. theta energy: -17.380 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -212.234822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.234822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.932266 (E_RNA) where: Base-Base interactions energy: -141.917 where: short stacking energy: -55.967 Base-Backbone interact. energy: -0.379 local terms energy: -71.636828 where: bonds (distance) C4'-P energy: -12.224 bonds (distance) P-C4' energy: -17.026 flat angles C4'-P-C4' energy: -15.576 flat angles P-C4'-P energy: -10.557 tors. eta vs tors. theta energy: -16.254 Dist. restrs. and SS energy: 1.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -166.197464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.197464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.202282 (E_RNA) where: Base-Base interactions energy: -102.315 where: short stacking energy: -48.314 Base-Backbone interact. energy: 0.312 local terms energy: -64.199419 where: bonds (distance) C4'-P energy: -11.799 bonds (distance) P-C4' energy: -13.964 flat angles C4'-P-C4' energy: -16.626 flat angles P-C4'-P energy: -10.568 tors. eta vs tors. theta energy: -11.242 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -154.356979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.356979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.718392 (E_RNA) where: Base-Base interactions energy: -85.829 where: short stacking energy: -50.389 Base-Backbone interact. energy: -1.158 local terms energy: -68.730935 where: bonds (distance) C4'-P energy: -12.351 bonds (distance) P-C4' energy: -18.597 flat angles C4'-P-C4' energy: -15.909 flat angles P-C4'-P energy: -9.701 tors. eta vs tors. theta energy: -12.174 Dist. restrs. and SS energy: 1.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -163.415777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.415777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.415777 (E_RNA) where: Base-Base interactions energy: -96.720 where: short stacking energy: -42.483 Base-Backbone interact. energy: 0.059 local terms energy: -66.754465 where: bonds (distance) C4'-P energy: -15.444 bonds (distance) P-C4' energy: -16.843 flat angles C4'-P-C4' energy: -15.844 flat angles P-C4'-P energy: -7.674 tors. eta vs tors. theta energy: -10.950 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -140.778924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.778924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.778924 (E_RNA) where: Base-Base interactions energy: -82.838 where: short stacking energy: -37.111 Base-Backbone interact. energy: 0.153 local terms energy: -58.093718 where: bonds (distance) C4'-P energy: -13.728 bonds (distance) P-C4' energy: -16.368 flat angles C4'-P-C4' energy: -11.950 flat angles P-C4'-P energy: -11.204 tors. eta vs tors. theta energy: -4.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -128.993426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.993426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.022152 (E_RNA) where: Base-Base interactions energy: -71.313 where: short stacking energy: -35.917 Base-Backbone interact. energy: -0.481 local terms energy: -57.228269 where: bonds (distance) C4'-P energy: -13.475 bonds (distance) P-C4' energy: -11.581 flat angles C4'-P-C4' energy: -15.529 flat angles P-C4'-P energy: -8.331 tors. eta vs tors. theta energy: -8.313 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -141.768621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.768621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.884574 (E_RNA) where: Base-Base interactions energy: -90.348 where: short stacking energy: -35.198 Base-Backbone interact. energy: -0.689 local terms energy: -50.847016 where: bonds (distance) C4'-P energy: -11.729 bonds (distance) P-C4' energy: -13.919 flat angles C4'-P-C4' energy: -11.735 flat angles P-C4'-P energy: -8.882 tors. eta vs tors. theta energy: -4.582 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -234.858746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.858746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.797458 (E_RNA) where: Base-Base interactions energy: -161.798 where: short stacking energy: -64.780 Base-Backbone interact. energy: -0.224 local terms energy: -74.775250 where: bonds (distance) C4'-P energy: -15.348 bonds (distance) P-C4' energy: -13.192 flat angles C4'-P-C4' energy: -18.887 flat angles P-C4'-P energy: -10.860 tors. eta vs tors. theta energy: -16.489 Dist. restrs. and SS energy: 1.939 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -232.642668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.642668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.192757 (E_RNA) where: Base-Base interactions energy: -154.410 where: short stacking energy: -60.371 Base-Backbone interact. energy: -0.247 local terms energy: -79.535511 where: bonds (distance) C4'-P energy: -16.870 bonds (distance) P-C4' energy: -18.186 flat angles C4'-P-C4' energy: -15.423 flat angles P-C4'-P energy: -12.599 tors. eta vs tors. theta energy: -16.457 Dist. restrs. and SS energy: 1.550 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -229.178899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.178899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.555113 (E_RNA) where: Base-Base interactions energy: -158.357 where: short stacking energy: -60.778 Base-Backbone interact. energy: -0.466 local terms energy: -72.732303 where: bonds (distance) C4'-P energy: -14.152 bonds (distance) P-C4' energy: -13.811 flat angles C4'-P-C4' energy: -17.657 flat angles P-C4'-P energy: -10.668 tors. eta vs tors. theta energy: -16.444 Dist. restrs. and SS energy: 2.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -213.002591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.002591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.134785 (E_RNA) where: Base-Base interactions energy: -140.330 where: short stacking energy: -60.677 Base-Backbone interact. energy: -0.177 local terms energy: -73.628535 where: bonds (distance) C4'-P energy: -13.389 bonds (distance) P-C4' energy: -13.638 flat angles C4'-P-C4' energy: -15.502 flat angles P-C4'-P energy: -12.699 tors. eta vs tors. theta energy: -18.401 Dist. restrs. and SS energy: 1.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -162.896490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.896490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.928474 (E_RNA) where: Base-Base interactions energy: -88.847 where: short stacking energy: -43.466 Base-Backbone interact. energy: -0.099 local terms energy: -73.983034 where: bonds (distance) C4'-P energy: -15.215 bonds (distance) P-C4' energy: -17.005 flat angles C4'-P-C4' energy: -15.687 flat angles P-C4'-P energy: -9.602 tors. eta vs tors. theta energy: -16.474 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -154.369254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.369254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.369254 (E_RNA) where: Base-Base interactions energy: -90.965 where: short stacking energy: -41.135 Base-Backbone interact. energy: -0.194 local terms energy: -63.210363 where: bonds (distance) C4'-P energy: -16.461 bonds (distance) P-C4' energy: -16.686 flat angles C4'-P-C4' energy: -15.371 flat angles P-C4'-P energy: -9.558 tors. eta vs tors. theta energy: -5.134 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -156.463695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.463695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.594360 (E_RNA) where: Base-Base interactions energy: -100.422 where: short stacking energy: -35.477 Base-Backbone interact. energy: -0.744 local terms energy: -55.427564 where: bonds (distance) C4'-P energy: -15.178 bonds (distance) P-C4' energy: -12.313 flat angles C4'-P-C4' energy: -15.216 flat angles P-C4'-P energy: -3.449 tors. eta vs tors. theta energy: -9.271 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -132.365537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.365537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.670526 (E_RNA) where: Base-Base interactions energy: -82.727 where: short stacking energy: -50.023 Base-Backbone interact. energy: -0.395 local terms energy: -49.547693 where: bonds (distance) C4'-P energy: -7.767 bonds (distance) P-C4' energy: -8.252 flat angles C4'-P-C4' energy: -17.301 flat angles P-C4'-P energy: -1.895 tors. eta vs tors. theta energy: -14.333 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -147.958757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.958757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.958757 (E_RNA) where: Base-Base interactions energy: -87.656 where: short stacking energy: -33.585 Base-Backbone interact. energy: -0.158 local terms energy: -60.144872 where: bonds (distance) C4'-P energy: -17.364 bonds (distance) P-C4' energy: -15.681 flat angles C4'-P-C4' energy: -12.023 flat angles P-C4'-P energy: -8.405 tors. eta vs tors. theta energy: -6.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -114.069714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.069714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.069714 (E_RNA) where: Base-Base interactions energy: -67.202 where: short stacking energy: -31.755 Base-Backbone interact. energy: 1.425 local terms energy: -48.292567 where: bonds (distance) C4'-P energy: -12.760 bonds (distance) P-C4' energy: -16.921 flat angles C4'-P-C4' energy: -8.536 flat angles P-C4'-P energy: -7.987 tors. eta vs tors. theta energy: -2.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -241.571726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.571726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.885822 (E_RNA) where: Base-Base interactions energy: -168.842 where: short stacking energy: -63.717 Base-Backbone interact. energy: -0.201 local terms energy: -73.842654 where: bonds (distance) C4'-P energy: -16.192 bonds (distance) P-C4' energy: -19.567 flat angles C4'-P-C4' energy: -14.332 flat angles P-C4'-P energy: -6.773 tors. eta vs tors. theta energy: -16.979 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -229.514698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.514698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.054386 (E_RNA) where: Base-Base interactions energy: -165.943 where: short stacking energy: -61.759 Base-Backbone interact. energy: -0.403 local terms energy: -64.707993 where: bonds (distance) C4'-P energy: -14.300 bonds (distance) P-C4' energy: -14.958 flat angles C4'-P-C4' energy: -14.987 flat angles P-C4'-P energy: -7.937 tors. eta vs tors. theta energy: -12.525 Dist. restrs. and SS energy: 1.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -220.096003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.096003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.837630 (E_RNA) where: Base-Base interactions energy: -158.933 where: short stacking energy: -61.302 Base-Backbone interact. energy: 5.606 local terms energy: -68.510210 where: bonds (distance) C4'-P energy: -11.741 bonds (distance) P-C4' energy: -15.902 flat angles C4'-P-C4' energy: -15.369 flat angles P-C4'-P energy: -10.632 tors. eta vs tors. theta energy: -14.866 Dist. restrs. and SS energy: 1.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -216.831403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.831403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.507806 (E_RNA) where: Base-Base interactions energy: -147.050 where: short stacking energy: -52.739 Base-Backbone interact. energy: -0.317 local terms energy: -71.140765 where: bonds (distance) C4'-P energy: -14.938 bonds (distance) P-C4' energy: -18.823 flat angles C4'-P-C4' energy: -13.767 flat angles P-C4'-P energy: -9.979 tors. eta vs tors. theta energy: -13.633 Dist. restrs. and SS energy: 1.676 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -151.808768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.808768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.808768 (E_RNA) where: Base-Base interactions energy: -91.474 where: short stacking energy: -53.692 Base-Backbone interact. energy: 1.757 local terms energy: -62.092350 where: bonds (distance) C4'-P energy: -15.421 bonds (distance) P-C4' energy: -14.478 flat angles C4'-P-C4' energy: -15.798 flat angles P-C4'-P energy: -4.611 tors. eta vs tors. theta energy: -11.784 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -165.363753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.363753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.422601 (E_RNA) where: Base-Base interactions energy: -105.558 where: short stacking energy: -58.515 Base-Backbone interact. energy: -1.099 local terms energy: -58.765891 where: bonds (distance) C4'-P energy: -10.914 bonds (distance) P-C4' energy: -15.580 flat angles C4'-P-C4' energy: -10.479 flat angles P-C4'-P energy: -5.008 tors. eta vs tors. theta energy: -16.786 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -147.510462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.510462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.510462 (E_RNA) where: Base-Base interactions energy: -84.074 where: short stacking energy: -43.507 Base-Backbone interact. energy: -0.037 local terms energy: -63.399494 where: bonds (distance) C4'-P energy: -15.179 bonds (distance) P-C4' energy: -14.927 flat angles C4'-P-C4' energy: -15.562 flat angles P-C4'-P energy: -6.399 tors. eta vs tors. theta energy: -11.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -120.792610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.792610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.792610 (E_RNA) where: Base-Base interactions energy: -69.864 where: short stacking energy: -27.018 Base-Backbone interact. energy: -0.195 local terms energy: -50.733338 where: bonds (distance) C4'-P energy: -11.522 bonds (distance) P-C4' energy: -16.604 flat angles C4'-P-C4' energy: -13.467 flat angles P-C4'-P energy: -6.473 tors. eta vs tors. theta energy: -2.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -155.895110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.895110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.947860 (E_RNA) where: Base-Base interactions energy: -103.568 where: short stacking energy: -49.242 Base-Backbone interact. energy: -0.487 local terms energy: -51.893717 where: bonds (distance) C4'-P energy: -12.645 bonds (distance) P-C4' energy: -14.288 flat angles C4'-P-C4' energy: -8.843 flat angles P-C4'-P energy: -5.339 tors. eta vs tors. theta energy: -10.780 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -119.946876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.946876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.968585 (E_RNA) where: Base-Base interactions energy: -60.404 where: short stacking energy: -29.445 Base-Backbone interact. energy: -0.474 local terms energy: -59.090090 where: bonds (distance) C4'-P energy: -13.712 bonds (distance) P-C4' energy: -16.131 flat angles C4'-P-C4' energy: -12.234 flat angles P-C4'-P energy: -10.962 tors. eta vs tors. theta energy: -6.050 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -240.641850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.641850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.766425 (E_RNA) where: Base-Base interactions energy: -165.275 where: short stacking energy: -71.692 Base-Backbone interact. energy: -0.183 local terms energy: -76.308289 where: bonds (distance) C4'-P energy: -15.869 bonds (distance) P-C4' energy: -15.349 flat angles C4'-P-C4' energy: -14.966 flat angles P-C4'-P energy: -14.330 tors. eta vs tors. theta energy: -15.793 Dist. restrs. and SS energy: 1.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -227.154360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.154360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.394458 (E_RNA) where: Base-Base interactions energy: -153.624 where: short stacking energy: -67.012 Base-Backbone interact. energy: -0.394 local terms energy: -75.377033 where: bonds (distance) C4'-P energy: -15.835 bonds (distance) P-C4' energy: -17.305 flat angles C4'-P-C4' energy: -12.828 flat angles P-C4'-P energy: -13.203 tors. eta vs tors. theta energy: -16.206 Dist. restrs. and SS energy: 2.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -219.044957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.044957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.700049 (E_RNA) where: Base-Base interactions energy: -156.196 where: short stacking energy: -59.320 Base-Backbone interact. energy: -0.264 local terms energy: -64.239973 where: bonds (distance) C4'-P energy: -11.803 bonds (distance) P-C4' energy: -16.840 flat angles C4'-P-C4' energy: -12.381 flat angles P-C4'-P energy: -10.592 tors. eta vs tors. theta energy: -12.624 Dist. restrs. and SS energy: 1.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -164.446544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.446544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.446544 (E_RNA) where: Base-Base interactions energy: -104.165 where: short stacking energy: -47.755 Base-Backbone interact. energy: -0.088 local terms energy: -60.193743 where: bonds (distance) C4'-P energy: -13.529 bonds (distance) P-C4' energy: -11.698 flat angles C4'-P-C4' energy: -17.251 flat angles P-C4'-P energy: -7.922 tors. eta vs tors. theta energy: -9.794 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -202.322576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.322576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.829385 (E_RNA) where: Base-Base interactions energy: -134.772 where: short stacking energy: -53.370 Base-Backbone interact. energy: -0.285 local terms energy: -67.771908 where: bonds (distance) C4'-P energy: -14.706 bonds (distance) P-C4' energy: -15.697 flat angles C4'-P-C4' energy: -14.129 flat angles P-C4'-P energy: -9.516 tors. eta vs tors. theta energy: -13.724 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -155.140603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.140603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.181281 (E_RNA) where: Base-Base interactions energy: -100.704 where: short stacking energy: -48.832 Base-Backbone interact. energy: -0.063 local terms energy: -54.414038 where: bonds (distance) C4'-P energy: -9.565 bonds (distance) P-C4' energy: -12.164 flat angles C4'-P-C4' energy: -15.683 flat angles P-C4'-P energy: -5.117 tors. eta vs tors. theta energy: -11.885 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -141.840156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.840156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.840156 (E_RNA) where: Base-Base interactions energy: -81.188 where: short stacking energy: -28.711 Base-Backbone interact. energy: 3.705 local terms energy: -64.357207 where: bonds (distance) C4'-P energy: -17.794 bonds (distance) P-C4' energy: -15.772 flat angles C4'-P-C4' energy: -10.758 flat angles P-C4'-P energy: -9.413 tors. eta vs tors. theta energy: -10.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -145.828264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.828264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.886444 (E_RNA) where: Base-Base interactions energy: -96.619 where: short stacking energy: -42.230 Base-Backbone interact. energy: -0.148 local terms energy: -49.119021 where: bonds (distance) C4'-P energy: -10.869 bonds (distance) P-C4' energy: -14.750 flat angles C4'-P-C4' energy: -9.277 flat angles P-C4'-P energy: -6.932 tors. eta vs tors. theta energy: -7.291 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -117.899298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.899298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.134037 (E_RNA) where: Base-Base interactions energy: -63.748 where: short stacking energy: -37.268 Base-Backbone interact. energy: 0.674 local terms energy: -55.059525 where: bonds (distance) C4'-P energy: -16.535 bonds (distance) P-C4' energy: -14.603 flat angles C4'-P-C4' energy: -8.196 flat angles P-C4'-P energy: -7.932 tors. eta vs tors. theta energy: -7.795 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -125.572164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.572164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.580096 (E_RNA) where: Base-Base interactions energy: -67.534 where: short stacking energy: -33.865 Base-Backbone interact. energy: -0.399 local terms energy: -57.646971 where: bonds (distance) C4'-P energy: -14.602 bonds (distance) P-C4' energy: -8.482 flat angles C4'-P-C4' energy: -17.345 flat angles P-C4'-P energy: -9.687 tors. eta vs tors. theta energy: -7.531 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -235.799206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.799206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.125136 (E_RNA) where: Base-Base interactions energy: -157.718 where: short stacking energy: -60.531 Base-Backbone interact. energy: -0.144 local terms energy: -79.262877 where: bonds (distance) C4'-P energy: -15.330 bonds (distance) P-C4' energy: -19.058 flat angles C4'-P-C4' energy: -17.205 flat angles P-C4'-P energy: -13.342 tors. eta vs tors. theta energy: -14.328 Dist. restrs. and SS energy: 1.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -233.171012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.171012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.543880 (E_RNA) where: Base-Base interactions energy: -159.437 where: short stacking energy: -64.712 Base-Backbone interact. energy: -0.316 local terms energy: -74.791396 where: bonds (distance) C4'-P energy: -17.861 bonds (distance) P-C4' energy: -14.109 flat angles C4'-P-C4' energy: -15.102 flat angles P-C4'-P energy: -11.568 tors. eta vs tors. theta energy: -16.151 Dist. restrs. and SS energy: 1.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -209.686982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.686982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.686982 (E_RNA) where: Base-Base interactions energy: -139.514 where: short stacking energy: -63.929 Base-Backbone interact. energy: -0.582 local terms energy: -69.590509 where: bonds (distance) C4'-P energy: -12.301 bonds (distance) P-C4' energy: -14.818 flat angles C4'-P-C4' energy: -13.991 flat angles P-C4'-P energy: -12.379 tors. eta vs tors. theta energy: -16.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -152.662656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.662656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.662656 (E_RNA) where: Base-Base interactions energy: -90.769 where: short stacking energy: -49.841 Base-Backbone interact. energy: 0.426 local terms energy: -62.320044 where: bonds (distance) C4'-P energy: -15.902 bonds (distance) P-C4' energy: -16.455 flat angles C4'-P-C4' energy: -15.396 flat angles P-C4'-P energy: -7.909 tors. eta vs tors. theta energy: -6.658 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -199.869181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.869181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.003462 (E_RNA) where: Base-Base interactions energy: -140.328 where: short stacking energy: -55.852 Base-Backbone interact. energy: 4.910 local terms energy: -65.585645 where: bonds (distance) C4'-P energy: -14.818 bonds (distance) P-C4' energy: -15.391 flat angles C4'-P-C4' energy: -13.541 flat angles P-C4'-P energy: -8.600 tors. eta vs tors. theta energy: -13.235 Dist. restrs. and SS energy: 1.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -153.326366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.326366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.499840 (E_RNA) where: Base-Base interactions energy: -93.570 where: short stacking energy: -38.020 Base-Backbone interact. energy: -0.148 local terms energy: -59.782448 where: bonds (distance) C4'-P energy: -12.977 bonds (distance) P-C4' energy: -14.992 flat angles C4'-P-C4' energy: -12.561 flat angles P-C4'-P energy: -9.803 tors. eta vs tors. theta energy: -9.450 Dist. restrs. and SS energy: 0.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -143.633821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.633821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.633821 (E_RNA) where: Base-Base interactions energy: -84.551 where: short stacking energy: -44.647 Base-Backbone interact. energy: -0.737 local terms energy: -58.346321 where: bonds (distance) C4'-P energy: -9.916 bonds (distance) P-C4' energy: -16.110 flat angles C4'-P-C4' energy: -12.489 flat angles P-C4'-P energy: -9.418 tors. eta vs tors. theta energy: -10.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -118.438014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.438014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.317746 (E_RNA) where: Base-Base interactions energy: -68.304 where: short stacking energy: -31.939 Base-Backbone interact. energy: -0.416 local terms energy: -50.597718 where: bonds (distance) C4'-P energy: -13.758 bonds (distance) P-C4' energy: -17.453 flat angles C4'-P-C4' energy: -11.233 flat angles P-C4'-P energy: -8.185 tors. eta vs tors. theta energy: 0.031 Dist. restrs. and SS energy: 0.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -128.942089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.942089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.942089 (E_RNA) where: Base-Base interactions energy: -70.475 where: short stacking energy: -32.553 Base-Backbone interact. energy: -0.142 local terms energy: -58.325543 where: bonds (distance) C4'-P energy: -16.912 bonds (distance) P-C4' energy: -19.109 flat angles C4'-P-C4' energy: -12.967 flat angles P-C4'-P energy: -10.464 tors. eta vs tors. theta energy: 1.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -104.862826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.862826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.875436 (E_RNA) where: Base-Base interactions energy: -49.125 where: short stacking energy: -27.480 Base-Backbone interact. energy: 0.355 local terms energy: -56.105317 where: bonds (distance) C4'-P energy: -14.755 bonds (distance) P-C4' energy: -15.159 flat angles C4'-P-C4' energy: -15.163 flat angles P-C4'-P energy: -7.580 tors. eta vs tors. theta energy: -3.448 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -237.254227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.254227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.677878 (E_RNA) where: Base-Base interactions energy: -161.298 where: short stacking energy: -68.436 Base-Backbone interact. energy: -0.383 local terms energy: -76.996651 where: bonds (distance) C4'-P energy: -15.459 bonds (distance) P-C4' energy: -16.272 flat angles C4'-P-C4' energy: -17.034 flat angles P-C4'-P energy: -10.902 tors. eta vs tors. theta energy: -17.330 Dist. restrs. and SS energy: 1.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -229.804890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.804890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.928165 (E_RNA) where: Base-Base interactions energy: -153.697 where: short stacking energy: -65.398 Base-Backbone interact. energy: -0.432 local terms energy: -77.799186 where: bonds (distance) C4'-P energy: -15.149 bonds (distance) P-C4' energy: -18.196 flat angles C4'-P-C4' energy: -17.609 flat angles P-C4'-P energy: -10.138 tors. eta vs tors. theta energy: -16.707 Dist. restrs. and SS energy: 2.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -216.017369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.017369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.711838 (E_RNA) where: Base-Base interactions energy: -145.352 where: short stacking energy: -58.890 Base-Backbone interact. energy: 1.050 local terms energy: -73.410271 where: bonds (distance) C4'-P energy: -15.704 bonds (distance) P-C4' energy: -15.654 flat angles C4'-P-C4' energy: -15.542 flat angles P-C4'-P energy: -11.777 tors. eta vs tors. theta energy: -14.734 Dist. restrs. and SS energy: 1.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -216.145782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.145782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.599516 (E_RNA) where: Base-Base interactions energy: -150.481 where: short stacking energy: -59.158 Base-Backbone interact. energy: -0.583 local terms energy: -66.535265 where: bonds (distance) C4'-P energy: -15.248 bonds (distance) P-C4' energy: -15.331 flat angles C4'-P-C4' energy: -13.373 flat angles P-C4'-P energy: -7.638 tors. eta vs tors. theta energy: -14.944 Dist. restrs. and SS energy: 1.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -148.566090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.566090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.570075 (E_RNA) where: Base-Base interactions energy: -80.896 where: short stacking energy: -41.497 Base-Backbone interact. energy: -0.173 local terms energy: -67.500919 where: bonds (distance) C4'-P energy: -15.775 bonds (distance) P-C4' energy: -17.431 flat angles C4'-P-C4' energy: -16.806 flat angles P-C4'-P energy: -12.322 tors. eta vs tors. theta energy: -5.168 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -161.503774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.503774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.649320 (E_RNA) where: Base-Base interactions energy: -101.459 where: short stacking energy: -42.734 Base-Backbone interact. energy: -0.134 local terms energy: -60.056105 where: bonds (distance) C4'-P energy: -17.658 bonds (distance) P-C4' energy: -12.189 flat angles C4'-P-C4' energy: -11.908 flat angles P-C4'-P energy: -8.868 tors. eta vs tors. theta energy: -9.433 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -142.429934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.429934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.502321 (E_RNA) where: Base-Base interactions energy: -86.999 where: short stacking energy: -41.969 Base-Backbone interact. energy: -0.061 local terms energy: -55.442229 where: bonds (distance) C4'-P energy: -16.097 bonds (distance) P-C4' energy: -13.110 flat angles C4'-P-C4' energy: -12.546 flat angles P-C4'-P energy: -6.120 tors. eta vs tors. theta energy: -7.569 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -145.959015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.959015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.970799 (E_RNA) where: Base-Base interactions energy: -86.590 where: short stacking energy: -38.460 Base-Backbone interact. energy: -0.120 local terms energy: -59.260758 where: bonds (distance) C4'-P energy: -12.930 bonds (distance) P-C4' energy: -15.611 flat angles C4'-P-C4' energy: -18.193 flat angles P-C4'-P energy: -7.511 tors. eta vs tors. theta energy: -5.017 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -96.907101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.907101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.601090 (E_RNA) where: Base-Base interactions energy: -49.977 where: short stacking energy: -32.965 Base-Backbone interact. energy: -0.198 local terms energy: -47.426125 where: bonds (distance) C4'-P energy: -14.205 bonds (distance) P-C4' energy: -6.623 flat angles C4'-P-C4' energy: -13.588 flat angles P-C4'-P energy: -6.981 tors. eta vs tors. theta energy: -6.029 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -120.720245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.720245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.728133 (E_RNA) where: Base-Base interactions energy: -67.238 where: short stacking energy: -27.788 Base-Backbone interact. energy: -1.149 local terms energy: -52.341890 where: bonds (distance) C4'-P energy: -16.760 bonds (distance) P-C4' energy: -17.496 flat angles C4'-P-C4' energy: -9.274 flat angles P-C4'-P energy: -5.105 tors. eta vs tors. theta energy: -3.707 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -232.797843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.797843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.657840 (E_RNA) where: Base-Base interactions energy: -163.520 where: short stacking energy: -61.162 Base-Backbone interact. energy: -0.104 local terms energy: -71.034522 where: bonds (distance) C4'-P energy: -16.656 bonds (distance) P-C4' energy: -15.687 flat angles C4'-P-C4' energy: -15.692 flat angles P-C4'-P energy: -7.227 tors. eta vs tors. theta energy: -15.772 Dist. restrs. and SS energy: 1.860 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -221.000587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.000587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.315589 (E_RNA) where: Base-Base interactions energy: -150.379 where: short stacking energy: -58.252 Base-Backbone interact. energy: -0.252 local terms energy: -71.684800 where: bonds (distance) C4'-P energy: -12.507 bonds (distance) P-C4' energy: -16.791 flat angles C4'-P-C4' energy: -18.423 flat angles P-C4'-P energy: -11.657 tors. eta vs tors. theta energy: -12.308 Dist. restrs. and SS energy: 1.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -224.168587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.168587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.424870 (E_RNA) where: Base-Base interactions energy: -154.261 where: short stacking energy: -59.777 Base-Backbone interact. energy: -0.239 local terms energy: -71.925099 where: bonds (distance) C4'-P energy: -13.985 bonds (distance) P-C4' energy: -15.067 flat angles C4'-P-C4' energy: -18.154 flat angles P-C4'-P energy: -9.278 tors. eta vs tors. theta energy: -15.441 Dist. restrs. and SS energy: 2.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -222.035862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.035862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.729224 (E_RNA) where: Base-Base interactions energy: -153.038 where: short stacking energy: -65.508 Base-Backbone interact. energy: 2.529 local terms energy: -73.220064 where: bonds (distance) C4'-P energy: -15.033 bonds (distance) P-C4' energy: -17.837 flat angles C4'-P-C4' energy: -14.702 flat angles P-C4'-P energy: -10.908 tors. eta vs tors. theta energy: -14.739 Dist. restrs. and SS energy: 1.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -158.403122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.403122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.418690 (E_RNA) where: Base-Base interactions energy: -99.762 where: short stacking energy: -48.875 Base-Backbone interact. energy: -0.129 local terms energy: -58.527780 where: bonds (distance) C4'-P energy: -17.098 bonds (distance) P-C4' energy: -15.337 flat angles C4'-P-C4' energy: -8.777 flat angles P-C4'-P energy: -9.473 tors. eta vs tors. theta energy: -7.843 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -141.899352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.899352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.915327 (E_RNA) where: Base-Base interactions energy: -87.229 where: short stacking energy: -35.608 Base-Backbone interact. energy: -0.263 local terms energy: -54.422975 where: bonds (distance) C4'-P energy: -11.978 bonds (distance) P-C4' energy: -14.639 flat angles C4'-P-C4' energy: -16.260 flat angles P-C4'-P energy: -7.582 tors. eta vs tors. theta energy: -3.966 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -155.868529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.868529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.868529 (E_RNA) where: Base-Base interactions energy: -91.623 where: short stacking energy: -41.401 Base-Backbone interact. energy: -0.033 local terms energy: -64.212870 where: bonds (distance) C4'-P energy: -13.670 bonds (distance) P-C4' energy: -10.728 flat angles C4'-P-C4' energy: -16.706 flat angles P-C4'-P energy: -11.404 tors. eta vs tors. theta energy: -11.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -141.225943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.225943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.168672 (E_RNA) where: Base-Base interactions energy: -76.766 where: short stacking energy: -39.660 Base-Backbone interact. energy: -0.612 local terms energy: -64.790532 where: bonds (distance) C4'-P energy: -15.216 bonds (distance) P-C4' energy: -16.039 flat angles C4'-P-C4' energy: -16.127 flat angles P-C4'-P energy: -8.040 tors. eta vs tors. theta energy: -9.369 Dist. restrs. and SS energy: 0.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -130.452167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.452167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.452167 (E_RNA) where: Base-Base interactions energy: -81.525 where: short stacking energy: -32.593 Base-Backbone interact. energy: -0.280 local terms energy: -48.647316 where: bonds (distance) C4'-P energy: -9.274 bonds (distance) P-C4' energy: -16.321 flat angles C4'-P-C4' energy: -14.421 flat angles P-C4'-P energy: -8.712 tors. eta vs tors. theta energy: 0.080 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -96.650403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.650403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.547840 (E_RNA) where: Base-Base interactions energy: -48.196 where: short stacking energy: -33.321 Base-Backbone interact. energy: -0.191 local terms energy: -49.161125 where: bonds (distance) C4'-P energy: -8.927 bonds (distance) P-C4' energy: -12.006 flat angles C4'-P-C4' energy: -12.378 flat angles P-C4'-P energy: -7.811 tors. eta vs tors. theta energy: -8.040 Dist. restrs. and SS energy: 0.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -238.821258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.821258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.393692 (E_RNA) where: Base-Base interactions energy: -166.592 where: short stacking energy: -57.236 Base-Backbone interact. energy: 0.902 local terms energy: -74.704285 where: bonds (distance) C4'-P energy: -16.946 bonds (distance) P-C4' energy: -16.230 flat angles C4'-P-C4' energy: -15.672 flat angles P-C4'-P energy: -11.588 tors. eta vs tors. theta energy: -14.269 Dist. restrs. and SS energy: 1.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -232.881760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.881760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.245554 (E_RNA) where: Base-Base interactions energy: -166.675 where: short stacking energy: -68.750 Base-Backbone interact. energy: -0.302 local terms energy: -67.268337 where: bonds (distance) C4'-P energy: -13.396 bonds (distance) P-C4' energy: -16.870 flat angles C4'-P-C4' energy: -9.671 flat angles P-C4'-P energy: -10.633 tors. eta vs tors. theta energy: -16.698 Dist. restrs. and SS energy: 1.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -227.901340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.901340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.068379 (E_RNA) where: Base-Base interactions energy: -161.897 where: short stacking energy: -60.793 Base-Backbone interact. energy: -0.176 local terms energy: -66.995115 where: bonds (distance) C4'-P energy: -13.423 bonds (distance) P-C4' energy: -15.258 flat angles C4'-P-C4' energy: -9.637 flat angles P-C4'-P energy: -10.734 tors. eta vs tors. theta energy: -17.944 Dist. restrs. and SS energy: 1.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -208.256302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.256302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.674461 (E_RNA) where: Base-Base interactions energy: -140.113 where: short stacking energy: -61.086 Base-Backbone interact. energy: -0.711 local terms energy: -68.850372 where: bonds (distance) C4'-P energy: -17.207 bonds (distance) P-C4' energy: -13.321 flat angles C4'-P-C4' energy: -12.923 flat angles P-C4'-P energy: -8.495 tors. eta vs tors. theta energy: -16.906 Dist. restrs. and SS energy: 1.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -153.222892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.222892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.229903 (E_RNA) where: Base-Base interactions energy: -87.665 where: short stacking energy: -43.804 Base-Backbone interact. energy: -0.059 local terms energy: -65.505784 where: bonds (distance) C4'-P energy: -15.427 bonds (distance) P-C4' energy: -18.150 flat angles C4'-P-C4' energy: -14.064 flat angles P-C4'-P energy: -11.544 tors. eta vs tors. theta energy: -6.321 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -166.513752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.513752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.513752 (E_RNA) where: Base-Base interactions energy: -102.135 where: short stacking energy: -52.862 Base-Backbone interact. energy: -0.136 local terms energy: -64.243020 where: bonds (distance) C4'-P energy: -10.247 bonds (distance) P-C4' energy: -14.596 flat angles C4'-P-C4' energy: -17.049 flat angles P-C4'-P energy: -10.791 tors. eta vs tors. theta energy: -11.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -145.953950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.953950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.953950 (E_RNA) where: Base-Base interactions energy: -97.193 where: short stacking energy: -39.968 Base-Backbone interact. energy: -0.277 local terms energy: -48.483423 where: bonds (distance) C4'-P energy: -10.876 bonds (distance) P-C4' energy: -14.968 flat angles C4'-P-C4' energy: -10.800 flat angles P-C4'-P energy: -6.328 tors. eta vs tors. theta energy: -5.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -149.827681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.827681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.839620 (E_RNA) where: Base-Base interactions energy: -92.898 where: short stacking energy: -41.143 Base-Backbone interact. energy: -0.198 local terms energy: -56.742783 where: bonds (distance) C4'-P energy: -9.331 bonds (distance) P-C4' energy: -15.347 flat angles C4'-P-C4' energy: -14.024 flat angles P-C4'-P energy: -6.036 tors. eta vs tors. theta energy: -12.005 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -139.033296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.033296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.296626 (E_RNA) where: Base-Base interactions energy: -75.969 where: short stacking energy: -35.648 Base-Backbone interact. energy: -0.003 local terms energy: -64.324904 where: bonds (distance) C4'-P energy: -16.275 bonds (distance) P-C4' energy: -14.695 flat angles C4'-P-C4' energy: -16.810 flat angles P-C4'-P energy: -6.684 tors. eta vs tors. theta energy: -9.861 Dist. restrs. and SS energy: 1.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -89.477725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.477725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.246855 (E_RNA) where: Base-Base interactions energy: -43.070 where: short stacking energy: -17.417 Base-Backbone interact. energy: -0.251 local terms energy: -46.925734 where: bonds (distance) C4'-P energy: -13.614 bonds (distance) P-C4' energy: -14.226 flat angles C4'-P-C4' energy: -13.946 flat angles P-C4'-P energy: -9.649 tors. eta vs tors. theta energy: 4.508 Dist. restrs. and SS energy: 0.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -237.784743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.784743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.268205 (E_RNA) where: Base-Base interactions energy: -164.486 where: short stacking energy: -60.557 Base-Backbone interact. energy: -0.762 local terms energy: -73.020647 where: bonds (distance) C4'-P energy: -15.956 bonds (distance) P-C4' energy: -15.321 flat angles C4'-P-C4' energy: -14.462 flat angles P-C4'-P energy: -11.612 tors. eta vs tors. theta energy: -15.669 Dist. restrs. and SS energy: 0.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -236.426196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.426196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.710280 (E_RNA) where: Base-Base interactions energy: -165.178 where: short stacking energy: -68.153 Base-Backbone interact. energy: -0.267 local terms energy: -72.266083 where: bonds (distance) C4'-P energy: -13.509 bonds (distance) P-C4' energy: -14.587 flat angles C4'-P-C4' energy: -17.461 flat angles P-C4'-P energy: -10.821 tors. eta vs tors. theta energy: -15.889 Dist. restrs. and SS energy: 1.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -222.921253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.921253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.237011 (E_RNA) where: Base-Base interactions energy: -156.673 where: short stacking energy: -61.383 Base-Backbone interact. energy: -0.446 local terms energy: -67.118192 where: bonds (distance) C4'-P energy: -14.632 bonds (distance) P-C4' energy: -13.806 flat angles C4'-P-C4' energy: -17.376 flat angles P-C4'-P energy: -9.317 tors. eta vs tors. theta energy: -11.987 Dist. restrs. and SS energy: 1.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -213.869342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.869342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.911809 (E_RNA) where: Base-Base interactions energy: -146.284 where: short stacking energy: -63.105 Base-Backbone interact. energy: 0.207 local terms energy: -69.835411 where: bonds (distance) C4'-P energy: -16.768 bonds (distance) P-C4' energy: -12.359 flat angles C4'-P-C4' energy: -16.141 flat angles P-C4'-P energy: -9.995 tors. eta vs tors. theta energy: -14.573 Dist. restrs. and SS energy: 2.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -187.755333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.755333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.767171 (E_RNA) where: Base-Base interactions energy: -114.885 where: short stacking energy: -51.628 Base-Backbone interact. energy: -0.248 local terms energy: -72.633851 where: bonds (distance) C4'-P energy: -17.153 bonds (distance) P-C4' energy: -16.143 flat angles C4'-P-C4' energy: -14.507 flat angles P-C4'-P energy: -8.810 tors. eta vs tors. theta energy: -16.022 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -179.360754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.360754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.284836 (E_RNA) where: Base-Base interactions energy: -107.189 where: short stacking energy: -62.381 Base-Backbone interact. energy: -0.000 local terms energy: -73.095149 where: bonds (distance) C4'-P energy: -12.467 bonds (distance) P-C4' energy: -11.584 flat angles C4'-P-C4' energy: -17.147 flat angles P-C4'-P energy: -10.918 tors. eta vs tors. theta energy: -20.980 Dist. restrs. and SS energy: 0.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -132.883990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.883990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.883990 (E_RNA) where: Base-Base interactions energy: -79.699 where: short stacking energy: -33.596 Base-Backbone interact. energy: -0.606 local terms energy: -52.579011 where: bonds (distance) C4'-P energy: -14.008 bonds (distance) P-C4' energy: -14.825 flat angles C4'-P-C4' energy: -11.715 flat angles P-C4'-P energy: -7.079 tors. eta vs tors. theta energy: -4.952 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -157.469180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.469180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.537140 (E_RNA) where: Base-Base interactions energy: -99.048 where: short stacking energy: -40.393 Base-Backbone interact. energy: -0.385 local terms energy: -58.103279 where: bonds (distance) C4'-P energy: -10.252 bonds (distance) P-C4' energy: -16.913 flat angles C4'-P-C4' energy: -15.914 flat angles P-C4'-P energy: -10.952 tors. eta vs tors. theta energy: -4.072 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -132.980225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.980225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.783483 (E_RNA) where: Base-Base interactions energy: -85.163 where: short stacking energy: -43.724 Base-Backbone interact. energy: -0.096 local terms energy: -48.525032 where: bonds (distance) C4'-P energy: -11.542 bonds (distance) P-C4' energy: -9.707 flat angles C4'-P-C4' energy: -11.066 flat angles P-C4'-P energy: -9.739 tors. eta vs tors. theta energy: -6.471 Dist. restrs. and SS energy: 0.803 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -107.503578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.503578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.536349 (E_RNA) where: Base-Base interactions energy: -56.849 where: short stacking energy: -21.851 Base-Backbone interact. energy: -0.622 local terms energy: -50.064827 where: bonds (distance) C4'-P energy: -15.641 bonds (distance) P-C4' energy: -18.190 flat angles C4'-P-C4' energy: -5.947 flat angles P-C4'-P energy: -8.488 tors. eta vs tors. theta energy: -1.800 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -227.471504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.471504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.333872 (E_RNA) where: Base-Base interactions energy: -157.325 where: short stacking energy: -65.527 Base-Backbone interact. energy: -0.199 local terms energy: -70.810100 where: bonds (distance) C4'-P energy: -13.998 bonds (distance) P-C4' energy: -15.582 flat angles C4'-P-C4' energy: -11.750 flat angles P-C4'-P energy: -10.950 tors. eta vs tors. theta energy: -18.529 Dist. restrs. and SS energy: 0.862 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -227.013894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.013894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.701161 (E_RNA) where: Base-Base interactions energy: -156.668 where: short stacking energy: -68.135 Base-Backbone interact. energy: -0.371 local terms energy: -71.661801 where: bonds (distance) C4'-P energy: -15.226 bonds (distance) P-C4' energy: -13.533 flat angles C4'-P-C4' energy: -15.748 flat angles P-C4'-P energy: -11.773 tors. eta vs tors. theta energy: -15.381 Dist. restrs. and SS energy: 1.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -214.759776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.759776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.337084 (E_RNA) where: Base-Base interactions energy: -139.039 where: short stacking energy: -55.015 Base-Backbone interact. energy: -0.291 local terms energy: -77.007594 where: bonds (distance) C4'-P energy: -18.147 bonds (distance) P-C4' energy: -17.340 flat angles C4'-P-C4' energy: -17.427 flat angles P-C4'-P energy: -9.889 tors. eta vs tors. theta energy: -14.205 Dist. restrs. and SS energy: 1.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -194.624445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.624445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.624928 (E_RNA) where: Base-Base interactions energy: -128.773 where: short stacking energy: -52.888 Base-Backbone interact. energy: -0.085 local terms energy: -65.766710 where: bonds (distance) C4'-P energy: -16.005 bonds (distance) P-C4' energy: -13.231 flat angles C4'-P-C4' energy: -13.088 flat angles P-C4'-P energy: -10.135 tors. eta vs tors. theta energy: -13.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -190.322437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.322437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.458678 (E_RNA) where: Base-Base interactions energy: -129.540 where: short stacking energy: -50.086 Base-Backbone interact. energy: -0.126 local terms energy: -62.792926 where: bonds (distance) C4'-P energy: -15.368 bonds (distance) P-C4' energy: -11.327 flat angles C4'-P-C4' energy: -14.278 flat angles P-C4'-P energy: -10.446 tors. eta vs tors. theta energy: -11.374 Dist. restrs. and SS energy: 2.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -152.107760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.107760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.636168 (E_RNA) where: Base-Base interactions energy: -93.173 where: short stacking energy: -54.110 Base-Backbone interact. energy: -0.004 local terms energy: -59.459286 where: bonds (distance) C4'-P energy: -12.205 bonds (distance) P-C4' energy: -13.713 flat angles C4'-P-C4' energy: -13.627 flat angles P-C4'-P energy: -7.465 tors. eta vs tors. theta energy: -12.449 Dist. restrs. and SS energy: 0.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -130.369686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.369686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.369686 (E_RNA) where: Base-Base interactions energy: -80.789 where: short stacking energy: -31.192 Base-Backbone interact. energy: -0.150 local terms energy: -49.430926 where: bonds (distance) C4'-P energy: -15.244 bonds (distance) P-C4' energy: -8.803 flat angles C4'-P-C4' energy: -13.463 flat angles P-C4'-P energy: -6.907 tors. eta vs tors. theta energy: -5.014 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -151.828203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.828203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.303497 (E_RNA) where: Base-Base interactions energy: -89.681 where: short stacking energy: -42.742 Base-Backbone interact. energy: -0.113 local terms energy: -62.509199 where: bonds (distance) C4'-P energy: -10.029 bonds (distance) P-C4' energy: -16.153 flat angles C4'-P-C4' energy: -14.462 flat angles P-C4'-P energy: -12.038 tors. eta vs tors. theta energy: -9.828 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -131.024925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.024925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.171036 (E_RNA) where: Base-Base interactions energy: -79.953 where: short stacking energy: -34.763 Base-Backbone interact. energy: -0.214 local terms energy: -51.004177 where: bonds (distance) C4'-P energy: -9.485 bonds (distance) P-C4' energy: -14.483 flat angles C4'-P-C4' energy: -13.438 flat angles P-C4'-P energy: -7.560 tors. eta vs tors. theta energy: -6.038 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -124.050107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.050107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.050107 (E_RNA) where: Base-Base interactions energy: -65.611 where: short stacking energy: -30.491 Base-Backbone interact. energy: -0.161 local terms energy: -58.278136 where: bonds (distance) C4'-P energy: -15.654 bonds (distance) P-C4' energy: -18.238 flat angles C4'-P-C4' energy: -9.714 flat angles P-C4'-P energy: -10.085 tors. eta vs tors. theta energy: -4.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -232.721256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.721256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.064461 (E_RNA) where: Base-Base interactions energy: -163.691 where: short stacking energy: -59.743 Base-Backbone interact. energy: 1.011 local terms energy: -72.384848 where: bonds (distance) C4'-P energy: -16.560 bonds (distance) P-C4' energy: -12.517 flat angles C4'-P-C4' energy: -16.573 flat angles P-C4'-P energy: -9.612 tors. eta vs tors. theta energy: -17.122 Dist. restrs. and SS energy: 2.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -227.173602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.173602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.571104 (E_RNA) where: Base-Base interactions energy: -156.998 where: short stacking energy: -67.127 Base-Backbone interact. energy: 0.147 local terms energy: -71.719441 where: bonds (distance) C4'-P energy: -14.515 bonds (distance) P-C4' energy: -16.424 flat angles C4'-P-C4' energy: -16.871 flat angles P-C4'-P energy: -11.198 tors. eta vs tors. theta energy: -12.712 Dist. restrs. and SS energy: 1.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -224.767618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.767618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.824388 (E_RNA) where: Base-Base interactions energy: -157.806 where: short stacking energy: -56.020 Base-Backbone interact. energy: 0.477 local terms energy: -68.495427 where: bonds (distance) C4'-P energy: -9.780 bonds (distance) P-C4' energy: -17.731 flat angles C4'-P-C4' energy: -19.460 flat angles P-C4'-P energy: -7.871 tors. eta vs tors. theta energy: -13.654 Dist. restrs. and SS energy: 1.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -183.222282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.222282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.289866 (E_RNA) where: Base-Base interactions energy: -114.682 where: short stacking energy: -42.187 Base-Backbone interact. energy: -0.114 local terms energy: -68.494043 where: bonds (distance) C4'-P energy: -11.638 bonds (distance) P-C4' energy: -16.420 flat angles C4'-P-C4' energy: -16.137 flat angles P-C4'-P energy: -13.895 tors. eta vs tors. theta energy: -10.404 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -153.956190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.956190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.956190 (E_RNA) where: Base-Base interactions energy: -94.929 where: short stacking energy: -43.739 Base-Backbone interact. energy: -0.002 local terms energy: -59.024309 where: bonds (distance) C4'-P energy: -12.002 bonds (distance) P-C4' energy: -17.989 flat angles C4'-P-C4' energy: -16.924 flat angles P-C4'-P energy: -3.837 tors. eta vs tors. theta energy: -8.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -164.818187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.818187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.068537 (E_RNA) where: Base-Base interactions energy: -99.130 where: short stacking energy: -45.130 Base-Backbone interact. energy: -0.491 local terms energy: -65.447382 where: bonds (distance) C4'-P energy: -14.027 bonds (distance) P-C4' energy: -16.892 flat angles C4'-P-C4' energy: -14.160 flat angles P-C4'-P energy: -5.728 tors. eta vs tors. theta energy: -14.639 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -126.735249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.735249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.735249 (E_RNA) where: Base-Base interactions energy: -73.356 where: short stacking energy: -39.831 Base-Backbone interact. energy: 1.424 local terms energy: -54.803552 where: bonds (distance) C4'-P energy: -12.586 bonds (distance) P-C4' energy: -17.064 flat angles C4'-P-C4' energy: -14.445 flat angles P-C4'-P energy: -5.951 tors. eta vs tors. theta energy: -4.757 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -132.947156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.947156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.958580 (E_RNA) where: Base-Base interactions energy: -77.563 where: short stacking energy: -29.543 Base-Backbone interact. energy: -0.165 local terms energy: -55.230299 where: bonds (distance) C4'-P energy: -18.316 bonds (distance) P-C4' energy: -13.224 flat angles C4'-P-C4' energy: -12.273 flat angles P-C4'-P energy: -3.318 tors. eta vs tors. theta energy: -8.098 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -140.844494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.844494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.849615 (E_RNA) where: Base-Base interactions energy: -85.690 where: short stacking energy: -46.887 Base-Backbone interact. energy: 1.338 local terms energy: -56.497352 where: bonds (distance) C4'-P energy: -9.601 bonds (distance) P-C4' energy: -15.127 flat angles C4'-P-C4' energy: -12.377 flat angles P-C4'-P energy: -7.326 tors. eta vs tors. theta energy: -12.066 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -143.405417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.405417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.198197 (E_RNA) where: Base-Base interactions energy: -94.556 where: short stacking energy: -34.985 Base-Backbone interact. energy: -1.009 local terms energy: -48.633544 where: bonds (distance) C4'-P energy: -11.618 bonds (distance) P-C4' energy: -7.736 flat angles C4'-P-C4' energy: -14.749 flat angles P-C4'-P energy: -2.627 tors. eta vs tors. theta energy: -11.903 Dist. restrs. and SS energy: 0.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -236.676564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.676564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.078807 (E_RNA) where: Base-Base interactions energy: -161.537 where: short stacking energy: -67.123 Base-Backbone interact. energy: -0.737 local terms energy: -75.805714 where: bonds (distance) C4'-P energy: -16.010 bonds (distance) P-C4' energy: -17.545 flat angles C4'-P-C4' energy: -15.128 flat angles P-C4'-P energy: -7.845 tors. eta vs tors. theta energy: -19.278 Dist. restrs. and SS energy: 1.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -236.564458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.564458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.817024 (E_RNA) where: Base-Base interactions energy: -171.888 where: short stacking energy: -66.711 Base-Backbone interact. energy: 1.278 local terms energy: -67.206979 where: bonds (distance) C4'-P energy: -17.004 bonds (distance) P-C4' energy: -15.711 flat angles C4'-P-C4' energy: -14.112 flat angles P-C4'-P energy: -5.375 tors. eta vs tors. theta energy: -15.005 Dist. restrs. and SS energy: 1.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -221.570481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.570481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.151886 (E_RNA) where: Base-Base interactions energy: -145.534 where: short stacking energy: -59.859 Base-Backbone interact. energy: -0.134 local terms energy: -77.483926 where: bonds (distance) C4'-P energy: -14.446 bonds (distance) P-C4' energy: -15.093 flat angles C4'-P-C4' energy: -18.215 flat angles P-C4'-P energy: -13.543 tors. eta vs tors. theta energy: -16.187 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -194.557623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.557623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.573850 (E_RNA) where: Base-Base interactions energy: -128.882 where: short stacking energy: -58.349 Base-Backbone interact. energy: 0.164 local terms energy: -65.855788 where: bonds (distance) C4'-P energy: -14.445 bonds (distance) P-C4' energy: -16.787 flat angles C4'-P-C4' energy: -12.256 flat angles P-C4'-P energy: -9.625 tors. eta vs tors. theta energy: -12.743 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -153.464584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.464584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.464584 (E_RNA) where: Base-Base interactions energy: -92.673 where: short stacking energy: -40.152 Base-Backbone interact. energy: -0.202 local terms energy: -60.589314 where: bonds (distance) C4'-P energy: -14.959 bonds (distance) P-C4' energy: -16.171 flat angles C4'-P-C4' energy: -16.532 flat angles P-C4'-P energy: -6.443 tors. eta vs tors. theta energy: -6.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -144.673764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.673764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.711520 (E_RNA) where: Base-Base interactions energy: -84.246 where: short stacking energy: -45.231 Base-Backbone interact. energy: 0.223 local terms energy: -61.688286 where: bonds (distance) C4'-P energy: -10.400 bonds (distance) P-C4' energy: -15.853 flat angles C4'-P-C4' energy: -15.052 flat angles P-C4'-P energy: -10.097 tors. eta vs tors. theta energy: -10.286 Dist. restrs. and SS energy: 1.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -158.369204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.369204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.369204 (E_RNA) where: Base-Base interactions energy: -97.210 where: short stacking energy: -41.109 Base-Backbone interact. energy: -0.417 local terms energy: -60.742193 where: bonds (distance) C4'-P energy: -11.997 bonds (distance) P-C4' energy: -17.607 flat angles C4'-P-C4' energy: -14.937 flat angles P-C4'-P energy: -7.247 tors. eta vs tors. theta energy: -8.954 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -140.402945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.402945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.586076 (E_RNA) where: Base-Base interactions energy: -80.700 where: short stacking energy: -41.812 Base-Backbone interact. energy: 0.842 local terms energy: -60.728319 where: bonds (distance) C4'-P energy: -10.866 bonds (distance) P-C4' energy: -15.895 flat angles C4'-P-C4' energy: -14.067 flat angles P-C4'-P energy: -12.262 tors. eta vs tors. theta energy: -7.637 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -117.455935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.455935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.455935 (E_RNA) where: Base-Base interactions energy: -65.483 where: short stacking energy: -28.559 Base-Backbone interact. energy: -0.469 local terms energy: -51.503697 where: bonds (distance) C4'-P energy: -18.217 bonds (distance) P-C4' energy: -15.208 flat angles C4'-P-C4' energy: -10.751 flat angles P-C4'-P energy: 0.390 tors. eta vs tors. theta energy: -7.717 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -120.132944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.132944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.165630 (E_RNA) where: Base-Base interactions energy: -71.042 where: short stacking energy: -38.887 Base-Backbone interact. energy: -0.434 local terms energy: -48.689937 where: bonds (distance) C4'-P energy: -14.589 bonds (distance) P-C4' energy: -3.149 flat angles C4'-P-C4' energy: -15.643 flat angles P-C4'-P energy: -2.151 tors. eta vs tors. theta energy: -13.158 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -230.908740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.908740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.171272 (E_RNA) where: Base-Base interactions energy: -165.747 where: short stacking energy: -68.363 Base-Backbone interact. energy: -0.544 local terms energy: -66.880251 where: bonds (distance) C4'-P energy: -12.394 bonds (distance) P-C4' energy: -15.970 flat angles C4'-P-C4' energy: -18.020 flat angles P-C4'-P energy: -4.040 tors. eta vs tors. theta energy: -16.456 Dist. restrs. and SS energy: 2.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -233.241291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.241291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.971264 (E_RNA) where: Base-Base interactions energy: -162.414 where: short stacking energy: -66.303 Base-Backbone interact. energy: -0.855 local terms energy: -71.702162 where: bonds (distance) C4'-P energy: -13.899 bonds (distance) P-C4' energy: -16.836 flat angles C4'-P-C4' energy: -13.558 flat angles P-C4'-P energy: -9.919 tors. eta vs tors. theta energy: -17.490 Dist. restrs. and SS energy: 1.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -202.151751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.151751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.231891 (E_RNA) where: Base-Base interactions energy: -136.453 where: short stacking energy: -59.376 Base-Backbone interact. energy: 2.066 local terms energy: -67.845283 where: bonds (distance) C4'-P energy: -13.807 bonds (distance) P-C4' energy: -15.773 flat angles C4'-P-C4' energy: -11.550 flat angles P-C4'-P energy: -10.400 tors. eta vs tors. theta energy: -16.315 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -223.358899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.358899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.819913 (E_RNA) where: Base-Base interactions energy: -149.343 where: short stacking energy: -62.964 Base-Backbone interact. energy: 1.058 local terms energy: -77.534452 where: bonds (distance) C4'-P energy: -17.835 bonds (distance) P-C4' energy: -17.942 flat angles C4'-P-C4' energy: -16.421 flat angles P-C4'-P energy: -9.089 tors. eta vs tors. theta energy: -16.247 Dist. restrs. and SS energy: 2.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -155.140424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.140424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.146809 (E_RNA) where: Base-Base interactions energy: -89.511 where: short stacking energy: -46.778 Base-Backbone interact. energy: -0.822 local terms energy: -64.813338 where: bonds (distance) C4'-P energy: -13.095 bonds (distance) P-C4' energy: -17.688 flat angles C4'-P-C4' energy: -13.754 flat angles P-C4'-P energy: -10.818 tors. eta vs tors. theta energy: -9.458 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -151.792621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.792621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.792621 (E_RNA) where: Base-Base interactions energy: -80.162 where: short stacking energy: -44.593 Base-Backbone interact. energy: -0.071 local terms energy: -71.559717 where: bonds (distance) C4'-P energy: -16.486 bonds (distance) P-C4' energy: -17.646 flat angles C4'-P-C4' energy: -13.337 flat angles P-C4'-P energy: -10.907 tors. eta vs tors. theta energy: -13.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -157.343204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.343204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.371213 (E_RNA) where: Base-Base interactions energy: -90.642 where: short stacking energy: -44.924 Base-Backbone interact. energy: -0.031 local terms energy: -66.698831 where: bonds (distance) C4'-P energy: -13.195 bonds (distance) P-C4' energy: -12.988 flat angles C4'-P-C4' energy: -16.754 flat angles P-C4'-P energy: -10.290 tors. eta vs tors. theta energy: -13.472 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -141.384882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.384882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.409878 (E_RNA) where: Base-Base interactions energy: -87.351 where: short stacking energy: -38.047 Base-Backbone interact. energy: -0.238 local terms energy: -53.820864 where: bonds (distance) C4'-P energy: -11.129 bonds (distance) P-C4' energy: -10.692 flat angles C4'-P-C4' energy: -12.790 flat angles P-C4'-P energy: -11.432 tors. eta vs tors. theta energy: -7.777 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -105.379165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.379165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.423934 (E_RNA) where: Base-Base interactions energy: -56.435 where: short stacking energy: -27.484 Base-Backbone interact. energy: -0.221 local terms energy: -48.767684 where: bonds (distance) C4'-P energy: -11.535 bonds (distance) P-C4' energy: -13.163 flat angles C4'-P-C4' energy: -14.019 flat angles P-C4'-P energy: -9.463 tors. eta vs tors. theta energy: -0.587 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -116.068321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.068321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.528496 (E_RNA) where: Base-Base interactions energy: -66.743 where: short stacking energy: -25.974 Base-Backbone interact. energy: -0.519 local terms energy: -49.265573 where: bonds (distance) C4'-P energy: -10.876 bonds (distance) P-C4' energy: -17.910 flat angles C4'-P-C4' energy: -11.912 flat angles P-C4'-P energy: -8.012 tors. eta vs tors. theta energy: -0.556 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -228.418265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.418265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.828669 (E_RNA) where: Base-Base interactions energy: -153.996 where: short stacking energy: -65.799 Base-Backbone interact. energy: -0.026 local terms energy: -75.806770 where: bonds (distance) C4'-P energy: -16.498 bonds (distance) P-C4' energy: -15.053 flat angles C4'-P-C4' energy: -18.556 flat angles P-C4'-P energy: -7.789 tors. eta vs tors. theta energy: -17.910 Dist. restrs. and SS energy: 1.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -220.158081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.158081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.862921 (E_RNA) where: Base-Base interactions energy: -154.174 where: short stacking energy: -61.817 Base-Backbone interact. energy: -0.037 local terms energy: -67.651426 where: bonds (distance) C4'-P energy: -13.461 bonds (distance) P-C4' energy: -16.907 flat angles C4'-P-C4' energy: -12.298 flat angles P-C4'-P energy: -9.784 tors. eta vs tors. theta energy: -15.201 Dist. restrs. and SS energy: 1.705 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -199.546056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.546056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.552818 (E_RNA) where: Base-Base interactions energy: -133.390 where: short stacking energy: -55.359 Base-Backbone interact. energy: -0.198 local terms energy: -65.965021 where: bonds (distance) C4'-P energy: -16.432 bonds (distance) P-C4' energy: -16.328 flat angles C4'-P-C4' energy: -10.781 flat angles P-C4'-P energy: -9.963 tors. eta vs tors. theta energy: -12.461 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -220.630393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.630393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.961088 (E_RNA) where: Base-Base interactions energy: -147.631 where: short stacking energy: -57.562 Base-Backbone interact. energy: -0.312 local terms energy: -74.018815 where: bonds (distance) C4'-P energy: -17.355 bonds (distance) P-C4' energy: -17.793 flat angles C4'-P-C4' energy: -14.126 flat angles P-C4'-P energy: -9.297 tors. eta vs tors. theta energy: -15.448 Dist. restrs. and SS energy: 1.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -153.941213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.941213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.995390 (E_RNA) where: Base-Base interactions energy: -91.616 where: short stacking energy: -39.490 Base-Backbone interact. energy: -0.737 local terms energy: -61.641566 where: bonds (distance) C4'-P energy: -15.102 bonds (distance) P-C4' energy: -13.776 flat angles C4'-P-C4' energy: -14.701 flat angles P-C4'-P energy: -11.481 tors. eta vs tors. theta energy: -6.583 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -157.289585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.289585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.477482 (E_RNA) where: Base-Base interactions energy: -88.524 where: short stacking energy: -46.594 Base-Backbone interact. energy: -0.201 local terms energy: -68.753239 where: bonds (distance) C4'-P energy: -12.454 bonds (distance) P-C4' energy: -16.106 flat angles C4'-P-C4' energy: -15.417 flat angles P-C4'-P energy: -11.447 tors. eta vs tors. theta energy: -13.329 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -146.349230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.349230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.355004 (E_RNA) where: Base-Base interactions energy: -81.323 where: short stacking energy: -45.166 Base-Backbone interact. energy: -0.096 local terms energy: -64.936616 where: bonds (distance) C4'-P energy: -11.149 bonds (distance) P-C4' energy: -18.806 flat angles C4'-P-C4' energy: -14.888 flat angles P-C4'-P energy: -6.365 tors. eta vs tors. theta energy: -13.729 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -124.647409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.647409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.647409 (E_RNA) where: Base-Base interactions energy: -71.264 where: short stacking energy: -39.088 Base-Backbone interact. energy: -0.033 local terms energy: -53.350837 where: bonds (distance) C4'-P energy: -13.945 bonds (distance) P-C4' energy: -13.564 flat angles C4'-P-C4' energy: -8.647 flat angles P-C4'-P energy: -9.898 tors. eta vs tors. theta energy: -7.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -140.880986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.880986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.410290 (E_RNA) where: Base-Base interactions energy: -84.748 where: short stacking energy: -39.006 Base-Backbone interact. energy: -0.270 local terms energy: -57.392174 where: bonds (distance) C4'-P energy: -14.540 bonds (distance) P-C4' energy: -15.455 flat angles C4'-P-C4' energy: -13.250 flat angles P-C4'-P energy: -6.143 tors. eta vs tors. theta energy: -8.004 Dist. restrs. and SS energy: 1.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -120.472680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.472680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.488594 (E_RNA) where: Base-Base interactions energy: -70.260 where: short stacking energy: -31.626 Base-Backbone interact. energy: 0.664 local terms energy: -50.892900 where: bonds (distance) C4'-P energy: -9.430 bonds (distance) P-C4' energy: -15.208 flat angles C4'-P-C4' energy: -11.005 flat angles P-C4'-P energy: -7.374 tors. eta vs tors. theta energy: -7.876 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -230.184703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.184703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.379511 (E_RNA) where: Base-Base interactions energy: -156.562 where: short stacking energy: -64.187 Base-Backbone interact. energy: 0.220 local terms energy: -75.037439 where: bonds (distance) C4'-P energy: -13.770 bonds (distance) P-C4' energy: -17.699 flat angles C4'-P-C4' energy: -15.642 flat angles P-C4'-P energy: -10.368 tors. eta vs tors. theta energy: -17.558 Dist. restrs. and SS energy: 1.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -221.539016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.539016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.055346 (E_RNA) where: Base-Base interactions energy: -158.292 where: short stacking energy: -58.375 Base-Backbone interact. energy: 0.928 local terms energy: -65.691586 where: bonds (distance) C4'-P energy: -12.840 bonds (distance) P-C4' energy: -15.045 flat angles C4'-P-C4' energy: -14.944 flat angles P-C4'-P energy: -9.209 tors. eta vs tors. theta energy: -13.653 Dist. restrs. and SS energy: 1.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -218.838638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.838638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.104988 (E_RNA) where: Base-Base interactions energy: -158.162 where: short stacking energy: -56.004 Base-Backbone interact. energy: -0.141 local terms energy: -61.801999 where: bonds (distance) C4'-P energy: -14.172 bonds (distance) P-C4' energy: -14.185 flat angles C4'-P-C4' energy: -14.902 flat angles P-C4'-P energy: -4.962 tors. eta vs tors. theta energy: -13.581 Dist. restrs. and SS energy: 1.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -205.088923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.088923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.088923 (E_RNA) where: Base-Base interactions energy: -138.110 where: short stacking energy: -53.255 Base-Backbone interact. energy: 0.959 local terms energy: -67.937718 where: bonds (distance) C4'-P energy: -12.429 bonds (distance) P-C4' energy: -14.727 flat angles C4'-P-C4' energy: -17.981 flat angles P-C4'-P energy: -6.354 tors. eta vs tors. theta energy: -16.448 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -162.749765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.749765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.749765 (E_RNA) where: Base-Base interactions energy: -97.708 where: short stacking energy: -40.200 Base-Backbone interact. energy: -0.079 local terms energy: -64.963161 where: bonds (distance) C4'-P energy: -14.304 bonds (distance) P-C4' energy: -15.507 flat angles C4'-P-C4' energy: -16.135 flat angles P-C4'-P energy: -11.806 tors. eta vs tors. theta energy: -7.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -163.028662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.028662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.034865 (E_RNA) where: Base-Base interactions energy: -100.627 where: short stacking energy: -38.728 Base-Backbone interact. energy: -0.505 local terms energy: -61.902842 where: bonds (distance) C4'-P energy: -10.615 bonds (distance) P-C4' energy: -16.272 flat angles C4'-P-C4' energy: -13.107 flat angles P-C4'-P energy: -7.273 tors. eta vs tors. theta energy: -14.636 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -138.725384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.725384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.749420 (E_RNA) where: Base-Base interactions energy: -76.297 where: short stacking energy: -42.400 Base-Backbone interact. energy: 0.221 local terms energy: -62.673662 where: bonds (distance) C4'-P energy: -15.901 bonds (distance) P-C4' energy: -18.895 flat angles C4'-P-C4' energy: -12.005 flat angles P-C4'-P energy: -9.138 tors. eta vs tors. theta energy: -6.735 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -140.333032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.333032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.333032 (E_RNA) where: Base-Base interactions energy: -88.938 where: short stacking energy: -37.479 Base-Backbone interact. energy: 1.781 local terms energy: -53.175470 where: bonds (distance) C4'-P energy: -11.057 bonds (distance) P-C4' energy: -13.209 flat angles C4'-P-C4' energy: -12.399 flat angles P-C4'-P energy: -9.247 tors. eta vs tors. theta energy: -7.264 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -135.725824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.725824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.829074 (E_RNA) where: Base-Base interactions energy: -72.777 where: short stacking energy: -37.616 Base-Backbone interact. energy: 0.050 local terms energy: -63.101848 where: bonds (distance) C4'-P energy: -16.005 bonds (distance) P-C4' energy: -13.582 flat angles C4'-P-C4' energy: -15.034 flat angles P-C4'-P energy: -11.389 tors. eta vs tors. theta energy: -7.092 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -112.548849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.548849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.565856 (E_RNA) where: Base-Base interactions energy: -59.227 where: short stacking energy: -29.763 Base-Backbone interact. energy: -0.113 local terms energy: -53.225686 where: bonds (distance) C4'-P energy: -11.997 bonds (distance) P-C4' energy: -12.559 flat angles C4'-P-C4' energy: -11.342 flat angles P-C4'-P energy: -11.333 tors. eta vs tors. theta energy: -5.994 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -231.724405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.724405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.278018 (E_RNA) where: Base-Base interactions energy: -157.207 where: short stacking energy: -67.653 Base-Backbone interact. energy: -0.121 local terms energy: -75.950387 where: bonds (distance) C4'-P energy: -15.459 bonds (distance) P-C4' energy: -18.048 flat angles C4'-P-C4' energy: -15.913 flat angles P-C4'-P energy: -7.558 tors. eta vs tors. theta energy: -18.972 Dist. restrs. and SS energy: 1.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -225.965744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.965744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.524100 (E_RNA) where: Base-Base interactions energy: -155.904 where: short stacking energy: -62.488 Base-Backbone interact. energy: 0.221 local terms energy: -71.840462 where: bonds (distance) C4'-P energy: -14.109 bonds (distance) P-C4' energy: -14.819 flat angles C4'-P-C4' energy: -15.399 flat angles P-C4'-P energy: -12.273 tors. eta vs tors. theta energy: -15.240 Dist. restrs. and SS energy: 1.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -211.904700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.904700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.542098 (E_RNA) where: Base-Base interactions energy: -142.777 where: short stacking energy: -56.728 Base-Backbone interact. energy: 0.639 local terms energy: -71.403762 where: bonds (distance) C4'-P energy: -14.619 bonds (distance) P-C4' energy: -16.948 flat angles C4'-P-C4' energy: -15.523 flat angles P-C4'-P energy: -11.049 tors. eta vs tors. theta energy: -13.264 Dist. restrs. and SS energy: 1.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -214.574211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.574211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.587900 (E_RNA) where: Base-Base interactions energy: -152.728 where: short stacking energy: -60.086 Base-Backbone interact. energy: -0.677 local terms energy: -61.183219 where: bonds (distance) C4'-P energy: -10.531 bonds (distance) P-C4' energy: -15.842 flat angles C4'-P-C4' energy: -15.808 flat angles P-C4'-P energy: -3.210 tors. eta vs tors. theta energy: -15.792 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -153.118116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.118116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.263092 (E_RNA) where: Base-Base interactions energy: -85.246 where: short stacking energy: -41.920 Base-Backbone interact. energy: -0.039 local terms energy: -67.978133 where: bonds (distance) C4'-P energy: -14.614 bonds (distance) P-C4' energy: -16.964 flat angles C4'-P-C4' energy: -16.280 flat angles P-C4'-P energy: -13.415 tors. eta vs tors. theta energy: -6.705 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -165.458805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.458805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.471410 (E_RNA) where: Base-Base interactions energy: -100.680 where: short stacking energy: -50.910 Base-Backbone interact. energy: -0.266 local terms energy: -64.525765 where: bonds (distance) C4'-P energy: -17.365 bonds (distance) P-C4' energy: -17.610 flat angles C4'-P-C4' energy: -12.510 flat angles P-C4'-P energy: -2.150 tors. eta vs tors. theta energy: -14.890 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -129.299206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.299206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.299206 (E_RNA) where: Base-Base interactions energy: -76.546 where: short stacking energy: -30.823 Base-Backbone interact. energy: -0.207 local terms energy: -52.546393 where: bonds (distance) C4'-P energy: -13.227 bonds (distance) P-C4' energy: -14.794 flat angles C4'-P-C4' energy: -14.564 flat angles P-C4'-P energy: -6.309 tors. eta vs tors. theta energy: -3.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -155.329837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.329837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.046020 (E_RNA) where: Base-Base interactions energy: -90.817 where: short stacking energy: -41.074 Base-Backbone interact. energy: 0.565 local terms energy: -65.793803 where: bonds (distance) C4'-P energy: -16.035 bonds (distance) P-C4' energy: -13.068 flat angles C4'-P-C4' energy: -13.474 flat angles P-C4'-P energy: -10.703 tors. eta vs tors. theta energy: -12.514 Dist. restrs. and SS energy: 0.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -123.597805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.597805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.608410 (E_RNA) where: Base-Base interactions energy: -77.183 where: short stacking energy: -23.876 Base-Backbone interact. energy: -0.243 local terms energy: -46.181699 where: bonds (distance) C4'-P energy: -16.159 bonds (distance) P-C4' energy: -14.272 flat angles C4'-P-C4' energy: -10.112 flat angles P-C4'-P energy: -4.634 tors. eta vs tors. theta energy: -1.005 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -130.454902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.454902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.454902 (E_RNA) where: Base-Base interactions energy: -79.067 where: short stacking energy: -32.178 Base-Backbone interact. energy: -0.308 local terms energy: -51.079221 where: bonds (distance) C4'-P energy: -11.568 bonds (distance) P-C4' energy: -14.054 flat angles C4'-P-C4' energy: -13.638 flat angles P-C4'-P energy: -9.957 tors. eta vs tors. theta energy: -1.862 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -238.574633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.574633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.247247 (E_RNA) where: Base-Base interactions energy: -164.417 where: short stacking energy: -60.997 Base-Backbone interact. energy: -0.280 local terms energy: -75.549685 where: bonds (distance) C4'-P energy: -17.600 bonds (distance) P-C4' energy: -14.360 flat angles C4'-P-C4' energy: -16.648 flat angles P-C4'-P energy: -9.838 tors. eta vs tors. theta energy: -17.105 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -220.753312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.753312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.884206 (E_RNA) where: Base-Base interactions energy: -152.157 where: short stacking energy: -69.942 Base-Backbone interact. energy: -0.255 local terms energy: -69.472468 where: bonds (distance) C4'-P energy: -11.265 bonds (distance) P-C4' energy: -13.990 flat angles C4'-P-C4' energy: -14.719 flat angles P-C4'-P energy: -11.895 tors. eta vs tors. theta energy: -17.602 Dist. restrs. and SS energy: 1.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -216.520160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.520160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.750528 (E_RNA) where: Base-Base interactions energy: -146.439 where: short stacking energy: -48.641 Base-Backbone interact. energy: -0.180 local terms energy: -70.131845 where: bonds (distance) C4'-P energy: -12.418 bonds (distance) P-C4' energy: -17.054 flat angles C4'-P-C4' energy: -16.350 flat angles P-C4'-P energy: -10.999 tors. eta vs tors. theta energy: -13.311 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -220.206907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.206907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.375686 (E_RNA) where: Base-Base interactions energy: -150.208 where: short stacking energy: -57.261 Base-Backbone interact. energy: -0.466 local terms energy: -70.702145 where: bonds (distance) C4'-P energy: -19.607 bonds (distance) P-C4' energy: -16.701 flat angles C4'-P-C4' energy: -11.923 flat angles P-C4'-P energy: -6.908 tors. eta vs tors. theta energy: -15.563 Dist. restrs. and SS energy: 1.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -171.880511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.880511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.896897 (E_RNA) where: Base-Base interactions energy: -103.798 where: short stacking energy: -53.237 Base-Backbone interact. energy: -0.517 local terms energy: -67.581812 where: bonds (distance) C4'-P energy: -13.438 bonds (distance) P-C4' energy: -16.005 flat angles C4'-P-C4' energy: -16.203 flat angles P-C4'-P energy: -6.947 tors. eta vs tors. theta energy: -14.989 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -143.004912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.004912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.035448 (E_RNA) where: Base-Base interactions energy: -83.225 where: short stacking energy: -35.552 Base-Backbone interact. energy: -0.094 local terms energy: -59.716334 where: bonds (distance) C4'-P energy: -11.144 bonds (distance) P-C4' energy: -19.127 flat angles C4'-P-C4' energy: -13.987 flat angles P-C4'-P energy: -9.987 tors. eta vs tors. theta energy: -5.470 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -140.199102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.199102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.199102 (E_RNA) where: Base-Base interactions energy: -85.577 where: short stacking energy: -41.278 Base-Backbone interact. energy: -0.131 local terms energy: -54.491421 where: bonds (distance) C4'-P energy: -12.964 bonds (distance) P-C4' energy: -17.463 flat angles C4'-P-C4' energy: -9.754 flat angles P-C4'-P energy: -7.384 tors. eta vs tors. theta energy: -6.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -140.368816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.368816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.387724 (E_RNA) where: Base-Base interactions energy: -81.254 where: short stacking energy: -40.023 Base-Backbone interact. energy: -0.019 local terms energy: -59.115387 where: bonds (distance) C4'-P energy: -13.769 bonds (distance) P-C4' energy: -15.519 flat angles C4'-P-C4' energy: -12.913 flat angles P-C4'-P energy: -6.089 tors. eta vs tors. theta energy: -10.825 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -136.880988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.880988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.908347 (E_RNA) where: Base-Base interactions energy: -85.087 where: short stacking energy: -37.745 Base-Backbone interact. energy: -0.365 local terms energy: -51.456402 where: bonds (distance) C4'-P energy: -13.596 bonds (distance) P-C4' energy: -13.722 flat angles C4'-P-C4' energy: -11.274 flat angles P-C4'-P energy: -10.436 tors. eta vs tors. theta energy: -2.429 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -128.919553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.919553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.940188 (E_RNA) where: Base-Base interactions energy: -78.141 where: short stacking energy: -42.560 Base-Backbone interact. energy: -0.051 local terms energy: -50.748819 where: bonds (distance) C4'-P energy: -14.600 bonds (distance) P-C4' energy: -8.656 flat angles C4'-P-C4' energy: -11.276 flat angles P-C4'-P energy: -6.077 tors. eta vs tors. theta energy: -10.139 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -239.492926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.492926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.323474 (E_RNA) where: Base-Base interactions energy: -165.977 where: short stacking energy: -65.592 Base-Backbone interact. energy: -0.010 local terms energy: -75.335948 where: bonds (distance) C4'-P energy: -13.324 bonds (distance) P-C4' energy: -18.125 flat angles C4'-P-C4' energy: -15.100 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -16.110 Dist. restrs. and SS energy: 1.831 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -212.578195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.578195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.630865 (E_RNA) where: Base-Base interactions energy: -144.845 where: short stacking energy: -55.567 Base-Backbone interact. energy: -0.267 local terms energy: -67.518734 where: bonds (distance) C4'-P energy: -15.733 bonds (distance) P-C4' energy: -13.299 flat angles C4'-P-C4' energy: -14.187 flat angles P-C4'-P energy: -12.520 tors. eta vs tors. theta energy: -11.779 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -222.805160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.805160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.932304 (E_RNA) where: Base-Base interactions energy: -152.044 where: short stacking energy: -56.480 Base-Backbone interact. energy: -0.199 local terms energy: -71.689533 where: bonds (distance) C4'-P energy: -15.857 bonds (distance) P-C4' energy: -17.628 flat angles C4'-P-C4' energy: -16.203 flat angles P-C4'-P energy: -7.699 tors. eta vs tors. theta energy: -14.302 Dist. restrs. and SS energy: 1.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -221.630406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.630406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.331729 (E_RNA) where: Base-Base interactions energy: -157.445 where: short stacking energy: -63.032 Base-Backbone interact. energy: 0.816 local terms energy: -66.702995 where: bonds (distance) C4'-P energy: -14.187 bonds (distance) P-C4' energy: -15.128 flat angles C4'-P-C4' energy: -15.632 flat angles P-C4'-P energy: -5.988 tors. eta vs tors. theta energy: -15.767 Dist. restrs. and SS energy: 1.701 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -153.750326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.750326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.811243 (E_RNA) where: Base-Base interactions energy: -105.764 where: short stacking energy: -41.295 Base-Backbone interact. energy: 0.236 local terms energy: -48.282617 where: bonds (distance) C4'-P energy: -8.380 bonds (distance) P-C4' energy: -11.569 flat angles C4'-P-C4' energy: -16.904 flat angles P-C4'-P energy: -4.625 tors. eta vs tors. theta energy: -6.806 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -172.036185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.036185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.036185 (E_RNA) where: Base-Base interactions energy: -99.597 where: short stacking energy: -54.695 Base-Backbone interact. energy: -0.114 local terms energy: -72.325181 where: bonds (distance) C4'-P energy: -14.702 bonds (distance) P-C4' energy: -15.293 flat angles C4'-P-C4' energy: -17.107 flat angles P-C4'-P energy: -11.792 tors. eta vs tors. theta energy: -13.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -151.860012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.860012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.874544 (E_RNA) where: Base-Base interactions energy: -95.818 where: short stacking energy: -39.552 Base-Backbone interact. energy: -0.216 local terms energy: -55.840672 where: bonds (distance) C4'-P energy: -10.619 bonds (distance) P-C4' energy: -12.837 flat angles C4'-P-C4' energy: -14.083 flat angles P-C4'-P energy: -10.862 tors. eta vs tors. theta energy: -7.439 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -143.125235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.125235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.206227 (E_RNA) where: Base-Base interactions energy: -82.709 where: short stacking energy: -44.294 Base-Backbone interact. energy: 1.128 local terms energy: -61.625523 where: bonds (distance) C4'-P energy: -14.586 bonds (distance) P-C4' energy: -15.544 flat angles C4'-P-C4' energy: -15.652 flat angles P-C4'-P energy: -7.624 tors. eta vs tors. theta energy: -8.221 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -115.669536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.669536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.669536 (E_RNA) where: Base-Base interactions energy: -63.997 where: short stacking energy: -25.596 Base-Backbone interact. energy: -0.414 local terms energy: -51.258089 where: bonds (distance) C4'-P energy: -12.922 bonds (distance) P-C4' energy: -15.469 flat angles C4'-P-C4' energy: -12.350 flat angles P-C4'-P energy: -13.051 tors. eta vs tors. theta energy: 2.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -123.093204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.093204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.093204 (E_RNA) where: Base-Base interactions energy: -66.301 where: short stacking energy: -29.771 Base-Backbone interact. energy: -0.927 local terms energy: -55.865476 where: bonds (distance) C4'-P energy: -11.308 bonds (distance) P-C4' energy: -12.802 flat angles C4'-P-C4' energy: -16.201 flat angles P-C4'-P energy: -9.524 tors. eta vs tors. theta energy: -6.031 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -221.308720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.308720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.324336 (E_RNA) where: Base-Base interactions energy: -150.340 where: short stacking energy: -57.649 Base-Backbone interact. energy: 0.122 local terms energy: -71.105652 where: bonds (distance) C4'-P energy: -17.728 bonds (distance) P-C4' energy: -15.254 flat angles C4'-P-C4' energy: -16.303 flat angles P-C4'-P energy: -8.328 tors. eta vs tors. theta energy: -13.494 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -238.696618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.696618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.056328 (E_RNA) where: Base-Base interactions energy: -169.355 where: short stacking energy: -63.203 Base-Backbone interact. energy: 1.217 local terms energy: -71.918687 where: bonds (distance) C4'-P energy: -16.019 bonds (distance) P-C4' energy: -16.490 flat angles C4'-P-C4' energy: -16.271 flat angles P-C4'-P energy: -6.124 tors. eta vs tors. theta energy: -17.015 Dist. restrs. and SS energy: 1.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -217.141276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.141276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.931006 (E_RNA) where: Base-Base interactions energy: -144.320 where: short stacking energy: -59.806 Base-Backbone interact. energy: -0.692 local terms energy: -73.918402 where: bonds (distance) C4'-P energy: -15.340 bonds (distance) P-C4' energy: -15.554 flat angles C4'-P-C4' energy: -16.452 flat angles P-C4'-P energy: -8.043 tors. eta vs tors. theta energy: -18.529 Dist. restrs. and SS energy: 1.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -221.785930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.785930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.107310 (E_RNA) where: Base-Base interactions energy: -158.698 where: short stacking energy: -60.109 Base-Backbone interact. energy: -0.623 local terms energy: -63.785393 where: bonds (distance) C4'-P energy: -17.290 bonds (distance) P-C4' energy: -11.970 flat angles C4'-P-C4' energy: -15.660 flat angles P-C4'-P energy: -5.062 tors. eta vs tors. theta energy: -13.804 Dist. restrs. and SS energy: 1.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -167.064753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.064753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.571734 (E_RNA) where: Base-Base interactions energy: -97.212 where: short stacking energy: -45.222 Base-Backbone interact. energy: -0.287 local terms energy: -70.072887 where: bonds (distance) C4'-P energy: -12.048 bonds (distance) P-C4' energy: -13.862 flat angles C4'-P-C4' energy: -15.561 flat angles P-C4'-P energy: -10.366 tors. eta vs tors. theta energy: -18.236 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -154.920275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.920275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.920275 (E_RNA) where: Base-Base interactions energy: -88.052 where: short stacking energy: -40.888 Base-Backbone interact. energy: -0.170 local terms energy: -66.698455 where: bonds (distance) C4'-P energy: -14.689 bonds (distance) P-C4' energy: -19.806 flat angles C4'-P-C4' energy: -15.969 flat angles P-C4'-P energy: -10.620 tors. eta vs tors. theta energy: -5.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -167.854542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.854542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.871099 (E_RNA) where: Base-Base interactions energy: -107.934 where: short stacking energy: -50.382 Base-Backbone interact. energy: -0.740 local terms energy: -59.196966 where: bonds (distance) C4'-P energy: -14.648 bonds (distance) P-C4' energy: -14.889 flat angles C4'-P-C4' energy: -10.117 flat angles P-C4'-P energy: -8.746 tors. eta vs tors. theta energy: -10.797 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -144.426681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.426681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.906743 (E_RNA) where: Base-Base interactions energy: -93.132 where: short stacking energy: -50.634 Base-Backbone interact. energy: -0.315 local terms energy: -52.459692 where: bonds (distance) C4'-P energy: -9.382 bonds (distance) P-C4' energy: -12.083 flat angles C4'-P-C4' energy: -12.854 flat angles P-C4'-P energy: -7.358 tors. eta vs tors. theta energy: -10.783 Dist. restrs. and SS energy: 1.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -141.920019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.920019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.966854 (E_RNA) where: Base-Base interactions energy: -79.393 where: short stacking energy: -41.773 Base-Backbone interact. energy: -0.116 local terms energy: -62.458006 where: bonds (distance) C4'-P energy: -15.281 bonds (distance) P-C4' energy: -15.192 flat angles C4'-P-C4' energy: -13.572 flat angles P-C4'-P energy: -7.652 tors. eta vs tors. theta energy: -10.761 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -118.959905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.959905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.141906 (E_RNA) where: Base-Base interactions energy: -75.510 where: short stacking energy: -32.428 Base-Backbone interact. energy: -0.128 local terms energy: -44.503393 where: bonds (distance) C4'-P energy: -11.783 bonds (distance) P-C4' energy: -14.261 flat angles C4'-P-C4' energy: -10.632 flat angles P-C4'-P energy: -3.448 tors. eta vs tors. theta energy: -4.380 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -228.324523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.324523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.351956 (E_RNA) where: Base-Base interactions energy: -152.216 where: short stacking energy: -54.889 Base-Backbone interact. energy: -0.073 local terms energy: -76.063273 where: bonds (distance) C4'-P energy: -15.111 bonds (distance) P-C4' energy: -16.787 flat angles C4'-P-C4' energy: -18.032 flat angles P-C4'-P energy: -13.701 tors. eta vs tors. theta energy: -12.433 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -226.913288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.913288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.725684 (E_RNA) where: Base-Base interactions energy: -154.070 where: short stacking energy: -61.229 Base-Backbone interact. energy: -1.039 local terms energy: -73.616572 where: bonds (distance) C4'-P energy: -13.923 bonds (distance) P-C4' energy: -18.348 flat angles C4'-P-C4' energy: -13.960 flat angles P-C4'-P energy: -11.027 tors. eta vs tors. theta energy: -16.358 Dist. restrs. and SS energy: 1.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -211.310788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.310788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.519492 (E_RNA) where: Base-Base interactions energy: -140.360 where: short stacking energy: -58.848 Base-Backbone interact. energy: -0.437 local terms energy: -71.721991 where: bonds (distance) C4'-P energy: -11.631 bonds (distance) P-C4' energy: -14.481 flat angles C4'-P-C4' energy: -14.125 flat angles P-C4'-P energy: -13.681 tors. eta vs tors. theta energy: -17.805 Dist. restrs. and SS energy: 1.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -183.965041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.965041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.965041 (E_RNA) where: Base-Base interactions energy: -116.494 where: short stacking energy: -45.774 Base-Backbone interact. energy: -0.098 local terms energy: -67.373458 where: bonds (distance) C4'-P energy: -16.804 bonds (distance) P-C4' energy: -12.817 flat angles C4'-P-C4' energy: -17.478 flat angles P-C4'-P energy: -11.565 tors. eta vs tors. theta energy: -8.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -221.967373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.967373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.289875 (E_RNA) where: Base-Base interactions energy: -151.842 where: short stacking energy: -63.373 Base-Backbone interact. energy: -0.248 local terms energy: -71.200353 where: bonds (distance) C4'-P energy: -6.249 bonds (distance) P-C4' energy: -16.239 flat angles C4'-P-C4' energy: -17.523 flat angles P-C4'-P energy: -13.471 tors. eta vs tors. theta energy: -17.719 Dist. restrs. and SS energy: 1.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -166.803233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.803233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.814860 (E_RNA) where: Base-Base interactions energy: -102.884 where: short stacking energy: -55.848 Base-Backbone interact. energy: -0.130 local terms energy: -63.800714 where: bonds (distance) C4'-P energy: -15.277 bonds (distance) P-C4' energy: -10.849 flat angles C4'-P-C4' energy: -12.067 flat angles P-C4'-P energy: -10.163 tors. eta vs tors. theta energy: -15.445 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -158.035966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.035966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.035966 (E_RNA) where: Base-Base interactions energy: -87.615 where: short stacking energy: -44.095 Base-Backbone interact. energy: -0.110 local terms energy: -70.310547 where: bonds (distance) C4'-P energy: -17.703 bonds (distance) P-C4' energy: -15.868 flat angles C4'-P-C4' energy: -14.029 flat angles P-C4'-P energy: -9.404 tors. eta vs tors. theta energy: -13.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -162.116543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.116543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.334083 (E_RNA) where: Base-Base interactions energy: -95.554 where: short stacking energy: -54.540 Base-Backbone interact. energy: -0.014 local terms energy: -66.766758 where: bonds (distance) C4'-P energy: -10.435 bonds (distance) P-C4' energy: -15.706 flat angles C4'-P-C4' energy: -16.572 flat angles P-C4'-P energy: -8.608 tors. eta vs tors. theta energy: -15.446 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -140.277455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.277455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.734828 (E_RNA) where: Base-Base interactions energy: -78.767 where: short stacking energy: -42.494 Base-Backbone interact. energy: -0.025 local terms energy: -61.942910 where: bonds (distance) C4'-P energy: -12.623 bonds (distance) P-C4' energy: -17.932 flat angles C4'-P-C4' energy: -17.375 flat angles P-C4'-P energy: -8.914 tors. eta vs tors. theta energy: -5.098 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -142.378552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.378552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.014372 (E_RNA) where: Base-Base interactions energy: -89.215 where: short stacking energy: -44.319 Base-Backbone interact. energy: -0.048 local terms energy: -53.751195 where: bonds (distance) C4'-P energy: -15.157 bonds (distance) P-C4' energy: -15.749 flat angles C4'-P-C4' energy: -4.985 flat angles P-C4'-P energy: -9.277 tors. eta vs tors. theta energy: -8.582 Dist. restrs. and SS energy: 0.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -231.941907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.941907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.065709 (E_RNA) where: Base-Base interactions energy: -156.105 where: short stacking energy: -60.208 Base-Backbone interact. energy: -0.065 local terms energy: -76.895833 where: bonds (distance) C4'-P energy: -18.096 bonds (distance) P-C4' energy: -17.514 flat angles C4'-P-C4' energy: -16.817 flat angles P-C4'-P energy: -8.310 tors. eta vs tors. theta energy: -16.158 Dist. restrs. and SS energy: 1.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -224.420440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.420440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.420440 (E_RNA) where: Base-Base interactions energy: -155.867 where: short stacking energy: -51.947 Base-Backbone interact. energy: -0.170 local terms energy: -68.383381 where: bonds (distance) C4'-P energy: -15.765 bonds (distance) P-C4' energy: -13.367 flat angles C4'-P-C4' energy: -16.923 flat angles P-C4'-P energy: -7.128 tors. eta vs tors. theta energy: -15.200 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -226.801336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.801336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.535718 (E_RNA) where: Base-Base interactions energy: -158.217 where: short stacking energy: -61.622 Base-Backbone interact. energy: -0.316 local terms energy: -70.002786 where: bonds (distance) C4'-P energy: -14.561 bonds (distance) P-C4' energy: -15.847 flat angles C4'-P-C4' energy: -18.193 flat angles P-C4'-P energy: -5.491 tors. eta vs tors. theta energy: -15.911 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -191.464476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.464476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.544306 (E_RNA) where: Base-Base interactions energy: -129.371 where: short stacking energy: -53.868 Base-Backbone interact. energy: -0.052 local terms energy: -62.120984 where: bonds (distance) C4'-P energy: -15.521 bonds (distance) P-C4' energy: -8.543 flat angles C4'-P-C4' energy: -17.091 flat angles P-C4'-P energy: -1.578 tors. eta vs tors. theta energy: -19.388 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -179.979922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.979922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.979922 (E_RNA) where: Base-Base interactions energy: -105.261 where: short stacking energy: -60.050 Base-Backbone interact. energy: -0.064 local terms energy: -74.654928 where: bonds (distance) C4'-P energy: -15.402 bonds (distance) P-C4' energy: -17.346 flat angles C4'-P-C4' energy: -15.358 flat angles P-C4'-P energy: -8.762 tors. eta vs tors. theta energy: -17.786 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -213.078993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.078993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.319600 (E_RNA) where: Base-Base interactions energy: -148.178 where: short stacking energy: -59.708 Base-Backbone interact. energy: -0.234 local terms energy: -65.907962 where: bonds (distance) C4'-P energy: -12.508 bonds (distance) P-C4' energy: -10.305 flat angles C4'-P-C4' energy: -14.966 flat angles P-C4'-P energy: -11.297 tors. eta vs tors. theta energy: -16.833 Dist. restrs. and SS energy: 1.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -141.513612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.513612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.580355 (E_RNA) where: Base-Base interactions energy: -90.984 where: short stacking energy: -40.741 Base-Backbone interact. energy: -0.083 local terms energy: -50.512607 where: bonds (distance) C4'-P energy: -12.831 bonds (distance) P-C4' energy: -18.805 flat angles C4'-P-C4' energy: -11.082 flat angles P-C4'-P energy: -2.403 tors. eta vs tors. theta energy: -5.392 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -141.943983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.943983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.078175 (E_RNA) where: Base-Base interactions energy: -76.807 where: short stacking energy: -29.603 Base-Backbone interact. energy: -0.016 local terms energy: -65.255417 where: bonds (distance) C4'-P energy: -15.513 bonds (distance) P-C4' energy: -17.059 flat angles C4'-P-C4' energy: -14.102 flat angles P-C4'-P energy: -11.177 tors. eta vs tors. theta energy: -7.405 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -138.572704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.572704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.596910 (E_RNA) where: Base-Base interactions energy: -76.216 where: short stacking energy: -35.520 Base-Backbone interact. energy: -0.116 local terms energy: -62.264823 where: bonds (distance) C4'-P energy: -14.914 bonds (distance) P-C4' energy: -15.368 flat angles C4'-P-C4' energy: -15.434 flat angles P-C4'-P energy: -6.653 tors. eta vs tors. theta energy: -9.896 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -128.190454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.190454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.214138 (E_RNA) where: Base-Base interactions energy: -80.280 where: short stacking energy: -40.192 Base-Backbone interact. energy: 3.229 local terms energy: -51.163526 where: bonds (distance) C4'-P energy: -12.081 bonds (distance) P-C4' energy: -13.521 flat angles C4'-P-C4' energy: -8.373 flat angles P-C4'-P energy: -9.237 tors. eta vs tors. theta energy: -7.951 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -231.879919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.879919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.289995 (E_RNA) where: Base-Base interactions energy: -163.365 where: short stacking energy: -60.092 Base-Backbone interact. energy: -0.263 local terms energy: -69.662493 where: bonds (distance) C4'-P energy: -17.019 bonds (distance) P-C4' energy: -15.190 flat angles C4'-P-C4' energy: -11.222 flat angles P-C4'-P energy: -12.589 tors. eta vs tors. theta energy: -13.642 Dist. restrs. and SS energy: 1.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -218.054376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.054376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.054376 (E_RNA) where: Base-Base interactions energy: -142.913 where: short stacking energy: -52.127 Base-Backbone interact. energy: -0.742 local terms energy: -74.399996 where: bonds (distance) C4'-P energy: -15.120 bonds (distance) P-C4' energy: -18.824 flat angles C4'-P-C4' energy: -15.674 flat angles P-C4'-P energy: -12.557 tors. eta vs tors. theta energy: -12.224 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -221.941881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.941881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.929763 (E_RNA) where: Base-Base interactions energy: -151.098 where: short stacking energy: -60.994 Base-Backbone interact. energy: -0.489 local terms energy: -71.341892 where: bonds (distance) C4'-P energy: -14.278 bonds (distance) P-C4' energy: -15.052 flat angles C4'-P-C4' energy: -16.627 flat angles P-C4'-P energy: -10.548 tors. eta vs tors. theta energy: -14.837 Dist. restrs. and SS energy: 0.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -191.412126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.412126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.462256 (E_RNA) where: Base-Base interactions energy: -121.642 where: short stacking energy: -55.698 Base-Backbone interact. energy: -0.116 local terms energy: -69.704113 where: bonds (distance) C4'-P energy: -14.064 bonds (distance) P-C4' energy: -13.961 flat angles C4'-P-C4' energy: -17.743 flat angles P-C4'-P energy: -8.536 tors. eta vs tors. theta energy: -15.399 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -166.454141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.454141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.454141 (E_RNA) where: Base-Base interactions energy: -98.337 where: short stacking energy: -43.989 Base-Backbone interact. energy: -0.861 local terms energy: -67.255724 where: bonds (distance) C4'-P energy: -11.792 bonds (distance) P-C4' energy: -18.093 flat angles C4'-P-C4' energy: -17.395 flat angles P-C4'-P energy: -10.099 tors. eta vs tors. theta energy: -9.877 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -146.363571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.363571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.363571 (E_RNA) where: Base-Base interactions energy: -86.201 where: short stacking energy: -36.126 Base-Backbone interact. energy: 0.459 local terms energy: -60.622089 where: bonds (distance) C4'-P energy: -18.093 bonds (distance) P-C4' energy: -13.391 flat angles C4'-P-C4' energy: -16.434 flat angles P-C4'-P energy: -7.218 tors. eta vs tors. theta energy: -5.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -151.142653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.142653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.174940 (E_RNA) where: Base-Base interactions energy: -93.720 where: short stacking energy: -35.141 Base-Backbone interact. energy: -0.173 local terms energy: -57.282066 where: bonds (distance) C4'-P energy: -17.187 bonds (distance) P-C4' energy: -12.638 flat angles C4'-P-C4' energy: -14.592 flat angles P-C4'-P energy: -7.124 tors. eta vs tors. theta energy: -5.741 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -124.860054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.860054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.904746 (E_RNA) where: Base-Base interactions energy: -81.768 where: short stacking energy: -35.921 Base-Backbone interact. energy: -1.135 local terms energy: -42.001347 where: bonds (distance) C4'-P energy: -13.344 bonds (distance) P-C4' energy: -9.313 flat angles C4'-P-C4' energy: -6.134 flat angles P-C4'-P energy: -7.047 tors. eta vs tors. theta energy: -6.163 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -135.976988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.976988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.126021 (E_RNA) where: Base-Base interactions energy: -83.829 where: short stacking energy: -38.733 Base-Backbone interact. energy: -0.100 local terms energy: -52.196995 where: bonds (distance) C4'-P energy: -17.107 bonds (distance) P-C4' energy: -9.887 flat angles C4'-P-C4' energy: -14.303 flat angles P-C4'-P energy: -3.034 tors. eta vs tors. theta energy: -7.865 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -147.888721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.888721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.918309 (E_RNA) where: Base-Base interactions energy: -93.201 where: short stacking energy: -42.243 Base-Backbone interact. energy: -0.263 local terms energy: -54.454550 where: bonds (distance) C4'-P energy: -11.568 bonds (distance) P-C4' energy: -12.709 flat angles C4'-P-C4' energy: -14.060 flat angles P-C4'-P energy: -6.716 tors. eta vs tors. theta energy: -9.401 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 10 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 3834377 moves confirmed later: 4678884 all moves confirmed: 8513261 percent of confirmed moves: 5.320788 current total energy: -196.436362 recalc. total energy: -196.436362 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 3290512 moves confirmed later: 3922825 all moves confirmed: 7213337 percent of confirmed moves: 4.508336 current total energy: -187.950686 recalc. total energy: -187.950686 replica 4 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 3426213 moves confirmed later: 4102053 all moves confirmed: 7528266 percent of confirmed moves: 4.705166 current total energy: -181.439489 recalc. total energy: -181.439489 replica 1 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 3207468 moves confirmed later: 3776225 all moves confirmed: 6983693 percent of confirmed moves: 4.364808 current total energy: -153.002567 recalc. total energy: -153.002567 replica 9 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 3521220 moves confirmed later: 4228224 all moves confirmed: 7749444 percent of confirmed moves: 4.843402 current total energy: -117.794246 recalc. total energy: -117.794246 replica 3 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 4227598 moves confirmed later: 5189559 all moves confirmed: 9417157 percent of confirmed moves: 5.885723 current total energy: -118.922910 recalc. total energy: -118.922910 replica 6 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 2565969 moves confirmed later: 2952678 all moves confirmed: 5518647 percent of confirmed moves: 3.449154 current total energy: -100.990003 recalc. total energy: -100.990003 replica 7 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 4023283 moves confirmed later: 4908930 all moves confirmed: 8932213 percent of confirmed moves: 5.582633 current total energy: -54.930451 recalc. total energy: -54.930451 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 3934309 moves confirmed later: 4801105 all moves confirmed: 8735414 percent of confirmed moves: 5.459634 current total energy: -80.977660 recalc. total energy: -80.977660 replica 5 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 4199966 moves confirmed later: 5172253 all moves confirmed: 9372219 percent of confirmed moves: 5.857637 current total energy: -76.631232 recalc. total energy: -76.631232 out arg RESULTS//1/Tetraloop_10_steps-ace9e91a_01 Time of doing 1600000 iterations: 496.966 seconds