SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab4e3981/inputs/seq.fa: 1 curr_seq: _GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAUUCGUAUAUCCUUAAUGAUAUGGUUUAAGGGCAAUACAUAGAGACCACAAAUUUCUUACUGCGAAUUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 71 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 360 n_atoms_counter: 360 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 71.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -286.698506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.698506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.698506 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.635987 where: bonds (distance) C4'-P energy: -68.982 bonds (distance) P-C4' energy: -64.415 flat angles C4'-P-C4' energy: -52.130 flat angles P-C4'-P energy: -59.631 tors. eta vs tors. theta energy: -31.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -386.108161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.108161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.108161 (E_RNA) where: Base-Base interactions energy: -168.176 where: short stacking energy: -140.812 Base-Backbone interact. energy: -1.448 local terms energy: -216.483298 where: bonds (distance) C4'-P energy: -46.157 bonds (distance) P-C4' energy: -47.288 flat angles C4'-P-C4' energy: -50.543 flat angles P-C4'-P energy: -32.613 tors. eta vs tors. theta energy: -39.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -377.009329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.009329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.009329 (E_RNA) where: Base-Base interactions energy: -170.989 where: short stacking energy: -132.967 Base-Backbone interact. energy: -0.122 local terms energy: -205.898875 where: bonds (distance) C4'-P energy: -48.819 bonds (distance) P-C4' energy: -48.362 flat angles C4'-P-C4' energy: -46.398 flat angles P-C4'-P energy: -30.057 tors. eta vs tors. theta energy: -32.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -331.350571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.350571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.350571 (E_RNA) where: Base-Base interactions energy: -135.482 where: short stacking energy: -110.394 Base-Backbone interact. energy: 0.713 local terms energy: -196.581988 where: bonds (distance) C4'-P energy: -43.250 bonds (distance) P-C4' energy: -45.878 flat angles C4'-P-C4' energy: -49.006 flat angles P-C4'-P energy: -33.892 tors. eta vs tors. theta energy: -24.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -301.333183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.333183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.333183 (E_RNA) where: Base-Base interactions energy: -123.190 where: short stacking energy: -115.356 Base-Backbone interact. energy: -0.186 local terms energy: -177.957426 where: bonds (distance) C4'-P energy: -37.748 bonds (distance) P-C4' energy: -51.083 flat angles C4'-P-C4' energy: -36.465 flat angles P-C4'-P energy: -35.497 tors. eta vs tors. theta energy: -17.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -293.486370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.486370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.486370 (E_RNA) where: Base-Base interactions energy: -120.616 where: short stacking energy: -98.077 Base-Backbone interact. energy: -1.084 local terms energy: -171.785927 where: bonds (distance) C4'-P energy: -41.951 bonds (distance) P-C4' energy: -41.050 flat angles C4'-P-C4' energy: -42.496 flat angles P-C4'-P energy: -23.271 tors. eta vs tors. theta energy: -23.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -286.070197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.070197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.070197 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.007677 where: bonds (distance) C4'-P energy: -68.866 bonds (distance) P-C4' energy: -64.408 flat angles C4'-P-C4' energy: -51.545 flat angles P-C4'-P energy: -59.557 tors. eta vs tors. theta energy: -31.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -286.070197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.070197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.070197 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.007677 where: bonds (distance) C4'-P energy: -68.866 bonds (distance) P-C4' energy: -64.408 flat angles C4'-P-C4' energy: -51.545 flat angles P-C4'-P energy: -59.557 tors. eta vs tors. theta energy: -31.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -286.107439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.107439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.107439 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.044919 where: bonds (distance) C4'-P energy: -68.866 bonds (distance) P-C4' energy: -64.408 flat angles C4'-P-C4' energy: -51.545 flat angles P-C4'-P energy: -59.594 tors. eta vs tors. theta energy: -31.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -286.107439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.107439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.107439 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.044919 where: bonds (distance) C4'-P energy: -68.866 bonds (distance) P-C4' energy: -64.408 flat angles C4'-P-C4' energy: -51.545 flat angles P-C4'-P energy: -59.594 tors. eta vs tors. theta energy: -31.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -286.107439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.107439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.107439 (E_RNA) where: Base-Base interactions energy: -10.062 where: short stacking energy: -10.062 Base-Backbone interact. energy: -0.000 local terms energy: -276.044919 where: bonds (distance) C4'-P energy: -68.866 bonds (distance) P-C4' energy: -64.408 flat angles C4'-P-C4' energy: -51.545 flat angles P-C4'-P energy: -59.594 tors. eta vs tors. theta energy: -31.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -442.658595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.658595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.658595 (E_RNA) where: Base-Base interactions energy: -248.323 where: short stacking energy: -150.088 Base-Backbone interact. energy: -0.556 local terms energy: -193.779403 where: bonds (distance) C4'-P energy: -45.235 bonds (distance) P-C4' energy: -38.670 flat angles C4'-P-C4' energy: -44.055 flat angles P-C4'-P energy: -25.096 tors. eta vs tors. theta energy: -40.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -422.835308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.835308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.835308 (E_RNA) where: Base-Base interactions energy: -213.642 where: short stacking energy: -143.977 Base-Backbone interact. energy: 0.202 local terms energy: -209.394631 where: bonds (distance) C4'-P energy: -42.987 bonds (distance) P-C4' energy: -42.864 flat angles C4'-P-C4' energy: -52.522 flat angles P-C4'-P energy: -36.845 tors. eta vs tors. theta energy: -34.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -395.293235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.293235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.293235 (E_RNA) where: Base-Base interactions energy: -197.251 where: short stacking energy: -150.158 Base-Backbone interact. energy: 0.899 local terms energy: -198.942046 where: bonds (distance) C4'-P energy: -33.630 bonds (distance) P-C4' energy: -51.481 flat angles C4'-P-C4' energy: -40.719 flat angles P-C4'-P energy: -26.479 tors. eta vs tors. theta energy: -46.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -306.774674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.774674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.774674 (E_RNA) where: Base-Base interactions energy: -137.419 where: short stacking energy: -119.077 Base-Backbone interact. energy: 4.823 local terms energy: -174.177927 where: bonds (distance) C4'-P energy: -42.729 bonds (distance) P-C4' energy: -45.894 flat angles C4'-P-C4' energy: -42.112 flat angles P-C4'-P energy: -23.767 tors. eta vs tors. theta energy: -19.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -284.523918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.523918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.523918 (E_RNA) where: Base-Base interactions energy: -119.985 where: short stacking energy: -89.450 Base-Backbone interact. energy: -0.849 local terms energy: -163.690674 where: bonds (distance) C4'-P energy: -39.751 bonds (distance) P-C4' energy: -39.128 flat angles C4'-P-C4' energy: -49.348 flat angles P-C4'-P energy: -21.360 tors. eta vs tors. theta energy: -14.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -275.840100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.840100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.840100 (E_RNA) where: Base-Base interactions energy: -119.199 where: short stacking energy: -96.495 Base-Backbone interact. energy: -0.589 local terms energy: -156.051941 where: bonds (distance) C4'-P energy: -42.170 bonds (distance) P-C4' energy: -46.214 flat angles C4'-P-C4' energy: -37.268 flat angles P-C4'-P energy: -21.328 tors. eta vs tors. theta energy: -9.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -249.641621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.641621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.641621 (E_RNA) where: Base-Base interactions energy: -85.872 where: short stacking energy: -55.259 Base-Backbone interact. energy: -0.610 local terms energy: -163.160214 where: bonds (distance) C4'-P energy: -47.497 bonds (distance) P-C4' energy: -42.789 flat angles C4'-P-C4' energy: -30.756 flat angles P-C4'-P energy: -28.995 tors. eta vs tors. theta energy: -13.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -240.793292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.793292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.793292 (E_RNA) where: Base-Base interactions energy: -99.038 where: short stacking energy: -65.214 Base-Backbone interact. energy: -0.085 local terms energy: -141.670621 where: bonds (distance) C4'-P energy: -29.070 bonds (distance) P-C4' energy: -40.240 flat angles C4'-P-C4' energy: -41.843 flat angles P-C4'-P energy: -23.164 tors. eta vs tors. theta energy: -7.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -219.704309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.704309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.704309 (E_RNA) where: Base-Base interactions energy: -105.432 where: short stacking energy: -63.487 Base-Backbone interact. energy: -2.645 local terms energy: -111.628060 where: bonds (distance) C4'-P energy: -32.772 bonds (distance) P-C4' energy: -43.015 flat angles C4'-P-C4' energy: -32.161 flat angles P-C4'-P energy: -2.239 tors. eta vs tors. theta energy: -1.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -187.349626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.349626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.349626 (E_RNA) where: Base-Base interactions energy: -63.974 where: short stacking energy: -40.210 Base-Backbone interact. energy: 4.439 local terms energy: -127.814395 where: bonds (distance) C4'-P energy: -37.373 bonds (distance) P-C4' energy: -40.113 flat angles C4'-P-C4' energy: -34.495 flat angles P-C4'-P energy: -24.147 tors. eta vs tors. theta energy: 8.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -447.722857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.722857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.722857 (E_RNA) where: Base-Base interactions energy: -218.636 where: short stacking energy: -149.303 Base-Backbone interact. energy: -0.147 local terms energy: -228.940125 where: bonds (distance) C4'-P energy: -50.540 bonds (distance) P-C4' energy: -51.479 flat angles C4'-P-C4' energy: -48.588 flat angles P-C4'-P energy: -35.656 tors. eta vs tors. theta energy: -42.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -493.591524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.591524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.591524 (E_RNA) where: Base-Base interactions energy: -286.355 where: short stacking energy: -141.842 Base-Backbone interact. energy: -1.930 local terms energy: -205.305812 where: bonds (distance) C4'-P energy: -43.304 bonds (distance) P-C4' energy: -52.064 flat angles C4'-P-C4' energy: -46.298 flat angles P-C4'-P energy: -33.585 tors. eta vs tors. theta energy: -30.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -390.179368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.179368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.179368 (E_RNA) where: Base-Base interactions energy: -199.460 where: short stacking energy: -140.938 Base-Backbone interact. energy: -0.278 local terms energy: -190.441086 where: bonds (distance) C4'-P energy: -24.341 bonds (distance) P-C4' energy: -51.060 flat angles C4'-P-C4' energy: -56.009 flat angles P-C4'-P energy: -22.085 tors. eta vs tors. theta energy: -36.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -284.931531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.931531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.931531 (E_RNA) where: Base-Base interactions energy: -113.774 where: short stacking energy: -82.568 Base-Backbone interact. energy: -0.657 local terms energy: -170.500347 where: bonds (distance) C4'-P energy: -45.004 bonds (distance) P-C4' energy: -42.036 flat angles C4'-P-C4' energy: -44.964 flat angles P-C4'-P energy: -26.170 tors. eta vs tors. theta energy: -12.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -288.200614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.200614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.200614 (E_RNA) where: Base-Base interactions energy: -136.798 where: short stacking energy: -86.783 Base-Backbone interact. energy: -0.790 local terms energy: -150.612369 where: bonds (distance) C4'-P energy: -43.172 bonds (distance) P-C4' energy: -39.725 flat angles C4'-P-C4' energy: -32.534 flat angles P-C4'-P energy: -22.539 tors. eta vs tors. theta energy: -12.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -257.807290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.807290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.807290 (E_RNA) where: Base-Base interactions energy: -97.060 where: short stacking energy: -83.818 Base-Backbone interact. energy: 0.193 local terms energy: -160.940453 where: bonds (distance) C4'-P energy: -46.102 bonds (distance) P-C4' energy: -46.704 flat angles C4'-P-C4' energy: -38.884 flat angles P-C4'-P energy: -23.746 tors. eta vs tors. theta energy: -5.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -231.086151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.086151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.086151 (E_RNA) where: Base-Base interactions energy: -99.541 where: short stacking energy: -58.971 Base-Backbone interact. energy: -0.200 local terms energy: -131.345179 where: bonds (distance) C4'-P energy: -41.321 bonds (distance) P-C4' energy: -42.611 flat angles C4'-P-C4' energy: -26.090 flat angles P-C4'-P energy: -14.943 tors. eta vs tors. theta energy: -6.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -217.527729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.527729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.527729 (E_RNA) where: Base-Base interactions energy: -80.217 where: short stacking energy: -74.524 Base-Backbone interact. energy: -0.425 local terms energy: -136.884850 where: bonds (distance) C4'-P energy: -41.758 bonds (distance) P-C4' energy: -43.299 flat angles C4'-P-C4' energy: -38.318 flat angles P-C4'-P energy: -14.193 tors. eta vs tors. theta energy: 0.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -200.231072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.231072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.231072 (E_RNA) where: Base-Base interactions energy: -66.437 where: short stacking energy: -52.181 Base-Backbone interact. energy: -0.949 local terms energy: -132.844769 where: bonds (distance) C4'-P energy: -34.176 bonds (distance) P-C4' energy: -45.220 flat angles C4'-P-C4' energy: -31.805 flat angles P-C4'-P energy: -16.256 tors. eta vs tors. theta energy: -5.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -200.826706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.826706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.826706 (E_RNA) where: Base-Base interactions energy: -70.359 where: short stacking energy: -49.537 Base-Backbone interact. energy: -1.043 local terms energy: -129.424888 where: bonds (distance) C4'-P energy: -45.147 bonds (distance) P-C4' energy: -40.500 flat angles C4'-P-C4' energy: -41.906 flat angles P-C4'-P energy: -15.780 tors. eta vs tors. theta energy: 13.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -465.429963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.429963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.429963 (E_RNA) where: Base-Base interactions energy: -247.363 where: short stacking energy: -147.723 Base-Backbone interact. energy: -0.885 local terms energy: -217.182440 where: bonds (distance) C4'-P energy: -48.452 bonds (distance) P-C4' energy: -50.858 flat angles C4'-P-C4' energy: -49.930 flat angles P-C4'-P energy: -29.125 tors. eta vs tors. theta energy: -38.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -496.914664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.914664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.914664 (E_RNA) where: Base-Base interactions energy: -293.082 where: short stacking energy: -140.331 Base-Backbone interact. energy: -1.428 local terms energy: -202.404872 where: bonds (distance) C4'-P energy: -36.334 bonds (distance) P-C4' energy: -48.927 flat angles C4'-P-C4' energy: -49.114 flat angles P-C4'-P energy: -35.402 tors. eta vs tors. theta energy: -32.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -417.368551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.368551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.368551 (E_RNA) where: Base-Base interactions energy: -217.508 where: short stacking energy: -138.442 Base-Backbone interact. energy: -1.124 local terms energy: -198.736685 where: bonds (distance) C4'-P energy: -44.156 bonds (distance) P-C4' energy: -45.271 flat angles C4'-P-C4' energy: -45.619 flat angles P-C4'-P energy: -36.368 tors. eta vs tors. theta energy: -27.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -343.279179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.279179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.279179 (E_RNA) where: Base-Base interactions energy: -172.432 where: short stacking energy: -106.399 Base-Backbone interact. energy: -1.685 local terms energy: -169.162682 where: bonds (distance) C4'-P energy: -33.588 bonds (distance) P-C4' energy: -47.843 flat angles C4'-P-C4' energy: -40.944 flat angles P-C4'-P energy: -25.531 tors. eta vs tors. theta energy: -21.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -295.299734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.299734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.299734 (E_RNA) where: Base-Base interactions energy: -137.540 where: short stacking energy: -87.394 Base-Backbone interact. energy: 1.461 local terms energy: -159.220478 where: bonds (distance) C4'-P energy: -40.128 bonds (distance) P-C4' energy: -46.248 flat angles C4'-P-C4' energy: -36.662 flat angles P-C4'-P energy: -28.166 tors. eta vs tors. theta energy: -8.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -306.396717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.396717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.396717 (E_RNA) where: Base-Base interactions energy: -136.621 where: short stacking energy: -83.483 Base-Backbone interact. energy: -0.469 local terms energy: -169.306337 where: bonds (distance) C4'-P energy: -39.457 bonds (distance) P-C4' energy: -52.228 flat angles C4'-P-C4' energy: -38.108 flat angles P-C4'-P energy: -25.016 tors. eta vs tors. theta energy: -14.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -322.571301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.571301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.571301 (E_RNA) where: Base-Base interactions energy: -179.951 where: short stacking energy: -85.915 Base-Backbone interact. energy: -1.255 local terms energy: -141.365245 where: bonds (distance) C4'-P energy: -39.214 bonds (distance) P-C4' energy: -41.315 flat angles C4'-P-C4' energy: -35.685 flat angles P-C4'-P energy: -15.320 tors. eta vs tors. theta energy: -9.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -227.101914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.101914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.101914 (E_RNA) where: Base-Base interactions energy: -91.355 where: short stacking energy: -84.701 Base-Backbone interact. energy: -0.945 local terms energy: -134.801392 where: bonds (distance) C4'-P energy: -34.174 bonds (distance) P-C4' energy: -33.306 flat angles C4'-P-C4' energy: -37.531 flat angles P-C4'-P energy: -18.188 tors. eta vs tors. theta energy: -11.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -273.057969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.057969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.057969 (E_RNA) where: Base-Base interactions energy: -125.624 where: short stacking energy: -74.476 Base-Backbone interact. energy: -0.927 local terms energy: -146.507451 where: bonds (distance) C4'-P energy: -37.964 bonds (distance) P-C4' energy: -34.969 flat angles C4'-P-C4' energy: -40.778 flat angles P-C4'-P energy: -22.583 tors. eta vs tors. theta energy: -10.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -195.458492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.458492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.458492 (E_RNA) where: Base-Base interactions energy: -72.894 where: short stacking energy: -56.683 Base-Backbone interact. energy: 1.313 local terms energy: -123.877482 where: bonds (distance) C4'-P energy: -40.592 bonds (distance) P-C4' energy: -41.933 flat angles C4'-P-C4' energy: -37.749 flat angles P-C4'-P energy: -1.951 tors. eta vs tors. theta energy: -1.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -544.594795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.594795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.594795 (E_RNA) where: Base-Base interactions energy: -323.722 where: short stacking energy: -171.670 Base-Backbone interact. energy: -2.009 local terms energy: -218.862996 where: bonds (distance) C4'-P energy: -50.985 bonds (distance) P-C4' energy: -45.359 flat angles C4'-P-C4' energy: -55.756 flat angles P-C4'-P energy: -29.788 tors. eta vs tors. theta energy: -36.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -494.956590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.956590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.956590 (E_RNA) where: Base-Base interactions energy: -279.981 where: short stacking energy: -143.963 Base-Backbone interact. energy: -1.364 local terms energy: -213.611894 where: bonds (distance) C4'-P energy: -45.344 bonds (distance) P-C4' energy: -42.005 flat angles C4'-P-C4' energy: -52.145 flat angles P-C4'-P energy: -36.737 tors. eta vs tors. theta energy: -37.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -412.307588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.307588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.307588 (E_RNA) where: Base-Base interactions energy: -231.826 where: short stacking energy: -112.081 Base-Backbone interact. energy: 1.282 local terms energy: -181.763231 where: bonds (distance) C4'-P energy: -45.532 bonds (distance) P-C4' energy: -38.495 flat angles C4'-P-C4' energy: -43.451 flat angles P-C4'-P energy: -29.840 tors. eta vs tors. theta energy: -24.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -384.771470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.771470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.771470 (E_RNA) where: Base-Base interactions energy: -205.903 where: short stacking energy: -130.898 Base-Backbone interact. energy: 0.067 local terms energy: -178.935179 where: bonds (distance) C4'-P energy: -46.248 bonds (distance) P-C4' energy: -46.933 flat angles C4'-P-C4' energy: -38.480 flat angles P-C4'-P energy: -25.722 tors. eta vs tors. theta energy: -21.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -311.200907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.200907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.200907 (E_RNA) where: Base-Base interactions energy: -157.870 where: short stacking energy: -104.798 Base-Backbone interact. energy: -0.332 local terms energy: -152.998867 where: bonds (distance) C4'-P energy: -44.340 bonds (distance) P-C4' energy: -33.598 flat angles C4'-P-C4' energy: -35.358 flat angles P-C4'-P energy: -23.830 tors. eta vs tors. theta energy: -15.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -295.053365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.053365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.053365 (E_RNA) where: Base-Base interactions energy: -128.810 where: short stacking energy: -82.948 Base-Backbone interact. energy: -0.765 local terms energy: -165.478701 where: bonds (distance) C4'-P energy: -47.886 bonds (distance) P-C4' energy: -43.179 flat angles C4'-P-C4' energy: -36.396 flat angles P-C4'-P energy: -24.641 tors. eta vs tors. theta energy: -13.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -246.417358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.417358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.417358 (E_RNA) where: Base-Base interactions energy: -84.699 where: short stacking energy: -86.127 Base-Backbone interact. energy: -0.041 local terms energy: -161.677026 where: bonds (distance) C4'-P energy: -43.885 bonds (distance) P-C4' energy: -43.301 flat angles C4'-P-C4' energy: -42.531 flat angles P-C4'-P energy: -19.848 tors. eta vs tors. theta energy: -12.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -263.150435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.150435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.150435 (E_RNA) where: Base-Base interactions energy: -106.907 where: short stacking energy: -64.043 Base-Backbone interact. energy: -2.845 local terms energy: -153.398447 where: bonds (distance) C4'-P energy: -45.218 bonds (distance) P-C4' energy: -45.918 flat angles C4'-P-C4' energy: -37.291 flat angles P-C4'-P energy: -18.257 tors. eta vs tors. theta energy: -6.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -308.065078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.065078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.065078 (E_RNA) where: Base-Base interactions energy: -157.721 where: short stacking energy: -88.130 Base-Backbone interact. energy: -0.355 local terms energy: -149.989440 where: bonds (distance) C4'-P energy: -42.480 bonds (distance) P-C4' energy: -33.669 flat angles C4'-P-C4' energy: -34.169 flat angles P-C4'-P energy: -28.151 tors. eta vs tors. theta energy: -11.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -191.273971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.273971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.273971 (E_RNA) where: Base-Base interactions energy: -75.212 where: short stacking energy: -48.254 Base-Backbone interact. energy: -1.476 local terms energy: -114.586607 where: bonds (distance) C4'-P energy: -31.715 bonds (distance) P-C4' energy: -44.678 flat angles C4'-P-C4' energy: -33.699 flat angles P-C4'-P energy: -17.359 tors. eta vs tors. theta energy: 12.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -575.812192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.812192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.812192 (E_RNA) where: Base-Base interactions energy: -354.230 where: short stacking energy: -165.219 Base-Backbone interact. energy: -0.591 local terms energy: -220.991848 where: bonds (distance) C4'-P energy: -48.028 bonds (distance) P-C4' energy: -53.139 flat angles C4'-P-C4' energy: -47.218 flat angles P-C4'-P energy: -30.099 tors. eta vs tors. theta energy: -42.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -516.945331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.945331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.945331 (E_RNA) where: Base-Base interactions energy: -302.171 where: short stacking energy: -146.128 Base-Backbone interact. energy: -0.995 local terms energy: -213.779116 where: bonds (distance) C4'-P energy: -53.119 bonds (distance) P-C4' energy: -45.776 flat angles C4'-P-C4' energy: -41.367 flat angles P-C4'-P energy: -37.186 tors. eta vs tors. theta energy: -36.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -422.703906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.703906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.703906 (E_RNA) where: Base-Base interactions energy: -246.363 where: short stacking energy: -118.597 Base-Backbone interact. energy: 0.255 local terms energy: -176.596004 where: bonds (distance) C4'-P energy: -44.044 bonds (distance) P-C4' energy: -31.503 flat angles C4'-P-C4' energy: -46.839 flat angles P-C4'-P energy: -30.287 tors. eta vs tors. theta energy: -23.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -415.949157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.949157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.949157 (E_RNA) where: Base-Base interactions energy: -226.566 where: short stacking energy: -131.379 Base-Backbone interact. energy: -0.741 local terms energy: -188.641750 where: bonds (distance) C4'-P energy: -40.982 bonds (distance) P-C4' energy: -50.724 flat angles C4'-P-C4' energy: -51.014 flat angles P-C4'-P energy: -21.381 tors. eta vs tors. theta energy: -24.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -290.338933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.338933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.338933 (E_RNA) where: Base-Base interactions energy: -133.474 where: short stacking energy: -89.837 Base-Backbone interact. energy: -2.550 local terms energy: -154.315300 where: bonds (distance) C4'-P energy: -42.184 bonds (distance) P-C4' energy: -41.616 flat angles C4'-P-C4' energy: -43.822 flat angles P-C4'-P energy: -22.478 tors. eta vs tors. theta energy: -4.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -269.523840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.523840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.523840 (E_RNA) where: Base-Base interactions energy: -114.573 where: short stacking energy: -90.263 Base-Backbone interact. energy: -1.418 local terms energy: -153.532852 where: bonds (distance) C4'-P energy: -37.685 bonds (distance) P-C4' energy: -45.677 flat angles C4'-P-C4' energy: -37.612 flat angles P-C4'-P energy: -22.348 tors. eta vs tors. theta energy: -10.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -242.299415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.299415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.299415 (E_RNA) where: Base-Base interactions energy: -97.647 where: short stacking energy: -71.451 Base-Backbone interact. energy: 1.813 local terms energy: -146.465994 where: bonds (distance) C4'-P energy: -38.681 bonds (distance) P-C4' energy: -44.103 flat angles C4'-P-C4' energy: -36.686 flat angles P-C4'-P energy: -24.897 tors. eta vs tors. theta energy: -2.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -304.515363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.515363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.515363 (E_RNA) where: Base-Base interactions energy: -152.199 where: short stacking energy: -84.354 Base-Backbone interact. energy: 1.374 local terms energy: -153.689951 where: bonds (distance) C4'-P energy: -39.920 bonds (distance) P-C4' energy: -37.414 flat angles C4'-P-C4' energy: -34.534 flat angles P-C4'-P energy: -25.085 tors. eta vs tors. theta energy: -16.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -225.697879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.697879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.697879 (E_RNA) where: Base-Base interactions energy: -94.674 where: short stacking energy: -76.597 Base-Backbone interact. energy: 0.542 local terms energy: -131.565660 where: bonds (distance) C4'-P energy: -39.837 bonds (distance) P-C4' energy: -45.979 flat angles C4'-P-C4' energy: -37.428 flat angles P-C4'-P energy: -12.282 tors. eta vs tors. theta energy: 3.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -195.323392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.323392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.323392 (E_RNA) where: Base-Base interactions energy: -55.708 where: short stacking energy: -49.247 Base-Backbone interact. energy: -1.500 local terms energy: -138.114790 where: bonds (distance) C4'-P energy: -42.505 bonds (distance) P-C4' energy: -40.306 flat angles C4'-P-C4' energy: -30.124 flat angles P-C4'-P energy: -34.402 tors. eta vs tors. theta energy: 9.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -621.697244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.697244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.697244 (E_RNA) where: Base-Base interactions energy: -396.257 where: short stacking energy: -187.396 Base-Backbone interact. energy: -0.856 local terms energy: -224.584410 where: bonds (distance) C4'-P energy: -48.409 bonds (distance) P-C4' energy: -47.971 flat angles C4'-P-C4' energy: -48.949 flat angles P-C4'-P energy: -28.403 tors. eta vs tors. theta energy: -50.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -526.255906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.255906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.255906 (E_RNA) where: Base-Base interactions energy: -318.035 where: short stacking energy: -134.166 Base-Backbone interact. energy: -1.047 local terms energy: -207.174207 where: bonds (distance) C4'-P energy: -48.593 bonds (distance) P-C4' energy: -46.641 flat angles C4'-P-C4' energy: -45.931 flat angles P-C4'-P energy: -33.301 tors. eta vs tors. theta energy: -32.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -490.919184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.919184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.919184 (E_RNA) where: Base-Base interactions energy: -297.403 where: short stacking energy: -153.395 Base-Backbone interact. energy: -0.635 local terms energy: -192.880578 where: bonds (distance) C4'-P energy: -41.684 bonds (distance) P-C4' energy: -38.696 flat angles C4'-P-C4' energy: -40.972 flat angles P-C4'-P energy: -26.872 tors. eta vs tors. theta energy: -44.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -434.938855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.938855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.938855 (E_RNA) where: Base-Base interactions energy: -229.879 where: short stacking energy: -134.884 Base-Backbone interact. energy: 3.717 local terms energy: -208.776154 where: bonds (distance) C4'-P energy: -42.700 bonds (distance) P-C4' energy: -45.889 flat angles C4'-P-C4' energy: -49.487 flat angles P-C4'-P energy: -38.575 tors. eta vs tors. theta energy: -32.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -328.737381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.737381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.737381 (E_RNA) where: Base-Base interactions energy: -162.214 where: short stacking energy: -72.519 Base-Backbone interact. energy: 0.376 local terms energy: -166.899213 where: bonds (distance) C4'-P energy: -46.239 bonds (distance) P-C4' energy: -44.295 flat angles C4'-P-C4' energy: -41.795 flat angles P-C4'-P energy: -20.982 tors. eta vs tors. theta energy: -13.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -293.021627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.021627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.021627 (E_RNA) where: Base-Base interactions energy: -134.778 where: short stacking energy: -91.003 Base-Backbone interact. energy: -0.949 local terms energy: -157.294095 where: bonds (distance) C4'-P energy: -37.818 bonds (distance) P-C4' energy: -44.647 flat angles C4'-P-C4' energy: -42.371 flat angles P-C4'-P energy: -20.014 tors. eta vs tors. theta energy: -12.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -323.492028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.492028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.492028 (E_RNA) where: Base-Base interactions energy: -164.882 where: short stacking energy: -91.726 Base-Backbone interact. energy: -0.611 local terms energy: -157.998830 where: bonds (distance) C4'-P energy: -43.805 bonds (distance) P-C4' energy: -31.341 flat angles C4'-P-C4' energy: -45.921 flat angles P-C4'-P energy: -22.033 tors. eta vs tors. theta energy: -14.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -245.549032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.549032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.549032 (E_RNA) where: Base-Base interactions energy: -74.782 where: short stacking energy: -71.028 Base-Backbone interact. energy: -1.494 local terms energy: -169.273106 where: bonds (distance) C4'-P energy: -35.058 bonds (distance) P-C4' energy: -44.828 flat angles C4'-P-C4' energy: -49.182 flat angles P-C4'-P energy: -30.133 tors. eta vs tors. theta energy: -10.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -202.340259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.340259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.340259 (E_RNA) where: Base-Base interactions energy: -67.966 where: short stacking energy: -58.754 Base-Backbone interact. energy: 0.028 local terms energy: -134.402159 where: bonds (distance) C4'-P energy: -40.093 bonds (distance) P-C4' energy: -43.352 flat angles C4'-P-C4' energy: -39.270 flat angles P-C4'-P energy: -18.684 tors. eta vs tors. theta energy: 6.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -208.729641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.729641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.729641 (E_RNA) where: Base-Base interactions energy: -69.058 where: short stacking energy: -54.281 Base-Backbone interact. energy: -2.093 local terms energy: -137.578611 where: bonds (distance) C4'-P energy: -41.125 bonds (distance) P-C4' energy: -32.259 flat angles C4'-P-C4' energy: -35.537 flat angles P-C4'-P energy: -24.008 tors. eta vs tors. theta energy: -4.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -659.365892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.365892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.365892 (E_RNA) where: Base-Base interactions energy: -431.346 where: short stacking energy: -190.488 Base-Backbone interact. energy: -1.876 local terms energy: -226.143878 where: bonds (distance) C4'-P energy: -49.261 bonds (distance) P-C4' energy: -44.187 flat angles C4'-P-C4' energy: -50.410 flat angles P-C4'-P energy: -25.907 tors. eta vs tors. theta energy: -56.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -562.171442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.171442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.171442 (E_RNA) where: Base-Base interactions energy: -351.793 where: short stacking energy: -183.155 Base-Backbone interact. energy: -0.271 local terms energy: -210.107344 where: bonds (distance) C4'-P energy: -50.743 bonds (distance) P-C4' energy: -46.430 flat angles C4'-P-C4' energy: -33.982 flat angles P-C4'-P energy: -31.189 tors. eta vs tors. theta energy: -47.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -531.875351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.875351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.875351 (E_RNA) where: Base-Base interactions energy: -334.318 where: short stacking energy: -158.264 Base-Backbone interact. energy: -0.391 local terms energy: -197.165507 where: bonds (distance) C4'-P energy: -38.625 bonds (distance) P-C4' energy: -39.834 flat angles C4'-P-C4' energy: -46.598 flat angles P-C4'-P energy: -30.462 tors. eta vs tors. theta energy: -41.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -369.068359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.068359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.068359 (E_RNA) where: Base-Base interactions energy: -213.605 where: short stacking energy: -114.953 Base-Backbone interact. energy: -0.930 local terms energy: -154.532751 where: bonds (distance) C4'-P energy: -33.484 bonds (distance) P-C4' energy: -43.400 flat angles C4'-P-C4' energy: -43.905 flat angles P-C4'-P energy: -23.785 tors. eta vs tors. theta energy: -9.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -405.787950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.787950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.787950 (E_RNA) where: Base-Base interactions energy: -239.156 where: short stacking energy: -117.302 Base-Backbone interact. energy: -1.578 local terms energy: -165.054173 where: bonds (distance) C4'-P energy: -30.647 bonds (distance) P-C4' energy: -44.149 flat angles C4'-P-C4' energy: -44.673 flat angles P-C4'-P energy: -21.831 tors. eta vs tors. theta energy: -23.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -356.703379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.703379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.703379 (E_RNA) where: Base-Base interactions energy: -185.307 where: short stacking energy: -118.109 Base-Backbone interact. energy: -1.972 local terms energy: -169.424407 where: bonds (distance) C4'-P energy: -47.113 bonds (distance) P-C4' energy: -35.153 flat angles C4'-P-C4' energy: -44.737 flat angles P-C4'-P energy: -24.596 tors. eta vs tors. theta energy: -17.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -275.898936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.898936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.898936 (E_RNA) where: Base-Base interactions energy: -129.570 where: short stacking energy: -71.249 Base-Backbone interact. energy: -2.965 local terms energy: -143.364231 where: bonds (distance) C4'-P energy: -50.091 bonds (distance) P-C4' energy: -39.386 flat angles C4'-P-C4' energy: -38.913 flat angles P-C4'-P energy: -14.915 tors. eta vs tors. theta energy: -0.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -228.000402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.000402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.000402 (E_RNA) where: Base-Base interactions energy: -76.030 where: short stacking energy: -48.583 Base-Backbone interact. energy: -0.590 local terms energy: -151.379988 where: bonds (distance) C4'-P energy: -44.807 bonds (distance) P-C4' energy: -40.066 flat angles C4'-P-C4' energy: -39.048 flat angles P-C4'-P energy: -20.783 tors. eta vs tors. theta energy: -6.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -208.758717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.758717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.758717 (E_RNA) where: Base-Base interactions energy: -83.018 where: short stacking energy: -71.874 Base-Backbone interact. energy: 4.680 local terms energy: -130.421145 where: bonds (distance) C4'-P energy: -38.665 bonds (distance) P-C4' energy: -40.921 flat angles C4'-P-C4' energy: -33.352 flat angles P-C4'-P energy: -14.268 tors. eta vs tors. theta energy: -3.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -191.439276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.439276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.439276 (E_RNA) where: Base-Base interactions energy: -55.674 where: short stacking energy: -49.868 Base-Backbone interact. energy: -1.908 local terms energy: -133.857294 where: bonds (distance) C4'-P energy: -35.039 bonds (distance) P-C4' energy: -37.792 flat angles C4'-P-C4' energy: -35.639 flat angles P-C4'-P energy: -21.932 tors. eta vs tors. theta energy: -3.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -681.251590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.251590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.251590 (E_RNA) where: Base-Base interactions energy: -442.592 where: short stacking energy: -189.254 Base-Backbone interact. energy: -0.444 local terms energy: -238.215338 where: bonds (distance) C4'-P energy: -50.231 bonds (distance) P-C4' energy: -48.788 flat angles C4'-P-C4' energy: -46.989 flat angles P-C4'-P energy: -34.254 tors. eta vs tors. theta energy: -57.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -581.687542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.687542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.687542 (E_RNA) where: Base-Base interactions energy: -372.169 where: short stacking energy: -159.863 Base-Backbone interact. energy: 0.201 local terms energy: -209.719828 where: bonds (distance) C4'-P energy: -48.992 bonds (distance) P-C4' energy: -45.314 flat angles C4'-P-C4' energy: -47.592 flat angles P-C4'-P energy: -26.186 tors. eta vs tors. theta energy: -41.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -518.221822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.221822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.221822 (E_RNA) where: Base-Base interactions energy: -323.002 where: short stacking energy: -158.250 Base-Backbone interact. energy: 6.018 local terms energy: -201.237521 where: bonds (distance) C4'-P energy: -45.092 bonds (distance) P-C4' energy: -46.698 flat angles C4'-P-C4' energy: -35.348 flat angles P-C4'-P energy: -26.704 tors. eta vs tors. theta energy: -47.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -416.892535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.892535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.892535 (E_RNA) where: Base-Base interactions energy: -240.825 where: short stacking energy: -117.992 Base-Backbone interact. energy: 1.299 local terms energy: -177.367152 where: bonds (distance) C4'-P energy: -41.295 bonds (distance) P-C4' energy: -39.784 flat angles C4'-P-C4' energy: -45.264 flat angles P-C4'-P energy: -25.360 tors. eta vs tors. theta energy: -25.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -366.500423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.500423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.500423 (E_RNA) where: Base-Base interactions energy: -205.995 where: short stacking energy: -122.664 Base-Backbone interact. energy: 0.231 local terms energy: -160.736468 where: bonds (distance) C4'-P energy: -41.362 bonds (distance) P-C4' energy: -37.971 flat angles C4'-P-C4' energy: -34.562 flat angles P-C4'-P energy: -19.909 tors. eta vs tors. theta energy: -26.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -349.302898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.302898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.302898 (E_RNA) where: Base-Base interactions energy: -180.650 where: short stacking energy: -115.129 Base-Backbone interact. energy: -1.371 local terms energy: -167.281218 where: bonds (distance) C4'-P energy: -40.513 bonds (distance) P-C4' energy: -44.507 flat angles C4'-P-C4' energy: -37.234 flat angles P-C4'-P energy: -26.824 tors. eta vs tors. theta energy: -18.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -295.270024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.270024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.270024 (E_RNA) where: Base-Base interactions energy: -136.184 where: short stacking energy: -80.972 Base-Backbone interact. energy: -0.437 local terms energy: -158.648394 where: bonds (distance) C4'-P energy: -38.962 bonds (distance) P-C4' energy: -46.366 flat angles C4'-P-C4' energy: -41.529 flat angles P-C4'-P energy: -22.268 tors. eta vs tors. theta energy: -9.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -221.042693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.042693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.042693 (E_RNA) where: Base-Base interactions energy: -65.665 where: short stacking energy: -59.300 Base-Backbone interact. energy: -0.544 local terms energy: -154.833816 where: bonds (distance) C4'-P energy: -41.429 bonds (distance) P-C4' energy: -44.426 flat angles C4'-P-C4' energy: -41.608 flat angles P-C4'-P energy: -26.806 tors. eta vs tors. theta energy: -0.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -195.851795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.851795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.851795 (E_RNA) where: Base-Base interactions energy: -66.648 where: short stacking energy: -49.572 Base-Backbone interact. energy: -0.581 local terms energy: -128.623017 where: bonds (distance) C4'-P energy: -39.565 bonds (distance) P-C4' energy: -45.053 flat angles C4'-P-C4' energy: -31.228 flat angles P-C4'-P energy: -18.273 tors. eta vs tors. theta energy: 5.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -193.269283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.269283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.269283 (E_RNA) where: Base-Base interactions energy: -72.312 where: short stacking energy: -57.635 Base-Backbone interact. energy: 1.748 local terms energy: -122.704672 where: bonds (distance) C4'-P energy: -38.012 bonds (distance) P-C4' energy: -34.767 flat angles C4'-P-C4' energy: -32.456 flat angles P-C4'-P energy: -14.154 tors. eta vs tors. theta energy: -3.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -682.438653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.438653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.438653 (E_RNA) where: Base-Base interactions energy: -440.851 where: short stacking energy: -213.060 Base-Backbone interact. energy: 0.276 local terms energy: -241.863405 where: bonds (distance) C4'-P energy: -46.426 bonds (distance) P-C4' energy: -54.514 flat angles C4'-P-C4' energy: -43.606 flat angles P-C4'-P energy: -35.348 tors. eta vs tors. theta energy: -61.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -643.944651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.944651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.944651 (E_RNA) where: Base-Base interactions energy: -429.034 where: short stacking energy: -191.550 Base-Backbone interact. energy: -2.551 local terms energy: -212.360199 where: bonds (distance) C4'-P energy: -44.182 bonds (distance) P-C4' energy: -36.690 flat angles C4'-P-C4' energy: -52.496 flat angles P-C4'-P energy: -30.716 tors. eta vs tors. theta energy: -48.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -560.768416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.768416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.768416 (E_RNA) where: Base-Base interactions energy: -348.813 where: short stacking energy: -174.359 Base-Backbone interact. energy: -1.009 local terms energy: -210.946673 where: bonds (distance) C4'-P energy: -45.825 bonds (distance) P-C4' energy: -49.896 flat angles C4'-P-C4' energy: -44.966 flat angles P-C4'-P energy: -20.009 tors. eta vs tors. theta energy: -50.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -452.120180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.120180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.120180 (E_RNA) where: Base-Base interactions energy: -253.643 where: short stacking energy: -138.103 Base-Backbone interact. energy: -0.846 local terms energy: -197.630959 where: bonds (distance) C4'-P energy: -42.383 bonds (distance) P-C4' energy: -47.497 flat angles C4'-P-C4' energy: -48.480 flat angles P-C4'-P energy: -26.589 tors. eta vs tors. theta energy: -32.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -402.479461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.479461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.479461 (E_RNA) where: Base-Base interactions energy: -225.988 where: short stacking energy: -126.304 Base-Backbone interact. energy: -1.324 local terms energy: -175.166699 where: bonds (distance) C4'-P energy: -51.174 bonds (distance) P-C4' energy: -43.514 flat angles C4'-P-C4' energy: -43.666 flat angles P-C4'-P energy: -21.818 tors. eta vs tors. theta energy: -14.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -377.207573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.207573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.207573 (E_RNA) where: Base-Base interactions energy: -196.911 where: short stacking energy: -119.808 Base-Backbone interact. energy: -1.200 local terms energy: -179.096978 where: bonds (distance) C4'-P energy: -44.304 bonds (distance) P-C4' energy: -44.283 flat angles C4'-P-C4' energy: -48.407 flat angles P-C4'-P energy: -20.225 tors. eta vs tors. theta energy: -21.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -241.173717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.173717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.173717 (E_RNA) where: Base-Base interactions energy: -85.585 where: short stacking energy: -61.120 Base-Backbone interact. energy: 2.529 local terms energy: -158.117729 where: bonds (distance) C4'-P energy: -46.705 bonds (distance) P-C4' energy: -47.642 flat angles C4'-P-C4' energy: -36.794 flat angles P-C4'-P energy: -25.884 tors. eta vs tors. theta energy: -1.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -214.671282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.671282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.671282 (E_RNA) where: Base-Base interactions energy: -58.676 where: short stacking energy: -56.145 Base-Backbone interact. energy: -0.495 local terms energy: -155.500432 where: bonds (distance) C4'-P energy: -41.472 bonds (distance) P-C4' energy: -39.633 flat angles C4'-P-C4' energy: -36.239 flat angles P-C4'-P energy: -28.140 tors. eta vs tors. theta energy: -10.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -227.713835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.713835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.713835 (E_RNA) where: Base-Base interactions energy: -92.804 where: short stacking energy: -88.614 Base-Backbone interact. energy: -0.855 local terms energy: -134.054451 where: bonds (distance) C4'-P energy: -23.979 bonds (distance) P-C4' energy: -33.090 flat angles C4'-P-C4' energy: -39.593 flat angles P-C4'-P energy: -22.216 tors. eta vs tors. theta energy: -15.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -200.481555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.481555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.481555 (E_RNA) where: Base-Base interactions energy: -71.900 where: short stacking energy: -60.769 Base-Backbone interact. energy: -0.920 local terms energy: -127.661814 where: bonds (distance) C4'-P energy: -27.883 bonds (distance) P-C4' energy: -42.065 flat angles C4'-P-C4' energy: -36.314 flat angles P-C4'-P energy: -20.604 tors. eta vs tors. theta energy: -0.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -667.046202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.046202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.046202 (E_RNA) where: Base-Base interactions energy: -428.165 where: short stacking energy: -195.596 Base-Backbone interact. energy: -0.089 local terms energy: -238.792334 where: bonds (distance) C4'-P energy: -43.069 bonds (distance) P-C4' energy: -48.946 flat angles C4'-P-C4' energy: -53.327 flat angles P-C4'-P energy: -35.421 tors. eta vs tors. theta energy: -58.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -620.736542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.736542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.736542 (E_RNA) where: Base-Base interactions energy: -393.902 where: short stacking energy: -175.757 Base-Backbone interact. energy: -0.686 local terms energy: -226.148762 where: bonds (distance) C4'-P energy: -53.952 bonds (distance) P-C4' energy: -45.307 flat angles C4'-P-C4' energy: -51.474 flat angles P-C4'-P energy: -29.195 tors. eta vs tors. theta energy: -46.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -565.912256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.912256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.912256 (E_RNA) where: Base-Base interactions energy: -360.478 where: short stacking energy: -167.571 Base-Backbone interact. energy: -1.641 local terms energy: -203.793415 where: bonds (distance) C4'-P energy: -43.278 bonds (distance) P-C4' energy: -42.152 flat angles C4'-P-C4' energy: -37.539 flat angles P-C4'-P energy: -30.294 tors. eta vs tors. theta energy: -50.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -441.032709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.032709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.032709 (E_RNA) where: Base-Base interactions energy: -263.820 where: short stacking energy: -134.162 Base-Backbone interact. energy: -3.480 local terms energy: -173.731825 where: bonds (distance) C4'-P energy: -32.638 bonds (distance) P-C4' energy: -39.476 flat angles C4'-P-C4' energy: -36.592 flat angles P-C4'-P energy: -35.554 tors. eta vs tors. theta energy: -29.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -374.932715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.932715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.932715 (E_RNA) where: Base-Base interactions energy: -199.558 where: short stacking energy: -113.395 Base-Backbone interact. energy: -0.234 local terms energy: -175.140797 where: bonds (distance) C4'-P energy: -33.885 bonds (distance) P-C4' energy: -45.516 flat angles C4'-P-C4' energy: -48.639 flat angles P-C4'-P energy: -22.408 tors. eta vs tors. theta energy: -24.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -424.796605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.796605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.796605 (E_RNA) where: Base-Base interactions energy: -247.291 where: short stacking energy: -121.487 Base-Backbone interact. energy: -1.788 local terms energy: -175.717853 where: bonds (distance) C4'-P energy: -46.203 bonds (distance) P-C4' energy: -38.145 flat angles C4'-P-C4' energy: -44.160 flat angles P-C4'-P energy: -20.616 tors. eta vs tors. theta energy: -26.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -280.245435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.245435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.245435 (E_RNA) where: Base-Base interactions energy: -115.155 where: short stacking energy: -80.820 Base-Backbone interact. energy: -1.188 local terms energy: -163.902462 where: bonds (distance) C4'-P energy: -43.399 bonds (distance) P-C4' energy: -48.106 flat angles C4'-P-C4' energy: -45.000 flat angles P-C4'-P energy: -17.532 tors. eta vs tors. theta energy: -9.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -235.249551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.249551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.249551 (E_RNA) where: Base-Base interactions energy: -115.288 where: short stacking energy: -76.839 Base-Backbone interact. energy: 0.577 local terms energy: -120.538804 where: bonds (distance) C4'-P energy: -27.729 bonds (distance) P-C4' energy: -36.124 flat angles C4'-P-C4' energy: -34.489 flat angles P-C4'-P energy: -19.559 tors. eta vs tors. theta energy: -2.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -196.201999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.201999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.201999 (E_RNA) where: Base-Base interactions energy: -54.583 where: short stacking energy: -52.901 Base-Backbone interact. energy: -0.637 local terms energy: -140.981581 where: bonds (distance) C4'-P energy: -46.708 bonds (distance) P-C4' energy: -43.185 flat angles C4'-P-C4' energy: -33.263 flat angles P-C4'-P energy: -14.498 tors. eta vs tors. theta energy: -3.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -185.681413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.681413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.681413 (E_RNA) where: Base-Base interactions energy: -64.778 where: short stacking energy: -51.265 Base-Backbone interact. energy: 0.305 local terms energy: -121.208612 where: bonds (distance) C4'-P energy: -38.875 bonds (distance) P-C4' energy: -34.746 flat angles C4'-P-C4' energy: -25.094 flat angles P-C4'-P energy: -21.035 tors. eta vs tors. theta energy: -1.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -678.363458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.363458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.363458 (E_RNA) where: Base-Base interactions energy: -444.737 where: short stacking energy: -200.034 Base-Backbone interact. energy: -1.402 local terms energy: -232.224655 where: bonds (distance) C4'-P energy: -43.614 bonds (distance) P-C4' energy: -41.892 flat angles C4'-P-C4' energy: -54.927 flat angles P-C4'-P energy: -34.261 tors. eta vs tors. theta energy: -57.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -627.807950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.807950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.807950 (E_RNA) where: Base-Base interactions energy: -413.361 where: short stacking energy: -167.653 Base-Backbone interact. energy: -2.264 local terms energy: -212.182637 where: bonds (distance) C4'-P energy: -46.938 bonds (distance) P-C4' energy: -47.028 flat angles C4'-P-C4' energy: -45.436 flat angles P-C4'-P energy: -28.363 tors. eta vs tors. theta energy: -44.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -573.955760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.955760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.955760 (E_RNA) where: Base-Base interactions energy: -348.649 where: short stacking energy: -181.716 Base-Backbone interact. energy: -0.436 local terms energy: -224.871225 where: bonds (distance) C4'-P energy: -51.318 bonds (distance) P-C4' energy: -46.591 flat angles C4'-P-C4' energy: -49.394 flat angles P-C4'-P energy: -30.146 tors. eta vs tors. theta energy: -47.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -439.760500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.760500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.760500 (E_RNA) where: Base-Base interactions energy: -249.203 where: short stacking energy: -130.352 Base-Backbone interact. energy: -0.201 local terms energy: -190.356586 where: bonds (distance) C4'-P energy: -53.224 bonds (distance) P-C4' energy: -39.022 flat angles C4'-P-C4' energy: -34.249 flat angles P-C4'-P energy: -34.754 tors. eta vs tors. theta energy: -29.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -365.039788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.039788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.039788 (E_RNA) where: Base-Base interactions energy: -179.190 where: short stacking energy: -108.166 Base-Backbone interact. energy: -0.377 local terms energy: -185.472425 where: bonds (distance) C4'-P energy: -50.660 bonds (distance) P-C4' energy: -47.403 flat angles C4'-P-C4' energy: -51.104 flat angles P-C4'-P energy: -26.880 tors. eta vs tors. theta energy: -9.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -417.778556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.778556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.778556 (E_RNA) where: Base-Base interactions energy: -244.593 where: short stacking energy: -122.707 Base-Backbone interact. energy: 0.511 local terms energy: -173.696647 where: bonds (distance) C4'-P energy: -41.241 bonds (distance) P-C4' energy: -44.737 flat angles C4'-P-C4' energy: -33.916 flat angles P-C4'-P energy: -26.291 tors. eta vs tors. theta energy: -27.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -235.690473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.690473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.690473 (E_RNA) where: Base-Base interactions energy: -99.369 where: short stacking energy: -61.591 Base-Backbone interact. energy: 3.619 local terms energy: -139.941073 where: bonds (distance) C4'-P energy: -40.977 bonds (distance) P-C4' energy: -44.220 flat angles C4'-P-C4' energy: -34.673 flat angles P-C4'-P energy: -21.663 tors. eta vs tors. theta energy: 1.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -208.727272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.727272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.727272 (E_RNA) where: Base-Base interactions energy: -70.527 where: short stacking energy: -54.579 Base-Backbone interact. energy: -2.063 local terms energy: -136.137003 where: bonds (distance) C4'-P energy: -35.893 bonds (distance) P-C4' energy: -48.282 flat angles C4'-P-C4' energy: -38.084 flat angles P-C4'-P energy: -23.960 tors. eta vs tors. theta energy: 10.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -216.227908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.227908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.227908 (E_RNA) where: Base-Base interactions energy: -100.198 where: short stacking energy: -73.905 Base-Backbone interact. energy: -1.042 local terms energy: -114.987735 where: bonds (distance) C4'-P energy: -39.159 bonds (distance) P-C4' energy: -27.781 flat angles C4'-P-C4' energy: -34.321 flat angles P-C4'-P energy: -25.766 tors. eta vs tors. theta energy: 12.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -176.464482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.464482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.464482 (E_RNA) where: Base-Base interactions energy: -56.120 where: short stacking energy: -44.055 Base-Backbone interact. energy: 0.278 local terms energy: -120.622110 where: bonds (distance) C4'-P energy: -35.820 bonds (distance) P-C4' energy: -31.482 flat angles C4'-P-C4' energy: -35.768 flat angles P-C4'-P energy: -21.477 tors. eta vs tors. theta energy: 3.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -690.850719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.850719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.850719 (E_RNA) where: Base-Base interactions energy: -463.284 where: short stacking energy: -201.079 Base-Backbone interact. energy: 1.379 local terms energy: -228.945816 where: bonds (distance) C4'-P energy: -41.714 bonds (distance) P-C4' energy: -49.754 flat angles C4'-P-C4' energy: -47.572 flat angles P-C4'-P energy: -29.306 tors. eta vs tors. theta energy: -60.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -632.908582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.908582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.908582 (E_RNA) where: Base-Base interactions energy: -417.773 where: short stacking energy: -180.319 Base-Backbone interact. energy: -1.081 local terms energy: -214.054552 where: bonds (distance) C4'-P energy: -45.588 bonds (distance) P-C4' energy: -45.766 flat angles C4'-P-C4' energy: -44.023 flat angles P-C4'-P energy: -36.059 tors. eta vs tors. theta energy: -42.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -542.825778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.825778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.825778 (E_RNA) where: Base-Base interactions energy: -328.392 where: short stacking energy: -163.548 Base-Backbone interact. energy: -2.065 local terms energy: -212.368743 where: bonds (distance) C4'-P energy: -44.781 bonds (distance) P-C4' energy: -46.754 flat angles C4'-P-C4' energy: -48.089 flat angles P-C4'-P energy: -29.372 tors. eta vs tors. theta energy: -43.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -416.421355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.421355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.421355 (E_RNA) where: Base-Base interactions energy: -240.918 where: short stacking energy: -135.302 Base-Backbone interact. energy: -0.758 local terms energy: -174.745014 where: bonds (distance) C4'-P energy: -42.758 bonds (distance) P-C4' energy: -41.962 flat angles C4'-P-C4' energy: -41.978 flat angles P-C4'-P energy: -19.906 tors. eta vs tors. theta energy: -28.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -457.173308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.173308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.173308 (E_RNA) where: Base-Base interactions energy: -269.998 where: short stacking energy: -139.700 Base-Backbone interact. energy: 0.186 local terms energy: -187.361242 where: bonds (distance) C4'-P energy: -38.387 bonds (distance) P-C4' energy: -40.742 flat angles C4'-P-C4' energy: -40.791 flat angles P-C4'-P energy: -27.834 tors. eta vs tors. theta energy: -39.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -394.477231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.477231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.477231 (E_RNA) where: Base-Base interactions energy: -213.831 where: short stacking energy: -117.696 Base-Backbone interact. energy: 0.284 local terms energy: -180.930512 where: bonds (distance) C4'-P energy: -50.492 bonds (distance) P-C4' energy: -43.563 flat angles C4'-P-C4' energy: -36.229 flat angles P-C4'-P energy: -25.582 tors. eta vs tors. theta energy: -25.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -252.699536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.699536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.699536 (E_RNA) where: Base-Base interactions energy: -104.570 where: short stacking energy: -82.404 Base-Backbone interact. energy: -0.919 local terms energy: -147.210026 where: bonds (distance) C4'-P energy: -42.120 bonds (distance) P-C4' energy: -46.553 flat angles C4'-P-C4' energy: -32.536 flat angles P-C4'-P energy: -13.641 tors. eta vs tors. theta energy: -12.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -229.185316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.185316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.185316 (E_RNA) where: Base-Base interactions energy: -89.262 where: short stacking energy: -71.463 Base-Backbone interact. energy: -1.355 local terms energy: -138.568808 where: bonds (distance) C4'-P energy: -43.124 bonds (distance) P-C4' energy: -41.638 flat angles C4'-P-C4' energy: -37.642 flat angles P-C4'-P energy: -20.149 tors. eta vs tors. theta energy: 3.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -209.360424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.360424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.360424 (E_RNA) where: Base-Base interactions energy: -78.628 where: short stacking energy: -68.605 Base-Backbone interact. energy: -1.042 local terms energy: -129.690232 where: bonds (distance) C4'-P energy: -46.183 bonds (distance) P-C4' energy: -32.189 flat angles C4'-P-C4' energy: -30.653 flat angles P-C4'-P energy: -24.622 tors. eta vs tors. theta energy: 3.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -195.903391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.903391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.903391 (E_RNA) where: Base-Base interactions energy: -59.672 where: short stacking energy: -59.672 Base-Backbone interact. energy: -0.462 local terms energy: -135.769257 where: bonds (distance) C4'-P energy: -30.444 bonds (distance) P-C4' energy: -40.147 flat angles C4'-P-C4' energy: -31.371 flat angles P-C4'-P energy: -25.536 tors. eta vs tors. theta energy: -8.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -703.412468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.412468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.412468 (E_RNA) where: Base-Base interactions energy: -462.743 where: short stacking energy: -198.230 Base-Backbone interact. energy: -0.135 local terms energy: -240.533830 where: bonds (distance) C4'-P energy: -46.372 bonds (distance) P-C4' energy: -49.999 flat angles C4'-P-C4' energy: -47.582 flat angles P-C4'-P energy: -35.716 tors. eta vs tors. theta energy: -60.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -653.668409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.668409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.668409 (E_RNA) where: Base-Base interactions energy: -418.916 where: short stacking energy: -175.264 Base-Backbone interact. energy: -1.656 local terms energy: -233.095754 where: bonds (distance) C4'-P energy: -46.945 bonds (distance) P-C4' energy: -44.696 flat angles C4'-P-C4' energy: -53.767 flat angles P-C4'-P energy: -35.543 tors. eta vs tors. theta energy: -52.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -556.054509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.054509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.054509 (E_RNA) where: Base-Base interactions energy: -331.243 where: short stacking energy: -166.721 Base-Backbone interact. energy: -0.337 local terms energy: -224.474462 where: bonds (distance) C4'-P energy: -44.901 bonds (distance) P-C4' energy: -46.700 flat angles C4'-P-C4' energy: -49.881 flat angles P-C4'-P energy: -31.589 tors. eta vs tors. theta energy: -51.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -561.099497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.099497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.099497 (E_RNA) where: Base-Base interactions energy: -354.566 where: short stacking energy: -168.712 Base-Backbone interact. energy: -0.915 local terms energy: -205.619307 where: bonds (distance) C4'-P energy: -44.269 bonds (distance) P-C4' energy: -42.598 flat angles C4'-P-C4' energy: -46.517 flat angles P-C4'-P energy: -29.655 tors. eta vs tors. theta energy: -42.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -430.051054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.051054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.051054 (E_RNA) where: Base-Base interactions energy: -248.411 where: short stacking energy: -112.353 Base-Backbone interact. energy: 1.316 local terms energy: -182.956093 where: bonds (distance) C4'-P energy: -46.991 bonds (distance) P-C4' energy: -43.035 flat angles C4'-P-C4' energy: -45.926 flat angles P-C4'-P energy: -25.780 tors. eta vs tors. theta energy: -21.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -384.830264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.830264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.830264 (E_RNA) where: Base-Base interactions energy: -215.512 where: short stacking energy: -106.746 Base-Backbone interact. energy: -1.577 local terms energy: -167.740908 where: bonds (distance) C4'-P energy: -33.663 bonds (distance) P-C4' energy: -44.803 flat angles C4'-P-C4' energy: -43.981 flat angles P-C4'-P energy: -24.718 tors. eta vs tors. theta energy: -20.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -233.095570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.095570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.095570 (E_RNA) where: Base-Base interactions energy: -78.852 where: short stacking energy: -54.582 Base-Backbone interact. energy: -1.072 local terms energy: -153.171476 where: bonds (distance) C4'-P energy: -36.514 bonds (distance) P-C4' energy: -39.520 flat angles C4'-P-C4' energy: -43.870 flat angles P-C4'-P energy: -30.462 tors. eta vs tors. theta energy: -2.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -219.855031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.855031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.855031 (E_RNA) where: Base-Base interactions energy: -74.863 where: short stacking energy: -61.972 Base-Backbone interact. energy: 0.120 local terms energy: -145.112232 where: bonds (distance) C4'-P energy: -33.991 bonds (distance) P-C4' energy: -40.701 flat angles C4'-P-C4' energy: -44.181 flat angles P-C4'-P energy: -21.100 tors. eta vs tors. theta energy: -5.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -207.054200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.054200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.054200 (E_RNA) where: Base-Base interactions energy: -79.794 where: short stacking energy: -67.294 Base-Backbone interact. energy: 2.090 local terms energy: -129.349771 where: bonds (distance) C4'-P energy: -33.207 bonds (distance) P-C4' energy: -41.760 flat angles C4'-P-C4' energy: -38.231 flat angles P-C4'-P energy: -20.335 tors. eta vs tors. theta energy: 4.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -191.912401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.912401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.912401 (E_RNA) where: Base-Base interactions energy: -89.231 where: short stacking energy: -56.023 Base-Backbone interact. energy: -1.306 local terms energy: -101.374634 where: bonds (distance) C4'-P energy: -37.512 bonds (distance) P-C4' energy: -33.415 flat angles C4'-P-C4' energy: -33.287 flat angles P-C4'-P energy: -6.843 tors. eta vs tors. theta energy: 9.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -693.198256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.198256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.198256 (E_RNA) where: Base-Base interactions energy: -457.083 where: short stacking energy: -192.721 Base-Backbone interact. energy: -0.323 local terms energy: -235.792392 where: bonds (distance) C4'-P energy: -46.889 bonds (distance) P-C4' energy: -50.128 flat angles C4'-P-C4' energy: -47.495 flat angles P-C4'-P energy: -32.570 tors. eta vs tors. theta energy: -58.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -658.694784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.694784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.694784 (E_RNA) where: Base-Base interactions energy: -449.783 where: short stacking energy: -194.993 Base-Backbone interact. energy: -0.714 local terms energy: -208.198470 where: bonds (distance) C4'-P energy: -39.325 bonds (distance) P-C4' energy: -43.770 flat angles C4'-P-C4' energy: -45.536 flat angles P-C4'-P energy: -31.848 tors. eta vs tors. theta energy: -47.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -551.741989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.741989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.741989 (E_RNA) where: Base-Base interactions energy: -334.984 where: short stacking energy: -155.623 Base-Backbone interact. energy: 0.842 local terms energy: -217.600339 where: bonds (distance) C4'-P energy: -45.356 bonds (distance) P-C4' energy: -37.692 flat angles C4'-P-C4' energy: -51.355 flat angles P-C4'-P energy: -30.711 tors. eta vs tors. theta energy: -52.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -555.754879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.754879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.754879 (E_RNA) where: Base-Base interactions energy: -340.906 where: short stacking energy: -183.951 Base-Backbone interact. energy: 0.407 local terms energy: -215.256409 where: bonds (distance) C4'-P energy: -38.525 bonds (distance) P-C4' energy: -41.318 flat angles C4'-P-C4' energy: -46.392 flat angles P-C4'-P energy: -35.271 tors. eta vs tors. theta energy: -53.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -433.949664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.949664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.949664 (E_RNA) where: Base-Base interactions energy: -272.239 where: short stacking energy: -127.702 Base-Backbone interact. energy: -1.338 local terms energy: -160.372518 where: bonds (distance) C4'-P energy: -40.322 bonds (distance) P-C4' energy: -41.437 flat angles C4'-P-C4' energy: -37.081 flat angles P-C4'-P energy: -20.533 tors. eta vs tors. theta energy: -21.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -341.692355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.692355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.692355 (E_RNA) where: Base-Base interactions energy: -175.233 where: short stacking energy: -118.033 Base-Backbone interact. energy: -0.844 local terms energy: -165.615826 where: bonds (distance) C4'-P energy: -40.608 bonds (distance) P-C4' energy: -36.365 flat angles C4'-P-C4' energy: -43.466 flat angles P-C4'-P energy: -27.835 tors. eta vs tors. theta energy: -17.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -249.691981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.691981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.691981 (E_RNA) where: Base-Base interactions energy: -94.611 where: short stacking energy: -76.521 Base-Backbone interact. energy: 0.013 local terms energy: -155.093238 where: bonds (distance) C4'-P energy: -47.837 bonds (distance) P-C4' energy: -43.922 flat angles C4'-P-C4' energy: -43.201 flat angles P-C4'-P energy: -19.429 tors. eta vs tors. theta energy: -0.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -218.726027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.726027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.726027 (E_RNA) where: Base-Base interactions energy: -77.940 where: short stacking energy: -49.230 Base-Backbone interact. energy: -1.039 local terms energy: -139.746731 where: bonds (distance) C4'-P energy: -37.169 bonds (distance) P-C4' energy: -47.758 flat angles C4'-P-C4' energy: -42.176 flat angles P-C4'-P energy: -20.101 tors. eta vs tors. theta energy: 7.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -198.817295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.817295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.817295 (E_RNA) where: Base-Base interactions energy: -68.528 where: short stacking energy: -56.480 Base-Backbone interact. energy: -0.554 local terms energy: -129.736285 where: bonds (distance) C4'-P energy: -41.082 bonds (distance) P-C4' energy: -39.476 flat angles C4'-P-C4' energy: -31.186 flat angles P-C4'-P energy: -18.338 tors. eta vs tors. theta energy: 0.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -209.341706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.341706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.341706 (E_RNA) where: Base-Base interactions energy: -83.924 where: short stacking energy: -74.946 Base-Backbone interact. energy: 0.582 local terms energy: -125.999126 where: bonds (distance) C4'-P energy: -42.500 bonds (distance) P-C4' energy: -30.044 flat angles C4'-P-C4' energy: -33.872 flat angles P-C4'-P energy: -21.551 tors. eta vs tors. theta energy: 1.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -709.272560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.272560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.272560 (E_RNA) where: Base-Base interactions energy: -482.626 where: short stacking energy: -201.533 Base-Backbone interact. energy: -0.208 local terms energy: -226.439068 where: bonds (distance) C4'-P energy: -42.891 bonds (distance) P-C4' energy: -44.853 flat angles C4'-P-C4' energy: -50.802 flat angles P-C4'-P energy: -25.292 tors. eta vs tors. theta energy: -62.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -659.279380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.279380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.279380 (E_RNA) where: Base-Base interactions energy: -438.234 where: short stacking energy: -182.536 Base-Backbone interact. energy: -0.793 local terms energy: -220.252331 where: bonds (distance) C4'-P energy: -48.068 bonds (distance) P-C4' energy: -41.270 flat angles C4'-P-C4' energy: -52.474 flat angles P-C4'-P energy: -29.799 tors. eta vs tors. theta energy: -48.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -565.579310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.579310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.579310 (E_RNA) where: Base-Base interactions energy: -359.323 where: short stacking energy: -174.629 Base-Backbone interact. energy: -0.264 local terms energy: -205.992112 where: bonds (distance) C4'-P energy: -42.274 bonds (distance) P-C4' energy: -44.936 flat angles C4'-P-C4' energy: -43.439 flat angles P-C4'-P energy: -27.699 tors. eta vs tors. theta energy: -47.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -555.382661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.382661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.382661 (E_RNA) where: Base-Base interactions energy: -337.884 where: short stacking energy: -175.236 Base-Backbone interact. energy: -0.316 local terms energy: -217.182750 where: bonds (distance) C4'-P energy: -38.689 bonds (distance) P-C4' energy: -49.619 flat angles C4'-P-C4' energy: -50.663 flat angles P-C4'-P energy: -28.414 tors. eta vs tors. theta energy: -49.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -437.539453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.539453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.539453 (E_RNA) where: Base-Base interactions energy: -243.008 where: short stacking energy: -116.950 Base-Backbone interact. energy: 0.883 local terms energy: -195.414522 where: bonds (distance) C4'-P energy: -43.702 bonds (distance) P-C4' energy: -48.457 flat angles C4'-P-C4' energy: -37.201 flat angles P-C4'-P energy: -40.189 tors. eta vs tors. theta energy: -25.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -336.416439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.416439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.416439 (E_RNA) where: Base-Base interactions energy: -180.152 where: short stacking energy: -106.327 Base-Backbone interact. energy: -0.799 local terms energy: -155.465329 where: bonds (distance) C4'-P energy: -35.963 bonds (distance) P-C4' energy: -31.025 flat angles C4'-P-C4' energy: -42.599 flat angles P-C4'-P energy: -24.368 tors. eta vs tors. theta energy: -21.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -241.663873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.663873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.663873 (E_RNA) where: Base-Base interactions energy: -91.705 where: short stacking energy: -88.086 Base-Backbone interact. energy: -1.878 local terms energy: -148.080733 where: bonds (distance) C4'-P energy: -37.654 bonds (distance) P-C4' energy: -36.733 flat angles C4'-P-C4' energy: -36.371 flat angles P-C4'-P energy: -30.011 tors. eta vs tors. theta energy: -7.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -223.125021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.125021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.125021 (E_RNA) where: Base-Base interactions energy: -65.286 where: short stacking energy: -60.534 Base-Backbone interact. energy: 0.143 local terms energy: -157.982732 where: bonds (distance) C4'-P energy: -43.599 bonds (distance) P-C4' energy: -40.689 flat angles C4'-P-C4' energy: -40.596 flat angles P-C4'-P energy: -29.038 tors. eta vs tors. theta energy: -4.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -205.303833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.303833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.303833 (E_RNA) where: Base-Base interactions energy: -63.515 where: short stacking energy: -41.049 Base-Backbone interact. energy: -0.468 local terms energy: -141.321029 where: bonds (distance) C4'-P energy: -49.452 bonds (distance) P-C4' energy: -39.124 flat angles C4'-P-C4' energy: -38.094 flat angles P-C4'-P energy: -22.800 tors. eta vs tors. theta energy: 8.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -181.997327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.997327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.997327 (E_RNA) where: Base-Base interactions energy: -72.290 where: short stacking energy: -54.511 Base-Backbone interact. energy: 1.386 local terms energy: -111.093284 where: bonds (distance) C4'-P energy: -30.168 bonds (distance) P-C4' energy: -42.349 flat angles C4'-P-C4' energy: -20.377 flat angles P-C4'-P energy: -20.187 tors. eta vs tors. theta energy: 1.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -685.407320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.407320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.407320 (E_RNA) where: Base-Base interactions energy: -451.841 where: short stacking energy: -194.358 Base-Backbone interact. energy: -1.440 local terms energy: -232.125832 where: bonds (distance) C4'-P energy: -46.507 bonds (distance) P-C4' energy: -44.987 flat angles C4'-P-C4' energy: -48.957 flat angles P-C4'-P energy: -35.751 tors. eta vs tors. theta energy: -55.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -640.085671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.085671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.085671 (E_RNA) where: Base-Base interactions energy: -423.119 where: short stacking energy: -198.148 Base-Backbone interact. energy: 0.212 local terms energy: -217.178959 where: bonds (distance) C4'-P energy: -41.525 bonds (distance) P-C4' energy: -43.740 flat angles C4'-P-C4' energy: -48.991 flat angles P-C4'-P energy: -26.734 tors. eta vs tors. theta energy: -56.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -559.010627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.010627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.010627 (E_RNA) where: Base-Base interactions energy: -344.678 where: short stacking energy: -174.520 Base-Backbone interact. energy: -1.401 local terms energy: -212.931812 where: bonds (distance) C4'-P energy: -46.275 bonds (distance) P-C4' energy: -41.683 flat angles C4'-P-C4' energy: -40.324 flat angles P-C4'-P energy: -34.207 tors. eta vs tors. theta energy: -50.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -556.831064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.831064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.831064 (E_RNA) where: Base-Base interactions energy: -349.085 where: short stacking energy: -165.358 Base-Backbone interact. energy: 2.849 local terms energy: -210.595332 where: bonds (distance) C4'-P energy: -42.419 bonds (distance) P-C4' energy: -46.824 flat angles C4'-P-C4' energy: -43.558 flat angles P-C4'-P energy: -34.342 tors. eta vs tors. theta energy: -43.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -391.120570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.120570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.120570 (E_RNA) where: Base-Base interactions energy: -218.841 where: short stacking energy: -112.584 Base-Backbone interact. energy: -1.479 local terms energy: -170.800807 where: bonds (distance) C4'-P energy: -42.266 bonds (distance) P-C4' energy: -39.761 flat angles C4'-P-C4' energy: -39.325 flat angles P-C4'-P energy: -32.144 tors. eta vs tors. theta energy: -17.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -393.252241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.252241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.252241 (E_RNA) where: Base-Base interactions energy: -214.959 where: short stacking energy: -113.282 Base-Backbone interact. energy: 0.082 local terms energy: -178.374858 where: bonds (distance) C4'-P energy: -36.363 bonds (distance) P-C4' energy: -49.616 flat angles C4'-P-C4' energy: -41.635 flat angles P-C4'-P energy: -30.089 tors. eta vs tors. theta energy: -20.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -266.081827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.081827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.081827 (E_RNA) where: Base-Base interactions energy: -108.839 where: short stacking energy: -75.087 Base-Backbone interact. energy: -0.827 local terms energy: -156.416682 where: bonds (distance) C4'-P energy: -33.733 bonds (distance) P-C4' energy: -48.797 flat angles C4'-P-C4' energy: -36.603 flat angles P-C4'-P energy: -27.251 tors. eta vs tors. theta energy: -10.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -219.588207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.588207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.588207 (E_RNA) where: Base-Base interactions energy: -86.769 where: short stacking energy: -64.577 Base-Backbone interact. energy: -0.727 local terms energy: -132.091683 where: bonds (distance) C4'-P energy: -37.754 bonds (distance) P-C4' energy: -40.677 flat angles C4'-P-C4' energy: -35.581 flat angles P-C4'-P energy: -23.283 tors. eta vs tors. theta energy: 5.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -238.981270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.981270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.981270 (E_RNA) where: Base-Base interactions energy: -81.421 where: short stacking energy: -75.104 Base-Backbone interact. energy: -0.316 local terms energy: -157.244432 where: bonds (distance) C4'-P energy: -44.666 bonds (distance) P-C4' energy: -39.597 flat angles C4'-P-C4' energy: -36.592 flat angles P-C4'-P energy: -21.285 tors. eta vs tors. theta energy: -15.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -199.473110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.473110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.473110 (E_RNA) where: Base-Base interactions energy: -81.871 where: short stacking energy: -64.000 Base-Backbone interact. energy: -1.463 local terms energy: -116.138788 where: bonds (distance) C4'-P energy: -35.823 bonds (distance) P-C4' energy: -43.603 flat angles C4'-P-C4' energy: -27.062 flat angles P-C4'-P energy: -17.113 tors. eta vs tors. theta energy: 7.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -712.710841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.710841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.710841 (E_RNA) where: Base-Base interactions energy: -476.347 where: short stacking energy: -215.196 Base-Backbone interact. energy: 0.405 local terms energy: -236.769016 where: bonds (distance) C4'-P energy: -43.056 bonds (distance) P-C4' energy: -50.109 flat angles C4'-P-C4' energy: -45.908 flat angles P-C4'-P energy: -35.014 tors. eta vs tors. theta energy: -62.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -635.250890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.250890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.250890 (E_RNA) where: Base-Base interactions energy: -411.526 where: short stacking energy: -175.697 Base-Backbone interact. energy: -0.654 local terms energy: -223.071069 where: bonds (distance) C4'-P energy: -52.639 bonds (distance) P-C4' energy: -41.351 flat angles C4'-P-C4' energy: -52.289 flat angles P-C4'-P energy: -27.614 tors. eta vs tors. theta energy: -49.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -561.585962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.585962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.585962 (E_RNA) where: Base-Base interactions energy: -333.966 where: short stacking energy: -160.955 Base-Backbone interact. energy: -1.007 local terms energy: -226.613547 where: bonds (distance) C4'-P energy: -48.445 bonds (distance) P-C4' energy: -47.978 flat angles C4'-P-C4' energy: -43.967 flat angles P-C4'-P energy: -38.571 tors. eta vs tors. theta energy: -47.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -502.333208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.333208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.333208 (E_RNA) where: Base-Base interactions energy: -291.741 where: short stacking energy: -150.391 Base-Backbone interact. energy: -3.158 local terms energy: -207.434398 where: bonds (distance) C4'-P energy: -44.579 bonds (distance) P-C4' energy: -50.729 flat angles C4'-P-C4' energy: -47.214 flat angles P-C4'-P energy: -23.693 tors. eta vs tors. theta energy: -41.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -457.883539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.883539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.883539 (E_RNA) where: Base-Base interactions energy: -252.962 where: short stacking energy: -133.780 Base-Backbone interact. energy: -1.030 local terms energy: -203.891467 where: bonds (distance) C4'-P energy: -47.283 bonds (distance) P-C4' energy: -47.591 flat angles C4'-P-C4' energy: -44.281 flat angles P-C4'-P energy: -32.599 tors. eta vs tors. theta energy: -32.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -392.244656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.244656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.244656 (E_RNA) where: Base-Base interactions energy: -217.381 where: short stacking energy: -111.608 Base-Backbone interact. energy: -1.418 local terms energy: -173.446196 where: bonds (distance) C4'-P energy: -44.521 bonds (distance) P-C4' energy: -43.319 flat angles C4'-P-C4' energy: -44.596 flat angles P-C4'-P energy: -29.117 tors. eta vs tors. theta energy: -11.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -284.397952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.397952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.397952 (E_RNA) where: Base-Base interactions energy: -128.224 where: short stacking energy: -88.668 Base-Backbone interact. energy: -0.394 local terms energy: -155.779558 where: bonds (distance) C4'-P energy: -37.951 bonds (distance) P-C4' energy: -45.579 flat angles C4'-P-C4' energy: -40.399 flat angles P-C4'-P energy: -24.586 tors. eta vs tors. theta energy: -7.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -247.218713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.218713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.218713 (E_RNA) where: Base-Base interactions energy: -125.053 where: short stacking energy: -78.616 Base-Backbone interact. energy: 1.724 local terms energy: -123.889068 where: bonds (distance) C4'-P energy: -24.655 bonds (distance) P-C4' energy: -43.161 flat angles C4'-P-C4' energy: -34.123 flat angles P-C4'-P energy: -22.760 tors. eta vs tors. theta energy: 0.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -204.727252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.727252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.727252 (E_RNA) where: Base-Base interactions energy: -66.425 where: short stacking energy: -56.564 Base-Backbone interact. energy: 0.438 local terms energy: -138.739745 where: bonds (distance) C4'-P energy: -50.540 bonds (distance) P-C4' energy: -44.043 flat angles C4'-P-C4' energy: -16.437 flat angles P-C4'-P energy: -30.272 tors. eta vs tors. theta energy: 2.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -188.316752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.316752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.316752 (E_RNA) where: Base-Base interactions energy: -49.052 where: short stacking energy: -43.415 Base-Backbone interact. energy: -0.146 local terms energy: -139.119366 where: bonds (distance) C4'-P energy: -44.189 bonds (distance) P-C4' energy: -48.017 flat angles C4'-P-C4' energy: -29.640 flat angles P-C4'-P energy: -23.708 tors. eta vs tors. theta energy: 6.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -701.508698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.508698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.508698 (E_RNA) where: Base-Base interactions energy: -476.219 where: short stacking energy: -207.306 Base-Backbone interact. energy: -2.151 local terms energy: -223.139126 where: bonds (distance) C4'-P energy: -43.028 bonds (distance) P-C4' energy: -42.448 flat angles C4'-P-C4' energy: -52.573 flat angles P-C4'-P energy: -29.951 tors. eta vs tors. theta energy: -55.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -648.646511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.646511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.646511 (E_RNA) where: Base-Base interactions energy: -428.124 where: short stacking energy: -181.377 Base-Backbone interact. energy: -1.496 local terms energy: -219.026561 where: bonds (distance) C4'-P energy: -38.630 bonds (distance) P-C4' energy: -52.121 flat angles C4'-P-C4' energy: -44.665 flat angles P-C4'-P energy: -36.563 tors. eta vs tors. theta energy: -47.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -554.014492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.014492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.014492 (E_RNA) where: Base-Base interactions energy: -342.207 where: short stacking energy: -170.255 Base-Backbone interact. energy: -0.297 local terms energy: -211.509808 where: bonds (distance) C4'-P energy: -40.004 bonds (distance) P-C4' energy: -49.119 flat angles C4'-P-C4' energy: -47.287 flat angles P-C4'-P energy: -25.944 tors. eta vs tors. theta energy: -49.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -504.996066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.996066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.996066 (E_RNA) where: Base-Base interactions energy: -309.016 where: short stacking energy: -165.775 Base-Backbone interact. energy: -0.091 local terms energy: -195.888886 where: bonds (distance) C4'-P energy: -39.621 bonds (distance) P-C4' energy: -44.148 flat angles C4'-P-C4' energy: -49.420 flat angles P-C4'-P energy: -19.176 tors. eta vs tors. theta energy: -43.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -452.917335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.917335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.917335 (E_RNA) where: Base-Base interactions energy: -285.368 where: short stacking energy: -127.794 Base-Backbone interact. energy: -0.745 local terms energy: -166.803758 where: bonds (distance) C4'-P energy: -35.921 bonds (distance) P-C4' energy: -41.500 flat angles C4'-P-C4' energy: -32.985 flat angles P-C4'-P energy: -19.769 tors. eta vs tors. theta energy: -36.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -431.150505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.150505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.150505 (E_RNA) where: Base-Base interactions energy: -263.045 where: short stacking energy: -130.945 Base-Backbone interact. energy: -0.329 local terms energy: -167.776155 where: bonds (distance) C4'-P energy: -38.748 bonds (distance) P-C4' energy: -41.609 flat angles C4'-P-C4' energy: -31.336 flat angles P-C4'-P energy: -24.779 tors. eta vs tors. theta energy: -31.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -248.997739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.997739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.997739 (E_RNA) where: Base-Base interactions energy: -103.842 where: short stacking energy: -71.839 Base-Backbone interact. energy: 0.056 local terms energy: -145.210863 where: bonds (distance) C4'-P energy: -32.530 bonds (distance) P-C4' energy: -46.189 flat angles C4'-P-C4' energy: -37.219 flat angles P-C4'-P energy: -24.381 tors. eta vs tors. theta energy: -4.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -219.814065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.814065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.814065 (E_RNA) where: Base-Base interactions energy: -79.674 where: short stacking energy: -68.854 Base-Backbone interact. energy: 3.008 local terms energy: -143.147716 where: bonds (distance) C4'-P energy: -32.879 bonds (distance) P-C4' energy: -46.220 flat angles C4'-P-C4' energy: -40.846 flat angles P-C4'-P energy: -18.669 tors. eta vs tors. theta energy: -4.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -227.784099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.784099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.784099 (E_RNA) where: Base-Base interactions energy: -98.299 where: short stacking energy: -64.743 Base-Backbone interact. energy: 0.701 local terms energy: -130.185510 where: bonds (distance) C4'-P energy: -37.405 bonds (distance) P-C4' energy: -40.142 flat angles C4'-P-C4' energy: -34.003 flat angles P-C4'-P energy: -19.398 tors. eta vs tors. theta energy: 0.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -198.534999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.534999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.534999 (E_RNA) where: Base-Base interactions energy: -79.123 where: short stacking energy: -50.388 Base-Backbone interact. energy: -0.196 local terms energy: -119.216714 where: bonds (distance) C4'-P energy: -41.535 bonds (distance) P-C4' energy: -34.971 flat angles C4'-P-C4' energy: -30.940 flat angles P-C4'-P energy: -18.619 tors. eta vs tors. theta energy: 6.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -705.359389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.359389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.359389 (E_RNA) where: Base-Base interactions energy: -464.497 where: short stacking energy: -200.726 Base-Backbone interact. energy: -0.262 local terms energy: -240.599675 where: bonds (distance) C4'-P energy: -41.552 bonds (distance) P-C4' energy: -49.040 flat angles C4'-P-C4' energy: -48.617 flat angles P-C4'-P energy: -37.495 tors. eta vs tors. theta energy: -63.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -618.463204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.463204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.463204 (E_RNA) where: Base-Base interactions energy: -393.669 where: short stacking energy: -178.343 Base-Backbone interact. energy: -2.731 local terms energy: -222.063281 where: bonds (distance) C4'-P energy: -42.301 bonds (distance) P-C4' energy: -44.008 flat angles C4'-P-C4' energy: -51.990 flat angles P-C4'-P energy: -37.759 tors. eta vs tors. theta energy: -46.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -592.899990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.899990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.899990 (E_RNA) where: Base-Base interactions energy: -376.156 where: short stacking energy: -162.857 Base-Backbone interact. energy: -1.062 local terms energy: -215.682253 where: bonds (distance) C4'-P energy: -48.910 bonds (distance) P-C4' energy: -48.652 flat angles C4'-P-C4' energy: -42.589 flat angles P-C4'-P energy: -29.521 tors. eta vs tors. theta energy: -46.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -479.713684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.713684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.713684 (E_RNA) where: Base-Base interactions energy: -290.190 where: short stacking energy: -134.743 Base-Backbone interact. energy: -0.301 local terms energy: -189.222513 where: bonds (distance) C4'-P energy: -39.842 bonds (distance) P-C4' energy: -45.527 flat angles C4'-P-C4' energy: -43.885 flat angles P-C4'-P energy: -26.046 tors. eta vs tors. theta energy: -33.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -466.086922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.086922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.086922 (E_RNA) where: Base-Base interactions energy: -286.508 where: short stacking energy: -139.196 Base-Backbone interact. energy: -0.650 local terms energy: -178.928986 where: bonds (distance) C4'-P energy: -43.326 bonds (distance) P-C4' energy: -46.081 flat angles C4'-P-C4' energy: -40.508 flat angles P-C4'-P energy: -18.864 tors. eta vs tors. theta energy: -30.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -398.141781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.141781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.141781 (E_RNA) where: Base-Base interactions energy: -230.685 where: short stacking energy: -129.022 Base-Backbone interact. energy: -0.840 local terms energy: -166.616395 where: bonds (distance) C4'-P energy: -40.279 bonds (distance) P-C4' energy: -38.617 flat angles C4'-P-C4' energy: -38.870 flat angles P-C4'-P energy: -32.116 tors. eta vs tors. theta energy: -16.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -237.824037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.824037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.824037 (E_RNA) where: Base-Base interactions energy: -113.619 where: short stacking energy: -74.212 Base-Backbone interact. energy: 0.821 local terms energy: -125.025642 where: bonds (distance) C4'-P energy: -25.837 bonds (distance) P-C4' energy: -36.749 flat angles C4'-P-C4' energy: -47.345 flat angles P-C4'-P energy: -14.017 tors. eta vs tors. theta energy: -1.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -235.278155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.278155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.278155 (E_RNA) where: Base-Base interactions energy: -81.233 where: short stacking energy: -54.993 Base-Backbone interact. energy: 1.919 local terms energy: -155.964057 where: bonds (distance) C4'-P energy: -36.979 bonds (distance) P-C4' energy: -46.076 flat angles C4'-P-C4' energy: -40.706 flat angles P-C4'-P energy: -27.618 tors. eta vs tors. theta energy: -4.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -213.057912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.057912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.057912 (E_RNA) where: Base-Base interactions energy: -90.157 where: short stacking energy: -64.155 Base-Backbone interact. energy: 0.750 local terms energy: -123.650877 where: bonds (distance) C4'-P energy: -31.480 bonds (distance) P-C4' energy: -34.641 flat angles C4'-P-C4' energy: -37.882 flat angles P-C4'-P energy: -17.685 tors. eta vs tors. theta energy: -1.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -183.261390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.261390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.261390 (E_RNA) where: Base-Base interactions energy: -61.697 where: short stacking energy: -46.792 Base-Backbone interact. energy: -0.959 local terms energy: -120.605630 where: bonds (distance) C4'-P energy: -42.800 bonds (distance) P-C4' energy: -39.591 flat angles C4'-P-C4' energy: -32.367 flat angles P-C4'-P energy: -15.165 tors. eta vs tors. theta energy: 9.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -720.701975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.701975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.701975 (E_RNA) where: Base-Base interactions energy: -467.271 where: short stacking energy: -217.328 Base-Backbone interact. energy: -0.644 local terms energy: -252.786871 where: bonds (distance) C4'-P energy: -49.990 bonds (distance) P-C4' energy: -48.185 flat angles C4'-P-C4' energy: -50.064 flat angles P-C4'-P energy: -40.360 tors. eta vs tors. theta energy: -64.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -621.940359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.940359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.940359 (E_RNA) where: Base-Base interactions energy: -407.168 where: short stacking energy: -196.523 Base-Backbone interact. energy: 0.942 local terms energy: -215.713526 where: bonds (distance) C4'-P energy: -43.525 bonds (distance) P-C4' energy: -46.458 flat angles C4'-P-C4' energy: -50.812 flat angles P-C4'-P energy: -26.234 tors. eta vs tors. theta energy: -48.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -564.119745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.119745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.119745 (E_RNA) where: Base-Base interactions energy: -373.909 where: short stacking energy: -183.397 Base-Backbone interact. energy: 0.081 local terms energy: -190.291542 where: bonds (distance) C4'-P energy: -25.683 bonds (distance) P-C4' energy: -44.706 flat angles C4'-P-C4' energy: -49.455 flat angles P-C4'-P energy: -25.166 tors. eta vs tors. theta energy: -45.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -508.169837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.169837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.169837 (E_RNA) where: Base-Base interactions energy: -313.470 where: short stacking energy: -144.923 Base-Backbone interact. energy: 0.739 local terms energy: -195.439199 where: bonds (distance) C4'-P energy: -36.607 bonds (distance) P-C4' energy: -50.341 flat angles C4'-P-C4' energy: -46.052 flat angles P-C4'-P energy: -22.868 tors. eta vs tors. theta energy: -39.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -419.988987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.988987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.988987 (E_RNA) where: Base-Base interactions energy: -242.818 where: short stacking energy: -115.248 Base-Backbone interact. energy: 0.933 local terms energy: -178.103812 where: bonds (distance) C4'-P energy: -39.718 bonds (distance) P-C4' energy: -42.177 flat angles C4'-P-C4' energy: -41.268 flat angles P-C4'-P energy: -27.445 tors. eta vs tors. theta energy: -27.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -420.120456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.120456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.120456 (E_RNA) where: Base-Base interactions energy: -230.228 where: short stacking energy: -135.141 Base-Backbone interact. energy: -0.464 local terms energy: -189.428141 where: bonds (distance) C4'-P energy: -40.664 bonds (distance) P-C4' energy: -37.209 flat angles C4'-P-C4' energy: -50.758 flat angles P-C4'-P energy: -23.722 tors. eta vs tors. theta energy: -37.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -253.329623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.329623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.329623 (E_RNA) where: Base-Base interactions energy: -95.704 where: short stacking energy: -65.792 Base-Backbone interact. energy: -1.087 local terms energy: -156.538503 where: bonds (distance) C4'-P energy: -46.544 bonds (distance) P-C4' energy: -41.146 flat angles C4'-P-C4' energy: -39.005 flat angles P-C4'-P energy: -28.204 tors. eta vs tors. theta energy: -1.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -244.647613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.647613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.647613 (E_RNA) where: Base-Base interactions energy: -91.213 where: short stacking energy: -66.809 Base-Backbone interact. energy: -1.831 local terms energy: -151.603345 where: bonds (distance) C4'-P energy: -40.411 bonds (distance) P-C4' energy: -46.208 flat angles C4'-P-C4' energy: -42.641 flat angles P-C4'-P energy: -15.872 tors. eta vs tors. theta energy: -6.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -210.054902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.054902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.054902 (E_RNA) where: Base-Base interactions energy: -59.152 where: short stacking energy: -46.418 Base-Backbone interact. energy: -0.688 local terms energy: -150.214675 where: bonds (distance) C4'-P energy: -50.237 bonds (distance) P-C4' energy: -45.701 flat angles C4'-P-C4' energy: -37.641 flat angles P-C4'-P energy: -18.169 tors. eta vs tors. theta energy: 1.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -201.780121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.780121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.780121 (E_RNA) where: Base-Base interactions energy: -91.112 where: short stacking energy: -70.718 Base-Backbone interact. energy: -0.636 local terms energy: -110.032222 where: bonds (distance) C4'-P energy: -40.518 bonds (distance) P-C4' energy: -34.824 flat angles C4'-P-C4' energy: -30.355 flat angles P-C4'-P energy: -15.645 tors. eta vs tors. theta energy: 11.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -713.534985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.534985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.534985 (E_RNA) where: Base-Base interactions energy: -470.961 where: short stacking energy: -209.966 Base-Backbone interact. energy: -1.079 local terms energy: -241.494856 where: bonds (distance) C4'-P energy: -48.869 bonds (distance) P-C4' energy: -48.725 flat angles C4'-P-C4' energy: -44.896 flat angles P-C4'-P energy: -39.141 tors. eta vs tors. theta energy: -59.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -647.348840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.348840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.348840 (E_RNA) where: Base-Base interactions energy: -425.453 where: short stacking energy: -190.913 Base-Backbone interact. energy: -0.286 local terms energy: -221.608865 where: bonds (distance) C4'-P energy: -48.551 bonds (distance) P-C4' energy: -43.266 flat angles C4'-P-C4' energy: -47.672 flat angles P-C4'-P energy: -33.536 tors. eta vs tors. theta energy: -48.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -541.766534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.766534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.766534 (E_RNA) where: Base-Base interactions energy: -325.553 where: short stacking energy: -161.260 Base-Backbone interact. energy: -0.360 local terms energy: -215.854030 where: bonds (distance) C4'-P energy: -44.667 bonds (distance) P-C4' energy: -48.862 flat angles C4'-P-C4' energy: -44.438 flat angles P-C4'-P energy: -30.808 tors. eta vs tors. theta energy: -47.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -495.115160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.115160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.115160 (E_RNA) where: Base-Base interactions energy: -300.438 where: short stacking energy: -145.136 Base-Backbone interact. energy: -1.819 local terms energy: -192.857379 where: bonds (distance) C4'-P energy: -40.234 bonds (distance) P-C4' energy: -39.933 flat angles C4'-P-C4' energy: -49.589 flat angles P-C4'-P energy: -28.487 tors. eta vs tors. theta energy: -34.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -419.434107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.434107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.434107 (E_RNA) where: Base-Base interactions energy: -227.747 where: short stacking energy: -113.136 Base-Backbone interact. energy: -1.576 local terms energy: -190.111177 where: bonds (distance) C4'-P energy: -40.206 bonds (distance) P-C4' energy: -43.755 flat angles C4'-P-C4' energy: -47.093 flat angles P-C4'-P energy: -35.760 tors. eta vs tors. theta energy: -23.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -409.185556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.185556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.185556 (E_RNA) where: Base-Base interactions energy: -230.807 where: short stacking energy: -122.153 Base-Backbone interact. energy: 0.880 local terms energy: -179.258861 where: bonds (distance) C4'-P energy: -42.503 bonds (distance) P-C4' energy: -36.472 flat angles C4'-P-C4' energy: -43.355 flat angles P-C4'-P energy: -31.093 tors. eta vs tors. theta energy: -25.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -237.315527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.315527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.315527 (E_RNA) where: Base-Base interactions energy: -94.579 where: short stacking energy: -74.032 Base-Backbone interact. energy: -1.138 local terms energy: -141.598118 where: bonds (distance) C4'-P energy: -47.452 bonds (distance) P-C4' energy: -41.265 flat angles C4'-P-C4' energy: -32.993 flat angles P-C4'-P energy: -17.990 tors. eta vs tors. theta energy: -1.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -222.986004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.986004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.986004 (E_RNA) where: Base-Base interactions energy: -86.592 where: short stacking energy: -76.689 Base-Backbone interact. energy: -0.669 local terms energy: -135.725346 where: bonds (distance) C4'-P energy: -41.275 bonds (distance) P-C4' energy: -34.931 flat angles C4'-P-C4' energy: -42.021 flat angles P-C4'-P energy: -17.876 tors. eta vs tors. theta energy: 0.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -210.127094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.127094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.127094 (E_RNA) where: Base-Base interactions energy: -66.238 where: short stacking energy: -62.333 Base-Backbone interact. energy: -2.083 local terms energy: -141.806187 where: bonds (distance) C4'-P energy: -41.238 bonds (distance) P-C4' energy: -38.053 flat angles C4'-P-C4' energy: -44.731 flat angles P-C4'-P energy: -16.825 tors. eta vs tors. theta energy: -0.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -193.696034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.696034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.696034 (E_RNA) where: Base-Base interactions energy: -74.983 where: short stacking energy: -64.531 Base-Backbone interact. energy: 0.989 local terms energy: -119.701688 where: bonds (distance) C4'-P energy: -28.454 bonds (distance) P-C4' energy: -37.869 flat angles C4'-P-C4' energy: -37.395 flat angles P-C4'-P energy: -15.548 tors. eta vs tors. theta energy: -0.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -721.088518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.088518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.088518 (E_RNA) where: Base-Base interactions energy: -483.569 where: short stacking energy: -207.518 Base-Backbone interact. energy: -2.399 local terms energy: -235.120104 where: bonds (distance) C4'-P energy: -42.416 bonds (distance) P-C4' energy: -50.469 flat angles C4'-P-C4' energy: -50.461 flat angles P-C4'-P energy: -29.898 tors. eta vs tors. theta energy: -61.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -632.980973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.980973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.980973 (E_RNA) where: Base-Base interactions energy: -412.231 where: short stacking energy: -189.121 Base-Backbone interact. energy: -0.414 local terms energy: -220.336157 where: bonds (distance) C4'-P energy: -34.901 bonds (distance) P-C4' energy: -51.971 flat angles C4'-P-C4' energy: -52.707 flat angles P-C4'-P energy: -33.582 tors. eta vs tors. theta energy: -47.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -563.833809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.833809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.833809 (E_RNA) where: Base-Base interactions energy: -333.808 where: short stacking energy: -190.712 Base-Backbone interact. energy: -0.368 local terms energy: -229.657684 where: bonds (distance) C4'-P energy: -40.624 bonds (distance) P-C4' energy: -45.411 flat angles C4'-P-C4' energy: -49.934 flat angles P-C4'-P energy: -28.077 tors. eta vs tors. theta energy: -65.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -545.375630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.375630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.375630 (E_RNA) where: Base-Base interactions energy: -346.368 where: short stacking energy: -165.399 Base-Backbone interact. energy: -0.387 local terms energy: -198.621496 where: bonds (distance) C4'-P energy: -35.478 bonds (distance) P-C4' energy: -41.040 flat angles C4'-P-C4' energy: -41.594 flat angles P-C4'-P energy: -33.186 tors. eta vs tors. theta energy: -47.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -459.464117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.464117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.464117 (E_RNA) where: Base-Base interactions energy: -270.873 where: short stacking energy: -133.237 Base-Backbone interact. energy: -1.941 local terms energy: -186.650136 where: bonds (distance) C4'-P energy: -44.710 bonds (distance) P-C4' energy: -43.022 flat angles C4'-P-C4' energy: -40.342 flat angles P-C4'-P energy: -29.580 tors. eta vs tors. theta energy: -28.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -377.511457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.511457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.511457 (E_RNA) where: Base-Base interactions energy: -214.949 where: short stacking energy: -99.205 Base-Backbone interact. energy: -2.077 local terms energy: -160.484664 where: bonds (distance) C4'-P energy: -38.321 bonds (distance) P-C4' energy: -43.087 flat angles C4'-P-C4' energy: -39.181 flat angles P-C4'-P energy: -17.833 tors. eta vs tors. theta energy: -22.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -236.701793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.701793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.701793 (E_RNA) where: Base-Base interactions energy: -98.373 where: short stacking energy: -77.795 Base-Backbone interact. energy: 1.488 local terms energy: -139.816482 where: bonds (distance) C4'-P energy: -40.514 bonds (distance) P-C4' energy: -44.527 flat angles C4'-P-C4' energy: -25.424 flat angles P-C4'-P energy: -32.790 tors. eta vs tors. theta energy: 3.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -227.259816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.259816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.259816 (E_RNA) where: Base-Base interactions energy: -87.419 where: short stacking energy: -70.867 Base-Backbone interact. energy: 0.439 local terms energy: -140.280321 where: bonds (distance) C4'-P energy: -33.216 bonds (distance) P-C4' energy: -29.991 flat angles C4'-P-C4' energy: -37.244 flat angles P-C4'-P energy: -25.408 tors. eta vs tors. theta energy: -14.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -192.592933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.592933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.592933 (E_RNA) where: Base-Base interactions energy: -83.609 where: short stacking energy: -64.476 Base-Backbone interact. energy: 1.717 local terms energy: -110.701404 where: bonds (distance) C4'-P energy: -29.630 bonds (distance) P-C4' energy: -30.002 flat angles C4'-P-C4' energy: -38.424 flat angles P-C4'-P energy: -16.512 tors. eta vs tors. theta energy: 3.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -196.188278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.188278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.188278 (E_RNA) where: Base-Base interactions energy: -70.901 where: short stacking energy: -67.762 Base-Backbone interact. energy: 2.115 local terms energy: -127.402398 where: bonds (distance) C4'-P energy: -39.257 bonds (distance) P-C4' energy: -40.842 flat angles C4'-P-C4' energy: -38.512 flat angles P-C4'-P energy: -14.954 tors. eta vs tors. theta energy: 6.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -707.924477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.924477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.924477 (E_RNA) where: Base-Base interactions energy: -474.708 where: short stacking energy: -205.246 Base-Backbone interact. energy: 1.051 local terms energy: -234.267559 where: bonds (distance) C4'-P energy: -44.713 bonds (distance) P-C4' energy: -50.050 flat angles C4'-P-C4' energy: -47.323 flat angles P-C4'-P energy: -32.748 tors. eta vs tors. theta energy: -59.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -621.743326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.743326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.743326 (E_RNA) where: Base-Base interactions energy: -391.265 where: short stacking energy: -163.106 Base-Backbone interact. energy: -1.056 local terms energy: -229.422288 where: bonds (distance) C4'-P energy: -43.509 bonds (distance) P-C4' energy: -53.545 flat angles C4'-P-C4' energy: -52.817 flat angles P-C4'-P energy: -37.721 tors. eta vs tors. theta energy: -41.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -557.257235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.257235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.257235 (E_RNA) where: Base-Base interactions energy: -332.465 where: short stacking energy: -193.361 Base-Backbone interact. energy: -0.001 local terms energy: -224.791030 where: bonds (distance) C4'-P energy: -42.512 bonds (distance) P-C4' energy: -47.538 flat angles C4'-P-C4' energy: -46.971 flat angles P-C4'-P energy: -25.883 tors. eta vs tors. theta energy: -61.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -551.910722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.910722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.910722 (E_RNA) where: Base-Base interactions energy: -331.843 where: short stacking energy: -144.941 Base-Backbone interact. energy: -0.581 local terms energy: -219.487178 where: bonds (distance) C4'-P energy: -46.620 bonds (distance) P-C4' energy: -40.796 flat angles C4'-P-C4' energy: -52.554 flat angles P-C4'-P energy: -31.285 tors. eta vs tors. theta energy: -48.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -455.764200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.764200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.764200 (E_RNA) where: Base-Base interactions energy: -275.506 where: short stacking energy: -135.205 Base-Backbone interact. energy: 2.126 local terms energy: -182.384254 where: bonds (distance) C4'-P energy: -40.861 bonds (distance) P-C4' energy: -39.433 flat angles C4'-P-C4' energy: -42.038 flat angles P-C4'-P energy: -27.464 tors. eta vs tors. theta energy: -32.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -369.812823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.812823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.812823 (E_RNA) where: Base-Base interactions energy: -213.413 where: short stacking energy: -123.854 Base-Backbone interact. energy: 0.192 local terms energy: -156.591477 where: bonds (distance) C4'-P energy: -37.995 bonds (distance) P-C4' energy: -37.975 flat angles C4'-P-C4' energy: -38.066 flat angles P-C4'-P energy: -21.846 tors. eta vs tors. theta energy: -20.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -238.715219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.715219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.715219 (E_RNA) where: Base-Base interactions energy: -84.450 where: short stacking energy: -71.882 Base-Backbone interact. energy: -0.712 local terms energy: -153.552447 where: bonds (distance) C4'-P energy: -32.283 bonds (distance) P-C4' energy: -42.158 flat angles C4'-P-C4' energy: -40.396 flat angles P-C4'-P energy: -25.771 tors. eta vs tors. theta energy: -12.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -224.743235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.743235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.743235 (E_RNA) where: Base-Base interactions energy: -87.223 where: short stacking energy: -82.209 Base-Backbone interact. energy: 1.925 local terms energy: -139.445049 where: bonds (distance) C4'-P energy: -45.375 bonds (distance) P-C4' energy: -43.765 flat angles C4'-P-C4' energy: -32.365 flat angles P-C4'-P energy: -14.174 tors. eta vs tors. theta energy: -3.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -221.697975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.697975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.697975 (E_RNA) where: Base-Base interactions energy: -97.703 where: short stacking energy: -50.313 Base-Backbone interact. energy: 1.173 local terms energy: -125.167757 where: bonds (distance) C4'-P energy: -40.287 bonds (distance) P-C4' energy: -36.907 flat angles C4'-P-C4' energy: -36.206 flat angles P-C4'-P energy: -17.351 tors. eta vs tors. theta energy: 5.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -193.278888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.278888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.278888 (E_RNA) where: Base-Base interactions energy: -77.253 where: short stacking energy: -39.497 Base-Backbone interact. energy: 2.434 local terms energy: -118.460092 where: bonds (distance) C4'-P energy: -36.019 bonds (distance) P-C4' energy: -42.862 flat angles C4'-P-C4' energy: -28.387 flat angles P-C4'-P energy: -20.594 tors. eta vs tors. theta energy: 9.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -707.700997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.700997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.700997 (E_RNA) where: Base-Base interactions energy: -477.123 where: short stacking energy: -208.770 Base-Backbone interact. energy: 0.591 local terms energy: -231.168692 where: bonds (distance) C4'-P energy: -38.566 bonds (distance) P-C4' energy: -44.797 flat angles C4'-P-C4' energy: -46.999 flat angles P-C4'-P energy: -32.754 tors. eta vs tors. theta energy: -68.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -640.668747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.668747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.668747 (E_RNA) where: Base-Base interactions energy: -429.210 where: short stacking energy: -192.920 Base-Backbone interact. energy: -0.929 local terms energy: -210.530389 where: bonds (distance) C4'-P energy: -48.727 bonds (distance) P-C4' energy: -46.291 flat angles C4'-P-C4' energy: -44.673 flat angles P-C4'-P energy: -29.113 tors. eta vs tors. theta energy: -41.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -577.519365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.519365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.519365 (E_RNA) where: Base-Base interactions energy: -366.309 where: short stacking energy: -177.361 Base-Backbone interact. energy: 0.953 local terms energy: -212.163071 where: bonds (distance) C4'-P energy: -42.364 bonds (distance) P-C4' energy: -48.149 flat angles C4'-P-C4' energy: -45.958 flat angles P-C4'-P energy: -23.318 tors. eta vs tors. theta energy: -52.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -560.423131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.423131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.423131 (E_RNA) where: Base-Base interactions energy: -350.827 where: short stacking energy: -181.857 Base-Backbone interact. energy: -0.617 local terms energy: -208.978599 where: bonds (distance) C4'-P energy: -45.549 bonds (distance) P-C4' energy: -43.256 flat angles C4'-P-C4' energy: -42.594 flat angles P-C4'-P energy: -24.444 tors. eta vs tors. theta energy: -53.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -442.835219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.835219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.835219 (E_RNA) where: Base-Base interactions energy: -252.887 where: short stacking energy: -128.511 Base-Backbone interact. energy: -0.739 local terms energy: -189.208698 where: bonds (distance) C4'-P energy: -42.333 bonds (distance) P-C4' energy: -48.918 flat angles C4'-P-C4' energy: -43.017 flat angles P-C4'-P energy: -23.732 tors. eta vs tors. theta energy: -31.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -377.899977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.899977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.899977 (E_RNA) where: Base-Base interactions energy: -216.657 where: short stacking energy: -121.128 Base-Backbone interact. energy: -0.483 local terms energy: -160.759699 where: bonds (distance) C4'-P energy: -35.447 bonds (distance) P-C4' energy: -36.158 flat angles C4'-P-C4' energy: -47.217 flat angles P-C4'-P energy: -19.430 tors. eta vs tors. theta energy: -22.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -260.557911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.557911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.557911 (E_RNA) where: Base-Base interactions energy: -94.150 where: short stacking energy: -69.478 Base-Backbone interact. energy: -1.183 local terms energy: -165.225505 where: bonds (distance) C4'-P energy: -48.012 bonds (distance) P-C4' energy: -50.658 flat angles C4'-P-C4' energy: -40.149 flat angles P-C4'-P energy: -25.111 tors. eta vs tors. theta energy: -1.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -221.634121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.634121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.634121 (E_RNA) where: Base-Base interactions energy: -71.949 where: short stacking energy: -56.864 Base-Backbone interact. energy: -0.563 local terms energy: -149.122190 where: bonds (distance) C4'-P energy: -42.015 bonds (distance) P-C4' energy: -34.039 flat angles C4'-P-C4' energy: -48.563 flat angles P-C4'-P energy: -19.521 tors. eta vs tors. theta energy: -4.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -243.513989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.513989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.513989 (E_RNA) where: Base-Base interactions energy: -118.408 where: short stacking energy: -56.388 Base-Backbone interact. energy: -1.986 local terms energy: -123.120739 where: bonds (distance) C4'-P energy: -31.909 bonds (distance) P-C4' energy: -44.317 flat angles C4'-P-C4' energy: -33.763 flat angles P-C4'-P energy: -18.273 tors. eta vs tors. theta energy: 5.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -206.129078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.129078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.129078 (E_RNA) where: Base-Base interactions energy: -91.448 where: short stacking energy: -41.937 Base-Backbone interact. energy: -0.588 local terms energy: -114.092892 where: bonds (distance) C4'-P energy: -34.772 bonds (distance) P-C4' energy: -39.236 flat angles C4'-P-C4' energy: -16.523 flat angles P-C4'-P energy: -20.910 tors. eta vs tors. theta energy: -2.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -718.469391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.469391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.469391 (E_RNA) where: Base-Base interactions energy: -489.166 where: short stacking energy: -208.948 Base-Backbone interact. energy: -0.895 local terms energy: -228.408560 where: bonds (distance) C4'-P energy: -42.645 bonds (distance) P-C4' energy: -39.402 flat angles C4'-P-C4' energy: -54.548 flat angles P-C4'-P energy: -30.736 tors. eta vs tors. theta energy: -61.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -655.890325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.890325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.890325 (E_RNA) where: Base-Base interactions energy: -438.396 where: short stacking energy: -189.869 Base-Backbone interact. energy: -2.301 local terms energy: -215.193625 where: bonds (distance) C4'-P energy: -44.311 bonds (distance) P-C4' energy: -45.671 flat angles C4'-P-C4' energy: -49.052 flat angles P-C4'-P energy: -26.362 tors. eta vs tors. theta energy: -49.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -548.738035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.738035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.738035 (E_RNA) where: Base-Base interactions energy: -324.259 where: short stacking energy: -173.410 Base-Backbone interact. energy: -0.140 local terms energy: -224.338770 where: bonds (distance) C4'-P energy: -46.413 bonds (distance) P-C4' energy: -49.114 flat angles C4'-P-C4' energy: -46.337 flat angles P-C4'-P energy: -30.508 tors. eta vs tors. theta energy: -51.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -537.240925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.240925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.240925 (E_RNA) where: Base-Base interactions energy: -345.633 where: short stacking energy: -155.333 Base-Backbone interact. energy: -0.763 local terms energy: -190.844635 where: bonds (distance) C4'-P energy: -44.901 bonds (distance) P-C4' energy: -33.405 flat angles C4'-P-C4' energy: -36.971 flat angles P-C4'-P energy: -27.253 tors. eta vs tors. theta energy: -48.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -466.234557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.234557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.234557 (E_RNA) where: Base-Base interactions energy: -277.673 where: short stacking energy: -124.999 Base-Backbone interact. energy: -0.527 local terms energy: -188.034820 where: bonds (distance) C4'-P energy: -42.276 bonds (distance) P-C4' energy: -47.807 flat angles C4'-P-C4' energy: -41.904 flat angles P-C4'-P energy: -23.816 tors. eta vs tors. theta energy: -32.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -377.559504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.559504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.559504 (E_RNA) where: Base-Base interactions energy: -212.035 where: short stacking energy: -120.686 Base-Backbone interact. energy: -1.601 local terms energy: -163.922951 where: bonds (distance) C4'-P energy: -27.481 bonds (distance) P-C4' energy: -45.703 flat angles C4'-P-C4' energy: -41.977 flat angles P-C4'-P energy: -27.775 tors. eta vs tors. theta energy: -20.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -243.212470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.212470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.212470 (E_RNA) where: Base-Base interactions energy: -92.087 where: short stacking energy: -91.116 Base-Backbone interact. energy: 1.259 local terms energy: -152.383976 where: bonds (distance) C4'-P energy: -39.809 bonds (distance) P-C4' energy: -41.102 flat angles C4'-P-C4' energy: -39.278 flat angles P-C4'-P energy: -22.417 tors. eta vs tors. theta energy: -9.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -275.725840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.725840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.725840 (E_RNA) where: Base-Base interactions energy: -151.579 where: short stacking energy: -84.934 Base-Backbone interact. energy: 0.077 local terms energy: -124.223994 where: bonds (distance) C4'-P energy: -38.542 bonds (distance) P-C4' energy: -34.836 flat angles C4'-P-C4' energy: -29.018 flat angles P-C4'-P energy: -19.624 tors. eta vs tors. theta energy: -2.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -213.529863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.529863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.529863 (E_RNA) where: Base-Base interactions energy: -67.068 where: short stacking energy: -55.211 Base-Backbone interact. energy: -0.525 local terms energy: -145.936276 where: bonds (distance) C4'-P energy: -41.988 bonds (distance) P-C4' energy: -46.704 flat angles C4'-P-C4' energy: -40.460 flat angles P-C4'-P energy: -15.995 tors. eta vs tors. theta energy: -0.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -227.897135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.897135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.897135 (E_RNA) where: Base-Base interactions energy: -110.970 where: short stacking energy: -63.660 Base-Backbone interact. energy: -0.197 local terms energy: -116.730289 where: bonds (distance) C4'-P energy: -37.815 bonds (distance) P-C4' energy: -40.631 flat angles C4'-P-C4' energy: -34.494 flat angles P-C4'-P energy: -15.656 tors. eta vs tors. theta energy: 11.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -712.955780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.955780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.955780 (E_RNA) where: Base-Base interactions energy: -482.653 where: short stacking energy: -199.783 Base-Backbone interact. energy: -1.338 local terms energy: -228.965261 where: bonds (distance) C4'-P energy: -39.964 bonds (distance) P-C4' energy: -45.061 flat angles C4'-P-C4' energy: -44.563 flat angles P-C4'-P energy: -35.477 tors. eta vs tors. theta energy: -63.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -630.927384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.927384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.927384 (E_RNA) where: Base-Base interactions energy: -419.813 where: short stacking energy: -191.964 Base-Backbone interact. energy: -0.631 local terms energy: -210.483160 where: bonds (distance) C4'-P energy: -37.079 bonds (distance) P-C4' energy: -47.681 flat angles C4'-P-C4' energy: -43.266 flat angles P-C4'-P energy: -30.904 tors. eta vs tors. theta energy: -51.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -570.762435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.762435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.762435 (E_RNA) where: Base-Base interactions energy: -360.461 where: short stacking energy: -174.540 Base-Backbone interact. energy: -1.353 local terms energy: -208.948679 where: bonds (distance) C4'-P energy: -35.989 bonds (distance) P-C4' energy: -43.897 flat angles C4'-P-C4' energy: -46.269 flat angles P-C4'-P energy: -33.224 tors. eta vs tors. theta energy: -49.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -532.629085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.629085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.629085 (E_RNA) where: Base-Base interactions energy: -321.122 where: short stacking energy: -163.303 Base-Backbone interact. energy: -0.483 local terms energy: -211.024210 where: bonds (distance) C4'-P energy: -44.632 bonds (distance) P-C4' energy: -41.711 flat angles C4'-P-C4' energy: -46.389 flat angles P-C4'-P energy: -33.604 tors. eta vs tors. theta energy: -44.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -475.102881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.102881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.102881 (E_RNA) where: Base-Base interactions energy: -291.787 where: short stacking energy: -149.890 Base-Backbone interact. energy: -1.206 local terms energy: -182.109556 where: bonds (distance) C4'-P energy: -41.923 bonds (distance) P-C4' energy: -33.334 flat angles C4'-P-C4' energy: -45.213 flat angles P-C4'-P energy: -22.014 tors. eta vs tors. theta energy: -39.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -383.340790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.340790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.340790 (E_RNA) where: Base-Base interactions energy: -204.907 where: short stacking energy: -114.253 Base-Backbone interact. energy: 0.703 local terms energy: -179.137234 where: bonds (distance) C4'-P energy: -42.339 bonds (distance) P-C4' energy: -39.874 flat angles C4'-P-C4' energy: -40.381 flat angles P-C4'-P energy: -31.621 tors. eta vs tors. theta energy: -24.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -221.232871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.232871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.232871 (E_RNA) where: Base-Base interactions energy: -61.262 where: short stacking energy: -51.214 Base-Backbone interact. energy: 0.828 local terms energy: -160.799700 where: bonds (distance) C4'-P energy: -36.766 bonds (distance) P-C4' energy: -48.946 flat angles C4'-P-C4' energy: -42.573 flat angles P-C4'-P energy: -25.564 tors. eta vs tors. theta energy: -6.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -263.549893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.549893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.549893 (E_RNA) where: Base-Base interactions energy: -130.124 where: short stacking energy: -87.235 Base-Backbone interact. energy: 1.506 local terms energy: -134.931245 where: bonds (distance) C4'-P energy: -30.543 bonds (distance) P-C4' energy: -38.883 flat angles C4'-P-C4' energy: -41.003 flat angles P-C4'-P energy: -24.727 tors. eta vs tors. theta energy: 0.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -223.507551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.507551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.507551 (E_RNA) where: Base-Base interactions energy: -69.009 where: short stacking energy: -46.460 Base-Backbone interact. energy: -0.373 local terms energy: -154.126192 where: bonds (distance) C4'-P energy: -43.972 bonds (distance) P-C4' energy: -44.437 flat angles C4'-P-C4' energy: -30.533 flat angles P-C4'-P energy: -31.220 tors. eta vs tors. theta energy: -3.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -187.615549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.615549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.615549 (E_RNA) where: Base-Base interactions energy: -51.574 where: short stacking energy: -45.548 Base-Backbone interact. energy: -1.176 local terms energy: -134.866051 where: bonds (distance) C4'-P energy: -42.710 bonds (distance) P-C4' energy: -42.567 flat angles C4'-P-C4' energy: -39.120 flat angles P-C4'-P energy: -22.154 tors. eta vs tors. theta energy: 11.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -717.720646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.720646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.720646 (E_RNA) where: Base-Base interactions energy: -473.535 where: short stacking energy: -196.588 Base-Backbone interact. energy: -1.644 local terms energy: -242.542099 where: bonds (distance) C4'-P energy: -51.103 bonds (distance) P-C4' energy: -45.683 flat angles C4'-P-C4' energy: -52.421 flat angles P-C4'-P energy: -38.267 tors. eta vs tors. theta energy: -55.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -609.787452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.787452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.787452 (E_RNA) where: Base-Base interactions energy: -396.010 where: short stacking energy: -179.753 Base-Backbone interact. energy: -0.413 local terms energy: -213.363966 where: bonds (distance) C4'-P energy: -43.974 bonds (distance) P-C4' energy: -48.678 flat angles C4'-P-C4' energy: -50.341 flat angles P-C4'-P energy: -24.985 tors. eta vs tors. theta energy: -45.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -560.227311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.227311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.227311 (E_RNA) where: Base-Base interactions energy: -347.584 where: short stacking energy: -173.254 Base-Backbone interact. energy: -1.262 local terms energy: -211.381105 where: bonds (distance) C4'-P energy: -44.633 bonds (distance) P-C4' energy: -46.456 flat angles C4'-P-C4' energy: -49.093 flat angles P-C4'-P energy: -26.868 tors. eta vs tors. theta energy: -44.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -549.958678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.958678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.958678 (E_RNA) where: Base-Base interactions energy: -350.911 where: short stacking energy: -168.958 Base-Backbone interact. energy: 2.905 local terms energy: -201.953041 where: bonds (distance) C4'-P energy: -35.299 bonds (distance) P-C4' energy: -43.547 flat angles C4'-P-C4' energy: -48.810 flat angles P-C4'-P energy: -26.970 tors. eta vs tors. theta energy: -47.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -457.645776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.645776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.645776 (E_RNA) where: Base-Base interactions energy: -272.597 where: short stacking energy: -128.876 Base-Backbone interact. energy: -0.944 local terms energy: -184.104933 where: bonds (distance) C4'-P energy: -37.553 bonds (distance) P-C4' energy: -36.155 flat angles C4'-P-C4' energy: -49.366 flat angles P-C4'-P energy: -31.580 tors. eta vs tors. theta energy: -29.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -392.396508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.396508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.396508 (E_RNA) where: Base-Base interactions energy: -229.634 where: short stacking energy: -123.335 Base-Backbone interact. energy: -0.373 local terms energy: -162.389298 where: bonds (distance) C4'-P energy: -40.697 bonds (distance) P-C4' energy: -43.028 flat angles C4'-P-C4' energy: -31.792 flat angles P-C4'-P energy: -13.997 tors. eta vs tors. theta energy: -32.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -241.329707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.329707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.329707 (E_RNA) where: Base-Base interactions energy: -88.668 where: short stacking energy: -83.139 Base-Backbone interact. energy: 1.277 local terms energy: -153.938871 where: bonds (distance) C4'-P energy: -45.515 bonds (distance) P-C4' energy: -53.303 flat angles C4'-P-C4' energy: -29.028 flat angles P-C4'-P energy: -21.185 tors. eta vs tors. theta energy: -4.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -214.253480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.253480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.253480 (E_RNA) where: Base-Base interactions energy: -72.248 where: short stacking energy: -68.234 Base-Backbone interact. energy: 0.409 local terms energy: -142.414618 where: bonds (distance) C4'-P energy: -33.197 bonds (distance) P-C4' energy: -38.278 flat angles C4'-P-C4' energy: -36.656 flat angles P-C4'-P energy: -20.422 tors. eta vs tors. theta energy: -13.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -202.559763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.559763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.559763 (E_RNA) where: Base-Base interactions energy: -75.855 where: short stacking energy: -55.908 Base-Backbone interact. energy: -0.730 local terms energy: -125.973875 where: bonds (distance) C4'-P energy: -43.825 bonds (distance) P-C4' energy: -30.598 flat angles C4'-P-C4' energy: -27.888 flat angles P-C4'-P energy: -24.653 tors. eta vs tors. theta energy: 0.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -204.168648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.168648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.168648 (E_RNA) where: Base-Base interactions energy: -68.200 where: short stacking energy: -42.971 Base-Backbone interact. energy: -0.289 local terms energy: -135.680431 where: bonds (distance) C4'-P energy: -46.021 bonds (distance) P-C4' energy: -40.994 flat angles C4'-P-C4' energy: -36.168 flat angles P-C4'-P energy: -12.157 tors. eta vs tors. theta energy: -0.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -722.849009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.849009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.849009 (E_RNA) where: Base-Base interactions energy: -472.975 where: short stacking energy: -197.816 Base-Backbone interact. energy: -1.182 local terms energy: -248.691929 where: bonds (distance) C4'-P energy: -44.360 bonds (distance) P-C4' energy: -43.778 flat angles C4'-P-C4' energy: -52.402 flat angles P-C4'-P energy: -45.123 tors. eta vs tors. theta energy: -63.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -634.793260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.793260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.793260 (E_RNA) where: Base-Base interactions energy: -398.611 where: short stacking energy: -190.359 Base-Backbone interact. energy: 0.948 local terms energy: -237.129695 where: bonds (distance) C4'-P energy: -45.093 bonds (distance) P-C4' energy: -47.834 flat angles C4'-P-C4' energy: -52.312 flat angles P-C4'-P energy: -36.648 tors. eta vs tors. theta energy: -55.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -568.942660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.942660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.942660 (E_RNA) where: Base-Base interactions energy: -365.962 where: short stacking energy: -152.587 Base-Backbone interact. energy: -0.729 local terms energy: -202.251986 where: bonds (distance) C4'-P energy: -37.921 bonds (distance) P-C4' energy: -44.335 flat angles C4'-P-C4' energy: -43.359 flat angles P-C4'-P energy: -28.769 tors. eta vs tors. theta energy: -47.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -512.145724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.145724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.145724 (E_RNA) where: Base-Base interactions energy: -312.650 where: short stacking energy: -167.440 Base-Backbone interact. energy: -0.097 local terms energy: -199.398553 where: bonds (distance) C4'-P energy: -32.629 bonds (distance) P-C4' energy: -41.668 flat angles C4'-P-C4' energy: -40.515 flat angles P-C4'-P energy: -37.747 tors. eta vs tors. theta energy: -46.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -430.103780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.103780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.103780 (E_RNA) where: Base-Base interactions energy: -251.568 where: short stacking energy: -136.104 Base-Backbone interact. energy: -0.248 local terms energy: -178.287790 where: bonds (distance) C4'-P energy: -38.981 bonds (distance) P-C4' energy: -44.307 flat angles C4'-P-C4' energy: -44.087 flat angles P-C4'-P energy: -18.434 tors. eta vs tors. theta energy: -32.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -386.275716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.275716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.275716 (E_RNA) where: Base-Base interactions energy: -226.897 where: short stacking energy: -118.675 Base-Backbone interact. energy: -1.885 local terms energy: -157.493391 where: bonds (distance) C4'-P energy: -31.090 bonds (distance) P-C4' energy: -38.172 flat angles C4'-P-C4' energy: -40.397 flat angles P-C4'-P energy: -30.044 tors. eta vs tors. theta energy: -17.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -273.747278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.747278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.747278 (E_RNA) where: Base-Base interactions energy: -122.535 where: short stacking energy: -76.067 Base-Backbone interact. energy: -1.027 local terms energy: -150.185862 where: bonds (distance) C4'-P energy: -34.487 bonds (distance) P-C4' energy: -38.004 flat angles C4'-P-C4' energy: -34.347 flat angles P-C4'-P energy: -27.899 tors. eta vs tors. theta energy: -15.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -239.043314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.043314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.043314 (E_RNA) where: Base-Base interactions energy: -78.669 where: short stacking energy: -62.577 Base-Backbone interact. energy: -1.994 local terms energy: -158.380108 where: bonds (distance) C4'-P energy: -44.665 bonds (distance) P-C4' energy: -48.945 flat angles C4'-P-C4' energy: -38.125 flat angles P-C4'-P energy: -22.636 tors. eta vs tors. theta energy: -4.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -258.020023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.020023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.020023 (E_RNA) where: Base-Base interactions energy: -118.475 where: short stacking energy: -59.666 Base-Backbone interact. energy: -0.195 local terms energy: -139.349611 where: bonds (distance) C4'-P energy: -43.131 bonds (distance) P-C4' energy: -37.770 flat angles C4'-P-C4' energy: -40.087 flat angles P-C4'-P energy: -18.783 tors. eta vs tors. theta energy: 0.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -187.808055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.808055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.808055 (E_RNA) where: Base-Base interactions energy: -50.754 where: short stacking energy: -44.138 Base-Backbone interact. energy: -0.877 local terms energy: -136.177245 where: bonds (distance) C4'-P energy: -45.687 bonds (distance) P-C4' energy: -37.688 flat angles C4'-P-C4' energy: -40.864 flat angles P-C4'-P energy: -22.501 tors. eta vs tors. theta energy: 10.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -715.068896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.068896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.068896 (E_RNA) where: Base-Base interactions energy: -484.870 where: short stacking energy: -210.355 Base-Backbone interact. energy: 5.701 local terms energy: -235.899603 where: bonds (distance) C4'-P energy: -47.389 bonds (distance) P-C4' energy: -46.879 flat angles C4'-P-C4' energy: -48.404 flat angles P-C4'-P energy: -36.714 tors. eta vs tors. theta energy: -56.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -658.752903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.752903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.752903 (E_RNA) where: Base-Base interactions energy: -445.152 where: short stacking energy: -203.184 Base-Backbone interact. energy: -0.756 local terms energy: -212.844011 where: bonds (distance) C4'-P energy: -32.743 bonds (distance) P-C4' energy: -47.184 flat angles C4'-P-C4' energy: -50.428 flat angles P-C4'-P energy: -28.561 tors. eta vs tors. theta energy: -53.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -579.954149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.954149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.954149 (E_RNA) where: Base-Base interactions energy: -374.536 where: short stacking energy: -153.782 Base-Backbone interact. energy: -2.202 local terms energy: -203.217006 where: bonds (distance) C4'-P energy: -48.839 bonds (distance) P-C4' energy: -39.287 flat angles C4'-P-C4' energy: -51.283 flat angles P-C4'-P energy: -27.811 tors. eta vs tors. theta energy: -35.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -514.207292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.207292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.207292 (E_RNA) where: Base-Base interactions energy: -331.734 where: short stacking energy: -164.298 Base-Backbone interact. energy: -0.950 local terms energy: -181.523247 where: bonds (distance) C4'-P energy: -37.268 bonds (distance) P-C4' energy: -42.208 flat angles C4'-P-C4' energy: -36.171 flat angles P-C4'-P energy: -25.349 tors. eta vs tors. theta energy: -40.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -455.604067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.604067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.604067 (E_RNA) where: Base-Base interactions energy: -266.757 where: short stacking energy: -130.250 Base-Backbone interact. energy: 2.096 local terms energy: -190.943169 where: bonds (distance) C4'-P energy: -39.391 bonds (distance) P-C4' energy: -49.320 flat angles C4'-P-C4' energy: -43.640 flat angles P-C4'-P energy: -27.074 tors. eta vs tors. theta energy: -31.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -387.569880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.569880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.569880 (E_RNA) where: Base-Base interactions energy: -227.706 where: short stacking energy: -118.002 Base-Backbone interact. energy: -0.593 local terms energy: -159.270083 where: bonds (distance) C4'-P energy: -33.866 bonds (distance) P-C4' energy: -47.037 flat angles C4'-P-C4' energy: -39.426 flat angles P-C4'-P energy: -19.567 tors. eta vs tors. theta energy: -19.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -287.492051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.492051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.492051 (E_RNA) where: Base-Base interactions energy: -141.794 where: short stacking energy: -77.028 Base-Backbone interact. energy: 0.179 local terms energy: -145.876626 where: bonds (distance) C4'-P energy: -39.041 bonds (distance) P-C4' energy: -44.353 flat angles C4'-P-C4' energy: -40.572 flat angles P-C4'-P energy: -13.796 tors. eta vs tors. theta energy: -8.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -244.294055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.294055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.294055 (E_RNA) where: Base-Base interactions energy: -124.416 where: short stacking energy: -82.019 Base-Backbone interact. energy: -0.223 local terms energy: -119.654576 where: bonds (distance) C4'-P energy: -26.352 bonds (distance) P-C4' energy: -35.351 flat angles C4'-P-C4' energy: -37.481 flat angles P-C4'-P energy: -18.924 tors. eta vs tors. theta energy: -1.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -191.420150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.420150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.420150 (E_RNA) where: Base-Base interactions energy: -57.864 where: short stacking energy: -43.939 Base-Backbone interact. energy: -1.494 local terms energy: -132.062178 where: bonds (distance) C4'-P energy: -34.855 bonds (distance) P-C4' energy: -49.161 flat angles C4'-P-C4' energy: -18.520 flat angles P-C4'-P energy: -30.047 tors. eta vs tors. theta energy: 0.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -211.423006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.423006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.423006 (E_RNA) where: Base-Base interactions energy: -86.552 where: short stacking energy: -40.161 Base-Backbone interact. energy: -0.586 local terms energy: -124.285039 where: bonds (distance) C4'-P energy: -35.012 bonds (distance) P-C4' energy: -42.663 flat angles C4'-P-C4' energy: -37.657 flat angles P-C4'-P energy: -19.227 tors. eta vs tors. theta energy: 10.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -703.133667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.133667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.133667 (E_RNA) where: Base-Base interactions energy: -459.045 where: short stacking energy: -203.029 Base-Backbone interact. energy: 1.161 local terms energy: -245.248851 where: bonds (distance) C4'-P energy: -39.642 bonds (distance) P-C4' energy: -50.217 flat angles C4'-P-C4' energy: -52.442 flat angles P-C4'-P energy: -39.662 tors. eta vs tors. theta energy: -63.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -644.685481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.685481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.685481 (E_RNA) where: Base-Base interactions energy: -416.978 where: short stacking energy: -177.497 Base-Backbone interact. energy: -0.789 local terms energy: -226.918607 where: bonds (distance) C4'-P energy: -42.297 bonds (distance) P-C4' energy: -49.029 flat angles C4'-P-C4' energy: -53.883 flat angles P-C4'-P energy: -31.224 tors. eta vs tors. theta energy: -50.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -592.870176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.870176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.870176 (E_RNA) where: Base-Base interactions energy: -379.952 where: short stacking energy: -147.354 Base-Backbone interact. energy: -2.285 local terms energy: -210.632594 where: bonds (distance) C4'-P energy: -48.916 bonds (distance) P-C4' energy: -41.828 flat angles C4'-P-C4' energy: -47.145 flat angles P-C4'-P energy: -26.183 tors. eta vs tors. theta energy: -46.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -526.100007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.100007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.100007 (E_RNA) where: Base-Base interactions energy: -316.709 where: short stacking energy: -160.051 Base-Backbone interact. energy: 0.008 local terms energy: -209.398393 where: bonds (distance) C4'-P energy: -45.738 bonds (distance) P-C4' energy: -47.577 flat angles C4'-P-C4' energy: -43.507 flat angles P-C4'-P energy: -27.718 tors. eta vs tors. theta energy: -44.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -407.913600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.913600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.913600 (E_RNA) where: Base-Base interactions energy: -229.414 where: short stacking energy: -108.219 Base-Backbone interact. energy: 1.758 local terms energy: -180.257448 where: bonds (distance) C4'-P energy: -40.682 bonds (distance) P-C4' energy: -46.194 flat angles C4'-P-C4' energy: -46.136 flat angles P-C4'-P energy: -25.974 tors. eta vs tors. theta energy: -21.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -450.950642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.950642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.950642 (E_RNA) where: Base-Base interactions energy: -259.885 where: short stacking energy: -139.276 Base-Backbone interact. energy: -1.133 local terms energy: -189.932849 where: bonds (distance) C4'-P energy: -45.900 bonds (distance) P-C4' energy: -46.365 flat angles C4'-P-C4' energy: -35.131 flat angles P-C4'-P energy: -23.380 tors. eta vs tors. theta energy: -39.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -277.493655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.493655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.493655 (E_RNA) where: Base-Base interactions energy: -125.878 where: short stacking energy: -85.928 Base-Backbone interact. energy: 0.373 local terms energy: -151.989067 where: bonds (distance) C4'-P energy: -32.167 bonds (distance) P-C4' energy: -35.501 flat angles C4'-P-C4' energy: -46.777 flat angles P-C4'-P energy: -22.272 tors. eta vs tors. theta energy: -15.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -252.042763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.042763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.042763 (E_RNA) where: Base-Base interactions energy: -108.654 where: short stacking energy: -84.152 Base-Backbone interact. energy: 1.754 local terms energy: -145.142575 where: bonds (distance) C4'-P energy: -36.299 bonds (distance) P-C4' energy: -42.797 flat angles C4'-P-C4' energy: -36.847 flat angles P-C4'-P energy: -25.425 tors. eta vs tors. theta energy: -3.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -241.742568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.742568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.742568 (E_RNA) where: Base-Base interactions energy: -86.310 where: short stacking energy: -72.570 Base-Backbone interact. energy: -0.139 local terms energy: -155.293776 where: bonds (distance) C4'-P energy: -37.919 bonds (distance) P-C4' energy: -50.571 flat angles C4'-P-C4' energy: -38.732 flat angles P-C4'-P energy: -22.346 tors. eta vs tors. theta energy: -5.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -186.855081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.855081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.855081 (E_RNA) where: Base-Base interactions energy: -69.589 where: short stacking energy: -63.364 Base-Backbone interact. energy: -0.621 local terms energy: -116.645014 where: bonds (distance) C4'-P energy: -33.247 bonds (distance) P-C4' energy: -39.547 flat angles C4'-P-C4' energy: -33.859 flat angles P-C4'-P energy: -13.261 tors. eta vs tors. theta energy: 3.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -719.552415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.552415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.552415 (E_RNA) where: Base-Base interactions energy: -478.061 where: short stacking energy: -209.199 Base-Backbone interact. energy: 0.316 local terms energy: -241.807574 where: bonds (distance) C4'-P energy: -44.800 bonds (distance) P-C4' energy: -44.231 flat angles C4'-P-C4' energy: -47.330 flat angles P-C4'-P energy: -42.662 tors. eta vs tors. theta energy: -62.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -667.072375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.072375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.072375 (E_RNA) where: Base-Base interactions energy: -433.275 where: short stacking energy: -200.201 Base-Backbone interact. energy: 0.235 local terms energy: -234.032076 where: bonds (distance) C4'-P energy: -50.258 bonds (distance) P-C4' energy: -42.917 flat angles C4'-P-C4' energy: -54.451 flat angles P-C4'-P energy: -33.941 tors. eta vs tors. theta energy: -52.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -599.363493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.363493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.363493 (E_RNA) where: Base-Base interactions energy: -397.344 where: short stacking energy: -158.231 Base-Backbone interact. energy: -1.874 local terms energy: -200.145679 where: bonds (distance) C4'-P energy: -46.617 bonds (distance) P-C4' energy: -33.256 flat angles C4'-P-C4' energy: -42.853 flat angles P-C4'-P energy: -31.463 tors. eta vs tors. theta energy: -45.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -557.479353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.479353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.479353 (E_RNA) where: Base-Base interactions energy: -338.789 where: short stacking energy: -163.470 Base-Backbone interact. energy: 0.843 local terms energy: -219.533142 where: bonds (distance) C4'-P energy: -44.530 bonds (distance) P-C4' energy: -49.170 flat angles C4'-P-C4' energy: -49.686 flat angles P-C4'-P energy: -31.534 tors. eta vs tors. theta energy: -44.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -409.137907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.137907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.137907 (E_RNA) where: Base-Base interactions energy: -232.665 where: short stacking energy: -116.752 Base-Backbone interact. energy: -0.674 local terms energy: -175.798879 where: bonds (distance) C4'-P energy: -36.715 bonds (distance) P-C4' energy: -37.079 flat angles C4'-P-C4' energy: -46.894 flat angles P-C4'-P energy: -33.333 tors. eta vs tors. theta energy: -21.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -394.754955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.754955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.754955 (E_RNA) where: Base-Base interactions energy: -232.043 where: short stacking energy: -143.864 Base-Backbone interact. energy: -0.862 local terms energy: -161.849317 where: bonds (distance) C4'-P energy: -38.716 bonds (distance) P-C4' energy: -35.842 flat angles C4'-P-C4' energy: -39.205 flat angles P-C4'-P energy: -23.844 tors. eta vs tors. theta energy: -24.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -265.744846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.744846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.744846 (E_RNA) where: Base-Base interactions energy: -120.971 where: short stacking energy: -75.616 Base-Backbone interact. energy: -0.522 local terms energy: -144.251581 where: bonds (distance) C4'-P energy: -29.831 bonds (distance) P-C4' energy: -42.766 flat angles C4'-P-C4' energy: -35.434 flat angles P-C4'-P energy: -29.477 tors. eta vs tors. theta energy: -6.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -259.254135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.254135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.254135 (E_RNA) where: Base-Base interactions energy: -110.448 where: short stacking energy: -66.973 Base-Backbone interact. energy: -0.523 local terms energy: -148.283177 where: bonds (distance) C4'-P energy: -38.666 bonds (distance) P-C4' energy: -48.588 flat angles C4'-P-C4' energy: -35.595 flat angles P-C4'-P energy: -27.188 tors. eta vs tors. theta energy: 1.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -257.153509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.153509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.153509 (E_RNA) where: Base-Base interactions energy: -116.549 where: short stacking energy: -69.980 Base-Backbone interact. energy: -0.856 local terms energy: -139.748355 where: bonds (distance) C4'-P energy: -45.993 bonds (distance) P-C4' energy: -38.822 flat angles C4'-P-C4' energy: -29.759 flat angles P-C4'-P energy: -25.414 tors. eta vs tors. theta energy: 0.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -199.101227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.101227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.101227 (E_RNA) where: Base-Base interactions energy: -70.060 where: short stacking energy: -50.354 Base-Backbone interact. energy: 0.602 local terms energy: -129.642283 where: bonds (distance) C4'-P energy: -29.279 bonds (distance) P-C4' energy: -45.379 flat angles C4'-P-C4' energy: -33.792 flat angles P-C4'-P energy: -23.807 tors. eta vs tors. theta energy: 2.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -714.454814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.454814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.454814 (E_RNA) where: Base-Base interactions energy: -500.456 where: short stacking energy: -197.308 Base-Backbone interact. energy: -1.607 local terms energy: -212.391782 where: bonds (distance) C4'-P energy: -43.588 bonds (distance) P-C4' energy: -38.462 flat angles C4'-P-C4' energy: -49.970 flat angles P-C4'-P energy: -25.341 tors. eta vs tors. theta energy: -55.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -665.975159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.975159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.975159 (E_RNA) where: Base-Base interactions energy: -441.442 where: short stacking energy: -194.466 Base-Backbone interact. energy: -0.454 local terms energy: -224.079333 where: bonds (distance) C4'-P energy: -39.874 bonds (distance) P-C4' energy: -46.756 flat angles C4'-P-C4' energy: -53.169 flat angles P-C4'-P energy: -27.254 tors. eta vs tors. theta energy: -57.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -605.560232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.560232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.560232 (E_RNA) where: Base-Base interactions energy: -393.735 where: short stacking energy: -172.333 Base-Backbone interact. energy: 4.277 local terms energy: -216.102220 where: bonds (distance) C4'-P energy: -38.014 bonds (distance) P-C4' energy: -44.655 flat angles C4'-P-C4' energy: -45.960 flat angles P-C4'-P energy: -28.840 tors. eta vs tors. theta energy: -58.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -552.254281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.254281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.254281 (E_RNA) where: Base-Base interactions energy: -346.714 where: short stacking energy: -151.439 Base-Backbone interact. energy: -0.149 local terms energy: -205.390592 where: bonds (distance) C4'-P energy: -37.876 bonds (distance) P-C4' energy: -45.712 flat angles C4'-P-C4' energy: -48.401 flat angles P-C4'-P energy: -33.780 tors. eta vs tors. theta energy: -39.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -441.292860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.292860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.292860 (E_RNA) where: Base-Base interactions energy: -244.105 where: short stacking energy: -142.981 Base-Backbone interact. energy: -1.607 local terms energy: -195.580992 where: bonds (distance) C4'-P energy: -45.916 bonds (distance) P-C4' energy: -46.028 flat angles C4'-P-C4' energy: -45.537 flat angles P-C4'-P energy: -24.082 tors. eta vs tors. theta energy: -34.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -381.295119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.295119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.295119 (E_RNA) where: Base-Base interactions energy: -213.537 where: short stacking energy: -105.806 Base-Backbone interact. energy: -0.358 local terms energy: -167.400271 where: bonds (distance) C4'-P energy: -48.450 bonds (distance) P-C4' energy: -47.878 flat angles C4'-P-C4' energy: -38.231 flat angles P-C4'-P energy: -14.401 tors. eta vs tors. theta energy: -18.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -305.201154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.201154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.201154 (E_RNA) where: Base-Base interactions energy: -150.980 where: short stacking energy: -86.237 Base-Backbone interact. energy: 1.903 local terms energy: -156.124429 where: bonds (distance) C4'-P energy: -43.406 bonds (distance) P-C4' energy: -48.435 flat angles C4'-P-C4' energy: -40.609 flat angles P-C4'-P energy: -13.728 tors. eta vs tors. theta energy: -9.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -223.596592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.596592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.596592 (E_RNA) where: Base-Base interactions energy: -87.049 where: short stacking energy: -64.741 Base-Backbone interact. energy: -0.832 local terms energy: -135.715717 where: bonds (distance) C4'-P energy: -39.711 bonds (distance) P-C4' energy: -45.525 flat angles C4'-P-C4' energy: -36.114 flat angles P-C4'-P energy: -17.719 tors. eta vs tors. theta energy: 3.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -246.171808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.171808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.171808 (E_RNA) where: Base-Base interactions energy: -125.477 where: short stacking energy: -60.702 Base-Backbone interact. energy: 2.131 local terms energy: -122.826538 where: bonds (distance) C4'-P energy: -42.541 bonds (distance) P-C4' energy: -34.620 flat angles C4'-P-C4' energy: -31.542 flat angles P-C4'-P energy: -13.157 tors. eta vs tors. theta energy: -0.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -191.008499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.008499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.008499 (E_RNA) where: Base-Base interactions energy: -69.778 where: short stacking energy: -50.152 Base-Backbone interact. energy: 1.458 local terms energy: -122.688261 where: bonds (distance) C4'-P energy: -31.939 bonds (distance) P-C4' energy: -44.480 flat angles C4'-P-C4' energy: -35.087 flat angles P-C4'-P energy: -18.620 tors. eta vs tors. theta energy: 7.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -720.383833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.383833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.383833 (E_RNA) where: Base-Base interactions energy: -496.655 where: short stacking energy: -193.546 Base-Backbone interact. energy: 1.364 local terms energy: -225.092505 where: bonds (distance) C4'-P energy: -46.363 bonds (distance) P-C4' energy: -40.698 flat angles C4'-P-C4' energy: -48.414 flat angles P-C4'-P energy: -36.447 tors. eta vs tors. theta energy: -53.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -685.771149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.771149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.771149 (E_RNA) where: Base-Base interactions energy: -443.888 where: short stacking energy: -208.621 Base-Backbone interact. energy: -0.503 local terms energy: -241.379231 where: bonds (distance) C4'-P energy: -48.041 bonds (distance) P-C4' energy: -41.500 flat angles C4'-P-C4' energy: -50.397 flat angles P-C4'-P energy: -37.661 tors. eta vs tors. theta energy: -63.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -574.707930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.707930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.707930 (E_RNA) where: Base-Base interactions energy: -370.431 where: short stacking energy: -180.912 Base-Backbone interact. energy: 0.429 local terms energy: -204.705927 where: bonds (distance) C4'-P energy: -45.202 bonds (distance) P-C4' energy: -42.076 flat angles C4'-P-C4' energy: -47.467 flat angles P-C4'-P energy: -25.496 tors. eta vs tors. theta energy: -44.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -560.268233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.268233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.268233 (E_RNA) where: Base-Base interactions energy: -351.206 where: short stacking energy: -176.776 Base-Backbone interact. energy: 1.696 local terms energy: -210.758084 where: bonds (distance) C4'-P energy: -41.752 bonds (distance) P-C4' energy: -45.420 flat angles C4'-P-C4' energy: -47.489 flat angles P-C4'-P energy: -32.890 tors. eta vs tors. theta energy: -43.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -436.364774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.364774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.364774 (E_RNA) where: Base-Base interactions energy: -259.282 where: short stacking energy: -128.912 Base-Backbone interact. energy: -1.240 local terms energy: -175.842378 where: bonds (distance) C4'-P energy: -40.050 bonds (distance) P-C4' energy: -43.893 flat angles C4'-P-C4' energy: -32.930 flat angles P-C4'-P energy: -34.644 tors. eta vs tors. theta energy: -24.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -331.284816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.284816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.284816 (E_RNA) where: Base-Base interactions energy: -153.593 where: short stacking energy: -95.673 Base-Backbone interact. energy: 0.299 local terms energy: -177.990470 where: bonds (distance) C4'-P energy: -38.922 bonds (distance) P-C4' energy: -43.124 flat angles C4'-P-C4' energy: -43.156 flat angles P-C4'-P energy: -26.267 tors. eta vs tors. theta energy: -26.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -365.582118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.582118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.582118 (E_RNA) where: Base-Base interactions energy: -206.366 where: short stacking energy: -117.400 Base-Backbone interact. energy: 1.831 local terms energy: -161.047027 where: bonds (distance) C4'-P energy: -42.016 bonds (distance) P-C4' energy: -40.471 flat angles C4'-P-C4' energy: -38.009 flat angles P-C4'-P energy: -26.852 tors. eta vs tors. theta energy: -13.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -248.735025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.735025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.735025 (E_RNA) where: Base-Base interactions energy: -95.008 where: short stacking energy: -61.659 Base-Backbone interact. energy: 0.696 local terms energy: -154.423490 where: bonds (distance) C4'-P energy: -45.162 bonds (distance) P-C4' energy: -42.456 flat angles C4'-P-C4' energy: -36.877 flat angles P-C4'-P energy: -25.989 tors. eta vs tors. theta energy: -3.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -217.503774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.503774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.503774 (E_RNA) where: Base-Base interactions energy: -78.647 where: short stacking energy: -69.740 Base-Backbone interact. energy: -0.644 local terms energy: -138.212597 where: bonds (distance) C4'-P energy: -35.341 bonds (distance) P-C4' energy: -41.298 flat angles C4'-P-C4' energy: -31.645 flat angles P-C4'-P energy: -21.813 tors. eta vs tors. theta energy: -8.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -186.671484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.671484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.671484 (E_RNA) where: Base-Base interactions energy: -58.738 where: short stacking energy: -46.328 Base-Backbone interact. energy: 0.399 local terms energy: -128.333062 where: bonds (distance) C4'-P energy: -33.926 bonds (distance) P-C4' energy: -47.697 flat angles C4'-P-C4' energy: -29.402 flat angles P-C4'-P energy: -19.912 tors. eta vs tors. theta energy: 2.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -737.484017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.484017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.484017 (E_RNA) where: Base-Base interactions energy: -500.063 where: short stacking energy: -207.931 Base-Backbone interact. energy: -1.083 local terms energy: -236.337525 where: bonds (distance) C4'-P energy: -50.854 bonds (distance) P-C4' energy: -50.078 flat angles C4'-P-C4' energy: -48.134 flat angles P-C4'-P energy: -31.155 tors. eta vs tors. theta energy: -56.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -684.100820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.100820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.100820 (E_RNA) where: Base-Base interactions energy: -455.107 where: short stacking energy: -211.898 Base-Backbone interact. energy: 4.568 local terms energy: -233.562037 where: bonds (distance) C4'-P energy: -49.842 bonds (distance) P-C4' energy: -42.620 flat angles C4'-P-C4' energy: -44.706 flat angles P-C4'-P energy: -37.311 tors. eta vs tors. theta energy: -59.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -576.025501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.025501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.025501 (E_RNA) where: Base-Base interactions energy: -368.755 where: short stacking energy: -164.926 Base-Backbone interact. energy: 1.067 local terms energy: -208.337379 where: bonds (distance) C4'-P energy: -44.564 bonds (distance) P-C4' energy: -40.439 flat angles C4'-P-C4' energy: -47.860 flat angles P-C4'-P energy: -30.072 tors. eta vs tors. theta energy: -45.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -547.300970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.300970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.300970 (E_RNA) where: Base-Base interactions energy: -353.951 where: short stacking energy: -154.803 Base-Backbone interact. energy: -1.836 local terms energy: -191.513845 where: bonds (distance) C4'-P energy: -43.447 bonds (distance) P-C4' energy: -38.580 flat angles C4'-P-C4' energy: -45.069 flat angles P-C4'-P energy: -31.730 tors. eta vs tors. theta energy: -32.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -460.111213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.111213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.111213 (E_RNA) where: Base-Base interactions energy: -267.856 where: short stacking energy: -151.058 Base-Backbone interact. energy: -0.691 local terms energy: -191.563958 where: bonds (distance) C4'-P energy: -45.498 bonds (distance) P-C4' energy: -45.891 flat angles C4'-P-C4' energy: -40.121 flat angles P-C4'-P energy: -28.747 tors. eta vs tors. theta energy: -31.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -324.932136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.932136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.932136 (E_RNA) where: Base-Base interactions energy: -160.724 where: short stacking energy: -96.179 Base-Backbone interact. energy: -0.626 local terms energy: -163.581461 where: bonds (distance) C4'-P energy: -41.015 bonds (distance) P-C4' energy: -48.029 flat angles C4'-P-C4' energy: -25.642 flat angles P-C4'-P energy: -27.071 tors. eta vs tors. theta energy: -21.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -335.080521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.080521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.080521 (E_RNA) where: Base-Base interactions energy: -185.622 where: short stacking energy: -97.426 Base-Backbone interact. energy: 1.647 local terms energy: -151.104955 where: bonds (distance) C4'-P energy: -32.247 bonds (distance) P-C4' energy: -43.595 flat angles C4'-P-C4' energy: -36.482 flat angles P-C4'-P energy: -15.856 tors. eta vs tors. theta energy: -22.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -219.688310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.688310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.688310 (E_RNA) where: Base-Base interactions energy: -90.763 where: short stacking energy: -73.199 Base-Backbone interact. energy: 2.893 local terms energy: -131.817556 where: bonds (distance) C4'-P energy: -32.277 bonds (distance) P-C4' energy: -38.484 flat angles C4'-P-C4' energy: -35.702 flat angles P-C4'-P energy: -21.212 tors. eta vs tors. theta energy: -4.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -199.043673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.043673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.043673 (E_RNA) where: Base-Base interactions energy: -77.127 where: short stacking energy: -62.085 Base-Backbone interact. energy: -1.818 local terms energy: -120.098717 where: bonds (distance) C4'-P energy: -22.720 bonds (distance) P-C4' energy: -48.915 flat angles C4'-P-C4' energy: -34.343 flat angles P-C4'-P energy: -18.176 tors. eta vs tors. theta energy: 4.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -202.824309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.824309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.824309 (E_RNA) where: Base-Base interactions energy: -80.973 where: short stacking energy: -48.222 Base-Backbone interact. energy: 0.179 local terms energy: -122.029767 where: bonds (distance) C4'-P energy: -41.084 bonds (distance) P-C4' energy: -40.923 flat angles C4'-P-C4' energy: -25.516 flat angles P-C4'-P energy: -21.906 tors. eta vs tors. theta energy: 7.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -732.362417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.362417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.362417 (E_RNA) where: Base-Base interactions energy: -491.411 where: short stacking energy: -196.864 Base-Backbone interact. energy: -0.783 local terms energy: -240.168233 where: bonds (distance) C4'-P energy: -46.123 bonds (distance) P-C4' energy: -51.814 flat angles C4'-P-C4' energy: -50.136 flat angles P-C4'-P energy: -33.827 tors. eta vs tors. theta energy: -58.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -673.034308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.034308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.034308 (E_RNA) where: Base-Base interactions energy: -438.110 where: short stacking energy: -198.876 Base-Backbone interact. energy: -0.945 local terms energy: -233.979661 where: bonds (distance) C4'-P energy: -42.996 bonds (distance) P-C4' energy: -46.466 flat angles C4'-P-C4' energy: -49.946 flat angles P-C4'-P energy: -40.891 tors. eta vs tors. theta energy: -53.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -593.557961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.557961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.557961 (E_RNA) where: Base-Base interactions energy: -389.188 where: short stacking energy: -167.787 Base-Backbone interact. energy: -0.938 local terms energy: -203.431820 where: bonds (distance) C4'-P energy: -43.723 bonds (distance) P-C4' energy: -39.773 flat angles C4'-P-C4' energy: -45.049 flat angles P-C4'-P energy: -30.479 tors. eta vs tors. theta energy: -44.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -563.405013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.405013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.405013 (E_RNA) where: Base-Base interactions energy: -368.026 where: short stacking energy: -162.256 Base-Backbone interact. energy: -1.259 local terms energy: -194.119813 where: bonds (distance) C4'-P energy: -44.121 bonds (distance) P-C4' energy: -33.133 flat angles C4'-P-C4' energy: -51.111 flat angles P-C4'-P energy: -28.030 tors. eta vs tors. theta energy: -37.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -457.894857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.894857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.894857 (E_RNA) where: Base-Base interactions energy: -276.110 where: short stacking energy: -136.297 Base-Backbone interact. energy: -2.059 local terms energy: -179.726032 where: bonds (distance) C4'-P energy: -37.231 bonds (distance) P-C4' energy: -40.945 flat angles C4'-P-C4' energy: -43.752 flat angles P-C4'-P energy: -22.675 tors. eta vs tors. theta energy: -35.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -427.081403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.081403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.081403 (E_RNA) where: Base-Base interactions energy: -266.294 where: short stacking energy: -123.205 Base-Backbone interact. energy: -1.495 local terms energy: -159.292253 where: bonds (distance) C4'-P energy: -31.058 bonds (distance) P-C4' energy: -45.436 flat angles C4'-P-C4' energy: -44.197 flat angles P-C4'-P energy: -21.238 tors. eta vs tors. theta energy: -17.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -313.925195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.925195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.925195 (E_RNA) where: Base-Base interactions energy: -160.114 where: short stacking energy: -83.503 Base-Backbone interact. energy: -1.670 local terms energy: -152.141722 where: bonds (distance) C4'-P energy: -42.635 bonds (distance) P-C4' energy: -40.038 flat angles C4'-P-C4' energy: -38.404 flat angles P-C4'-P energy: -25.043 tors. eta vs tors. theta energy: -6.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -221.566447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.566447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.566447 (E_RNA) where: Base-Base interactions energy: -80.362 where: short stacking energy: -68.654 Base-Backbone interact. energy: 1.061 local terms energy: -142.265959 where: bonds (distance) C4'-P energy: -37.841 bonds (distance) P-C4' energy: -43.185 flat angles C4'-P-C4' energy: -29.152 flat angles P-C4'-P energy: -27.362 tors. eta vs tors. theta energy: -4.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -211.433201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.433201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.433201 (E_RNA) where: Base-Base interactions energy: -88.899 where: short stacking energy: -78.017 Base-Backbone interact. energy: -0.600 local terms energy: -121.934869 where: bonds (distance) C4'-P energy: -28.862 bonds (distance) P-C4' energy: -34.514 flat angles C4'-P-C4' energy: -38.388 flat angles P-C4'-P energy: -20.312 tors. eta vs tors. theta energy: 0.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -234.253917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.253917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.253917 (E_RNA) where: Base-Base interactions energy: -75.940 where: short stacking energy: -74.214 Base-Backbone interact. energy: 2.541 local terms energy: -160.854274 where: bonds (distance) C4'-P energy: -38.696 bonds (distance) P-C4' energy: -40.956 flat angles C4'-P-C4' energy: -40.051 flat angles P-C4'-P energy: -33.306 tors. eta vs tors. theta energy: -7.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -745.653095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.653095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.653095 (E_RNA) where: Base-Base interactions energy: -506.286 where: short stacking energy: -218.251 Base-Backbone interact. energy: -0.270 local terms energy: -239.096382 where: bonds (distance) C4'-P energy: -41.226 bonds (distance) P-C4' energy: -45.370 flat angles C4'-P-C4' energy: -52.747 flat angles P-C4'-P energy: -35.614 tors. eta vs tors. theta energy: -64.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -667.982234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.982234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.982234 (E_RNA) where: Base-Base interactions energy: -429.312 where: short stacking energy: -190.622 Base-Backbone interact. energy: -0.635 local terms energy: -238.035113 where: bonds (distance) C4'-P energy: -46.116 bonds (distance) P-C4' energy: -49.162 flat angles C4'-P-C4' energy: -55.348 flat angles P-C4'-P energy: -30.781 tors. eta vs tors. theta energy: -56.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -597.791602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.791602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.791602 (E_RNA) where: Base-Base interactions energy: -386.607 where: short stacking energy: -186.423 Base-Backbone interact. energy: -1.831 local terms energy: -209.353809 where: bonds (distance) C4'-P energy: -40.613 bonds (distance) P-C4' energy: -41.279 flat angles C4'-P-C4' energy: -42.086 flat angles P-C4'-P energy: -36.570 tors. eta vs tors. theta energy: -48.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -575.056835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.056835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.056835 (E_RNA) where: Base-Base interactions energy: -354.802 where: short stacking energy: -167.735 Base-Backbone interact. energy: -0.271 local terms energy: -219.984304 where: bonds (distance) C4'-P energy: -39.545 bonds (distance) P-C4' energy: -48.901 flat angles C4'-P-C4' energy: -45.943 flat angles P-C4'-P energy: -34.453 tors. eta vs tors. theta energy: -51.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -462.722722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.722722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.722722 (E_RNA) where: Base-Base interactions energy: -287.368 where: short stacking energy: -139.773 Base-Backbone interact. energy: -0.708 local terms energy: -174.647325 where: bonds (distance) C4'-P energy: -42.185 bonds (distance) P-C4' energy: -42.654 flat angles C4'-P-C4' energy: -36.742 flat angles P-C4'-P energy: -24.085 tors. eta vs tors. theta energy: -28.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -427.254506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.254506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.254506 (E_RNA) where: Base-Base interactions energy: -254.605 where: short stacking energy: -128.209 Base-Backbone interact. energy: -1.777 local terms energy: -170.871913 where: bonds (distance) C4'-P energy: -39.615 bonds (distance) P-C4' energy: -41.129 flat angles C4'-P-C4' energy: -42.667 flat angles P-C4'-P energy: -17.948 tors. eta vs tors. theta energy: -29.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -280.197281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.197281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.197281 (E_RNA) where: Base-Base interactions energy: -117.097 where: short stacking energy: -72.367 Base-Backbone interact. energy: -0.898 local terms energy: -162.202871 where: bonds (distance) C4'-P energy: -36.432 bonds (distance) P-C4' energy: -53.888 flat angles C4'-P-C4' energy: -34.727 flat angles P-C4'-P energy: -31.881 tors. eta vs tors. theta energy: -5.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -324.815935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.815935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.815935 (E_RNA) where: Base-Base interactions energy: -171.305 where: short stacking energy: -92.577 Base-Backbone interact. energy: -0.494 local terms energy: -153.016785 where: bonds (distance) C4'-P energy: -36.551 bonds (distance) P-C4' energy: -44.229 flat angles C4'-P-C4' energy: -36.374 flat angles P-C4'-P energy: -14.789 tors. eta vs tors. theta energy: -21.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -201.281889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.281889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.281889 (E_RNA) where: Base-Base interactions energy: -50.165 where: short stacking energy: -47.533 Base-Backbone interact. energy: -0.463 local terms energy: -150.653739 where: bonds (distance) C4'-P energy: -51.925 bonds (distance) P-C4' energy: -45.324 flat angles C4'-P-C4' energy: -34.775 flat angles P-C4'-P energy: -19.059 tors. eta vs tors. theta energy: 0.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -197.530277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.530277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.530277 (E_RNA) where: Base-Base interactions energy: -65.744 where: short stacking energy: -62.021 Base-Backbone interact. energy: 2.334 local terms energy: -134.120418 where: bonds (distance) C4'-P energy: -38.517 bonds (distance) P-C4' energy: -36.646 flat angles C4'-P-C4' energy: -36.853 flat angles P-C4'-P energy: -17.512 tors. eta vs tors. theta energy: -4.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -758.329496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.329496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.329496 (E_RNA) where: Base-Base interactions energy: -524.755 where: short stacking energy: -208.775 Base-Backbone interact. energy: -1.463 local terms energy: -232.111100 where: bonds (distance) C4'-P energy: -47.247 bonds (distance) P-C4' energy: -49.136 flat angles C4'-P-C4' energy: -41.846 flat angles P-C4'-P energy: -29.938 tors. eta vs tors. theta energy: -63.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -660.053256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.053256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.053256 (E_RNA) where: Base-Base interactions energy: -427.082 where: short stacking energy: -196.675 Base-Backbone interact. energy: -0.777 local terms energy: -232.194260 where: bonds (distance) C4'-P energy: -46.688 bonds (distance) P-C4' energy: -45.642 flat angles C4'-P-C4' energy: -48.915 flat angles P-C4'-P energy: -37.313 tors. eta vs tors. theta energy: -53.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -601.242354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.242354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.242354 (E_RNA) where: Base-Base interactions energy: -379.465 where: short stacking energy: -162.655 Base-Backbone interact. energy: -1.173 local terms energy: -220.604186 where: bonds (distance) C4'-P energy: -40.820 bonds (distance) P-C4' energy: -42.438 flat angles C4'-P-C4' energy: -50.229 flat angles P-C4'-P energy: -33.685 tors. eta vs tors. theta energy: -53.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -553.568904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.568904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.568904 (E_RNA) where: Base-Base interactions energy: -351.593 where: short stacking energy: -165.626 Base-Backbone interact. energy: -1.000 local terms energy: -200.976309 where: bonds (distance) C4'-P energy: -38.457 bonds (distance) P-C4' energy: -51.781 flat angles C4'-P-C4' energy: -46.079 flat angles P-C4'-P energy: -20.262 tors. eta vs tors. theta energy: -44.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -511.553968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.553968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.553968 (E_RNA) where: Base-Base interactions energy: -306.632 where: short stacking energy: -149.462 Base-Backbone interact. energy: -0.956 local terms energy: -203.966297 where: bonds (distance) C4'-P energy: -49.478 bonds (distance) P-C4' energy: -41.143 flat angles C4'-P-C4' energy: -45.089 flat angles P-C4'-P energy: -26.805 tors. eta vs tors. theta energy: -41.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -415.694106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.694106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.694106 (E_RNA) where: Base-Base interactions energy: -234.596 where: short stacking energy: -120.167 Base-Backbone interact. energy: -0.445 local terms energy: -180.652917 where: bonds (distance) C4'-P energy: -33.739 bonds (distance) P-C4' energy: -43.764 flat angles C4'-P-C4' energy: -38.934 flat angles P-C4'-P energy: -29.217 tors. eta vs tors. theta energy: -34.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -241.706365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.706365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.706365 (E_RNA) where: Base-Base interactions energy: -103.723 where: short stacking energy: -79.098 Base-Backbone interact. energy: -0.732 local terms energy: -137.251658 where: bonds (distance) C4'-P energy: -34.376 bonds (distance) P-C4' energy: -37.717 flat angles C4'-P-C4' energy: -46.900 flat angles P-C4'-P energy: -15.628 tors. eta vs tors. theta energy: -2.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -304.567837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.567837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.567837 (E_RNA) where: Base-Base interactions energy: -157.060 where: short stacking energy: -76.779 Base-Backbone interact. energy: 0.531 local terms energy: -148.039550 where: bonds (distance) C4'-P energy: -42.967 bonds (distance) P-C4' energy: -35.720 flat angles C4'-P-C4' energy: -29.387 flat angles P-C4'-P energy: -29.203 tors. eta vs tors. theta energy: -10.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -204.477049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.477049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.477049 (E_RNA) where: Base-Base interactions energy: -83.026 where: short stacking energy: -58.444 Base-Backbone interact. energy: 0.946 local terms energy: -122.396214 where: bonds (distance) C4'-P energy: -32.962 bonds (distance) P-C4' energy: -45.526 flat angles C4'-P-C4' energy: -15.822 flat angles P-C4'-P energy: -23.696 tors. eta vs tors. theta energy: -4.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -192.250159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.250159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.250159 (E_RNA) where: Base-Base interactions energy: -67.119 where: short stacking energy: -48.299 Base-Backbone interact. energy: 0.226 local terms energy: -125.357019 where: bonds (distance) C4'-P energy: -29.285 bonds (distance) P-C4' energy: -45.432 flat angles C4'-P-C4' energy: -32.811 flat angles P-C4'-P energy: -25.690 tors. eta vs tors. theta energy: 7.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -767.404911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.404911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.404911 (E_RNA) where: Base-Base interactions energy: -528.257 where: short stacking energy: -211.742 Base-Backbone interact. energy: -0.067 local terms energy: -239.080837 where: bonds (distance) C4'-P energy: -48.920 bonds (distance) P-C4' energy: -41.201 flat angles C4'-P-C4' energy: -46.352 flat angles P-C4'-P energy: -32.917 tors. eta vs tors. theta energy: -69.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -644.853544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.853544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.853544 (E_RNA) where: Base-Base interactions energy: -432.597 where: short stacking energy: -195.224 Base-Backbone interact. energy: 1.082 local terms energy: -213.337756 where: bonds (distance) C4'-P energy: -42.146 bonds (distance) P-C4' energy: -40.749 flat angles C4'-P-C4' energy: -46.976 flat angles P-C4'-P energy: -28.790 tors. eta vs tors. theta energy: -54.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -589.677002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.677002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.677002 (E_RNA) where: Base-Base interactions energy: -374.385 where: short stacking energy: -187.581 Base-Backbone interact. energy: -0.786 local terms energy: -214.506238 where: bonds (distance) C4'-P energy: -39.982 bonds (distance) P-C4' energy: -43.256 flat angles C4'-P-C4' energy: -50.104 flat angles P-C4'-P energy: -34.603 tors. eta vs tors. theta energy: -46.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -533.179709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.179709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.179709 (E_RNA) where: Base-Base interactions energy: -327.978 where: short stacking energy: -149.098 Base-Backbone interact. energy: -0.965 local terms energy: -204.236501 where: bonds (distance) C4'-P energy: -39.789 bonds (distance) P-C4' energy: -49.507 flat angles C4'-P-C4' energy: -45.819 flat angles P-C4'-P energy: -33.560 tors. eta vs tors. theta energy: -35.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -483.949091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.949091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.949091 (E_RNA) where: Base-Base interactions energy: -306.029 where: short stacking energy: -137.284 Base-Backbone interact. energy: -0.728 local terms energy: -177.191736 where: bonds (distance) C4'-P energy: -40.050 bonds (distance) P-C4' energy: -46.768 flat angles C4'-P-C4' energy: -26.938 flat angles P-C4'-P energy: -31.476 tors. eta vs tors. theta energy: -31.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -421.388571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.388571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.388571 (E_RNA) where: Base-Base interactions energy: -239.305 where: short stacking energy: -138.180 Base-Backbone interact. energy: -0.769 local terms energy: -181.314007 where: bonds (distance) C4'-P energy: -36.473 bonds (distance) P-C4' energy: -44.968 flat angles C4'-P-C4' energy: -44.033 flat angles P-C4'-P energy: -28.862 tors. eta vs tors. theta energy: -26.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -327.263756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.263756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.263756 (E_RNA) where: Base-Base interactions energy: -166.104 where: short stacking energy: -95.742 Base-Backbone interact. energy: -0.634 local terms energy: -160.525325 where: bonds (distance) C4'-P energy: -33.885 bonds (distance) P-C4' energy: -41.956 flat angles C4'-P-C4' energy: -37.015 flat angles P-C4'-P energy: -30.828 tors. eta vs tors. theta energy: -16.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -210.528977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.528977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.528977 (E_RNA) where: Base-Base interactions energy: -67.152 where: short stacking energy: -59.758 Base-Backbone interact. energy: 3.244 local terms energy: -146.620752 where: bonds (distance) C4'-P energy: -35.587 bonds (distance) P-C4' energy: -48.223 flat angles C4'-P-C4' energy: -41.404 flat angles P-C4'-P energy: -25.552 tors. eta vs tors. theta energy: 4.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -211.392125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.392125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.392125 (E_RNA) where: Base-Base interactions energy: -79.255 where: short stacking energy: -64.464 Base-Backbone interact. energy: -0.325 local terms energy: -131.811282 where: bonds (distance) C4'-P energy: -35.531 bonds (distance) P-C4' energy: -39.468 flat angles C4'-P-C4' energy: -38.019 flat angles P-C4'-P energy: -12.832 tors. eta vs tors. theta energy: -5.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -183.714877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.714877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.714877 (E_RNA) where: Base-Base interactions energy: -59.766 where: short stacking energy: -49.190 Base-Backbone interact. energy: -1.830 local terms energy: -122.118906 where: bonds (distance) C4'-P energy: -41.268 bonds (distance) P-C4' energy: -39.901 flat angles C4'-P-C4' energy: -21.444 flat angles P-C4'-P energy: -16.868 tors. eta vs tors. theta energy: -2.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -778.048124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.048124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.048124 (E_RNA) where: Base-Base interactions energy: -536.004 where: short stacking energy: -221.059 Base-Backbone interact. energy: 0.197 local terms energy: -242.240641 where: bonds (distance) C4'-P energy: -41.685 bonds (distance) P-C4' energy: -47.470 flat angles C4'-P-C4' energy: -52.463 flat angles P-C4'-P energy: -33.835 tors. eta vs tors. theta energy: -66.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -636.878708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.878708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.878708 (E_RNA) where: Base-Base interactions energy: -405.727 where: short stacking energy: -196.217 Base-Backbone interact. energy: -0.714 local terms energy: -230.437258 where: bonds (distance) C4'-P energy: -45.076 bonds (distance) P-C4' energy: -51.335 flat angles C4'-P-C4' energy: -45.307 flat angles P-C4'-P energy: -35.984 tors. eta vs tors. theta energy: -52.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -559.782716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.782716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.782716 (E_RNA) where: Base-Base interactions energy: -361.119 where: short stacking energy: -169.788 Base-Backbone interact. energy: -0.317 local terms energy: -198.346913 where: bonds (distance) C4'-P energy: -35.532 bonds (distance) P-C4' energy: -43.966 flat angles C4'-P-C4' energy: -47.811 flat angles P-C4'-P energy: -29.295 tors. eta vs tors. theta energy: -41.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -514.189295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.189295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.189295 (E_RNA) where: Base-Base interactions energy: -333.000 where: short stacking energy: -146.092 Base-Backbone interact. energy: 0.491 local terms energy: -181.679810 where: bonds (distance) C4'-P energy: -38.135 bonds (distance) P-C4' energy: -44.386 flat angles C4'-P-C4' energy: -39.058 flat angles P-C4'-P energy: -26.273 tors. eta vs tors. theta energy: -33.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -497.329178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.329178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.329178 (E_RNA) where: Base-Base interactions energy: -310.403 where: short stacking energy: -137.497 Base-Backbone interact. energy: -1.842 local terms energy: -185.084626 where: bonds (distance) C4'-P energy: -28.911 bonds (distance) P-C4' energy: -41.826 flat angles C4'-P-C4' energy: -44.067 flat angles P-C4'-P energy: -34.745 tors. eta vs tors. theta energy: -35.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -413.755788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.755788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.755788 (E_RNA) where: Base-Base interactions energy: -237.165 where: short stacking energy: -139.828 Base-Backbone interact. energy: 0.114 local terms energy: -176.705333 where: bonds (distance) C4'-P energy: -32.842 bonds (distance) P-C4' energy: -41.064 flat angles C4'-P-C4' energy: -40.740 flat angles P-C4'-P energy: -27.391 tors. eta vs tors. theta energy: -34.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -315.403850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.403850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.403850 (E_RNA) where: Base-Base interactions energy: -141.540 where: short stacking energy: -70.429 Base-Backbone interact. energy: -1.023 local terms energy: -172.840816 where: bonds (distance) C4'-P energy: -49.565 bonds (distance) P-C4' energy: -39.849 flat angles C4'-P-C4' energy: -45.759 flat angles P-C4'-P energy: -27.077 tors. eta vs tors. theta energy: -10.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -237.069602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.069602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.069602 (E_RNA) where: Base-Base interactions energy: -115.048 where: short stacking energy: -73.633 Base-Backbone interact. energy: -0.220 local terms energy: -121.801517 where: bonds (distance) C4'-P energy: -37.158 bonds (distance) P-C4' energy: -46.481 flat angles C4'-P-C4' energy: -20.707 flat angles P-C4'-P energy: -21.540 tors. eta vs tors. theta energy: 4.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -211.878362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.878362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.878362 (E_RNA) where: Base-Base interactions energy: -75.271 where: short stacking energy: -54.681 Base-Backbone interact. energy: -0.873 local terms energy: -135.734693 where: bonds (distance) C4'-P energy: -30.726 bonds (distance) P-C4' energy: -46.211 flat angles C4'-P-C4' energy: -40.084 flat angles P-C4'-P energy: -18.456 tors. eta vs tors. theta energy: -0.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -196.112724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.112724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.112724 (E_RNA) where: Base-Base interactions energy: -68.545 where: short stacking energy: -53.335 Base-Backbone interact. energy: -0.228 local terms energy: -127.340085 where: bonds (distance) C4'-P energy: -33.422 bonds (distance) P-C4' energy: -38.115 flat angles C4'-P-C4' energy: -32.837 flat angles P-C4'-P energy: -18.588 tors. eta vs tors. theta energy: -4.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -763.545479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.545479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.545479 (E_RNA) where: Base-Base interactions energy: -514.645 where: short stacking energy: -214.069 Base-Backbone interact. energy: -0.877 local terms energy: -248.023722 where: bonds (distance) C4'-P energy: -45.060 bonds (distance) P-C4' energy: -47.337 flat angles C4'-P-C4' energy: -47.912 flat angles P-C4'-P energy: -37.422 tors. eta vs tors. theta energy: -70.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -634.462103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.462103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.462103 (E_RNA) where: Base-Base interactions energy: -411.336 where: short stacking energy: -183.196 Base-Backbone interact. energy: 0.233 local terms energy: -223.359168 where: bonds (distance) C4'-P energy: -50.356 bonds (distance) P-C4' energy: -50.901 flat angles C4'-P-C4' energy: -50.987 flat angles P-C4'-P energy: -30.344 tors. eta vs tors. theta energy: -40.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -600.458374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.458374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.458374 (E_RNA) where: Base-Base interactions energy: -378.236 where: short stacking energy: -162.582 Base-Backbone interact. energy: 2.772 local terms energy: -224.994360 where: bonds (distance) C4'-P energy: -47.195 bonds (distance) P-C4' energy: -49.528 flat angles C4'-P-C4' energy: -46.222 flat angles P-C4'-P energy: -29.707 tors. eta vs tors. theta energy: -52.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -547.975350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.975350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.975350 (E_RNA) where: Base-Base interactions energy: -346.486 where: short stacking energy: -162.371 Base-Backbone interact. energy: -0.422 local terms energy: -201.067494 where: bonds (distance) C4'-P energy: -39.165 bonds (distance) P-C4' energy: -50.112 flat angles C4'-P-C4' energy: -37.825 flat angles P-C4'-P energy: -21.352 tors. eta vs tors. theta energy: -52.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -511.857906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.857906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.857906 (E_RNA) where: Base-Base interactions energy: -335.346 where: short stacking energy: -150.903 Base-Backbone interact. energy: -0.548 local terms energy: -175.963642 where: bonds (distance) C4'-P energy: -37.842 bonds (distance) P-C4' energy: -34.031 flat angles C4'-P-C4' energy: -41.846 flat angles P-C4'-P energy: -17.756 tors. eta vs tors. theta energy: -44.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -395.546562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.546562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.546562 (E_RNA) where: Base-Base interactions energy: -232.923 where: short stacking energy: -123.447 Base-Backbone interact. energy: -2.105 local terms energy: -160.518566 where: bonds (distance) C4'-P energy: -39.238 bonds (distance) P-C4' energy: -40.593 flat angles C4'-P-C4' energy: -34.761 flat angles P-C4'-P energy: -26.771 tors. eta vs tors. theta energy: -19.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -333.440639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.440639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.440639 (E_RNA) where: Base-Base interactions energy: -161.012 where: short stacking energy: -83.177 Base-Backbone interact. energy: -0.760 local terms energy: -171.668776 where: bonds (distance) C4'-P energy: -45.740 bonds (distance) P-C4' energy: -48.651 flat angles C4'-P-C4' energy: -39.053 flat angles P-C4'-P energy: -35.650 tors. eta vs tors. theta energy: -2.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -236.915024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.915024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.915024 (E_RNA) where: Base-Base interactions energy: -101.404 where: short stacking energy: -76.915 Base-Backbone interact. energy: 0.291 local terms energy: -135.801948 where: bonds (distance) C4'-P energy: -37.679 bonds (distance) P-C4' energy: -48.359 flat angles C4'-P-C4' energy: -36.385 flat angles P-C4'-P energy: -7.939 tors. eta vs tors. theta energy: -5.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -194.926341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.926341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.926341 (E_RNA) where: Base-Base interactions energy: -63.620 where: short stacking energy: -49.162 Base-Backbone interact. energy: -1.147 local terms energy: -130.159046 where: bonds (distance) C4'-P energy: -46.972 bonds (distance) P-C4' energy: -41.955 flat angles C4'-P-C4' energy: -27.577 flat angles P-C4'-P energy: -24.452 tors. eta vs tors. theta energy: 10.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -190.008392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.008392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.008392 (E_RNA) where: Base-Base interactions energy: -66.242 where: short stacking energy: -63.080 Base-Backbone interact. energy: -0.312 local terms energy: -123.454572 where: bonds (distance) C4'-P energy: -30.507 bonds (distance) P-C4' energy: -45.889 flat angles C4'-P-C4' energy: -41.443 flat angles P-C4'-P energy: -4.354 tors. eta vs tors. theta energy: -1.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -759.730129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.730129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.730129 (E_RNA) where: Base-Base interactions energy: -511.103 where: short stacking energy: -207.994 Base-Backbone interact. energy: -0.218 local terms energy: -248.410020 where: bonds (distance) C4'-P energy: -49.407 bonds (distance) P-C4' energy: -40.186 flat angles C4'-P-C4' energy: -55.948 flat angles P-C4'-P energy: -39.537 tors. eta vs tors. theta energy: -63.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -639.739026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.739026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.739026 (E_RNA) where: Base-Base interactions energy: -416.752 where: short stacking energy: -195.512 Base-Backbone interact. energy: 0.528 local terms energy: -223.515234 where: bonds (distance) C4'-P energy: -44.452 bonds (distance) P-C4' energy: -43.882 flat angles C4'-P-C4' energy: -52.141 flat angles P-C4'-P energy: -31.567 tors. eta vs tors. theta energy: -51.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -608.436384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.436384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.436384 (E_RNA) where: Base-Base interactions energy: -388.123 where: short stacking energy: -187.282 Base-Backbone interact. energy: -0.268 local terms energy: -220.044833 where: bonds (distance) C4'-P energy: -37.917 bonds (distance) P-C4' energy: -54.875 flat angles C4'-P-C4' energy: -50.636 flat angles P-C4'-P energy: -17.825 tors. eta vs tors. theta energy: -58.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -574.005690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.005690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.005690 (E_RNA) where: Base-Base interactions energy: -372.853 where: short stacking energy: -171.399 Base-Backbone interact. energy: -1.114 local terms energy: -200.039292 where: bonds (distance) C4'-P energy: -32.914 bonds (distance) P-C4' energy: -44.021 flat angles C4'-P-C4' energy: -45.124 flat angles P-C4'-P energy: -31.038 tors. eta vs tors. theta energy: -46.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -510.348622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.348622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.348622 (E_RNA) where: Base-Base interactions energy: -314.554 where: short stacking energy: -144.524 Base-Backbone interact. energy: -1.206 local terms energy: -194.588566 where: bonds (distance) C4'-P energy: -43.338 bonds (distance) P-C4' energy: -36.672 flat angles C4'-P-C4' energy: -45.712 flat angles P-C4'-P energy: -28.679 tors. eta vs tors. theta energy: -40.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -351.600712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.600712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.600712 (E_RNA) where: Base-Base interactions energy: -193.531 where: short stacking energy: -86.922 Base-Backbone interact. energy: -0.910 local terms energy: -157.159570 where: bonds (distance) C4'-P energy: -46.160 bonds (distance) P-C4' energy: -38.074 flat angles C4'-P-C4' energy: -43.891 flat angles P-C4'-P energy: -24.793 tors. eta vs tors. theta energy: -4.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -319.479266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.479266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.479266 (E_RNA) where: Base-Base interactions energy: -165.567 where: short stacking energy: -92.263 Base-Backbone interact. energy: -0.613 local terms energy: -153.299541 where: bonds (distance) C4'-P energy: -49.624 bonds (distance) P-C4' energy: -41.617 flat angles C4'-P-C4' energy: -34.039 flat angles P-C4'-P energy: -20.012 tors. eta vs tors. theta energy: -8.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -225.476542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.476542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.476542 (E_RNA) where: Base-Base interactions energy: -83.309 where: short stacking energy: -52.713 Base-Backbone interact. energy: -1.996 local terms energy: -140.172441 where: bonds (distance) C4'-P energy: -30.344 bonds (distance) P-C4' energy: -35.692 flat angles C4'-P-C4' energy: -42.486 flat angles P-C4'-P energy: -30.564 tors. eta vs tors. theta energy: -1.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -220.653631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.653631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.653631 (E_RNA) where: Base-Base interactions energy: -86.158 where: short stacking energy: -79.899 Base-Backbone interact. energy: 3.998 local terms energy: -138.493214 where: bonds (distance) C4'-P energy: -42.983 bonds (distance) P-C4' energy: -37.272 flat angles C4'-P-C4' energy: -34.277 flat angles P-C4'-P energy: -18.397 tors. eta vs tors. theta energy: -5.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -192.163560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.163560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.163560 (E_RNA) where: Base-Base interactions energy: -59.646 where: short stacking energy: -38.718 Base-Backbone interact. energy: -1.009 local terms energy: -131.508544 where: bonds (distance) C4'-P energy: -36.410 bonds (distance) P-C4' energy: -43.382 flat angles C4'-P-C4' energy: -38.707 flat angles P-C4'-P energy: -13.750 tors. eta vs tors. theta energy: 0.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -761.215681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.215681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.215681 (E_RNA) where: Base-Base interactions energy: -514.869 where: short stacking energy: -217.338 Base-Backbone interact. energy: 0.086 local terms energy: -246.432708 where: bonds (distance) C4'-P energy: -49.578 bonds (distance) P-C4' energy: -46.294 flat angles C4'-P-C4' energy: -50.272 flat angles P-C4'-P energy: -38.229 tors. eta vs tors. theta energy: -62.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -660.251263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.251263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.251263 (E_RNA) where: Base-Base interactions energy: -434.471 where: short stacking energy: -191.675 Base-Backbone interact. energy: -0.718 local terms energy: -225.061998 where: bonds (distance) C4'-P energy: -39.287 bonds (distance) P-C4' energy: -50.517 flat angles C4'-P-C4' energy: -47.214 flat angles P-C4'-P energy: -30.677 tors. eta vs tors. theta energy: -57.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -597.279580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.279580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.279580 (E_RNA) where: Base-Base interactions energy: -387.733 where: short stacking energy: -191.008 Base-Backbone interact. energy: -1.589 local terms energy: -207.958026 where: bonds (distance) C4'-P energy: -46.438 bonds (distance) P-C4' energy: -35.889 flat angles C4'-P-C4' energy: -47.926 flat angles P-C4'-P energy: -29.853 tors. eta vs tors. theta energy: -47.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -572.685643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.685643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.685643 (E_RNA) where: Base-Base interactions energy: -355.895 where: short stacking energy: -187.797 Base-Backbone interact. energy: 3.138 local terms energy: -219.928613 where: bonds (distance) C4'-P energy: -41.246 bonds (distance) P-C4' energy: -39.355 flat angles C4'-P-C4' energy: -50.309 flat angles P-C4'-P energy: -37.705 tors. eta vs tors. theta energy: -51.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -496.292067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.292067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.292067 (E_RNA) where: Base-Base interactions energy: -292.240 where: short stacking energy: -151.765 Base-Backbone interact. energy: -0.350 local terms energy: -203.702261 where: bonds (distance) C4'-P energy: -41.901 bonds (distance) P-C4' energy: -45.226 flat angles C4'-P-C4' energy: -43.921 flat angles P-C4'-P energy: -30.079 tors. eta vs tors. theta energy: -42.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -363.116505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.116505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.116505 (E_RNA) where: Base-Base interactions energy: -182.294 where: short stacking energy: -93.437 Base-Backbone interact. energy: -1.682 local terms energy: -179.140178 where: bonds (distance) C4'-P energy: -38.763 bonds (distance) P-C4' energy: -48.182 flat angles C4'-P-C4' energy: -37.367 flat angles P-C4'-P energy: -33.644 tors. eta vs tors. theta energy: -21.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -306.008566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.008566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.008566 (E_RNA) where: Base-Base interactions energy: -150.558 where: short stacking energy: -79.716 Base-Backbone interact. energy: -2.032 local terms energy: -153.418699 where: bonds (distance) C4'-P energy: -36.156 bonds (distance) P-C4' energy: -47.809 flat angles C4'-P-C4' energy: -36.831 flat angles P-C4'-P energy: -22.910 tors. eta vs tors. theta energy: -9.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -235.151228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.151228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.151228 (E_RNA) where: Base-Base interactions energy: -107.299 where: short stacking energy: -69.240 Base-Backbone interact. energy: -2.067 local terms energy: -125.785911 where: bonds (distance) C4'-P energy: -34.845 bonds (distance) P-C4' energy: -42.201 flat angles C4'-P-C4' energy: -33.592 flat angles P-C4'-P energy: -18.484 tors. eta vs tors. theta energy: 3.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -218.082639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.082639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.082639 (E_RNA) where: Base-Base interactions energy: -78.728 where: short stacking energy: -64.310 Base-Backbone interact. energy: -1.150 local terms energy: -138.204909 where: bonds (distance) C4'-P energy: -36.209 bonds (distance) P-C4' energy: -48.563 flat angles C4'-P-C4' energy: -40.478 flat angles P-C4'-P energy: -12.815 tors. eta vs tors. theta energy: -0.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -208.505449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.505449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.505449 (E_RNA) where: Base-Base interactions energy: -78.842 where: short stacking energy: -57.537 Base-Backbone interact. energy: -1.127 local terms energy: -128.536395 where: bonds (distance) C4'-P energy: -40.850 bonds (distance) P-C4' energy: -35.581 flat angles C4'-P-C4' energy: -29.917 flat angles P-C4'-P energy: -17.981 tors. eta vs tors. theta energy: -4.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -750.130479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.130479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.130479 (E_RNA) where: Base-Base interactions energy: -493.495 where: short stacking energy: -213.532 Base-Backbone interact. energy: -0.389 local terms energy: -256.246800 where: bonds (distance) C4'-P energy: -52.920 bonds (distance) P-C4' energy: -46.115 flat angles C4'-P-C4' energy: -53.173 flat angles P-C4'-P energy: -38.876 tors. eta vs tors. theta energy: -65.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -661.824234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.824234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.824234 (E_RNA) where: Base-Base interactions energy: -432.760 where: short stacking energy: -186.866 Base-Backbone interact. energy: -0.666 local terms energy: -228.399036 where: bonds (distance) C4'-P energy: -44.348 bonds (distance) P-C4' energy: -50.487 flat angles C4'-P-C4' energy: -52.889 flat angles P-C4'-P energy: -33.640 tors. eta vs tors. theta energy: -47.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -588.490772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.490772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.490772 (E_RNA) where: Base-Base interactions energy: -383.532 where: short stacking energy: -172.832 Base-Backbone interact. energy: -0.288 local terms energy: -204.671065 where: bonds (distance) C4'-P energy: -40.147 bonds (distance) P-C4' energy: -42.437 flat angles C4'-P-C4' energy: -50.699 flat angles P-C4'-P energy: -24.225 tors. eta vs tors. theta energy: -47.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -569.374169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.374169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.374169 (E_RNA) where: Base-Base interactions energy: -356.747 where: short stacking energy: -170.064 Base-Backbone interact. energy: -0.746 local terms energy: -211.881955 where: bonds (distance) C4'-P energy: -51.174 bonds (distance) P-C4' energy: -33.807 flat angles C4'-P-C4' energy: -46.277 flat angles P-C4'-P energy: -27.272 tors. eta vs tors. theta energy: -53.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -539.397564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.397564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.397564 (E_RNA) where: Base-Base interactions energy: -332.122 where: short stacking energy: -160.206 Base-Backbone interact. energy: -0.564 local terms energy: -206.711236 where: bonds (distance) C4'-P energy: -33.501 bonds (distance) P-C4' energy: -47.966 flat angles C4'-P-C4' energy: -43.160 flat angles P-C4'-P energy: -33.564 tors. eta vs tors. theta energy: -48.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -373.430177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.430177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.430177 (E_RNA) where: Base-Base interactions energy: -188.591 where: short stacking energy: -111.831 Base-Backbone interact. energy: -0.727 local terms energy: -184.112203 where: bonds (distance) C4'-P energy: -39.527 bonds (distance) P-C4' energy: -46.614 flat angles C4'-P-C4' energy: -35.341 flat angles P-C4'-P energy: -35.891 tors. eta vs tors. theta energy: -26.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -321.577900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.577900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.577900 (E_RNA) where: Base-Base interactions energy: -166.127 where: short stacking energy: -100.690 Base-Backbone interact. energy: -1.098 local terms energy: -154.352016 where: bonds (distance) C4'-P energy: -31.551 bonds (distance) P-C4' energy: -48.412 flat angles C4'-P-C4' energy: -35.933 flat angles P-C4'-P energy: -25.132 tors. eta vs tors. theta energy: -13.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -214.154500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.154500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.154500 (E_RNA) where: Base-Base interactions energy: -81.619 where: short stacking energy: -70.639 Base-Backbone interact. energy: -1.479 local terms energy: -131.056475 where: bonds (distance) C4'-P energy: -37.277 bonds (distance) P-C4' energy: -42.966 flat angles C4'-P-C4' energy: -37.549 flat angles P-C4'-P energy: -12.623 tors. eta vs tors. theta energy: -0.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -202.827124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.827124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.827124 (E_RNA) where: Base-Base interactions energy: -78.222 where: short stacking energy: -62.558 Base-Backbone interact. energy: 0.638 local terms energy: -125.242621 where: bonds (distance) C4'-P energy: -45.682 bonds (distance) P-C4' energy: -37.336 flat angles C4'-P-C4' energy: -41.418 flat angles P-C4'-P energy: -11.753 tors. eta vs tors. theta energy: 10.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -194.011834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.011834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.011834 (E_RNA) where: Base-Base interactions energy: -72.016 where: short stacking energy: -56.420 Base-Backbone interact. energy: 1.011 local terms energy: -123.006574 where: bonds (distance) C4'-P energy: -36.930 bonds (distance) P-C4' energy: -38.859 flat angles C4'-P-C4' energy: -32.435 flat angles P-C4'-P energy: -24.112 tors. eta vs tors. theta energy: 9.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -745.338305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.338305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.338305 (E_RNA) where: Base-Base interactions energy: -505.004 where: short stacking energy: -214.840 Base-Backbone interact. energy: -1.425 local terms energy: -238.909246 where: bonds (distance) C4'-P energy: -54.887 bonds (distance) P-C4' energy: -43.064 flat angles C4'-P-C4' energy: -45.670 flat angles P-C4'-P energy: -30.892 tors. eta vs tors. theta energy: -64.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -675.152088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.152088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.152088 (E_RNA) where: Base-Base interactions energy: -452.521 where: short stacking energy: -202.537 Base-Backbone interact. energy: -0.972 local terms energy: -221.658507 where: bonds (distance) C4'-P energy: -42.150 bonds (distance) P-C4' energy: -41.259 flat angles C4'-P-C4' energy: -46.872 flat angles P-C4'-P energy: -39.277 tors. eta vs tors. theta energy: -52.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -596.997785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.997785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.997785 (E_RNA) where: Base-Base interactions energy: -391.951 where: short stacking energy: -169.994 Base-Backbone interact. energy: -1.593 local terms energy: -203.453024 where: bonds (distance) C4'-P energy: -29.792 bonds (distance) P-C4' energy: -45.166 flat angles C4'-P-C4' energy: -46.599 flat angles P-C4'-P energy: -33.069 tors. eta vs tors. theta energy: -48.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -570.674954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.674954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.674954 (E_RNA) where: Base-Base interactions energy: -336.600 where: short stacking energy: -162.833 Base-Backbone interact. energy: -0.479 local terms energy: -233.596452 where: bonds (distance) C4'-P energy: -44.513 bonds (distance) P-C4' energy: -54.906 flat angles C4'-P-C4' energy: -48.663 flat angles P-C4'-P energy: -37.850 tors. eta vs tors. theta energy: -47.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -551.205355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.205355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.205355 (E_RNA) where: Base-Base interactions energy: -341.609 where: short stacking energy: -166.804 Base-Backbone interact. energy: 0.313 local terms energy: -209.908560 where: bonds (distance) C4'-P energy: -41.020 bonds (distance) P-C4' energy: -42.446 flat angles C4'-P-C4' energy: -45.333 flat angles P-C4'-P energy: -29.419 tors. eta vs tors. theta energy: -51.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -315.526202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.526202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.526202 (E_RNA) where: Base-Base interactions energy: -167.807 where: short stacking energy: -85.021 Base-Backbone interact. energy: -2.497 local terms energy: -145.221971 where: bonds (distance) C4'-P energy: -40.131 bonds (distance) P-C4' energy: -38.773 flat angles C4'-P-C4' energy: -34.700 flat angles P-C4'-P energy: -24.240 tors. eta vs tors. theta energy: -7.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -304.783805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.783805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.783805 (E_RNA) where: Base-Base interactions energy: -163.874 where: short stacking energy: -81.487 Base-Backbone interact. energy: 2.412 local terms energy: -143.321671 where: bonds (distance) C4'-P energy: -37.677 bonds (distance) P-C4' energy: -43.681 flat angles C4'-P-C4' energy: -30.739 flat angles P-C4'-P energy: -17.699 tors. eta vs tors. theta energy: -13.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -255.359815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.359815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.359815 (E_RNA) where: Base-Base interactions energy: -103.358 where: short stacking energy: -84.899 Base-Backbone interact. energy: -0.557 local terms energy: -151.444622 where: bonds (distance) C4'-P energy: -26.033 bonds (distance) P-C4' energy: -44.160 flat angles C4'-P-C4' energy: -37.839 flat angles P-C4'-P energy: -28.586 tors. eta vs tors. theta energy: -14.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -201.449652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.449652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.449652 (E_RNA) where: Base-Base interactions energy: -69.072 where: short stacking energy: -51.253 Base-Backbone interact. energy: -0.819 local terms energy: -131.558885 where: bonds (distance) C4'-P energy: -34.838 bonds (distance) P-C4' energy: -38.912 flat angles C4'-P-C4' energy: -37.719 flat angles P-C4'-P energy: -17.658 tors. eta vs tors. theta energy: -2.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -184.598250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.598250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.598250 (E_RNA) where: Base-Base interactions energy: -62.938 where: short stacking energy: -47.105 Base-Backbone interact. energy: -1.124 local terms energy: -120.536223 where: bonds (distance) C4'-P energy: -43.730 bonds (distance) P-C4' energy: -31.591 flat angles C4'-P-C4' energy: -31.199 flat angles P-C4'-P energy: -25.474 tors. eta vs tors. theta energy: 11.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -752.914065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.914065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.914065 (E_RNA) where: Base-Base interactions energy: -496.059 where: short stacking energy: -213.857 Base-Backbone interact. energy: -0.318 local terms energy: -256.537738 where: bonds (distance) C4'-P energy: -48.864 bonds (distance) P-C4' energy: -47.995 flat angles C4'-P-C4' energy: -51.260 flat angles P-C4'-P energy: -42.629 tors. eta vs tors. theta energy: -65.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -685.368383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.368383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.368383 (E_RNA) where: Base-Base interactions energy: -460.261 where: short stacking energy: -214.511 Base-Backbone interact. energy: -1.052 local terms energy: -224.055545 where: bonds (distance) C4'-P energy: -42.275 bonds (distance) P-C4' energy: -44.923 flat angles C4'-P-C4' energy: -48.039 flat angles P-C4'-P energy: -30.147 tors. eta vs tors. theta energy: -58.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -614.244561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.244561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.244561 (E_RNA) where: Base-Base interactions energy: -402.830 where: short stacking energy: -170.158 Base-Backbone interact. energy: -0.585 local terms energy: -210.829106 where: bonds (distance) C4'-P energy: -41.394 bonds (distance) P-C4' energy: -43.725 flat angles C4'-P-C4' energy: -42.140 flat angles P-C4'-P energy: -25.074 tors. eta vs tors. theta energy: -58.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -555.977478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.977478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.977478 (E_RNA) where: Base-Base interactions energy: -342.641 where: short stacking energy: -164.530 Base-Backbone interact. energy: 0.980 local terms energy: -214.316035 where: bonds (distance) C4'-P energy: -41.133 bonds (distance) P-C4' energy: -44.547 flat angles C4'-P-C4' energy: -46.319 flat angles P-C4'-P energy: -31.994 tors. eta vs tors. theta energy: -50.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -557.674685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.674685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.674685 (E_RNA) where: Base-Base interactions energy: -355.956 where: short stacking energy: -164.343 Base-Backbone interact. energy: 0.113 local terms energy: -201.831701 where: bonds (distance) C4'-P energy: -42.571 bonds (distance) P-C4' energy: -42.303 flat angles C4'-P-C4' energy: -48.273 flat angles P-C4'-P energy: -29.322 tors. eta vs tors. theta energy: -39.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -339.494759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.494759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.494759 (E_RNA) where: Base-Base interactions energy: -160.853 where: short stacking energy: -106.442 Base-Backbone interact. energy: 1.517 local terms energy: -180.158786 where: bonds (distance) C4'-P energy: -40.016 bonds (distance) P-C4' energy: -41.011 flat angles C4'-P-C4' energy: -38.858 flat angles P-C4'-P energy: -33.664 tors. eta vs tors. theta energy: -26.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -309.990974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.990974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.990974 (E_RNA) where: Base-Base interactions energy: -158.651 where: short stacking energy: -78.008 Base-Backbone interact. energy: -1.432 local terms energy: -149.907877 where: bonds (distance) C4'-P energy: -37.235 bonds (distance) P-C4' energy: -40.130 flat angles C4'-P-C4' energy: -37.434 flat angles P-C4'-P energy: -22.200 tors. eta vs tors. theta energy: -12.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -271.845622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.845622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.845622 (E_RNA) where: Base-Base interactions energy: -118.126 where: short stacking energy: -68.545 Base-Backbone interact. energy: 0.744 local terms energy: -154.463950 where: bonds (distance) C4'-P energy: -47.775 bonds (distance) P-C4' energy: -30.641 flat angles C4'-P-C4' energy: -40.987 flat angles P-C4'-P energy: -20.669 tors. eta vs tors. theta energy: -14.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -198.670024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.670024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.670024 (E_RNA) where: Base-Base interactions energy: -76.602 where: short stacking energy: -33.572 Base-Backbone interact. energy: -0.122 local terms energy: -121.945897 where: bonds (distance) C4'-P energy: -39.664 bonds (distance) P-C4' energy: -37.386 flat angles C4'-P-C4' energy: -38.579 flat angles P-C4'-P energy: -20.529 tors. eta vs tors. theta energy: 14.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -204.236338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.236338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.236338 (E_RNA) where: Base-Base interactions energy: -65.633 where: short stacking energy: -55.310 Base-Backbone interact. energy: -1.330 local terms energy: -137.272501 where: bonds (distance) C4'-P energy: -40.793 bonds (distance) P-C4' energy: -45.967 flat angles C4'-P-C4' energy: -35.965 flat angles P-C4'-P energy: -19.090 tors. eta vs tors. theta energy: 4.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -749.044622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.044622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.044622 (E_RNA) where: Base-Base interactions energy: -498.725 where: short stacking energy: -198.985 Base-Backbone interact. energy: -1.125 local terms energy: -249.194803 where: bonds (distance) C4'-P energy: -41.109 bonds (distance) P-C4' energy: -57.171 flat angles C4'-P-C4' energy: -55.508 flat angles P-C4'-P energy: -36.282 tors. eta vs tors. theta energy: -59.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -683.563171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.563171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.563171 (E_RNA) where: Base-Base interactions energy: -439.934 where: short stacking energy: -206.960 Base-Backbone interact. energy: -0.201 local terms energy: -243.428002 where: bonds (distance) C4'-P energy: -47.105 bonds (distance) P-C4' energy: -48.092 flat angles C4'-P-C4' energy: -54.034 flat angles P-C4'-P energy: -35.608 tors. eta vs tors. theta energy: -58.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -614.195238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.195238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.195238 (E_RNA) where: Base-Base interactions energy: -395.051 where: short stacking energy: -161.711 Base-Backbone interact. energy: 0.478 local terms energy: -219.622177 where: bonds (distance) C4'-P energy: -45.368 bonds (distance) P-C4' energy: -51.675 flat angles C4'-P-C4' energy: -45.813 flat angles P-C4'-P energy: -29.929 tors. eta vs tors. theta energy: -46.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -608.259230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.259230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.259230 (E_RNA) where: Base-Base interactions energy: -386.816 where: short stacking energy: -187.200 Base-Backbone interact. energy: 1.457 local terms energy: -222.900108 where: bonds (distance) C4'-P energy: -42.158 bonds (distance) P-C4' energy: -44.613 flat angles C4'-P-C4' energy: -51.518 flat angles P-C4'-P energy: -26.966 tors. eta vs tors. theta energy: -57.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -521.422358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.422358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.422358 (E_RNA) where: Base-Base interactions energy: -315.423 where: short stacking energy: -168.453 Base-Backbone interact. energy: 2.963 local terms energy: -208.961949 where: bonds (distance) C4'-P energy: -47.270 bonds (distance) P-C4' energy: -48.624 flat angles C4'-P-C4' energy: -43.777 flat angles P-C4'-P energy: -26.663 tors. eta vs tors. theta energy: -42.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -352.960460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.960460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.960460 (E_RNA) where: Base-Base interactions energy: -189.889 where: short stacking energy: -105.869 Base-Backbone interact. energy: -0.589 local terms energy: -162.481972 where: bonds (distance) C4'-P energy: -44.368 bonds (distance) P-C4' energy: -36.801 flat angles C4'-P-C4' energy: -41.282 flat angles P-C4'-P energy: -25.162 tors. eta vs tors. theta energy: -14.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -331.860281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.860281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.860281 (E_RNA) where: Base-Base interactions energy: -175.488 where: short stacking energy: -82.489 Base-Backbone interact. energy: -2.425 local terms energy: -153.947374 where: bonds (distance) C4'-P energy: -35.326 bonds (distance) P-C4' energy: -47.377 flat angles C4'-P-C4' energy: -36.894 flat angles P-C4'-P energy: -25.789 tors. eta vs tors. theta energy: -8.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -218.836967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.836967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.836967 (E_RNA) where: Base-Base interactions energy: -90.799 where: short stacking energy: -58.423 Base-Backbone interact. energy: -1.262 local terms energy: -126.776427 where: bonds (distance) C4'-P energy: -35.455 bonds (distance) P-C4' energy: -34.357 flat angles C4'-P-C4' energy: -29.673 flat angles P-C4'-P energy: -29.957 tors. eta vs tors. theta energy: 2.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -208.737511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.737511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.737511 (E_RNA) where: Base-Base interactions energy: -72.675 where: short stacking energy: -63.534 Base-Backbone interact. energy: 0.192 local terms energy: -136.254113 where: bonds (distance) C4'-P energy: -42.297 bonds (distance) P-C4' energy: -32.439 flat angles C4'-P-C4' energy: -36.384 flat angles P-C4'-P energy: -16.148 tors. eta vs tors. theta energy: -8.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -199.551909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.551909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.551909 (E_RNA) where: Base-Base interactions energy: -64.031 where: short stacking energy: -44.629 Base-Backbone interact. energy: 0.943 local terms energy: -136.463992 where: bonds (distance) C4'-P energy: -37.807 bonds (distance) P-C4' energy: -48.567 flat angles C4'-P-C4' energy: -28.405 flat angles P-C4'-P energy: -22.692 tors. eta vs tors. theta energy: 1.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -757.669353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.669353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.669353 (E_RNA) where: Base-Base interactions energy: -518.669 where: short stacking energy: -216.818 Base-Backbone interact. energy: -1.077 local terms energy: -237.923121 where: bonds (distance) C4'-P energy: -40.049 bonds (distance) P-C4' energy: -48.649 flat angles C4'-P-C4' energy: -53.222 flat angles P-C4'-P energy: -29.407 tors. eta vs tors. theta energy: -66.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -692.784541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.784541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.784541 (E_RNA) where: Base-Base interactions energy: -467.375 where: short stacking energy: -222.158 Base-Backbone interact. energy: 1.363 local terms energy: -226.772037 where: bonds (distance) C4'-P energy: -44.646 bonds (distance) P-C4' energy: -41.347 flat angles C4'-P-C4' energy: -48.066 flat angles P-C4'-P energy: -35.166 tors. eta vs tors. theta energy: -57.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -630.246544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.246544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.246544 (E_RNA) where: Base-Base interactions energy: -407.105 where: short stacking energy: -191.615 Base-Backbone interact. energy: -0.445 local terms energy: -222.696787 where: bonds (distance) C4'-P energy: -44.705 bonds (distance) P-C4' energy: -39.362 flat angles C4'-P-C4' energy: -49.177 flat angles P-C4'-P energy: -37.097 tors. eta vs tors. theta energy: -52.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -608.270617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.270617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.270617 (E_RNA) where: Base-Base interactions energy: -386.983 where: short stacking energy: -197.892 Base-Backbone interact. energy: -0.227 local terms energy: -221.060623 where: bonds (distance) C4'-P energy: -42.191 bonds (distance) P-C4' energy: -45.837 flat angles C4'-P-C4' energy: -50.656 flat angles P-C4'-P energy: -28.179 tors. eta vs tors. theta energy: -54.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -524.011798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.011798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.011798 (E_RNA) where: Base-Base interactions energy: -325.788 where: short stacking energy: -170.338 Base-Backbone interact. energy: 2.468 local terms energy: -200.691728 where: bonds (distance) C4'-P energy: -45.076 bonds (distance) P-C4' energy: -34.899 flat angles C4'-P-C4' energy: -45.167 flat angles P-C4'-P energy: -32.542 tors. eta vs tors. theta energy: -43.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -331.481771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.481771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.481771 (E_RNA) where: Base-Base interactions energy: -151.069 where: short stacking energy: -109.437 Base-Backbone interact. energy: 0.476 local terms energy: -180.888588 where: bonds (distance) C4'-P energy: -45.183 bonds (distance) P-C4' energy: -46.690 flat angles C4'-P-C4' energy: -39.652 flat angles P-C4'-P energy: -24.707 tors. eta vs tors. theta energy: -24.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -291.232898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.232898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.232898 (E_RNA) where: Base-Base interactions energy: -148.382 where: short stacking energy: -75.351 Base-Backbone interact. energy: -2.180 local terms energy: -140.671072 where: bonds (distance) C4'-P energy: -43.905 bonds (distance) P-C4' energy: -44.652 flat angles C4'-P-C4' energy: -28.225 flat angles P-C4'-P energy: -27.889 tors. eta vs tors. theta energy: 3.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -308.682430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.682430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.682430 (E_RNA) where: Base-Base interactions energy: -165.669 where: short stacking energy: -73.274 Base-Backbone interact. energy: -1.130 local terms energy: -141.883590 where: bonds (distance) C4'-P energy: -44.974 bonds (distance) P-C4' energy: -43.046 flat angles C4'-P-C4' energy: -29.824 flat angles P-C4'-P energy: -18.304 tors. eta vs tors. theta energy: -5.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -209.978560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.978560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.978560 (E_RNA) where: Base-Base interactions energy: -72.006 where: short stacking energy: -68.639 Base-Backbone interact. energy: 1.312 local terms energy: -139.284712 where: bonds (distance) C4'-P energy: -40.907 bonds (distance) P-C4' energy: -44.285 flat angles C4'-P-C4' energy: -31.877 flat angles P-C4'-P energy: -28.591 tors. eta vs tors. theta energy: 6.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -200.122413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.122413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.122413 (E_RNA) where: Base-Base interactions energy: -72.217 where: short stacking energy: -50.314 Base-Backbone interact. energy: -1.258 local terms energy: -126.647454 where: bonds (distance) C4'-P energy: -38.917 bonds (distance) P-C4' energy: -35.927 flat angles C4'-P-C4' energy: -25.712 flat angles P-C4'-P energy: -28.426 tors. eta vs tors. theta energy: 2.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -763.330735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.330735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.330735 (E_RNA) where: Base-Base interactions energy: -502.976 where: short stacking energy: -215.059 Base-Backbone interact. energy: 0.374 local terms energy: -260.728778 where: bonds (distance) C4'-P energy: -49.713 bonds (distance) P-C4' energy: -47.737 flat angles C4'-P-C4' energy: -52.771 flat angles P-C4'-P energy: -44.743 tors. eta vs tors. theta energy: -65.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -699.370676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.370676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.370676 (E_RNA) where: Base-Base interactions energy: -445.959 where: short stacking energy: -213.563 Base-Backbone interact. energy: 3.389 local terms energy: -256.801007 where: bonds (distance) C4'-P energy: -47.658 bonds (distance) P-C4' energy: -48.214 flat angles C4'-P-C4' energy: -54.752 flat angles P-C4'-P energy: -43.149 tors. eta vs tors. theta energy: -63.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -620.308034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.308034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.308034 (E_RNA) where: Base-Base interactions energy: -399.288 where: short stacking energy: -185.094 Base-Backbone interact. energy: -0.317 local terms energy: -220.703917 where: bonds (distance) C4'-P energy: -39.033 bonds (distance) P-C4' energy: -35.511 flat angles C4'-P-C4' energy: -53.232 flat angles P-C4'-P energy: -30.902 tors. eta vs tors. theta energy: -62.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -612.148769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.148769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.148769 (E_RNA) where: Base-Base interactions energy: -394.590 where: short stacking energy: -185.106 Base-Backbone interact. energy: -0.226 local terms energy: -217.332457 where: bonds (distance) C4'-P energy: -40.397 bonds (distance) P-C4' energy: -42.707 flat angles C4'-P-C4' energy: -43.552 flat angles P-C4'-P energy: -37.877 tors. eta vs tors. theta energy: -52.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -520.002295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.002295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.002295 (E_RNA) where: Base-Base interactions energy: -306.223 where: short stacking energy: -166.898 Base-Backbone interact. energy: -1.266 local terms energy: -212.513424 where: bonds (distance) C4'-P energy: -38.449 bonds (distance) P-C4' energy: -46.422 flat angles C4'-P-C4' energy: -47.181 flat angles P-C4'-P energy: -36.386 tors. eta vs tors. theta energy: -44.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -307.319118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.319118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.319118 (E_RNA) where: Base-Base interactions energy: -153.656 where: short stacking energy: -92.934 Base-Backbone interact. energy: 0.033 local terms energy: -153.696070 where: bonds (distance) C4'-P energy: -44.760 bonds (distance) P-C4' energy: -37.721 flat angles C4'-P-C4' energy: -36.557 flat angles P-C4'-P energy: -24.755 tors. eta vs tors. theta energy: -9.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -325.428975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.428975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.428975 (E_RNA) where: Base-Base interactions energy: -169.209 where: short stacking energy: -96.711 Base-Backbone interact. energy: -0.737 local terms energy: -155.482910 where: bonds (distance) C4'-P energy: -31.461 bonds (distance) P-C4' energy: -47.217 flat angles C4'-P-C4' energy: -38.920 flat angles P-C4'-P energy: -22.766 tors. eta vs tors. theta energy: -15.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -261.775509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.775509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.775509 (E_RNA) where: Base-Base interactions energy: -123.157 where: short stacking energy: -78.012 Base-Backbone interact. energy: -1.033 local terms energy: -137.585156 where: bonds (distance) C4'-P energy: -37.080 bonds (distance) P-C4' energy: -42.499 flat angles C4'-P-C4' energy: -42.627 flat angles P-C4'-P energy: -18.662 tors. eta vs tors. theta energy: 3.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -196.761913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.761913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.761913 (E_RNA) where: Base-Base interactions energy: -59.495 where: short stacking energy: -55.112 Base-Backbone interact. energy: 0.028 local terms energy: -137.294223 where: bonds (distance) C4'-P energy: -36.514 bonds (distance) P-C4' energy: -45.828 flat angles C4'-P-C4' energy: -32.770 flat angles P-C4'-P energy: -22.098 tors. eta vs tors. theta energy: -0.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -189.595144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.595144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.595144 (E_RNA) where: Base-Base interactions energy: -74.589 where: short stacking energy: -53.256 Base-Backbone interact. energy: -0.046 local terms energy: -114.959565 where: bonds (distance) C4'-P energy: -42.138 bonds (distance) P-C4' energy: -29.489 flat angles C4'-P-C4' energy: -35.556 flat angles P-C4'-P energy: -17.479 tors. eta vs tors. theta energy: 9.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -758.664134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.664134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.664134 (E_RNA) where: Base-Base interactions energy: -500.987 where: short stacking energy: -215.257 Base-Backbone interact. energy: -2.525 local terms energy: -255.151786 where: bonds (distance) C4'-P energy: -49.889 bonds (distance) P-C4' energy: -45.556 flat angles C4'-P-C4' energy: -57.857 flat angles P-C4'-P energy: -35.525 tors. eta vs tors. theta energy: -66.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -667.243791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.243791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.243791 (E_RNA) where: Base-Base interactions energy: -442.475 where: short stacking energy: -192.329 Base-Backbone interact. energy: -1.788 local terms energy: -222.981286 where: bonds (distance) C4'-P energy: -43.853 bonds (distance) P-C4' energy: -46.455 flat angles C4'-P-C4' energy: -46.721 flat angles P-C4'-P energy: -33.891 tors. eta vs tors. theta energy: -52.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -632.933301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.933301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.933301 (E_RNA) where: Base-Base interactions energy: -406.351 where: short stacking energy: -187.393 Base-Backbone interact. energy: 0.343 local terms energy: -226.925221 where: bonds (distance) C4'-P energy: -43.719 bonds (distance) P-C4' energy: -46.005 flat angles C4'-P-C4' energy: -52.745 flat angles P-C4'-P energy: -28.991 tors. eta vs tors. theta energy: -55.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -602.265889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.265889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.265889 (E_RNA) where: Base-Base interactions energy: -387.794 where: short stacking energy: -168.945 Base-Backbone interact. energy: -1.341 local terms energy: -213.131557 where: bonds (distance) C4'-P energy: -40.772 bonds (distance) P-C4' energy: -45.527 flat angles C4'-P-C4' energy: -48.699 flat angles P-C4'-P energy: -24.153 tors. eta vs tors. theta energy: -53.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -475.831040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.831040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.831040 (E_RNA) where: Base-Base interactions energy: -282.830 where: short stacking energy: -139.291 Base-Backbone interact. energy: -0.582 local terms energy: -192.418622 where: bonds (distance) C4'-P energy: -39.812 bonds (distance) P-C4' energy: -42.691 flat angles C4'-P-C4' energy: -44.912 flat angles P-C4'-P energy: -37.015 tors. eta vs tors. theta energy: -27.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -347.447441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.447441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.447441 (E_RNA) where: Base-Base interactions energy: -178.380 where: short stacking energy: -103.260 Base-Backbone interact. energy: 2.967 local terms energy: -172.034247 where: bonds (distance) C4'-P energy: -41.062 bonds (distance) P-C4' energy: -42.090 flat angles C4'-P-C4' energy: -41.643 flat angles P-C4'-P energy: -31.995 tors. eta vs tors. theta energy: -15.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -330.148752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.148752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.148752 (E_RNA) where: Base-Base interactions energy: -179.163 where: short stacking energy: -102.877 Base-Backbone interact. energy: -0.167 local terms energy: -150.818724 where: bonds (distance) C4'-P energy: -39.770 bonds (distance) P-C4' energy: -38.253 flat angles C4'-P-C4' energy: -37.114 flat angles P-C4'-P energy: -28.219 tors. eta vs tors. theta energy: -7.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -224.827950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.827950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.827950 (E_RNA) where: Base-Base interactions energy: -97.528 where: short stacking energy: -57.253 Base-Backbone interact. energy: -0.943 local terms energy: -126.356512 where: bonds (distance) C4'-P energy: -41.336 bonds (distance) P-C4' energy: -43.410 flat angles C4'-P-C4' energy: -34.949 flat angles P-C4'-P energy: -21.596 tors. eta vs tors. theta energy: 14.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -236.240817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.240817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.240817 (E_RNA) where: Base-Base interactions energy: -93.362 where: short stacking energy: -54.225 Base-Backbone interact. energy: -1.465 local terms energy: -141.414024 where: bonds (distance) C4'-P energy: -36.716 bonds (distance) P-C4' energy: -40.260 flat angles C4'-P-C4' energy: -34.227 flat angles P-C4'-P energy: -24.977 tors. eta vs tors. theta energy: -5.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -195.266499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.266499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.266499 (E_RNA) where: Base-Base interactions energy: -67.712 where: short stacking energy: -48.057 Base-Backbone interact. energy: -0.777 local terms energy: -126.777568 where: bonds (distance) C4'-P energy: -39.514 bonds (distance) P-C4' energy: -51.208 flat angles C4'-P-C4' energy: -30.979 flat angles P-C4'-P energy: -16.122 tors. eta vs tors. theta energy: 11.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -770.444358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.444358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.444358 (E_RNA) where: Base-Base interactions energy: -516.681 where: short stacking energy: -217.015 Base-Backbone interact. energy: -0.157 local terms energy: -253.606803 where: bonds (distance) C4'-P energy: -54.318 bonds (distance) P-C4' energy: -43.329 flat angles C4'-P-C4' energy: -51.507 flat angles P-C4'-P energy: -40.391 tors. eta vs tors. theta energy: -64.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -671.765829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.765829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.765829 (E_RNA) where: Base-Base interactions energy: -451.267 where: short stacking energy: -203.865 Base-Backbone interact. energy: -1.487 local terms energy: -219.012502 where: bonds (distance) C4'-P energy: -40.776 bonds (distance) P-C4' energy: -46.581 flat angles C4'-P-C4' energy: -49.221 flat angles P-C4'-P energy: -30.986 tors. eta vs tors. theta energy: -51.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -602.043601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.043601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.043601 (E_RNA) where: Base-Base interactions energy: -403.962 where: short stacking energy: -180.540 Base-Backbone interact. energy: -1.014 local terms energy: -197.067409 where: bonds (distance) C4'-P energy: -33.508 bonds (distance) P-C4' energy: -46.849 flat angles C4'-P-C4' energy: -45.299 flat angles P-C4'-P energy: -21.088 tors. eta vs tors. theta energy: -50.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -613.517741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.517741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.517741 (E_RNA) where: Base-Base interactions energy: -386.904 where: short stacking energy: -183.548 Base-Backbone interact. energy: -1.795 local terms energy: -224.818692 where: bonds (distance) C4'-P energy: -38.265 bonds (distance) P-C4' energy: -46.091 flat angles C4'-P-C4' energy: -52.562 flat angles P-C4'-P energy: -28.812 tors. eta vs tors. theta energy: -59.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -501.046711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.046711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.046711 (E_RNA) where: Base-Base interactions energy: -293.237 where: short stacking energy: -141.154 Base-Backbone interact. energy: -0.417 local terms energy: -207.392371 where: bonds (distance) C4'-P energy: -41.767 bonds (distance) P-C4' energy: -42.685 flat angles C4'-P-C4' energy: -52.057 flat angles P-C4'-P energy: -30.018 tors. eta vs tors. theta energy: -40.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -348.273165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.273165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.273165 (E_RNA) where: Base-Base interactions energy: -169.637 where: short stacking energy: -97.061 Base-Backbone interact. energy: 0.518 local terms energy: -179.153909 where: bonds (distance) C4'-P energy: -46.527 bonds (distance) P-C4' energy: -50.054 flat angles C4'-P-C4' energy: -42.990 flat angles P-C4'-P energy: -28.590 tors. eta vs tors. theta energy: -10.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -353.311144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.311144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.311144 (E_RNA) where: Base-Base interactions energy: -189.297 where: short stacking energy: -100.722 Base-Backbone interact. energy: -0.666 local terms energy: -163.347440 where: bonds (distance) C4'-P energy: -41.831 bonds (distance) P-C4' energy: -36.417 flat angles C4'-P-C4' energy: -39.779 flat angles P-C4'-P energy: -28.618 tors. eta vs tors. theta energy: -16.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -236.652463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.652463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.652463 (E_RNA) where: Base-Base interactions energy: -78.649 where: short stacking energy: -57.075 Base-Backbone interact. energy: -0.009 local terms energy: -157.994811 where: bonds (distance) C4'-P energy: -48.274 bonds (distance) P-C4' energy: -41.358 flat angles C4'-P-C4' energy: -42.612 flat angles P-C4'-P energy: -20.534 tors. eta vs tors. theta energy: -5.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -243.942481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.942481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.942481 (E_RNA) where: Base-Base interactions energy: -115.075 where: short stacking energy: -58.542 Base-Backbone interact. energy: -0.432 local terms energy: -128.435730 where: bonds (distance) C4'-P energy: -38.677 bonds (distance) P-C4' energy: -36.483 flat angles C4'-P-C4' energy: -36.627 flat angles P-C4'-P energy: -23.437 tors. eta vs tors. theta energy: 6.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -198.571773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.571773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.571773 (E_RNA) where: Base-Base interactions energy: -61.836 where: short stacking energy: -57.896 Base-Backbone interact. energy: 2.863 local terms energy: -139.599152 where: bonds (distance) C4'-P energy: -31.226 bonds (distance) P-C4' energy: -45.084 flat angles C4'-P-C4' energy: -29.419 flat angles P-C4'-P energy: -27.095 tors. eta vs tors. theta energy: -6.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -750.066393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.066393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.066393 (E_RNA) where: Base-Base interactions energy: -499.631 where: short stacking energy: -224.657 Base-Backbone interact. energy: -1.080 local terms energy: -249.355033 where: bonds (distance) C4'-P energy: -41.883 bonds (distance) P-C4' energy: -44.935 flat angles C4'-P-C4' energy: -54.735 flat angles P-C4'-P energy: -36.749 tors. eta vs tors. theta energy: -71.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -659.114165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.114165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.114165 (E_RNA) where: Base-Base interactions energy: -433.030 where: short stacking energy: -199.957 Base-Backbone interact. energy: 1.146 local terms energy: -227.230955 where: bonds (distance) C4'-P energy: -43.424 bonds (distance) P-C4' energy: -41.232 flat angles C4'-P-C4' energy: -55.713 flat angles P-C4'-P energy: -33.965 tors. eta vs tors. theta energy: -52.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -613.139282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.139282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.139282 (E_RNA) where: Base-Base interactions energy: -395.210 where: short stacking energy: -175.638 Base-Backbone interact. energy: -1.849 local terms energy: -216.080037 where: bonds (distance) C4'-P energy: -35.953 bonds (distance) P-C4' energy: -48.946 flat angles C4'-P-C4' energy: -49.432 flat angles P-C4'-P energy: -32.551 tors. eta vs tors. theta energy: -49.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -652.069585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.069585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.069585 (E_RNA) where: Base-Base interactions energy: -429.570 where: short stacking energy: -197.505 Base-Backbone interact. energy: -0.350 local terms energy: -222.149243 where: bonds (distance) C4'-P energy: -46.322 bonds (distance) P-C4' energy: -39.345 flat angles C4'-P-C4' energy: -53.402 flat angles P-C4'-P energy: -26.099 tors. eta vs tors. theta energy: -56.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -500.781572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.781572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.781572 (E_RNA) where: Base-Base interactions energy: -306.134 where: short stacking energy: -147.549 Base-Backbone interact. energy: -0.678 local terms energy: -193.969848 where: bonds (distance) C4'-P energy: -45.903 bonds (distance) P-C4' energy: -41.967 flat angles C4'-P-C4' energy: -40.922 flat angles P-C4'-P energy: -32.513 tors. eta vs tors. theta energy: -32.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -378.228659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.228659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.228659 (E_RNA) where: Base-Base interactions energy: -187.314 where: short stacking energy: -115.188 Base-Backbone interact. energy: -0.706 local terms energy: -190.208644 where: bonds (distance) C4'-P energy: -42.174 bonds (distance) P-C4' energy: -40.475 flat angles C4'-P-C4' energy: -41.650 flat angles P-C4'-P energy: -36.769 tors. eta vs tors. theta energy: -29.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -327.811744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.811744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.811744 (E_RNA) where: Base-Base interactions energy: -180.106 where: short stacking energy: -86.915 Base-Backbone interact. energy: 0.111 local terms energy: -147.817110 where: bonds (distance) C4'-P energy: -41.767 bonds (distance) P-C4' energy: -37.304 flat angles C4'-P-C4' energy: -28.708 flat angles P-C4'-P energy: -31.626 tors. eta vs tors. theta energy: -8.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -273.477408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.477408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.477408 (E_RNA) where: Base-Base interactions energy: -141.100 where: short stacking energy: -84.711 Base-Backbone interact. energy: -0.831 local terms energy: -131.546982 where: bonds (distance) C4'-P energy: -36.078 bonds (distance) P-C4' energy: -40.517 flat angles C4'-P-C4' energy: -37.059 flat angles P-C4'-P energy: -13.778 tors. eta vs tors. theta energy: -4.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -221.566327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.566327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.566327 (E_RNA) where: Base-Base interactions energy: -94.226 where: short stacking energy: -63.175 Base-Backbone interact. energy: -1.041 local terms energy: -126.299137 where: bonds (distance) C4'-P energy: -33.724 bonds (distance) P-C4' energy: -33.180 flat angles C4'-P-C4' energy: -36.555 flat angles P-C4'-P energy: -24.410 tors. eta vs tors. theta energy: 1.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -188.608239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.608239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.608239 (E_RNA) where: Base-Base interactions energy: -48.758 where: short stacking energy: -47.079 Base-Backbone interact. energy: 0.448 local terms energy: -140.298213 where: bonds (distance) C4'-P energy: -45.544 bonds (distance) P-C4' energy: -41.267 flat angles C4'-P-C4' energy: -38.819 flat angles P-C4'-P energy: -20.137 tors. eta vs tors. theta energy: 5.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -754.050102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.050102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.050102 (E_RNA) where: Base-Base interactions energy: -517.786 where: short stacking energy: -219.204 Base-Backbone interact. energy: -0.463 local terms energy: -235.801314 where: bonds (distance) C4'-P energy: -43.190 bonds (distance) P-C4' energy: -48.715 flat angles C4'-P-C4' energy: -47.431 flat angles P-C4'-P energy: -33.067 tors. eta vs tors. theta energy: -63.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -652.573820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.573820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.573820 (E_RNA) where: Base-Base interactions energy: -424.079 where: short stacking energy: -179.530 Base-Backbone interact. energy: -3.023 local terms energy: -225.471735 where: bonds (distance) C4'-P energy: -38.622 bonds (distance) P-C4' energy: -47.378 flat angles C4'-P-C4' energy: -50.314 flat angles P-C4'-P energy: -31.589 tors. eta vs tors. theta energy: -57.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -660.577504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.577504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.577504 (E_RNA) where: Base-Base interactions energy: -436.265 where: short stacking energy: -198.677 Base-Backbone interact. energy: -0.111 local terms energy: -224.201571 where: bonds (distance) C4'-P energy: -41.451 bonds (distance) P-C4' energy: -50.974 flat angles C4'-P-C4' energy: -45.823 flat angles P-C4'-P energy: -29.381 tors. eta vs tors. theta energy: -56.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -613.277673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.277673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.277673 (E_RNA) where: Base-Base interactions energy: -394.281 where: short stacking energy: -175.938 Base-Backbone interact. energy: -1.360 local terms energy: -217.635896 where: bonds (distance) C4'-P energy: -45.883 bonds (distance) P-C4' energy: -46.797 flat angles C4'-P-C4' energy: -46.041 flat angles P-C4'-P energy: -29.968 tors. eta vs tors. theta energy: -48.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -530.842931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.842931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.842931 (E_RNA) where: Base-Base interactions energy: -325.577 where: short stacking energy: -155.906 Base-Backbone interact. energy: -0.759 local terms energy: -204.507287 where: bonds (distance) C4'-P energy: -43.134 bonds (distance) P-C4' energy: -47.623 flat angles C4'-P-C4' energy: -41.138 flat angles P-C4'-P energy: -21.212 tors. eta vs tors. theta energy: -51.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -368.526441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.526441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.526441 (E_RNA) where: Base-Base interactions energy: -188.696 where: short stacking energy: -114.457 Base-Backbone interact. energy: -0.816 local terms energy: -179.014852 where: bonds (distance) C4'-P energy: -43.658 bonds (distance) P-C4' energy: -43.910 flat angles C4'-P-C4' energy: -42.241 flat angles P-C4'-P energy: -25.904 tors. eta vs tors. theta energy: -23.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -310.452647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.452647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.452647 (E_RNA) where: Base-Base interactions energy: -152.480 where: short stacking energy: -93.452 Base-Backbone interact. energy: -2.959 local terms energy: -155.013652 where: bonds (distance) C4'-P energy: -44.702 bonds (distance) P-C4' energy: -38.972 flat angles C4'-P-C4' energy: -39.238 flat angles P-C4'-P energy: -26.018 tors. eta vs tors. theta energy: -6.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -218.572641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.572641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.572641 (E_RNA) where: Base-Base interactions energy: -80.028 where: short stacking energy: -65.938 Base-Backbone interact. energy: 3.145 local terms energy: -141.689089 where: bonds (distance) C4'-P energy: -39.158 bonds (distance) P-C4' energy: -45.368 flat angles C4'-P-C4' energy: -32.017 flat angles P-C4'-P energy: -29.093 tors. eta vs tors. theta energy: 3.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -242.149958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.149958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.149958 (E_RNA) where: Base-Base interactions energy: -87.529 where: short stacking energy: -70.787 Base-Backbone interact. energy: -0.775 local terms energy: -153.846286 where: bonds (distance) C4'-P energy: -47.042 bonds (distance) P-C4' energy: -49.623 flat angles C4'-P-C4' energy: -28.801 flat angles P-C4'-P energy: -26.006 tors. eta vs tors. theta energy: -2.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -200.880521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.880521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.880521 (E_RNA) where: Base-Base interactions energy: -70.098 where: short stacking energy: -49.711 Base-Backbone interact. energy: 0.203 local terms energy: -130.985396 where: bonds (distance) C4'-P energy: -41.092 bonds (distance) P-C4' energy: -42.756 flat angles C4'-P-C4' energy: -23.317 flat angles P-C4'-P energy: -27.337 tors. eta vs tors. theta energy: 3.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -763.399992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.399992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.399992 (E_RNA) where: Base-Base interactions energy: -512.803 where: short stacking energy: -211.007 Base-Backbone interact. energy: -0.641 local terms energy: -249.955669 where: bonds (distance) C4'-P energy: -45.781 bonds (distance) P-C4' energy: -49.253 flat angles C4'-P-C4' energy: -48.611 flat angles P-C4'-P energy: -36.488 tors. eta vs tors. theta energy: -69.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -653.864702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.864702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.864702 (E_RNA) where: Base-Base interactions energy: -431.010 where: short stacking energy: -189.895 Base-Backbone interact. energy: 1.284 local terms energy: -224.138397 where: bonds (distance) C4'-P energy: -43.864 bonds (distance) P-C4' energy: -46.173 flat angles C4'-P-C4' energy: -48.780 flat angles P-C4'-P energy: -32.005 tors. eta vs tors. theta energy: -53.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -644.500431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.500431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.500431 (E_RNA) where: Base-Base interactions energy: -431.905 where: short stacking energy: -185.460 Base-Backbone interact. energy: -1.140 local terms energy: -211.456082 where: bonds (distance) C4'-P energy: -39.161 bonds (distance) P-C4' energy: -47.663 flat angles C4'-P-C4' energy: -46.948 flat angles P-C4'-P energy: -30.327 tors. eta vs tors. theta energy: -47.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -591.925100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.925100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.925100 (E_RNA) where: Base-Base interactions energy: -374.239 where: short stacking energy: -176.265 Base-Backbone interact. energy: -2.392 local terms energy: -215.293881 where: bonds (distance) C4'-P energy: -41.278 bonds (distance) P-C4' energy: -45.756 flat angles C4'-P-C4' energy: -43.195 flat angles P-C4'-P energy: -38.100 tors. eta vs tors. theta energy: -46.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -510.622870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.622870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.622870 (E_RNA) where: Base-Base interactions energy: -299.222 where: short stacking energy: -145.350 Base-Backbone interact. energy: -0.382 local terms energy: -211.018804 where: bonds (distance) C4'-P energy: -43.049 bonds (distance) P-C4' energy: -49.031 flat angles C4'-P-C4' energy: -51.191 flat angles P-C4'-P energy: -19.722 tors. eta vs tors. theta energy: -48.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -359.795083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.795083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.795083 (E_RNA) where: Base-Base interactions energy: -194.634 where: short stacking energy: -122.776 Base-Backbone interact. energy: -0.699 local terms energy: -164.462005 where: bonds (distance) C4'-P energy: -33.092 bonds (distance) P-C4' energy: -38.405 flat angles C4'-P-C4' energy: -41.119 flat angles P-C4'-P energy: -30.065 tors. eta vs tors. theta energy: -21.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -271.701663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.701663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.701663 (E_RNA) where: Base-Base interactions energy: -133.233 where: short stacking energy: -79.502 Base-Backbone interact. energy: -0.375 local terms energy: -138.093451 where: bonds (distance) C4'-P energy: -40.210 bonds (distance) P-C4' energy: -36.055 flat angles C4'-P-C4' energy: -39.830 flat angles P-C4'-P energy: -20.274 tors. eta vs tors. theta energy: -1.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -239.245416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.245416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.245416 (E_RNA) where: Base-Base interactions energy: -88.292 where: short stacking energy: -60.615 Base-Backbone interact. energy: -3.317 local terms energy: -147.636470 where: bonds (distance) C4'-P energy: -41.116 bonds (distance) P-C4' energy: -48.380 flat angles C4'-P-C4' energy: -39.715 flat angles P-C4'-P energy: -18.722 tors. eta vs tors. theta energy: 0.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -202.799237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.799237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.799237 (E_RNA) where: Base-Base interactions energy: -72.939 where: short stacking energy: -55.645 Base-Backbone interact. energy: -1.148 local terms energy: -128.712437 where: bonds (distance) C4'-P energy: -35.868 bonds (distance) P-C4' energy: -46.561 flat angles C4'-P-C4' energy: -30.904 flat angles P-C4'-P energy: -15.343 tors. eta vs tors. theta energy: -0.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -201.732622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.732622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.732622 (E_RNA) where: Base-Base interactions energy: -75.825 where: short stacking energy: -54.208 Base-Backbone interact. energy: 3.667 local terms energy: -129.574525 where: bonds (distance) C4'-P energy: -45.168 bonds (distance) P-C4' energy: -42.935 flat angles C4'-P-C4' energy: -29.072 flat angles P-C4'-P energy: -25.550 tors. eta vs tors. theta energy: 13.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -737.570052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.570052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.570052 (E_RNA) where: Base-Base interactions energy: -499.529 where: short stacking energy: -206.788 Base-Backbone interact. energy: -0.680 local terms energy: -237.361543 where: bonds (distance) C4'-P energy: -35.918 bonds (distance) P-C4' energy: -52.901 flat angles C4'-P-C4' energy: -49.372 flat angles P-C4'-P energy: -37.272 tors. eta vs tors. theta energy: -61.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -664.708883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.708883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.708883 (E_RNA) where: Base-Base interactions energy: -427.518 where: short stacking energy: -189.855 Base-Backbone interact. energy: 0.697 local terms energy: -237.887740 where: bonds (distance) C4'-P energy: -48.046 bonds (distance) P-C4' energy: -52.429 flat angles C4'-P-C4' energy: -51.453 flat angles P-C4'-P energy: -36.995 tors. eta vs tors. theta energy: -48.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -629.446673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.446673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.446673 (E_RNA) where: Base-Base interactions energy: -422.330 where: short stacking energy: -180.426 Base-Backbone interact. energy: 2.706 local terms energy: -209.822728 where: bonds (distance) C4'-P energy: -40.914 bonds (distance) P-C4' energy: -41.907 flat angles C4'-P-C4' energy: -47.074 flat angles P-C4'-P energy: -26.692 tors. eta vs tors. theta energy: -53.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -600.676245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.676245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.676245 (E_RNA) where: Base-Base interactions energy: -385.779 where: short stacking energy: -186.995 Base-Backbone interact. energy: -1.118 local terms energy: -213.779253 where: bonds (distance) C4'-P energy: -29.676 bonds (distance) P-C4' energy: -47.800 flat angles C4'-P-C4' energy: -53.596 flat angles P-C4'-P energy: -27.925 tors. eta vs tors. theta energy: -54.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -518.520097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.520097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.520097 (E_RNA) where: Base-Base interactions energy: -319.234 where: short stacking energy: -154.565 Base-Backbone interact. energy: -0.497 local terms energy: -198.788698 where: bonds (distance) C4'-P energy: -49.410 bonds (distance) P-C4' energy: -43.651 flat angles C4'-P-C4' energy: -42.060 flat angles P-C4'-P energy: -23.436 tors. eta vs tors. theta energy: -40.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -347.203871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.203871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.203871 (E_RNA) where: Base-Base interactions energy: -196.954 where: short stacking energy: -92.299 Base-Backbone interact. energy: -0.791 local terms energy: -149.458752 where: bonds (distance) C4'-P energy: -41.863 bonds (distance) P-C4' energy: -38.355 flat angles C4'-P-C4' energy: -42.651 flat angles P-C4'-P energy: -19.185 tors. eta vs tors. theta energy: -7.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -280.786841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.786841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.786841 (E_RNA) where: Base-Base interactions energy: -128.254 where: short stacking energy: -84.497 Base-Backbone interact. energy: -0.290 local terms energy: -152.242336 where: bonds (distance) C4'-P energy: -32.725 bonds (distance) P-C4' energy: -44.223 flat angles C4'-P-C4' energy: -40.362 flat angles P-C4'-P energy: -28.290 tors. eta vs tors. theta energy: -6.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -220.805970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.805970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.805970 (E_RNA) where: Base-Base interactions energy: -77.300 where: short stacking energy: -47.181 Base-Backbone interact. energy: -0.961 local terms energy: -142.544699 where: bonds (distance) C4'-P energy: -41.930 bonds (distance) P-C4' energy: -39.930 flat angles C4'-P-C4' energy: -42.878 flat angles P-C4'-P energy: -27.851 tors. eta vs tors. theta energy: 10.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -207.425135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.425135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.425135 (E_RNA) where: Base-Base interactions energy: -66.012 where: short stacking energy: -52.011 Base-Backbone interact. energy: 0.100 local terms energy: -141.512693 where: bonds (distance) C4'-P energy: -39.962 bonds (distance) P-C4' energy: -43.347 flat angles C4'-P-C4' energy: -40.685 flat angles P-C4'-P energy: -21.505 tors. eta vs tors. theta energy: 3.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -196.884579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.884579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.884579 (E_RNA) where: Base-Base interactions energy: -81.918 where: short stacking energy: -78.671 Base-Backbone interact. energy: -1.315 local terms energy: -113.650834 where: bonds (distance) C4'-P energy: -29.496 bonds (distance) P-C4' energy: -38.122 flat angles C4'-P-C4' energy: -23.328 flat angles P-C4'-P energy: -22.496 tors. eta vs tors. theta energy: -0.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -746.075081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.075081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.075081 (E_RNA) where: Base-Base interactions energy: -494.491 where: short stacking energy: -226.924 Base-Backbone interact. energy: -0.280 local terms energy: -251.304683 where: bonds (distance) C4'-P energy: -42.719 bonds (distance) P-C4' energy: -46.522 flat angles C4'-P-C4' energy: -53.319 flat angles P-C4'-P energy: -37.384 tors. eta vs tors. theta energy: -71.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -665.368103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.368103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.368103 (E_RNA) where: Base-Base interactions energy: -444.452 where: short stacking energy: -189.796 Base-Backbone interact. energy: -1.934 local terms energy: -218.982544 where: bonds (distance) C4'-P energy: -45.284 bonds (distance) P-C4' energy: -50.071 flat angles C4'-P-C4' energy: -50.465 flat angles P-C4'-P energy: -25.114 tors. eta vs tors. theta energy: -48.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -636.203143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.203143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.203143 (E_RNA) where: Base-Base interactions energy: -408.463 where: short stacking energy: -185.536 Base-Backbone interact. energy: -0.424 local terms energy: -227.315513 where: bonds (distance) C4'-P energy: -46.014 bonds (distance) P-C4' energy: -46.435 flat angles C4'-P-C4' energy: -51.279 flat angles P-C4'-P energy: -38.627 tors. eta vs tors. theta energy: -44.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -583.808779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.808779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.808779 (E_RNA) where: Base-Base interactions energy: -376.508 where: short stacking energy: -169.649 Base-Backbone interact. energy: -0.628 local terms energy: -206.671875 where: bonds (distance) C4'-P energy: -42.314 bonds (distance) P-C4' energy: -46.578 flat angles C4'-P-C4' energy: -44.040 flat angles P-C4'-P energy: -30.079 tors. eta vs tors. theta energy: -43.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -535.486306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.486306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.486306 (E_RNA) where: Base-Base interactions energy: -320.361 where: short stacking energy: -154.465 Base-Backbone interact. energy: -2.725 local terms energy: -212.401064 where: bonds (distance) C4'-P energy: -45.769 bonds (distance) P-C4' energy: -45.911 flat angles C4'-P-C4' energy: -48.912 flat angles P-C4'-P energy: -33.401 tors. eta vs tors. theta energy: -38.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -381.882653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.882653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.882653 (E_RNA) where: Base-Base interactions energy: -199.926 where: short stacking energy: -122.453 Base-Backbone interact. energy: -1.184 local terms energy: -180.772403 where: bonds (distance) C4'-P energy: -45.795 bonds (distance) P-C4' energy: -43.980 flat angles C4'-P-C4' energy: -49.377 flat angles P-C4'-P energy: -22.854 tors. eta vs tors. theta energy: -18.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -299.545119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.545119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.545119 (E_RNA) where: Base-Base interactions energy: -128.907 where: short stacking energy: -67.727 Base-Backbone interact. energy: -0.810 local terms energy: -169.827986 where: bonds (distance) C4'-P energy: -45.425 bonds (distance) P-C4' energy: -45.842 flat angles C4'-P-C4' energy: -41.559 flat angles P-C4'-P energy: -31.081 tors. eta vs tors. theta energy: -5.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -227.033713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.033713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.033713 (E_RNA) where: Base-Base interactions energy: -91.027 where: short stacking energy: -82.055 Base-Backbone interact. energy: -0.573 local terms energy: -135.434184 where: bonds (distance) C4'-P energy: -41.034 bonds (distance) P-C4' energy: -40.591 flat angles C4'-P-C4' energy: -38.568 flat angles P-C4'-P energy: -10.463 tors. eta vs tors. theta energy: -4.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -216.227414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.227414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.227414 (E_RNA) where: Base-Base interactions energy: -66.907 where: short stacking energy: -48.222 Base-Backbone interact. energy: -0.718 local terms energy: -148.601759 where: bonds (distance) C4'-P energy: -39.272 bonds (distance) P-C4' energy: -50.001 flat angles C4'-P-C4' energy: -35.884 flat angles P-C4'-P energy: -24.292 tors. eta vs tors. theta energy: 0.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -188.218914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.218914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.218914 (E_RNA) where: Base-Base interactions energy: -60.797 where: short stacking energy: -51.910 Base-Backbone interact. energy: -3.096 local terms energy: -124.326032 where: bonds (distance) C4'-P energy: -32.660 bonds (distance) P-C4' energy: -53.978 flat angles C4'-P-C4' energy: -30.558 flat angles P-C4'-P energy: -20.295 tors. eta vs tors. theta energy: 13.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -746.472577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.472577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.472577 (E_RNA) where: Base-Base interactions energy: -501.160 where: short stacking energy: -225.057 Base-Backbone interact. energy: -0.101 local terms energy: -245.211596 where: bonds (distance) C4'-P energy: -42.689 bonds (distance) P-C4' energy: -49.699 flat angles C4'-P-C4' energy: -47.463 flat angles P-C4'-P energy: -38.079 tors. eta vs tors. theta energy: -67.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -670.300884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.300884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.300884 (E_RNA) where: Base-Base interactions energy: -444.125 where: short stacking energy: -203.989 Base-Backbone interact. energy: -0.176 local terms energy: -225.999142 where: bonds (distance) C4'-P energy: -47.148 bonds (distance) P-C4' energy: -41.422 flat angles C4'-P-C4' energy: -51.231 flat angles P-C4'-P energy: -34.236 tors. eta vs tors. theta energy: -51.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -624.652033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.652033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.652033 (E_RNA) where: Base-Base interactions energy: -428.651 where: short stacking energy: -179.930 Base-Backbone interact. energy: 0.529 local terms energy: -196.530068 where: bonds (distance) C4'-P energy: -43.810 bonds (distance) P-C4' energy: -30.999 flat angles C4'-P-C4' energy: -41.566 flat angles P-C4'-P energy: -35.512 tors. eta vs tors. theta energy: -44.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -577.159769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.159769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.159769 (E_RNA) where: Base-Base interactions energy: -366.970 where: short stacking energy: -170.942 Base-Backbone interact. energy: -0.381 local terms energy: -209.809379 where: bonds (distance) C4'-P energy: -36.308 bonds (distance) P-C4' energy: -45.822 flat angles C4'-P-C4' energy: -45.708 flat angles P-C4'-P energy: -33.890 tors. eta vs tors. theta energy: -48.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -508.603218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.603218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.603218 (E_RNA) where: Base-Base interactions energy: -317.673 where: short stacking energy: -141.304 Base-Backbone interact. energy: -1.253 local terms energy: -189.677545 where: bonds (distance) C4'-P energy: -37.977 bonds (distance) P-C4' energy: -37.502 flat angles C4'-P-C4' energy: -48.326 flat angles P-C4'-P energy: -23.104 tors. eta vs tors. theta energy: -42.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -359.721109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.721109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.721109 (E_RNA) where: Base-Base interactions energy: -181.050 where: short stacking energy: -107.555 Base-Backbone interact. energy: -0.354 local terms energy: -178.317733 where: bonds (distance) C4'-P energy: -45.586 bonds (distance) P-C4' energy: -45.237 flat angles C4'-P-C4' energy: -40.058 flat angles P-C4'-P energy: -29.057 tors. eta vs tors. theta energy: -18.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -290.711716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.711716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.711716 (E_RNA) where: Base-Base interactions energy: -133.979 where: short stacking energy: -74.264 Base-Backbone interact. energy: -0.935 local terms energy: -155.797529 where: bonds (distance) C4'-P energy: -41.052 bonds (distance) P-C4' energy: -52.869 flat angles C4'-P-C4' energy: -34.822 flat angles P-C4'-P energy: -27.189 tors. eta vs tors. theta energy: 0.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -214.675492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.675492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.675492 (E_RNA) where: Base-Base interactions energy: -79.424 where: short stacking energy: -76.455 Base-Backbone interact. energy: -1.059 local terms energy: -134.193220 where: bonds (distance) C4'-P energy: -42.461 bonds (distance) P-C4' energy: -30.406 flat angles C4'-P-C4' energy: -37.630 flat angles P-C4'-P energy: -19.367 tors. eta vs tors. theta energy: -4.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -208.033453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.033453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.033453 (E_RNA) where: Base-Base interactions energy: -75.314 where: short stacking energy: -67.877 Base-Backbone interact. energy: -1.225 local terms energy: -131.494034 where: bonds (distance) C4'-P energy: -39.842 bonds (distance) P-C4' energy: -38.735 flat angles C4'-P-C4' energy: -37.136 flat angles P-C4'-P energy: -15.998 tors. eta vs tors. theta energy: 0.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -183.923123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.923123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.923123 (E_RNA) where: Base-Base interactions energy: -60.848 where: short stacking energy: -39.700 Base-Backbone interact. energy: 0.936 local terms energy: -124.010798 where: bonds (distance) C4'-P energy: -42.749 bonds (distance) P-C4' energy: -40.558 flat angles C4'-P-C4' energy: -37.618 flat angles P-C4'-P energy: -16.236 tors. eta vs tors. theta energy: 13.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -755.515091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.515091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.515091 (E_RNA) where: Base-Base interactions energy: -505.467 where: short stacking energy: -227.659 Base-Backbone interact. energy: -1.036 local terms energy: -249.012422 where: bonds (distance) C4'-P energy: -42.390 bonds (distance) P-C4' energy: -49.188 flat angles C4'-P-C4' energy: -50.259 flat angles P-C4'-P energy: -35.169 tors. eta vs tors. theta energy: -72.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -654.298860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.298860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.298860 (E_RNA) where: Base-Base interactions energy: -428.696 where: short stacking energy: -194.865 Base-Backbone interact. energy: -0.814 local terms energy: -224.789209 where: bonds (distance) C4'-P energy: -43.901 bonds (distance) P-C4' energy: -43.144 flat angles C4'-P-C4' energy: -47.560 flat angles P-C4'-P energy: -37.953 tors. eta vs tors. theta energy: -52.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -668.872013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.872013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.872013 (E_RNA) where: Base-Base interactions energy: -432.947 where: short stacking energy: -208.693 Base-Backbone interact. energy: -1.290 local terms energy: -234.635293 where: bonds (distance) C4'-P energy: -42.161 bonds (distance) P-C4' energy: -53.077 flat angles C4'-P-C4' energy: -47.642 flat angles P-C4'-P energy: -34.719 tors. eta vs tors. theta energy: -57.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -593.754543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.754543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.754543 (E_RNA) where: Base-Base interactions energy: -384.956 where: short stacking energy: -185.034 Base-Backbone interact. energy: -0.671 local terms energy: -208.127173 where: bonds (distance) C4'-P energy: -37.798 bonds (distance) P-C4' energy: -35.850 flat angles C4'-P-C4' energy: -45.944 flat angles P-C4'-P energy: -32.495 tors. eta vs tors. theta energy: -56.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -524.778945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.778945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.778945 (E_RNA) where: Base-Base interactions energy: -342.421 where: short stacking energy: -142.563 Base-Backbone interact. energy: 0.538 local terms energy: -182.895739 where: bonds (distance) C4'-P energy: -32.312 bonds (distance) P-C4' energy: -39.341 flat angles C4'-P-C4' energy: -45.423 flat angles P-C4'-P energy: -29.393 tors. eta vs tors. theta energy: -36.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -312.219912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.219912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.219912 (E_RNA) where: Base-Base interactions energy: -166.977 where: short stacking energy: -94.355 Base-Backbone interact. energy: -0.596 local terms energy: -144.647034 where: bonds (distance) C4'-P energy: -40.451 bonds (distance) P-C4' energy: -40.266 flat angles C4'-P-C4' energy: -32.979 flat angles P-C4'-P energy: -25.152 tors. eta vs tors. theta energy: -5.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -325.049724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.049724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.049724 (E_RNA) where: Base-Base interactions energy: -174.222 where: short stacking energy: -113.072 Base-Backbone interact. energy: 1.198 local terms energy: -152.025225 where: bonds (distance) C4'-P energy: -35.110 bonds (distance) P-C4' energy: -35.820 flat angles C4'-P-C4' energy: -40.991 flat angles P-C4'-P energy: -25.168 tors. eta vs tors. theta energy: -14.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -224.872044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.872044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.872044 (E_RNA) where: Base-Base interactions energy: -92.775 where: short stacking energy: -63.472 Base-Backbone interact. energy: -1.207 local terms energy: -130.889686 where: bonds (distance) C4'-P energy: -41.432 bonds (distance) P-C4' energy: -33.420 flat angles C4'-P-C4' energy: -40.271 flat angles P-C4'-P energy: -18.105 tors. eta vs tors. theta energy: 2.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -220.022688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.022688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.022688 (E_RNA) where: Base-Base interactions energy: -79.803 where: short stacking energy: -75.690 Base-Backbone interact. energy: 1.198 local terms energy: -141.417209 where: bonds (distance) C4'-P energy: -36.610 bonds (distance) P-C4' energy: -34.638 flat angles C4'-P-C4' energy: -37.878 flat angles P-C4'-P energy: -26.225 tors. eta vs tors. theta energy: -6.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -191.109038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.109038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.109038 (E_RNA) where: Base-Base interactions energy: -59.445 where: short stacking energy: -47.067 Base-Backbone interact. energy: 0.916 local terms energy: -132.579374 where: bonds (distance) C4'-P energy: -33.546 bonds (distance) P-C4' energy: -36.729 flat angles C4'-P-C4' energy: -43.819 flat angles P-C4'-P energy: -22.517 tors. eta vs tors. theta energy: 4.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -747.261400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.261400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.261400 (E_RNA) where: Base-Base interactions energy: -490.888 where: short stacking energy: -224.957 Base-Backbone interact. energy: 0.907 local terms energy: -257.280980 where: bonds (distance) C4'-P energy: -50.893 bonds (distance) P-C4' energy: -50.580 flat angles C4'-P-C4' energy: -50.379 flat angles P-C4'-P energy: -33.671 tors. eta vs tors. theta energy: -71.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -643.591583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.591583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.591583 (E_RNA) where: Base-Base interactions energy: -405.058 where: short stacking energy: -174.853 Base-Backbone interact. energy: -0.840 local terms energy: -237.692820 where: bonds (distance) C4'-P energy: -46.723 bonds (distance) P-C4' energy: -49.119 flat angles C4'-P-C4' energy: -53.342 flat angles P-C4'-P energy: -36.196 tors. eta vs tors. theta energy: -52.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -631.581452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.581452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.581452 (E_RNA) where: Base-Base interactions energy: -424.029 where: short stacking energy: -178.752 Base-Backbone interact. energy: 0.257 local terms energy: -207.809083 where: bonds (distance) C4'-P energy: -47.246 bonds (distance) P-C4' energy: -39.305 flat angles C4'-P-C4' energy: -42.039 flat angles P-C4'-P energy: -27.863 tors. eta vs tors. theta energy: -51.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -619.327756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.327756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.327756 (E_RNA) where: Base-Base interactions energy: -386.341 where: short stacking energy: -196.706 Base-Backbone interact. energy: 1.280 local terms energy: -234.266394 where: bonds (distance) C4'-P energy: -47.477 bonds (distance) P-C4' energy: -45.737 flat angles C4'-P-C4' energy: -49.214 flat angles P-C4'-P energy: -37.074 tors. eta vs tors. theta energy: -54.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -511.059272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.059272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.059272 (E_RNA) where: Base-Base interactions energy: -324.801 where: short stacking energy: -160.538 Base-Backbone interact. energy: -1.248 local terms energy: -185.010521 where: bonds (distance) C4'-P energy: -38.448 bonds (distance) P-C4' energy: -38.709 flat angles C4'-P-C4' energy: -37.879 flat angles P-C4'-P energy: -27.283 tors. eta vs tors. theta energy: -42.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -311.358365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.358365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.358365 (E_RNA) where: Base-Base interactions energy: -163.687 where: short stacking energy: -79.752 Base-Backbone interact. energy: -1.572 local terms energy: -146.099454 where: bonds (distance) C4'-P energy: -45.299 bonds (distance) P-C4' energy: -39.228 flat angles C4'-P-C4' energy: -31.307 flat angles P-C4'-P energy: -23.447 tors. eta vs tors. theta energy: -6.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -326.351059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.351059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.351059 (E_RNA) where: Base-Base interactions energy: -169.218 where: short stacking energy: -113.607 Base-Backbone interact. energy: -0.893 local terms energy: -156.239779 where: bonds (distance) C4'-P energy: -44.815 bonds (distance) P-C4' energy: -35.356 flat angles C4'-P-C4' energy: -35.823 flat angles P-C4'-P energy: -21.178 tors. eta vs tors. theta energy: -19.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -241.346139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.346139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.346139 (E_RNA) where: Base-Base interactions energy: -105.525 where: short stacking energy: -74.370 Base-Backbone interact. energy: 1.305 local terms energy: -137.126432 where: bonds (distance) C4'-P energy: -28.542 bonds (distance) P-C4' energy: -42.774 flat angles C4'-P-C4' energy: -29.677 flat angles P-C4'-P energy: -26.089 tors. eta vs tors. theta energy: -10.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -200.763616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.763616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.763616 (E_RNA) where: Base-Base interactions energy: -78.431 where: short stacking energy: -68.667 Base-Backbone interact. energy: -1.426 local terms energy: -120.906768 where: bonds (distance) C4'-P energy: -37.827 bonds (distance) P-C4' energy: -34.585 flat angles C4'-P-C4' energy: -35.517 flat angles P-C4'-P energy: -13.128 tors. eta vs tors. theta energy: 0.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -209.299578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.299578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.299578 (E_RNA) where: Base-Base interactions energy: -94.841 where: short stacking energy: -67.639 Base-Backbone interact. energy: 0.683 local terms energy: -115.141491 where: bonds (distance) C4'-P energy: -28.285 bonds (distance) P-C4' energy: -51.959 flat angles C4'-P-C4' energy: -23.081 flat angles P-C4'-P energy: -15.285 tors. eta vs tors. theta energy: 3.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -759.661317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.661317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.661317 (E_RNA) where: Base-Base interactions energy: -507.794 where: short stacking energy: -225.616 Base-Backbone interact. energy: 2.198 local terms energy: -254.065577 where: bonds (distance) C4'-P energy: -49.682 bonds (distance) P-C4' energy: -45.981 flat angles C4'-P-C4' energy: -54.514 flat angles P-C4'-P energy: -32.589 tors. eta vs tors. theta energy: -71.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -677.539582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.539582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.539582 (E_RNA) where: Base-Base interactions energy: -468.556 where: short stacking energy: -203.668 Base-Backbone interact. energy: -0.680 local terms energy: -208.303991 where: bonds (distance) C4'-P energy: -31.489 bonds (distance) P-C4' energy: -46.582 flat angles C4'-P-C4' energy: -50.716 flat angles P-C4'-P energy: -32.219 tors. eta vs tors. theta energy: -47.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -642.386779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.386779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.386779 (E_RNA) where: Base-Base interactions energy: -433.524 where: short stacking energy: -174.669 Base-Backbone interact. energy: -1.084 local terms energy: -207.778984 where: bonds (distance) C4'-P energy: -32.805 bonds (distance) P-C4' energy: -44.788 flat angles C4'-P-C4' energy: -46.897 flat angles P-C4'-P energy: -35.785 tors. eta vs tors. theta energy: -47.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -589.797278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.797278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.797278 (E_RNA) where: Base-Base interactions energy: -361.008 where: short stacking energy: -168.706 Base-Backbone interact. energy: 0.090 local terms energy: -228.879267 where: bonds (distance) C4'-P energy: -45.506 bonds (distance) P-C4' energy: -46.100 flat angles C4'-P-C4' energy: -46.897 flat angles P-C4'-P energy: -29.819 tors. eta vs tors. theta energy: -60.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -536.435233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.435233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.435233 (E_RNA) where: Base-Base interactions energy: -343.352 where: short stacking energy: -155.312 Base-Backbone interact. energy: 1.162 local terms energy: -194.245477 where: bonds (distance) C4'-P energy: -41.416 bonds (distance) P-C4' energy: -40.387 flat angles C4'-P-C4' energy: -51.262 flat angles P-C4'-P energy: -22.947 tors. eta vs tors. theta energy: -38.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -328.976214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.976214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.976214 (E_RNA) where: Base-Base interactions energy: -169.997 where: short stacking energy: -96.278 Base-Backbone interact. energy: -0.179 local terms energy: -158.799871 where: bonds (distance) C4'-P energy: -37.835 bonds (distance) P-C4' energy: -46.580 flat angles C4'-P-C4' energy: -33.997 flat angles P-C4'-P energy: -24.010 tors. eta vs tors. theta energy: -16.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -300.290790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.290790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.290790 (E_RNA) where: Base-Base interactions energy: -146.698 where: short stacking energy: -93.404 Base-Backbone interact. energy: 0.775 local terms energy: -154.367224 where: bonds (distance) C4'-P energy: -43.872 bonds (distance) P-C4' energy: -45.951 flat angles C4'-P-C4' energy: -33.410 flat angles P-C4'-P energy: -20.216 tors. eta vs tors. theta energy: -10.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -242.777437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.777437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.777437 (E_RNA) where: Base-Base interactions energy: -104.006 where: short stacking energy: -79.282 Base-Backbone interact. energy: -1.159 local terms energy: -137.612917 where: bonds (distance) C4'-P energy: -38.740 bonds (distance) P-C4' energy: -33.820 flat angles C4'-P-C4' energy: -29.179 flat angles P-C4'-P energy: -15.535 tors. eta vs tors. theta energy: -20.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -192.453331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.453331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.453331 (E_RNA) where: Base-Base interactions energy: -63.736 where: short stacking energy: -50.852 Base-Backbone interact. energy: 4.384 local terms energy: -133.101233 where: bonds (distance) C4'-P energy: -34.414 bonds (distance) P-C4' energy: -35.502 flat angles C4'-P-C4' energy: -41.809 flat angles P-C4'-P energy: -24.314 tors. eta vs tors. theta energy: 2.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -200.785559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.785559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.785559 (E_RNA) where: Base-Base interactions energy: -74.008 where: short stacking energy: -50.279 Base-Backbone interact. energy: -1.297 local terms energy: -125.480676 where: bonds (distance) C4'-P energy: -47.209 bonds (distance) P-C4' energy: -39.831 flat angles C4'-P-C4' energy: -25.470 flat angles P-C4'-P energy: -25.346 tors. eta vs tors. theta energy: 12.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -775.471609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.471609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.471609 (E_RNA) where: Base-Base interactions energy: -520.175 where: short stacking energy: -224.587 Base-Backbone interact. energy: -0.234 local terms energy: -255.063094 where: bonds (distance) C4'-P energy: -44.862 bonds (distance) P-C4' energy: -51.139 flat angles C4'-P-C4' energy: -50.838 flat angles P-C4'-P energy: -36.712 tors. eta vs tors. theta energy: -71.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -671.066277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.066277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.066277 (E_RNA) where: Base-Base interactions energy: -465.227 where: short stacking energy: -199.091 Base-Backbone interact. energy: -1.442 local terms energy: -204.397813 where: bonds (distance) C4'-P energy: -42.684 bonds (distance) P-C4' energy: -28.167 flat angles C4'-P-C4' energy: -46.650 flat angles P-C4'-P energy: -36.910 tors. eta vs tors. theta energy: -49.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -645.485402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.485402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.485402 (E_RNA) where: Base-Base interactions energy: -416.299 where: short stacking energy: -195.803 Base-Backbone interact. energy: -1.680 local terms energy: -227.506760 where: bonds (distance) C4'-P energy: -37.870 bonds (distance) P-C4' energy: -48.419 flat angles C4'-P-C4' energy: -49.413 flat angles P-C4'-P energy: -38.877 tors. eta vs tors. theta energy: -52.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -588.156998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.156998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.156998 (E_RNA) where: Base-Base interactions energy: -376.392 where: short stacking energy: -167.144 Base-Backbone interact. energy: -0.988 local terms energy: -210.777691 where: bonds (distance) C4'-P energy: -44.137 bonds (distance) P-C4' energy: -44.528 flat angles C4'-P-C4' energy: -47.579 flat angles P-C4'-P energy: -27.625 tors. eta vs tors. theta energy: -46.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -516.990932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.990932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.990932 (E_RNA) where: Base-Base interactions energy: -306.617 where: short stacking energy: -140.312 Base-Backbone interact. energy: -0.206 local terms energy: -210.168086 where: bonds (distance) C4'-P energy: -40.829 bonds (distance) P-C4' energy: -50.826 flat angles C4'-P-C4' energy: -44.389 flat angles P-C4'-P energy: -29.631 tors. eta vs tors. theta energy: -44.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -337.290206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.290206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.290206 (E_RNA) where: Base-Base interactions energy: -166.261 where: short stacking energy: -92.856 Base-Backbone interact. energy: -0.936 local terms energy: -170.093382 where: bonds (distance) C4'-P energy: -46.739 bonds (distance) P-C4' energy: -44.334 flat angles C4'-P-C4' energy: -31.134 flat angles P-C4'-P energy: -29.573 tors. eta vs tors. theta energy: -18.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -290.294335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.294335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.294335 (E_RNA) where: Base-Base interactions energy: -138.933 where: short stacking energy: -74.720 Base-Backbone interact. energy: -0.406 local terms energy: -150.955202 where: bonds (distance) C4'-P energy: -40.121 bonds (distance) P-C4' energy: -42.009 flat angles C4'-P-C4' energy: -39.824 flat angles P-C4'-P energy: -24.380 tors. eta vs tors. theta energy: -4.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -231.690111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.690111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.690111 (E_RNA) where: Base-Base interactions energy: -84.976 where: short stacking energy: -66.101 Base-Backbone interact. energy: -0.690 local terms energy: -146.024283 where: bonds (distance) C4'-P energy: -40.400 bonds (distance) P-C4' energy: -41.718 flat angles C4'-P-C4' energy: -46.687 flat angles P-C4'-P energy: -11.569 tors. eta vs tors. theta energy: -5.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -210.586478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.586478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.586478 (E_RNA) where: Base-Base interactions energy: -57.290 where: short stacking energy: -53.462 Base-Backbone interact. energy: 0.025 local terms energy: -153.320806 where: bonds (distance) C4'-P energy: -47.143 bonds (distance) P-C4' energy: -47.308 flat angles C4'-P-C4' energy: -33.303 flat angles P-C4'-P energy: -27.138 tors. eta vs tors. theta energy: 1.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -194.647482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.647482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.647482 (E_RNA) where: Base-Base interactions energy: -70.530 where: short stacking energy: -62.600 Base-Backbone interact. energy: -0.889 local terms energy: -123.228387 where: bonds (distance) C4'-P energy: -44.466 bonds (distance) P-C4' energy: -35.114 flat angles C4'-P-C4' energy: -37.381 flat angles P-C4'-P energy: -9.521 tors. eta vs tors. theta energy: 3.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -770.283588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.283588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.283588 (E_RNA) where: Base-Base interactions energy: -526.885 where: short stacking energy: -215.612 Base-Backbone interact. energy: -0.410 local terms energy: -242.988197 where: bonds (distance) C4'-P energy: -40.323 bonds (distance) P-C4' energy: -52.263 flat angles C4'-P-C4' energy: -46.088 flat angles P-C4'-P energy: -38.986 tors. eta vs tors. theta energy: -65.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -658.369134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.369134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.369134 (E_RNA) where: Base-Base interactions energy: -442.395 where: short stacking energy: -186.883 Base-Backbone interact. energy: -0.783 local terms energy: -215.191944 where: bonds (distance) C4'-P energy: -37.719 bonds (distance) P-C4' energy: -41.829 flat angles C4'-P-C4' energy: -52.153 flat angles P-C4'-P energy: -32.586 tors. eta vs tors. theta energy: -50.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -647.980459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.980459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.980459 (E_RNA) where: Base-Base interactions energy: -422.959 where: short stacking energy: -198.602 Base-Backbone interact. energy: -0.651 local terms energy: -224.370431 where: bonds (distance) C4'-P energy: -45.878 bonds (distance) P-C4' energy: -44.643 flat angles C4'-P-C4' energy: -47.871 flat angles P-C4'-P energy: -35.394 tors. eta vs tors. theta energy: -50.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -618.566602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.566602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.566602 (E_RNA) where: Base-Base interactions energy: -412.155 where: short stacking energy: -197.410 Base-Backbone interact. energy: -1.118 local terms energy: -205.293971 where: bonds (distance) C4'-P energy: -31.905 bonds (distance) P-C4' energy: -46.272 flat angles C4'-P-C4' energy: -43.389 flat angles P-C4'-P energy: -24.916 tors. eta vs tors. theta energy: -58.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -538.044082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.044082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.044082 (E_RNA) where: Base-Base interactions energy: -344.480 where: short stacking energy: -155.545 Base-Backbone interact. energy: -0.566 local terms energy: -192.998597 where: bonds (distance) C4'-P energy: -40.467 bonds (distance) P-C4' energy: -42.699 flat angles C4'-P-C4' energy: -36.793 flat angles P-C4'-P energy: -25.439 tors. eta vs tors. theta energy: -47.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -329.590087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.590087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.590087 (E_RNA) where: Base-Base interactions energy: -169.631 where: short stacking energy: -94.485 Base-Backbone interact. energy: -0.468 local terms energy: -159.490863 where: bonds (distance) C4'-P energy: -43.747 bonds (distance) P-C4' energy: -34.678 flat angles C4'-P-C4' energy: -40.274 flat angles P-C4'-P energy: -27.221 tors. eta vs tors. theta energy: -13.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -285.981525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.981525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.981525 (E_RNA) where: Base-Base interactions energy: -125.543 where: short stacking energy: -79.612 Base-Backbone interact. energy: 0.070 local terms energy: -160.508349 where: bonds (distance) C4'-P energy: -47.283 bonds (distance) P-C4' energy: -35.943 flat angles C4'-P-C4' energy: -44.782 flat angles P-C4'-P energy: -25.528 tors. eta vs tors. theta energy: -6.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -249.003671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.003671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.003671 (E_RNA) where: Base-Base interactions energy: -97.866 where: short stacking energy: -95.357 Base-Backbone interact. energy: 1.125 local terms energy: -152.263234 where: bonds (distance) C4'-P energy: -43.313 bonds (distance) P-C4' energy: -37.059 flat angles C4'-P-C4' energy: -39.804 flat angles P-C4'-P energy: -27.424 tors. eta vs tors. theta energy: -4.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -240.559742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.559742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.559742 (E_RNA) where: Base-Base interactions energy: -103.104 where: short stacking energy: -67.064 Base-Backbone interact. energy: -0.601 local terms energy: -136.854106 where: bonds (distance) C4'-P energy: -32.015 bonds (distance) P-C4' energy: -37.700 flat angles C4'-P-C4' energy: -41.332 flat angles P-C4'-P energy: -27.655 tors. eta vs tors. theta energy: 1.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -206.321205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.321205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.321205 (E_RNA) where: Base-Base interactions energy: -75.709 where: short stacking energy: -68.813 Base-Backbone interact. energy: 2.778 local terms energy: -133.389856 where: bonds (distance) C4'-P energy: -40.925 bonds (distance) P-C4' energy: -41.596 flat angles C4'-P-C4' energy: -37.610 flat angles P-C4'-P energy: -9.810 tors. eta vs tors. theta energy: -3.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -765.219231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.219231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.219231 (E_RNA) where: Base-Base interactions energy: -522.553 where: short stacking energy: -236.625 Base-Backbone interact. energy: -0.273 local terms energy: -242.392565 where: bonds (distance) C4'-P energy: -42.919 bonds (distance) P-C4' energy: -45.007 flat angles C4'-P-C4' energy: -47.356 flat angles P-C4'-P energy: -38.286 tors. eta vs tors. theta energy: -68.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -679.794540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.794540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.794540 (E_RNA) where: Base-Base interactions energy: -446.740 where: short stacking energy: -199.147 Base-Backbone interact. energy: -1.456 local terms energy: -231.598363 where: bonds (distance) C4'-P energy: -42.471 bonds (distance) P-C4' energy: -47.290 flat angles C4'-P-C4' energy: -52.290 flat angles P-C4'-P energy: -31.992 tors. eta vs tors. theta energy: -57.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -643.255282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.255282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.255282 (E_RNA) where: Base-Base interactions energy: -413.132 where: short stacking energy: -195.722 Base-Backbone interact. energy: -0.226 local terms energy: -229.897172 where: bonds (distance) C4'-P energy: -45.179 bonds (distance) P-C4' energy: -46.329 flat angles C4'-P-C4' energy: -45.596 flat angles P-C4'-P energy: -32.537 tors. eta vs tors. theta energy: -60.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -623.181607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.181607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.181607 (E_RNA) where: Base-Base interactions energy: -428.153 where: short stacking energy: -182.731 Base-Backbone interact. energy: -1.348 local terms energy: -193.680002 where: bonds (distance) C4'-P energy: -40.099 bonds (distance) P-C4' energy: -35.319 flat angles C4'-P-C4' energy: -42.916 flat angles P-C4'-P energy: -32.832 tors. eta vs tors. theta energy: -42.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -540.713286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.713286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.713286 (E_RNA) where: Base-Base interactions energy: -325.834 where: short stacking energy: -163.444 Base-Backbone interact. energy: -0.072 local terms energy: -214.807033 where: bonds (distance) C4'-P energy: -42.224 bonds (distance) P-C4' energy: -41.574 flat angles C4'-P-C4' energy: -49.429 flat angles P-C4'-P energy: -31.279 tors. eta vs tors. theta energy: -50.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -338.750848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.750848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.750848 (E_RNA) where: Base-Base interactions energy: -171.510 where: short stacking energy: -95.407 Base-Backbone interact. energy: 0.030 local terms energy: -167.270599 where: bonds (distance) C4'-P energy: -42.490 bonds (distance) P-C4' energy: -46.036 flat angles C4'-P-C4' energy: -41.602 flat angles P-C4'-P energy: -22.525 tors. eta vs tors. theta energy: -14.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -304.030167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.030167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.030167 (E_RNA) where: Base-Base interactions energy: -154.782 where: short stacking energy: -86.278 Base-Backbone interact. energy: -1.704 local terms energy: -147.543325 where: bonds (distance) C4'-P energy: -43.706 bonds (distance) P-C4' energy: -38.296 flat angles C4'-P-C4' energy: -34.092 flat angles P-C4'-P energy: -22.384 tors. eta vs tors. theta energy: -9.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -249.514424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.514424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.514424 (E_RNA) where: Base-Base interactions energy: -102.120 where: short stacking energy: -69.243 Base-Backbone interact. energy: -0.103 local terms energy: -147.291818 where: bonds (distance) C4'-P energy: -36.671 bonds (distance) P-C4' energy: -50.733 flat angles C4'-P-C4' energy: -26.921 flat angles P-C4'-P energy: -25.785 tors. eta vs tors. theta energy: -7.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -235.028155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.028155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.028155 (E_RNA) where: Base-Base interactions energy: -72.709 where: short stacking energy: -62.334 Base-Backbone interact. energy: 0.239 local terms energy: -162.557720 where: bonds (distance) C4'-P energy: -41.300 bonds (distance) P-C4' energy: -46.695 flat angles C4'-P-C4' energy: -45.854 flat angles P-C4'-P energy: -19.058 tors. eta vs tors. theta energy: -9.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -196.349686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.349686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.349686 (E_RNA) where: Base-Base interactions energy: -68.318 where: short stacking energy: -57.993 Base-Backbone interact. energy: -0.060 local terms energy: -127.971596 where: bonds (distance) C4'-P energy: -27.946 bonds (distance) P-C4' energy: -40.846 flat angles C4'-P-C4' energy: -36.645 flat angles P-C4'-P energy: -25.484 tors. eta vs tors. theta energy: 2.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -751.229022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.229022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.229022 (E_RNA) where: Base-Base interactions energy: -515.195 where: short stacking energy: -211.574 Base-Backbone interact. energy: -1.297 local terms energy: -234.737246 where: bonds (distance) C4'-P energy: -48.163 bonds (distance) P-C4' energy: -46.908 flat angles C4'-P-C4' energy: -51.378 flat angles P-C4'-P energy: -28.556 tors. eta vs tors. theta energy: -59.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -689.834443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.834443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.834443 (E_RNA) where: Base-Base interactions energy: -462.229 where: short stacking energy: -213.287 Base-Backbone interact. energy: 0.163 local terms energy: -227.768853 where: bonds (distance) C4'-P energy: -35.779 bonds (distance) P-C4' energy: -44.658 flat angles C4'-P-C4' energy: -50.576 flat angles P-C4'-P energy: -37.872 tors. eta vs tors. theta energy: -58.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -657.781718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.781718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.781718 (E_RNA) where: Base-Base interactions energy: -430.313 where: short stacking energy: -181.108 Base-Backbone interact. energy: 1.001 local terms energy: -228.469597 where: bonds (distance) C4'-P energy: -47.665 bonds (distance) P-C4' energy: -47.706 flat angles C4'-P-C4' energy: -46.737 flat angles P-C4'-P energy: -31.742 tors. eta vs tors. theta energy: -54.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -613.242082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.242082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.242082 (E_RNA) where: Base-Base interactions energy: -412.485 where: short stacking energy: -190.706 Base-Backbone interact. energy: -0.523 local terms energy: -200.233573 where: bonds (distance) C4'-P energy: -45.605 bonds (distance) P-C4' energy: -37.400 flat angles C4'-P-C4' energy: -42.398 flat angles P-C4'-P energy: -24.929 tors. eta vs tors. theta energy: -49.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -608.094954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.094954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.094954 (E_RNA) where: Base-Base interactions energy: -386.483 where: short stacking energy: -179.243 Base-Backbone interact. energy: -0.400 local terms energy: -221.211866 where: bonds (distance) C4'-P energy: -38.732 bonds (distance) P-C4' energy: -44.633 flat angles C4'-P-C4' energy: -50.337 flat angles P-C4'-P energy: -30.529 tors. eta vs tors. theta energy: -56.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -320.149096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.149096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.149096 (E_RNA) where: Base-Base interactions energy: -167.287 where: short stacking energy: -99.752 Base-Backbone interact. energy: -0.048 local terms energy: -152.813906 where: bonds (distance) C4'-P energy: -39.874 bonds (distance) P-C4' energy: -42.119 flat angles C4'-P-C4' energy: -32.801 flat angles P-C4'-P energy: -25.682 tors. eta vs tors. theta energy: -12.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -340.767607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.767607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.767607 (E_RNA) where: Base-Base interactions energy: -181.751 where: short stacking energy: -94.741 Base-Backbone interact. energy: 1.565 local terms energy: -160.581459 where: bonds (distance) C4'-P energy: -38.624 bonds (distance) P-C4' energy: -45.411 flat angles C4'-P-C4' energy: -37.195 flat angles P-C4'-P energy: -25.573 tors. eta vs tors. theta energy: -13.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -252.528259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.528259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.528259 (E_RNA) where: Base-Base interactions energy: -117.003 where: short stacking energy: -84.396 Base-Backbone interact. energy: 1.211 local terms energy: -136.735981 where: bonds (distance) C4'-P energy: -30.636 bonds (distance) P-C4' energy: -38.181 flat angles C4'-P-C4' energy: -35.289 flat angles P-C4'-P energy: -21.804 tors. eta vs tors. theta energy: -10.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -216.143050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.143050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.143050 (E_RNA) where: Base-Base interactions energy: -82.643 where: short stacking energy: -73.269 Base-Backbone interact. energy: 0.221 local terms energy: -133.720888 where: bonds (distance) C4'-P energy: -24.884 bonds (distance) P-C4' energy: -47.303 flat angles C4'-P-C4' energy: -31.834 flat angles P-C4'-P energy: -28.805 tors. eta vs tors. theta energy: -0.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -196.078993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.078993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.078993 (E_RNA) where: Base-Base interactions energy: -72.273 where: short stacking energy: -56.423 Base-Backbone interact. energy: 1.663 local terms energy: -125.468973 where: bonds (distance) C4'-P energy: -32.384 bonds (distance) P-C4' energy: -44.309 flat angles C4'-P-C4' energy: -34.839 flat angles P-C4'-P energy: -15.235 tors. eta vs tors. theta energy: 1.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -738.630730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.630730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.630730 (E_RNA) where: Base-Base interactions energy: -497.986 where: short stacking energy: -219.720 Base-Backbone interact. energy: -0.391 local terms energy: -240.253554 where: bonds (distance) C4'-P energy: -48.624 bonds (distance) P-C4' energy: -46.423 flat angles C4'-P-C4' energy: -51.822 flat angles P-C4'-P energy: -36.647 tors. eta vs tors. theta energy: -56.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -684.722404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.722404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.722404 (E_RNA) where: Base-Base interactions energy: -459.482 where: short stacking energy: -199.603 Base-Backbone interact. energy: -1.015 local terms energy: -224.225411 where: bonds (distance) C4'-P energy: -44.186 bonds (distance) P-C4' energy: -48.441 flat angles C4'-P-C4' energy: -45.880 flat angles P-C4'-P energy: -29.462 tors. eta vs tors. theta energy: -56.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -628.359586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.359586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.359586 (E_RNA) where: Base-Base interactions energy: -393.616 where: short stacking energy: -185.417 Base-Backbone interact. energy: -0.569 local terms energy: -234.174369 where: bonds (distance) C4'-P energy: -48.442 bonds (distance) P-C4' energy: -49.017 flat angles C4'-P-C4' energy: -45.330 flat angles P-C4'-P energy: -37.228 tors. eta vs tors. theta energy: -54.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -598.105401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.105401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.105401 (E_RNA) where: Base-Base interactions energy: -380.157 where: short stacking energy: -171.866 Base-Backbone interact. energy: -1.156 local terms energy: -216.792692 where: bonds (distance) C4'-P energy: -40.689 bonds (distance) P-C4' energy: -49.105 flat angles C4'-P-C4' energy: -42.817 flat angles P-C4'-P energy: -35.089 tors. eta vs tors. theta energy: -49.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -550.983193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.983193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.983193 (E_RNA) where: Base-Base interactions energy: -347.663 where: short stacking energy: -164.973 Base-Backbone interact. energy: -1.302 local terms energy: -202.017928 where: bonds (distance) C4'-P energy: -41.455 bonds (distance) P-C4' energy: -43.130 flat angles C4'-P-C4' energy: -48.705 flat angles P-C4'-P energy: -22.632 tors. eta vs tors. theta energy: -46.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -356.013431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.013431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.013431 (E_RNA) where: Base-Base interactions energy: -195.726 where: short stacking energy: -103.429 Base-Backbone interact. energy: -1.371 local terms energy: -158.916745 where: bonds (distance) C4'-P energy: -40.957 bonds (distance) P-C4' energy: -45.898 flat angles C4'-P-C4' energy: -32.466 flat angles P-C4'-P energy: -24.105 tors. eta vs tors. theta energy: -15.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -299.315059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.315059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.315059 (E_RNA) where: Base-Base interactions energy: -149.837 where: short stacking energy: -96.111 Base-Backbone interact. energy: 0.528 local terms energy: -150.006435 where: bonds (distance) C4'-P energy: -42.613 bonds (distance) P-C4' energy: -41.804 flat angles C4'-P-C4' energy: -31.382 flat angles P-C4'-P energy: -18.852 tors. eta vs tors. theta energy: -15.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -236.867960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.867960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.867960 (E_RNA) where: Base-Base interactions energy: -100.554 where: short stacking energy: -69.447 Base-Backbone interact. energy: 1.833 local terms energy: -138.146982 where: bonds (distance) C4'-P energy: -47.560 bonds (distance) P-C4' energy: -39.641 flat angles C4'-P-C4' energy: -29.022 flat angles P-C4'-P energy: -19.877 tors. eta vs tors. theta energy: -2.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -199.321023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.321023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.321023 (E_RNA) where: Base-Base interactions energy: -78.828 where: short stacking energy: -59.193 Base-Backbone interact. energy: -0.134 local terms energy: -120.359022 where: bonds (distance) C4'-P energy: -25.831 bonds (distance) P-C4' energy: -37.688 flat angles C4'-P-C4' energy: -33.673 flat angles P-C4'-P energy: -27.757 tors. eta vs tors. theta energy: 4.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -186.796960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.796960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.796960 (E_RNA) where: Base-Base interactions energy: -69.218 where: short stacking energy: -40.816 Base-Backbone interact. energy: 0.218 local terms energy: -117.796609 where: bonds (distance) C4'-P energy: -43.343 bonds (distance) P-C4' energy: -33.850 flat angles C4'-P-C4' energy: -23.452 flat angles P-C4'-P energy: -21.087 tors. eta vs tors. theta energy: 3.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -756.547306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.547306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.547306 (E_RNA) where: Base-Base interactions energy: -510.399 where: short stacking energy: -229.369 Base-Backbone interact. energy: 1.357 local terms energy: -247.505253 where: bonds (distance) C4'-P energy: -45.369 bonds (distance) P-C4' energy: -46.891 flat angles C4'-P-C4' energy: -49.807 flat angles P-C4'-P energy: -38.474 tors. eta vs tors. theta energy: -66.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -695.525115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.525115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.525115 (E_RNA) where: Base-Base interactions energy: -469.831 where: short stacking energy: -197.215 Base-Backbone interact. energy: -1.270 local terms energy: -224.423547 where: bonds (distance) C4'-P energy: -41.198 bonds (distance) P-C4' energy: -43.468 flat angles C4'-P-C4' energy: -51.027 flat angles P-C4'-P energy: -31.258 tors. eta vs tors. theta energy: -57.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -638.620837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.620837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.620837 (E_RNA) where: Base-Base interactions energy: -406.040 where: short stacking energy: -183.689 Base-Backbone interact. energy: -0.564 local terms energy: -232.016518 where: bonds (distance) C4'-P energy: -45.720 bonds (distance) P-C4' energy: -49.719 flat angles C4'-P-C4' energy: -48.032 flat angles P-C4'-P energy: -31.186 tors. eta vs tors. theta energy: -57.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -588.641857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.641857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.641857 (E_RNA) where: Base-Base interactions energy: -384.074 where: short stacking energy: -164.583 Base-Backbone interact. energy: -0.936 local terms energy: -203.632011 where: bonds (distance) C4'-P energy: -42.288 bonds (distance) P-C4' energy: -33.165 flat angles C4'-P-C4' energy: -44.913 flat angles P-C4'-P energy: -34.900 tors. eta vs tors. theta energy: -48.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -526.532456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.532456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.532456 (E_RNA) where: Base-Base interactions energy: -327.163 where: short stacking energy: -155.571 Base-Backbone interact. energy: -1.021 local terms energy: -198.348884 where: bonds (distance) C4'-P energy: -42.519 bonds (distance) P-C4' energy: -43.312 flat angles C4'-P-C4' energy: -43.341 flat angles P-C4'-P energy: -29.260 tors. eta vs tors. theta energy: -39.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -317.125646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.125646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.125646 (E_RNA) where: Base-Base interactions energy: -168.904 where: short stacking energy: -99.500 Base-Backbone interact. energy: -0.691 local terms energy: -147.530651 where: bonds (distance) C4'-P energy: -38.306 bonds (distance) P-C4' energy: -41.162 flat angles C4'-P-C4' energy: -32.709 flat angles P-C4'-P energy: -22.728 tors. eta vs tors. theta energy: -12.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -298.908859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.908859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.908859 (E_RNA) where: Base-Base interactions energy: -165.511 where: short stacking energy: -74.003 Base-Backbone interact. energy: 2.039 local terms energy: -135.437088 where: bonds (distance) C4'-P energy: -39.125 bonds (distance) P-C4' energy: -41.073 flat angles C4'-P-C4' energy: -31.563 flat angles P-C4'-P energy: -20.429 tors. eta vs tors. theta energy: -3.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -252.530265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.530265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.530265 (E_RNA) where: Base-Base interactions energy: -104.925 where: short stacking energy: -70.711 Base-Backbone interact. energy: -1.690 local terms energy: -145.915244 where: bonds (distance) C4'-P energy: -28.314 bonds (distance) P-C4' energy: -44.028 flat angles C4'-P-C4' energy: -33.018 flat angles P-C4'-P energy: -27.844 tors. eta vs tors. theta energy: -12.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -226.691578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.691578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.691578 (E_RNA) where: Base-Base interactions energy: -82.527 where: short stacking energy: -68.121 Base-Backbone interact. energy: -2.594 local terms energy: -141.569707 where: bonds (distance) C4'-P energy: -41.617 bonds (distance) P-C4' energy: -44.861 flat angles C4'-P-C4' energy: -38.557 flat angles P-C4'-P energy: -21.965 tors. eta vs tors. theta energy: 5.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -191.335046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.335046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.335046 (E_RNA) where: Base-Base interactions energy: -59.219 where: short stacking energy: -52.754 Base-Backbone interact. energy: 1.713 local terms energy: -133.829548 where: bonds (distance) C4'-P energy: -29.869 bonds (distance) P-C4' energy: -44.143 flat angles C4'-P-C4' energy: -32.217 flat angles P-C4'-P energy: -25.811 tors. eta vs tors. theta energy: -1.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -749.061377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.061377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.061377 (E_RNA) where: Base-Base interactions energy: -499.545 where: short stacking energy: -226.459 Base-Backbone interact. energy: -0.600 local terms energy: -248.916104 where: bonds (distance) C4'-P energy: -48.215 bonds (distance) P-C4' energy: -44.784 flat angles C4'-P-C4' energy: -47.439 flat angles P-C4'-P energy: -36.781 tors. eta vs tors. theta energy: -71.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -678.835064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.835064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.835064 (E_RNA) where: Base-Base interactions energy: -457.242 where: short stacking energy: -190.107 Base-Backbone interact. energy: -0.964 local terms energy: -220.629003 where: bonds (distance) C4'-P energy: -45.395 bonds (distance) P-C4' energy: -41.272 flat angles C4'-P-C4' energy: -44.757 flat angles P-C4'-P energy: -31.272 tors. eta vs tors. theta energy: -57.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -640.206913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.206913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.206913 (E_RNA) where: Base-Base interactions energy: -402.586 where: short stacking energy: -192.109 Base-Backbone interact. energy: 2.476 local terms energy: -240.096916 where: bonds (distance) C4'-P energy: -46.559 bonds (distance) P-C4' energy: -52.661 flat angles C4'-P-C4' energy: -47.410 flat angles P-C4'-P energy: -40.460 tors. eta vs tors. theta energy: -53.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -597.112734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.112734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.112734 (E_RNA) where: Base-Base interactions energy: -367.881 where: short stacking energy: -183.728 Base-Backbone interact. energy: -0.698 local terms energy: -228.533554 where: bonds (distance) C4'-P energy: -48.058 bonds (distance) P-C4' energy: -46.654 flat angles C4'-P-C4' energy: -48.162 flat angles P-C4'-P energy: -26.318 tors. eta vs tors. theta energy: -59.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -527.965139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.965139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.965139 (E_RNA) where: Base-Base interactions energy: -319.892 where: short stacking energy: -155.536 Base-Backbone interact. energy: -0.916 local terms energy: -207.157232 where: bonds (distance) C4'-P energy: -44.936 bonds (distance) P-C4' energy: -38.002 flat angles C4'-P-C4' energy: -45.360 flat angles P-C4'-P energy: -37.793 tors. eta vs tors. theta energy: -41.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -336.462048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.462048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.462048 (E_RNA) where: Base-Base interactions energy: -165.246 where: short stacking energy: -120.054 Base-Backbone interact. energy: -0.472 local terms energy: -170.743904 where: bonds (distance) C4'-P energy: -38.653 bonds (distance) P-C4' energy: -37.577 flat angles C4'-P-C4' energy: -38.132 flat angles P-C4'-P energy: -29.421 tors. eta vs tors. theta energy: -26.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -272.707773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.707773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.707773 (E_RNA) where: Base-Base interactions energy: -116.775 where: short stacking energy: -72.039 Base-Backbone interact. energy: 0.278 local terms energy: -156.211374 where: bonds (distance) C4'-P energy: -43.008 bonds (distance) P-C4' energy: -47.840 flat angles C4'-P-C4' energy: -33.466 flat angles P-C4'-P energy: -29.282 tors. eta vs tors. theta energy: -2.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -279.516134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.516134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.516134 (E_RNA) where: Base-Base interactions energy: -151.755 where: short stacking energy: -81.520 Base-Backbone interact. energy: -2.366 local terms energy: -125.394633 where: bonds (distance) C4'-P energy: -41.862 bonds (distance) P-C4' energy: -34.905 flat angles C4'-P-C4' energy: -34.855 flat angles P-C4'-P energy: -10.218 tors. eta vs tors. theta energy: -3.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -209.506074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.506074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.506074 (E_RNA) where: Base-Base interactions energy: -65.526 where: short stacking energy: -53.094 Base-Backbone interact. energy: -0.679 local terms energy: -143.301666 where: bonds (distance) C4'-P energy: -44.375 bonds (distance) P-C4' energy: -46.152 flat angles C4'-P-C4' energy: -35.695 flat angles P-C4'-P energy: -22.850 tors. eta vs tors. theta energy: 5.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -204.311134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.311134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.311134 (E_RNA) where: Base-Base interactions energy: -70.827 where: short stacking energy: -48.604 Base-Backbone interact. energy: 0.693 local terms energy: -134.177186 where: bonds (distance) C4'-P energy: -43.326 bonds (distance) P-C4' energy: -40.095 flat angles C4'-P-C4' energy: -37.862 flat angles P-C4'-P energy: -22.217 tors. eta vs tors. theta energy: 9.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -753.448919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.448919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.448919 (E_RNA) where: Base-Base interactions energy: -495.380 where: short stacking energy: -225.421 Base-Backbone interact. energy: -0.925 local terms energy: -257.144758 where: bonds (distance) C4'-P energy: -46.214 bonds (distance) P-C4' energy: -44.332 flat angles C4'-P-C4' energy: -53.669 flat angles P-C4'-P energy: -41.540 tors. eta vs tors. theta energy: -71.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -671.121918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.121918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.121918 (E_RNA) where: Base-Base interactions energy: -446.519 where: short stacking energy: -198.250 Base-Backbone interact. energy: 0.377 local terms energy: -224.980120 where: bonds (distance) C4'-P energy: -47.513 bonds (distance) P-C4' energy: -46.999 flat angles C4'-P-C4' energy: -47.039 flat angles P-C4'-P energy: -31.686 tors. eta vs tors. theta energy: -51.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -640.766414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.766414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.766414 (E_RNA) where: Base-Base interactions energy: -399.146 where: short stacking energy: -181.390 Base-Backbone interact. energy: -0.546 local terms energy: -241.073532 where: bonds (distance) C4'-P energy: -41.050 bonds (distance) P-C4' energy: -50.280 flat angles C4'-P-C4' energy: -53.049 flat angles P-C4'-P energy: -31.288 tors. eta vs tors. theta energy: -65.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -591.341889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.341889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.341889 (E_RNA) where: Base-Base interactions energy: -378.902 where: short stacking energy: -182.595 Base-Backbone interact. energy: 0.967 local terms energy: -213.407384 where: bonds (distance) C4'-P energy: -44.375 bonds (distance) P-C4' energy: -49.166 flat angles C4'-P-C4' energy: -45.715 flat angles P-C4'-P energy: -25.905 tors. eta vs tors. theta energy: -48.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -552.996868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.996868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.996868 (E_RNA) where: Base-Base interactions energy: -349.890 where: short stacking energy: -162.629 Base-Backbone interact. energy: -0.568 local terms energy: -202.539127 where: bonds (distance) C4'-P energy: -43.103 bonds (distance) P-C4' energy: -48.651 flat angles C4'-P-C4' energy: -34.446 flat angles P-C4'-P energy: -33.755 tors. eta vs tors. theta energy: -42.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -328.465855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.465855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.465855 (E_RNA) where: Base-Base interactions energy: -157.083 where: short stacking energy: -94.391 Base-Backbone interact. energy: 0.221 local terms energy: -171.604121 where: bonds (distance) C4'-P energy: -48.420 bonds (distance) P-C4' energy: -50.411 flat angles C4'-P-C4' energy: -39.060 flat angles P-C4'-P energy: -23.463 tors. eta vs tors. theta energy: -10.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -292.314329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.314329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.314329 (E_RNA) where: Base-Base interactions energy: -141.970 where: short stacking energy: -65.352 Base-Backbone interact. energy: 2.053 local terms energy: -152.397077 where: bonds (distance) C4'-P energy: -43.019 bonds (distance) P-C4' energy: -44.845 flat angles C4'-P-C4' energy: -39.000 flat angles P-C4'-P energy: -22.980 tors. eta vs tors. theta energy: -2.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -226.846014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.846014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.846014 (E_RNA) where: Base-Base interactions energy: -76.402 where: short stacking energy: -58.327 Base-Backbone interact. energy: -0.733 local terms energy: -149.711404 where: bonds (distance) C4'-P energy: -37.271 bonds (distance) P-C4' energy: -43.994 flat angles C4'-P-C4' energy: -39.856 flat angles P-C4'-P energy: -31.325 tors. eta vs tors. theta energy: 2.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -304.811397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.811397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.811397 (E_RNA) where: Base-Base interactions energy: -159.391 where: short stacking energy: -86.264 Base-Backbone interact. energy: 0.130 local terms energy: -145.549798 where: bonds (distance) C4'-P energy: -36.484 bonds (distance) P-C4' energy: -46.680 flat angles C4'-P-C4' energy: -29.484 flat angles P-C4'-P energy: -22.247 tors. eta vs tors. theta energy: -10.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -216.885329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.885329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.885329 (E_RNA) where: Base-Base interactions energy: -89.514 where: short stacking energy: -53.698 Base-Backbone interact. energy: -0.033 local terms energy: -127.338358 where: bonds (distance) C4'-P energy: -41.484 bonds (distance) P-C4' energy: -39.638 flat angles C4'-P-C4' energy: -36.107 flat angles P-C4'-P energy: -12.600 tors. eta vs tors. theta energy: 2.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -739.459571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.459571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.459571 (E_RNA) where: Base-Base interactions energy: -504.883 where: short stacking energy: -228.610 Base-Backbone interact. energy: -0.893 local terms energy: -233.683673 where: bonds (distance) C4'-P energy: -41.195 bonds (distance) P-C4' energy: -41.781 flat angles C4'-P-C4' energy: -49.810 flat angles P-C4'-P energy: -29.706 tors. eta vs tors. theta energy: -71.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -675.762293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.762293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.762293 (E_RNA) where: Base-Base interactions energy: -445.606 where: short stacking energy: -194.423 Base-Backbone interact. energy: -0.946 local terms energy: -229.211029 where: bonds (distance) C4'-P energy: -50.561 bonds (distance) P-C4' energy: -39.351 flat angles C4'-P-C4' energy: -51.610 flat angles P-C4'-P energy: -30.359 tors. eta vs tors. theta energy: -57.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -630.066068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.066068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.066068 (E_RNA) where: Base-Base interactions energy: -398.364 where: short stacking energy: -176.914 Base-Backbone interact. energy: 0.050 local terms energy: -231.752684 where: bonds (distance) C4'-P energy: -44.507 bonds (distance) P-C4' energy: -52.826 flat angles C4'-P-C4' energy: -47.239 flat angles P-C4'-P energy: -33.272 tors. eta vs tors. theta energy: -53.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -594.350535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.350535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.350535 (E_RNA) where: Base-Base interactions energy: -388.751 where: short stacking energy: -179.609 Base-Backbone interact. energy: -1.257 local terms energy: -204.342305 where: bonds (distance) C4'-P energy: -39.102 bonds (distance) P-C4' energy: -45.246 flat angles C4'-P-C4' energy: -49.152 flat angles P-C4'-P energy: -25.074 tors. eta vs tors. theta energy: -45.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -591.435498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.435498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.435498 (E_RNA) where: Base-Base interactions energy: -369.648 where: short stacking energy: -174.016 Base-Backbone interact. energy: -0.898 local terms energy: -220.889158 where: bonds (distance) C4'-P energy: -37.347 bonds (distance) P-C4' energy: -44.287 flat angles C4'-P-C4' energy: -45.053 flat angles P-C4'-P energy: -35.876 tors. eta vs tors. theta energy: -58.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -345.965692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.965692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.965692 (E_RNA) where: Base-Base interactions energy: -184.177 where: short stacking energy: -100.409 Base-Backbone interact. energy: 0.958 local terms energy: -162.746879 where: bonds (distance) C4'-P energy: -37.959 bonds (distance) P-C4' energy: -46.467 flat angles C4'-P-C4' energy: -28.703 flat angles P-C4'-P energy: -29.761 tors. eta vs tors. theta energy: -19.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -282.000345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.000345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.000345 (E_RNA) where: Base-Base interactions energy: -113.756 where: short stacking energy: -85.896 Base-Backbone interact. energy: -0.935 local terms energy: -167.309656 where: bonds (distance) C4'-P energy: -34.888 bonds (distance) P-C4' energy: -43.164 flat angles C4'-P-C4' energy: -38.172 flat angles P-C4'-P energy: -34.247 tors. eta vs tors. theta energy: -16.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -218.874172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.874172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.874172 (E_RNA) where: Base-Base interactions energy: -73.587 where: short stacking energy: -55.009 Base-Backbone interact. energy: -0.894 local terms energy: -144.393520 where: bonds (distance) C4'-P energy: -40.087 bonds (distance) P-C4' energy: -40.722 flat angles C4'-P-C4' energy: -39.836 flat angles P-C4'-P energy: -24.464 tors. eta vs tors. theta energy: 0.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -218.664391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.664391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.664391 (E_RNA) where: Base-Base interactions energy: -68.135 where: short stacking energy: -53.199 Base-Backbone interact. energy: -2.060 local terms energy: -148.469479 where: bonds (distance) C4'-P energy: -45.249 bonds (distance) P-C4' energy: -44.680 flat angles C4'-P-C4' energy: -40.497 flat angles P-C4'-P energy: -24.566 tors. eta vs tors. theta energy: 6.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -233.313914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.313914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.313914 (E_RNA) where: Base-Base interactions energy: -84.861 where: short stacking energy: -53.073 Base-Backbone interact. energy: 0.810 local terms energy: -149.263232 where: bonds (distance) C4'-P energy: -33.307 bonds (distance) P-C4' energy: -50.491 flat angles C4'-P-C4' energy: -41.505 flat angles P-C4'-P energy: -20.791 tors. eta vs tors. theta energy: -3.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -760.773362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.773362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.773362 (E_RNA) where: Base-Base interactions energy: -502.089 where: short stacking energy: -225.112 Base-Backbone interact. energy: -0.151 local terms energy: -258.533450 where: bonds (distance) C4'-P energy: -48.915 bonds (distance) P-C4' energy: -51.432 flat angles C4'-P-C4' energy: -47.504 flat angles P-C4'-P energy: -37.404 tors. eta vs tors. theta energy: -73.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -644.012809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.012809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.012809 (E_RNA) where: Base-Base interactions energy: -405.287 where: short stacking energy: -192.625 Base-Backbone interact. energy: -0.949 local terms energy: -237.776133 where: bonds (distance) C4'-P energy: -49.235 bonds (distance) P-C4' energy: -52.905 flat angles C4'-P-C4' energy: -46.326 flat angles P-C4'-P energy: -30.978 tors. eta vs tors. theta energy: -58.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -654.901984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.901984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.901984 (E_RNA) where: Base-Base interactions energy: -430.931 where: short stacking energy: -199.069 Base-Backbone interact. energy: -0.054 local terms energy: -223.916977 where: bonds (distance) C4'-P energy: -43.740 bonds (distance) P-C4' energy: -43.177 flat angles C4'-P-C4' energy: -47.136 flat angles P-C4'-P energy: -28.908 tors. eta vs tors. theta energy: -60.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -587.263719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.263719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.263719 (E_RNA) where: Base-Base interactions energy: -346.892 where: short stacking energy: -180.820 Base-Backbone interact. energy: 1.520 local terms energy: -241.891343 where: bonds (distance) C4'-P energy: -52.259 bonds (distance) P-C4' energy: -50.003 flat angles C4'-P-C4' energy: -52.928 flat angles P-C4'-P energy: -32.192 tors. eta vs tors. theta energy: -54.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -541.537353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.537353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.537353 (E_RNA) where: Base-Base interactions energy: -340.168 where: short stacking energy: -148.501 Base-Backbone interact. energy: -1.435 local terms energy: -199.934461 where: bonds (distance) C4'-P energy: -43.126 bonds (distance) P-C4' energy: -38.519 flat angles C4'-P-C4' energy: -45.692 flat angles P-C4'-P energy: -21.553 tors. eta vs tors. theta energy: -51.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -350.207018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.207018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.207018 (E_RNA) where: Base-Base interactions energy: -186.690 where: short stacking energy: -115.593 Base-Backbone interact. energy: -0.550 local terms energy: -162.967738 where: bonds (distance) C4'-P energy: -39.857 bonds (distance) P-C4' energy: -43.512 flat angles C4'-P-C4' energy: -33.054 flat angles P-C4'-P energy: -21.924 tors. eta vs tors. theta energy: -24.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -319.783097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.783097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.783097 (E_RNA) where: Base-Base interactions energy: -160.617 where: short stacking energy: -90.213 Base-Backbone interact. energy: 0.304 local terms energy: -159.470613 where: bonds (distance) C4'-P energy: -43.873 bonds (distance) P-C4' energy: -41.836 flat angles C4'-P-C4' energy: -36.123 flat angles P-C4'-P energy: -31.253 tors. eta vs tors. theta energy: -6.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -248.231227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.231227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.231227 (E_RNA) where: Base-Base interactions energy: -106.677 where: short stacking energy: -78.897 Base-Backbone interact. energy: 0.063 local terms energy: -141.617134 where: bonds (distance) C4'-P energy: -47.701 bonds (distance) P-C4' energy: -33.496 flat angles C4'-P-C4' energy: -35.762 flat angles P-C4'-P energy: -20.662 tors. eta vs tors. theta energy: -3.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -227.307091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.307091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.307091 (E_RNA) where: Base-Base interactions energy: -92.960 where: short stacking energy: -65.761 Base-Backbone interact. energy: 3.626 local terms energy: -137.973044 where: bonds (distance) C4'-P energy: -39.055 bonds (distance) P-C4' energy: -37.246 flat angles C4'-P-C4' energy: -37.377 flat angles P-C4'-P energy: -28.381 tors. eta vs tors. theta energy: 4.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -203.086364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.086364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.086364 (E_RNA) where: Base-Base interactions energy: -74.851 where: short stacking energy: -51.192 Base-Backbone interact. energy: 0.680 local terms energy: -128.915194 where: bonds (distance) C4'-P energy: -39.958 bonds (distance) P-C4' energy: -29.009 flat angles C4'-P-C4' energy: -31.374 flat angles P-C4'-P energy: -26.740 tors. eta vs tors. theta energy: -1.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -751.262136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.262136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.262136 (E_RNA) where: Base-Base interactions energy: -487.288 where: short stacking energy: -214.986 Base-Backbone interact. energy: -0.302 local terms energy: -263.672190 where: bonds (distance) C4'-P energy: -51.681 bonds (distance) P-C4' energy: -47.753 flat angles C4'-P-C4' energy: -55.793 flat angles P-C4'-P energy: -37.644 tors. eta vs tors. theta energy: -70.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -648.506451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.506451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.506451 (E_RNA) where: Base-Base interactions energy: -417.244 where: short stacking energy: -205.308 Base-Backbone interact. energy: -0.598 local terms energy: -230.664724 where: bonds (distance) C4'-P energy: -45.365 bonds (distance) P-C4' energy: -46.555 flat angles C4'-P-C4' energy: -48.330 flat angles P-C4'-P energy: -31.239 tors. eta vs tors. theta energy: -59.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -578.380200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.380200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.380200 (E_RNA) where: Base-Base interactions energy: -353.394 where: short stacking energy: -171.382 Base-Backbone interact. energy: -0.189 local terms energy: -224.796777 where: bonds (distance) C4'-P energy: -42.745 bonds (distance) P-C4' energy: -48.485 flat angles C4'-P-C4' energy: -47.713 flat angles P-C4'-P energy: -30.966 tors. eta vs tors. theta energy: -54.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -619.920367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.920367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.920367 (E_RNA) where: Base-Base interactions energy: -399.982 where: short stacking energy: -179.546 Base-Backbone interact. energy: -0.726 local terms energy: -219.211548 where: bonds (distance) C4'-P energy: -44.709 bonds (distance) P-C4' energy: -45.184 flat angles C4'-P-C4' energy: -45.877 flat angles P-C4'-P energy: -36.787 tors. eta vs tors. theta energy: -46.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -522.917327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.917327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.917327 (E_RNA) where: Base-Base interactions energy: -322.847 where: short stacking energy: -138.509 Base-Backbone interact. energy: 1.180 local terms energy: -201.250691 where: bonds (distance) C4'-P energy: -42.666 bonds (distance) P-C4' energy: -41.468 flat angles C4'-P-C4' energy: -47.998 flat angles P-C4'-P energy: -31.113 tors. eta vs tors. theta energy: -38.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -365.857269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.857269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.857269 (E_RNA) where: Base-Base interactions energy: -196.986 where: short stacking energy: -115.717 Base-Backbone interact. energy: 4.545 local terms energy: -173.416134 where: bonds (distance) C4'-P energy: -41.250 bonds (distance) P-C4' energy: -42.204 flat angles C4'-P-C4' energy: -47.306 flat angles P-C4'-P energy: -23.207 tors. eta vs tors. theta energy: -19.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -331.657578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.657578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.657578 (E_RNA) where: Base-Base interactions energy: -160.328 where: short stacking energy: -96.708 Base-Backbone interact. energy: 0.994 local terms energy: -172.324018 where: bonds (distance) C4'-P energy: -49.894 bonds (distance) P-C4' energy: -45.014 flat angles C4'-P-C4' energy: -40.041 flat angles P-C4'-P energy: -22.906 tors. eta vs tors. theta energy: -14.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -260.441036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.441036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.441036 (E_RNA) where: Base-Base interactions energy: -119.101 where: short stacking energy: -84.253 Base-Backbone interact. energy: -1.362 local terms energy: -139.977945 where: bonds (distance) C4'-P energy: -29.676 bonds (distance) P-C4' energy: -40.736 flat angles C4'-P-C4' energy: -37.652 flat angles P-C4'-P energy: -22.312 tors. eta vs tors. theta energy: -9.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -222.629142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.629142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.629142 (E_RNA) where: Base-Base interactions energy: -87.015 where: short stacking energy: -51.055 Base-Backbone interact. energy: -0.179 local terms energy: -135.434896 where: bonds (distance) C4'-P energy: -44.215 bonds (distance) P-C4' energy: -38.564 flat angles C4'-P-C4' energy: -34.988 flat angles P-C4'-P energy: -22.734 tors. eta vs tors. theta energy: 5.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -223.412220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.412220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.412220 (E_RNA) where: Base-Base interactions energy: -85.254 where: short stacking energy: -74.388 Base-Backbone interact. energy: -0.572 local terms energy: -137.586566 where: bonds (distance) C4'-P energy: -36.638 bonds (distance) P-C4' energy: -46.935 flat angles C4'-P-C4' energy: -34.888 flat angles P-C4'-P energy: -15.618 tors. eta vs tors. theta energy: -3.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -760.044038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.044038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.044038 (E_RNA) where: Base-Base interactions energy: -499.244 where: short stacking energy: -222.584 Base-Backbone interact. energy: -0.966 local terms energy: -259.834074 where: bonds (distance) C4'-P energy: -49.732 bonds (distance) P-C4' energy: -44.437 flat angles C4'-P-C4' energy: -56.488 flat angles P-C4'-P energy: -33.819 tors. eta vs tors. theta energy: -75.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -658.660878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.660878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.660878 (E_RNA) where: Base-Base interactions energy: -415.088 where: short stacking energy: -197.300 Base-Backbone interact. energy: -0.948 local terms energy: -242.624710 where: bonds (distance) C4'-P energy: -52.542 bonds (distance) P-C4' energy: -50.730 flat angles C4'-P-C4' energy: -48.028 flat angles P-C4'-P energy: -35.741 tors. eta vs tors. theta energy: -55.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -582.320060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.320060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.320060 (E_RNA) where: Base-Base interactions energy: -356.507 where: short stacking energy: -173.925 Base-Backbone interact. energy: -0.080 local terms energy: -225.733293 where: bonds (distance) C4'-P energy: -45.594 bonds (distance) P-C4' energy: -46.437 flat angles C4'-P-C4' energy: -49.416 flat angles P-C4'-P energy: -29.449 tors. eta vs tors. theta energy: -54.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -608.353629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.353629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.353629 (E_RNA) where: Base-Base interactions energy: -415.573 where: short stacking energy: -156.849 Base-Backbone interact. energy: 0.133 local terms energy: -192.913267 where: bonds (distance) C4'-P energy: -45.634 bonds (distance) P-C4' energy: -38.721 flat angles C4'-P-C4' energy: -43.955 flat angles P-C4'-P energy: -26.024 tors. eta vs tors. theta energy: -38.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -537.845447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.845447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.845447 (E_RNA) where: Base-Base interactions energy: -360.915 where: short stacking energy: -151.036 Base-Backbone interact. energy: -1.196 local terms energy: -175.734018 where: bonds (distance) C4'-P energy: -44.499 bonds (distance) P-C4' energy: -31.093 flat angles C4'-P-C4' energy: -41.111 flat angles P-C4'-P energy: -14.231 tors. eta vs tors. theta energy: -44.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -404.102963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.102963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.102963 (E_RNA) where: Base-Base interactions energy: -223.306 where: short stacking energy: -135.186 Base-Backbone interact. energy: -0.150 local terms energy: -180.647086 where: bonds (distance) C4'-P energy: -42.041 bonds (distance) P-C4' energy: -40.564 flat angles C4'-P-C4' energy: -47.258 flat angles P-C4'-P energy: -20.366 tors. eta vs tors. theta energy: -30.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -349.946221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.946221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.946221 (E_RNA) where: Base-Base interactions energy: -164.252 where: short stacking energy: -113.404 Base-Backbone interact. energy: -0.463 local terms energy: -185.230659 where: bonds (distance) C4'-P energy: -46.383 bonds (distance) P-C4' energy: -47.084 flat angles C4'-P-C4' energy: -39.360 flat angles P-C4'-P energy: -26.971 tors. eta vs tors. theta energy: -25.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -226.793449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.793449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.793449 (E_RNA) where: Base-Base interactions energy: -83.474 where: short stacking energy: -77.507 Base-Backbone interact. energy: -0.392 local terms energy: -142.927641 where: bonds (distance) C4'-P energy: -33.937 bonds (distance) P-C4' energy: -38.639 flat angles C4'-P-C4' energy: -43.216 flat angles P-C4'-P energy: -16.224 tors. eta vs tors. theta energy: -10.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -244.116326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.116326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.116326 (E_RNA) where: Base-Base interactions energy: -124.136 where: short stacking energy: -72.873 Base-Backbone interact. energy: 6.704 local terms energy: -126.684740 where: bonds (distance) C4'-P energy: -37.164 bonds (distance) P-C4' energy: -39.746 flat angles C4'-P-C4' energy: -35.689 flat angles P-C4'-P energy: -20.570 tors. eta vs tors. theta energy: 6.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -194.876733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.876733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.876733 (E_RNA) where: Base-Base interactions energy: -81.825 where: short stacking energy: -61.372 Base-Backbone interact. energy: 0.549 local terms energy: -113.600930 where: bonds (distance) C4'-P energy: -33.762 bonds (distance) P-C4' energy: -43.788 flat angles C4'-P-C4' energy: -28.502 flat angles P-C4'-P energy: -11.343 tors. eta vs tors. theta energy: 3.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -748.698126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.698126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.698126 (E_RNA) where: Base-Base interactions energy: -499.627 where: short stacking energy: -226.810 Base-Backbone interact. energy: -0.159 local terms energy: -248.912812 where: bonds (distance) C4'-P energy: -50.689 bonds (distance) P-C4' energy: -47.024 flat angles C4'-P-C4' energy: -46.078 flat angles P-C4'-P energy: -27.704 tors. eta vs tors. theta energy: -77.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -630.472015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.472015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.472015 (E_RNA) where: Base-Base interactions energy: -401.567 where: short stacking energy: -187.386 Base-Backbone interact. energy: -0.901 local terms energy: -228.004470 where: bonds (distance) C4'-P energy: -48.316 bonds (distance) P-C4' energy: -47.440 flat angles C4'-P-C4' energy: -45.815 flat angles P-C4'-P energy: -30.644 tors. eta vs tors. theta energy: -55.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -640.256786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.256786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.256786 (E_RNA) where: Base-Base interactions energy: -421.846 where: short stacking energy: -162.743 Base-Backbone interact. energy: 0.159 local terms energy: -218.570212 where: bonds (distance) C4'-P energy: -48.975 bonds (distance) P-C4' energy: -49.832 flat angles C4'-P-C4' energy: -42.968 flat angles P-C4'-P energy: -31.308 tors. eta vs tors. theta energy: -45.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -541.567294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.567294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.567294 (E_RNA) where: Base-Base interactions energy: -344.654 where: short stacking energy: -163.877 Base-Backbone interact. energy: 1.697 local terms energy: -198.610781 where: bonds (distance) C4'-P energy: -36.625 bonds (distance) P-C4' energy: -38.090 flat angles C4'-P-C4' energy: -45.317 flat angles P-C4'-P energy: -31.075 tors. eta vs tors. theta energy: -47.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -567.194714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.194714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.194714 (E_RNA) where: Base-Base interactions energy: -383.207 where: short stacking energy: -162.355 Base-Backbone interact. energy: -0.627 local terms energy: -183.360550 where: bonds (distance) C4'-P energy: -39.076 bonds (distance) P-C4' energy: -38.638 flat angles C4'-P-C4' energy: -40.496 flat angles P-C4'-P energy: -26.073 tors. eta vs tors. theta energy: -39.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -351.566198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.566198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.566198 (E_RNA) where: Base-Base interactions energy: -180.040 where: short stacking energy: -109.615 Base-Backbone interact. energy: -1.941 local terms energy: -169.585529 where: bonds (distance) C4'-P energy: -41.771 bonds (distance) P-C4' energy: -44.320 flat angles C4'-P-C4' energy: -38.418 flat angles P-C4'-P energy: -24.544 tors. eta vs tors. theta energy: -20.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -332.808124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.808124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.808124 (E_RNA) where: Base-Base interactions energy: -151.302 where: short stacking energy: -99.318 Base-Backbone interact. energy: -0.206 local terms energy: -181.300100 where: bonds (distance) C4'-P energy: -45.943 bonds (distance) P-C4' energy: -42.110 flat angles C4'-P-C4' energy: -44.337 flat angles P-C4'-P energy: -27.801 tors. eta vs tors. theta energy: -21.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -226.650295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.650295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.650295 (E_RNA) where: Base-Base interactions energy: -86.010 where: short stacking energy: -70.364 Base-Backbone interact. energy: -1.645 local terms energy: -138.995327 where: bonds (distance) C4'-P energy: -35.859 bonds (distance) P-C4' energy: -43.524 flat angles C4'-P-C4' energy: -35.537 flat angles P-C4'-P energy: -17.908 tors. eta vs tors. theta energy: -6.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -211.869816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.869816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.869816 (E_RNA) where: Base-Base interactions energy: -68.668 where: short stacking energy: -68.383 Base-Backbone interact. energy: -0.735 local terms energy: -142.466272 where: bonds (distance) C4'-P energy: -37.898 bonds (distance) P-C4' energy: -36.785 flat angles C4'-P-C4' energy: -32.862 flat angles P-C4'-P energy: -28.313 tors. eta vs tors. theta energy: -6.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -204.757328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.757328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.757328 (E_RNA) where: Base-Base interactions energy: -77.813 where: short stacking energy: -60.289 Base-Backbone interact. energy: -1.563 local terms energy: -125.381128 where: bonds (distance) C4'-P energy: -37.028 bonds (distance) P-C4' energy: -37.906 flat angles C4'-P-C4' energy: -29.744 flat angles P-C4'-P energy: -20.085 tors. eta vs tors. theta energy: -0.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -742.995015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.995015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.995015 (E_RNA) where: Base-Base interactions energy: -493.114 where: short stacking energy: -213.275 Base-Backbone interact. energy: -0.312 local terms energy: -249.568658 where: bonds (distance) C4'-P energy: -48.698 bonds (distance) P-C4' energy: -47.466 flat angles C4'-P-C4' energy: -48.376 flat angles P-C4'-P energy: -36.360 tors. eta vs tors. theta energy: -68.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -653.997197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.997197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.997197 (E_RNA) where: Base-Base interactions energy: -426.675 where: short stacking energy: -204.810 Base-Backbone interact. energy: 0.011 local terms energy: -227.333528 where: bonds (distance) C4'-P energy: -40.737 bonds (distance) P-C4' energy: -46.389 flat angles C4'-P-C4' energy: -47.836 flat angles P-C4'-P energy: -36.274 tors. eta vs tors. theta energy: -56.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -621.024549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.024549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.024549 (E_RNA) where: Base-Base interactions energy: -401.215 where: short stacking energy: -160.756 Base-Backbone interact. energy: -1.158 local terms energy: -218.652046 where: bonds (distance) C4'-P energy: -49.477 bonds (distance) P-C4' energy: -44.151 flat angles C4'-P-C4' energy: -51.804 flat angles P-C4'-P energy: -30.740 tors. eta vs tors. theta energy: -42.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -563.463868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.463868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.463868 (E_RNA) where: Base-Base interactions energy: -361.819 where: short stacking energy: -168.272 Base-Backbone interact. energy: 0.125 local terms energy: -201.769388 where: bonds (distance) C4'-P energy: -38.267 bonds (distance) P-C4' energy: -41.303 flat angles C4'-P-C4' energy: -43.848 flat angles P-C4'-P energy: -36.393 tors. eta vs tors. theta energy: -41.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -537.635952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.635952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.635952 (E_RNA) where: Base-Base interactions energy: -342.326 where: short stacking energy: -166.524 Base-Backbone interact. energy: -0.652 local terms energy: -194.657163 where: bonds (distance) C4'-P energy: -34.825 bonds (distance) P-C4' energy: -41.168 flat angles C4'-P-C4' energy: -38.939 flat angles P-C4'-P energy: -34.519 tors. eta vs tors. theta energy: -45.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -344.266207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.266207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.266207 (E_RNA) where: Base-Base interactions energy: -188.031 where: short stacking energy: -106.787 Base-Backbone interact. energy: -0.612 local terms energy: -155.623135 where: bonds (distance) C4'-P energy: -33.527 bonds (distance) P-C4' energy: -45.884 flat angles C4'-P-C4' energy: -32.800 flat angles P-C4'-P energy: -28.070 tors. eta vs tors. theta energy: -15.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -296.753056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.753056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.753056 (E_RNA) where: Base-Base interactions energy: -147.286 where: short stacking energy: -89.716 Base-Backbone interact. energy: 0.704 local terms energy: -150.171145 where: bonds (distance) C4'-P energy: -42.784 bonds (distance) P-C4' energy: -43.645 flat angles C4'-P-C4' energy: -36.446 flat angles P-C4'-P energy: -19.562 tors. eta vs tors. theta energy: -7.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -251.177135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.177135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.177135 (E_RNA) where: Base-Base interactions energy: -118.023 where: short stacking energy: -98.101 Base-Backbone interact. energy: -0.493 local terms energy: -132.660676 where: bonds (distance) C4'-P energy: -34.876 bonds (distance) P-C4' energy: -31.701 flat angles C4'-P-C4' energy: -38.371 flat angles P-C4'-P energy: -25.086 tors. eta vs tors. theta energy: -2.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -199.022240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.022240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.022240 (E_RNA) where: Base-Base interactions energy: -81.181 where: short stacking energy: -53.498 Base-Backbone interact. energy: -1.507 local terms energy: -116.334117 where: bonds (distance) C4'-P energy: -34.129 bonds (distance) P-C4' energy: -39.016 flat angles C4'-P-C4' energy: -35.229 flat angles P-C4'-P energy: -19.690 tors. eta vs tors. theta energy: 11.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -197.028702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.028702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.028702 (E_RNA) where: Base-Base interactions energy: -69.139 where: short stacking energy: -57.968 Base-Backbone interact. energy: -0.919 local terms energy: -126.970670 where: bonds (distance) C4'-P energy: -40.328 bonds (distance) P-C4' energy: -29.695 flat angles C4'-P-C4' energy: -42.928 flat angles P-C4'-P energy: -17.016 tors. eta vs tors. theta energy: 2.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -739.695568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.695568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.695568 (E_RNA) where: Base-Base interactions energy: -485.723 where: short stacking energy: -229.921 Base-Backbone interact. energy: -1.770 local terms energy: -252.203005 where: bonds (distance) C4'-P energy: -44.228 bonds (distance) P-C4' energy: -49.979 flat angles C4'-P-C4' energy: -54.971 flat angles P-C4'-P energy: -29.987 tors. eta vs tors. theta energy: -73.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -640.664947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.664947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.664947 (E_RNA) where: Base-Base interactions energy: -426.581 where: short stacking energy: -184.644 Base-Backbone interact. energy: -0.486 local terms energy: -213.598413 where: bonds (distance) C4'-P energy: -40.679 bonds (distance) P-C4' energy: -47.720 flat angles C4'-P-C4' energy: -53.222 flat angles P-C4'-P energy: -27.825 tors. eta vs tors. theta energy: -44.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -618.137454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.137454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.137454 (E_RNA) where: Base-Base interactions energy: -403.828 where: short stacking energy: -170.478 Base-Backbone interact. energy: -0.569 local terms energy: -213.741433 where: bonds (distance) C4'-P energy: -39.701 bonds (distance) P-C4' energy: -48.143 flat angles C4'-P-C4' energy: -43.917 flat angles P-C4'-P energy: -35.573 tors. eta vs tors. theta energy: -46.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -571.164433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.164433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.164433 (E_RNA) where: Base-Base interactions energy: -356.671 where: short stacking energy: -162.722 Base-Backbone interact. energy: 0.682 local terms energy: -215.175105 where: bonds (distance) C4'-P energy: -43.461 bonds (distance) P-C4' energy: -38.459 flat angles C4'-P-C4' energy: -45.502 flat angles P-C4'-P energy: -38.211 tors. eta vs tors. theta energy: -49.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -534.422958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.422958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.422958 (E_RNA) where: Base-Base interactions energy: -339.248 where: short stacking energy: -146.986 Base-Backbone interact. energy: -1.627 local terms energy: -193.548270 where: bonds (distance) C4'-P energy: -41.158 bonds (distance) P-C4' energy: -39.875 flat angles C4'-P-C4' energy: -44.817 flat angles P-C4'-P energy: -30.440 tors. eta vs tors. theta energy: -37.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -352.585405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.585405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.585405 (E_RNA) where: Base-Base interactions energy: -185.467 where: short stacking energy: -107.475 Base-Backbone interact. energy: 0.325 local terms energy: -167.443837 where: bonds (distance) C4'-P energy: -37.237 bonds (distance) P-C4' energy: -44.623 flat angles C4'-P-C4' energy: -43.517 flat angles P-C4'-P energy: -25.578 tors. eta vs tors. theta energy: -16.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -252.582929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.582929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.582929 (E_RNA) where: Base-Base interactions energy: -93.969 where: short stacking energy: -69.824 Base-Backbone interact. energy: -0.257 local terms energy: -158.356555 where: bonds (distance) C4'-P energy: -44.780 bonds (distance) P-C4' energy: -48.476 flat angles C4'-P-C4' energy: -35.152 flat angles P-C4'-P energy: -19.873 tors. eta vs tors. theta energy: -10.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -216.827018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.827018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.827018 (E_RNA) where: Base-Base interactions energy: -95.633 where: short stacking energy: -56.856 Base-Backbone interact. energy: 3.181 local terms energy: -124.375007 where: bonds (distance) C4'-P energy: -36.598 bonds (distance) P-C4' energy: -37.259 flat angles C4'-P-C4' energy: -29.433 flat angles P-C4'-P energy: -24.958 tors. eta vs tors. theta energy: 3.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -226.886060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.886060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.886060 (E_RNA) where: Base-Base interactions energy: -93.621 where: short stacking energy: -67.120 Base-Backbone interact. energy: 1.791 local terms energy: -135.055556 where: bonds (distance) C4'-P energy: -40.945 bonds (distance) P-C4' energy: -35.837 flat angles C4'-P-C4' energy: -36.590 flat angles P-C4'-P energy: -23.721 tors. eta vs tors. theta energy: 2.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -190.003092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.003092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.003092 (E_RNA) where: Base-Base interactions energy: -57.608 where: short stacking energy: -52.485 Base-Backbone interact. energy: -0.250 local terms energy: -132.144402 where: bonds (distance) C4'-P energy: -34.422 bonds (distance) P-C4' energy: -45.258 flat angles C4'-P-C4' energy: -26.821 flat angles P-C4'-P energy: -31.954 tors. eta vs tors. theta energy: 6.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -740.202618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.202618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.202618 (E_RNA) where: Base-Base interactions energy: -490.206 where: short stacking energy: -221.053 Base-Backbone interact. energy: -0.401 local terms energy: -249.596245 where: bonds (distance) C4'-P energy: -41.275 bonds (distance) P-C4' energy: -50.280 flat angles C4'-P-C4' energy: -50.068 flat angles P-C4'-P energy: -37.687 tors. eta vs tors. theta energy: -70.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -660.042997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.042997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.042997 (E_RNA) where: Base-Base interactions energy: -427.879 where: short stacking energy: -198.474 Base-Backbone interact. energy: -0.614 local terms energy: -231.550035 where: bonds (distance) C4'-P energy: -40.574 bonds (distance) P-C4' energy: -45.203 flat angles C4'-P-C4' energy: -54.699 flat angles P-C4'-P energy: -35.041 tors. eta vs tors. theta energy: -56.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -647.663716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.663716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.663716 (E_RNA) where: Base-Base interactions energy: -420.741 where: short stacking energy: -160.798 Base-Backbone interact. energy: -1.037 local terms energy: -225.885343 where: bonds (distance) C4'-P energy: -41.257 bonds (distance) P-C4' energy: -48.730 flat angles C4'-P-C4' energy: -49.203 flat angles P-C4'-P energy: -32.828 tors. eta vs tors. theta energy: -53.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -572.383740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.383740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.383740 (E_RNA) where: Base-Base interactions energy: -342.787 where: short stacking energy: -170.221 Base-Backbone interact. energy: -0.639 local terms energy: -228.957451 where: bonds (distance) C4'-P energy: -46.591 bonds (distance) P-C4' energy: -48.515 flat angles C4'-P-C4' energy: -51.508 flat angles P-C4'-P energy: -30.994 tors. eta vs tors. theta energy: -51.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -537.097839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.097839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.097839 (E_RNA) where: Base-Base interactions energy: -319.556 where: short stacking energy: -145.110 Base-Backbone interact. energy: -0.608 local terms energy: -216.934457 where: bonds (distance) C4'-P energy: -48.411 bonds (distance) P-C4' energy: -44.507 flat angles C4'-P-C4' energy: -43.552 flat angles P-C4'-P energy: -32.807 tors. eta vs tors. theta energy: -47.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -340.485947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.485947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.485947 (E_RNA) where: Base-Base interactions energy: -177.434 where: short stacking energy: -99.472 Base-Backbone interact. energy: -0.563 local terms energy: -162.489249 where: bonds (distance) C4'-P energy: -37.536 bonds (distance) P-C4' energy: -45.077 flat angles C4'-P-C4' energy: -34.706 flat angles P-C4'-P energy: -29.633 tors. eta vs tors. theta energy: -15.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -253.615779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.615779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.615779 (E_RNA) where: Base-Base interactions energy: -92.832 where: short stacking energy: -63.703 Base-Backbone interact. energy: 0.465 local terms energy: -161.248611 where: bonds (distance) C4'-P energy: -44.024 bonds (distance) P-C4' energy: -44.051 flat angles C4'-P-C4' energy: -39.265 flat angles P-C4'-P energy: -25.506 tors. eta vs tors. theta energy: -8.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -238.910956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.910956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.910956 (E_RNA) where: Base-Base interactions energy: -102.283 where: short stacking energy: -64.719 Base-Backbone interact. energy: -0.958 local terms energy: -135.670291 where: bonds (distance) C4'-P energy: -44.287 bonds (distance) P-C4' energy: -39.988 flat angles C4'-P-C4' energy: -38.758 flat angles P-C4'-P energy: -10.285 tors. eta vs tors. theta energy: -2.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -215.666052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.666052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.666052 (E_RNA) where: Base-Base interactions energy: -81.692 where: short stacking energy: -55.562 Base-Backbone interact. energy: -1.431 local terms energy: -132.542333 where: bonds (distance) C4'-P energy: -41.950 bonds (distance) P-C4' energy: -41.264 flat angles C4'-P-C4' energy: -35.150 flat angles P-C4'-P energy: -17.226 tors. eta vs tors. theta energy: 3.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -183.752923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.752923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.752923 (E_RNA) where: Base-Base interactions energy: -73.538 where: short stacking energy: -59.686 Base-Backbone interact. energy: -0.877 local terms energy: -109.338245 where: bonds (distance) C4'-P energy: -33.821 bonds (distance) P-C4' energy: -34.120 flat angles C4'-P-C4' energy: -21.646 flat angles P-C4'-P energy: -21.972 tors. eta vs tors. theta energy: 2.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -752.821271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.821271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.821271 (E_RNA) where: Base-Base interactions energy: -504.270 where: short stacking energy: -223.187 Base-Backbone interact. energy: 0.020 local terms energy: -248.571354 where: bonds (distance) C4'-P energy: -51.293 bonds (distance) P-C4' energy: -49.773 flat angles C4'-P-C4' energy: -50.179 flat angles P-C4'-P energy: -32.619 tors. eta vs tors. theta energy: -64.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -687.683242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.683242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.683242 (E_RNA) where: Base-Base interactions energy: -461.461 where: short stacking energy: -204.185 Base-Backbone interact. energy: -2.079 local terms energy: -224.143929 where: bonds (distance) C4'-P energy: -39.518 bonds (distance) P-C4' energy: -49.894 flat angles C4'-P-C4' energy: -48.123 flat angles P-C4'-P energy: -27.996 tors. eta vs tors. theta energy: -58.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -651.231273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.231273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.231273 (E_RNA) where: Base-Base interactions energy: -431.110 where: short stacking energy: -181.077 Base-Backbone interact. energy: -2.663 local terms energy: -217.458254 where: bonds (distance) C4'-P energy: -42.204 bonds (distance) P-C4' energy: -48.096 flat angles C4'-P-C4' energy: -34.842 flat angles P-C4'-P energy: -33.825 tors. eta vs tors. theta energy: -58.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -556.317157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.317157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.317157 (E_RNA) where: Base-Base interactions energy: -349.034 where: short stacking energy: -145.599 Base-Backbone interact. energy: -0.496 local terms energy: -206.786609 where: bonds (distance) C4'-P energy: -42.916 bonds (distance) P-C4' energy: -46.523 flat angles C4'-P-C4' energy: -49.832 flat angles P-C4'-P energy: -27.976 tors. eta vs tors. theta energy: -39.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -538.663875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.663875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.663875 (E_RNA) where: Base-Base interactions energy: -337.284 where: short stacking energy: -160.184 Base-Backbone interact. energy: -0.310 local terms energy: -201.069208 where: bonds (distance) C4'-P energy: -38.001 bonds (distance) P-C4' energy: -43.607 flat angles C4'-P-C4' energy: -42.003 flat angles P-C4'-P energy: -31.418 tors. eta vs tors. theta energy: -46.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -386.125927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.125927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.125927 (E_RNA) where: Base-Base interactions energy: -215.054 where: short stacking energy: -113.684 Base-Backbone interact. energy: 0.688 local terms energy: -171.760412 where: bonds (distance) C4'-P energy: -45.546 bonds (distance) P-C4' energy: -47.210 flat angles C4'-P-C4' energy: -44.319 flat angles P-C4'-P energy: -23.634 tors. eta vs tors. theta energy: -11.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -250.909433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.909433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.909433 (E_RNA) where: Base-Base interactions energy: -93.039 where: short stacking energy: -91.854 Base-Backbone interact. energy: 3.244 local terms energy: -161.113975 where: bonds (distance) C4'-P energy: -40.658 bonds (distance) P-C4' energy: -46.021 flat angles C4'-P-C4' energy: -34.730 flat angles P-C4'-P energy: -20.688 tors. eta vs tors. theta energy: -19.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -222.628877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.628877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.628877 (E_RNA) where: Base-Base interactions energy: -81.743 where: short stacking energy: -62.440 Base-Backbone interact. energy: -0.396 local terms energy: -140.489335 where: bonds (distance) C4'-P energy: -38.573 bonds (distance) P-C4' energy: -45.070 flat angles C4'-P-C4' energy: -24.141 flat angles P-C4'-P energy: -22.521 tors. eta vs tors. theta energy: -10.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -203.583249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.583249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.583249 (E_RNA) where: Base-Base interactions energy: -66.068 where: short stacking energy: -58.511 Base-Backbone interact. energy: -0.406 local terms energy: -137.109834 where: bonds (distance) C4'-P energy: -43.642 bonds (distance) P-C4' energy: -35.481 flat angles C4'-P-C4' energy: -39.330 flat angles P-C4'-P energy: -13.358 tors. eta vs tors. theta energy: -5.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -224.757795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.757795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.757795 (E_RNA) where: Base-Base interactions energy: -96.815 where: short stacking energy: -62.625 Base-Backbone interact. energy: 4.661 local terms energy: -132.603792 where: bonds (distance) C4'-P energy: -37.446 bonds (distance) P-C4' energy: -41.592 flat angles C4'-P-C4' energy: -33.396 flat angles P-C4'-P energy: -20.234 tors. eta vs tors. theta energy: 0.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -760.837753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.837753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.837753 (E_RNA) where: Base-Base interactions energy: -514.693 where: short stacking energy: -227.563 Base-Backbone interact. energy: -1.609 local terms energy: -244.536002 where: bonds (distance) C4'-P energy: -49.982 bonds (distance) P-C4' energy: -42.617 flat angles C4'-P-C4' energy: -49.585 flat angles P-C4'-P energy: -30.704 tors. eta vs tors. theta energy: -71.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -702.919521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.919521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.919521 (E_RNA) where: Base-Base interactions energy: -470.522 where: short stacking energy: -209.060 Base-Backbone interact. energy: -1.289 local terms energy: -231.108721 where: bonds (distance) C4'-P energy: -46.188 bonds (distance) P-C4' energy: -44.219 flat angles C4'-P-C4' energy: -49.759 flat angles P-C4'-P energy: -32.804 tors. eta vs tors. theta energy: -58.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -643.006992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.006992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.006992 (E_RNA) where: Base-Base interactions energy: -435.987 where: short stacking energy: -174.426 Base-Backbone interact. energy: -1.762 local terms energy: -205.258213 where: bonds (distance) C4'-P energy: -37.206 bonds (distance) P-C4' energy: -41.483 flat angles C4'-P-C4' energy: -51.299 flat angles P-C4'-P energy: -32.943 tors. eta vs tors. theta energy: -42.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -533.930358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.930358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.930358 (E_RNA) where: Base-Base interactions energy: -332.410 where: short stacking energy: -145.884 Base-Backbone interact. energy: 1.253 local terms energy: -202.773046 where: bonds (distance) C4'-P energy: -42.847 bonds (distance) P-C4' energy: -49.223 flat angles C4'-P-C4' energy: -45.824 flat angles P-C4'-P energy: -25.800 tors. eta vs tors. theta energy: -39.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -547.040750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.040750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.040750 (E_RNA) where: Base-Base interactions energy: -331.808 where: short stacking energy: -159.098 Base-Backbone interact. energy: -0.851 local terms energy: -214.381440 where: bonds (distance) C4'-P energy: -42.631 bonds (distance) P-C4' energy: -39.671 flat angles C4'-P-C4' energy: -46.421 flat angles P-C4'-P energy: -35.575 tors. eta vs tors. theta energy: -50.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -349.995484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.995484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.995484 (E_RNA) where: Base-Base interactions energy: -181.055 where: short stacking energy: -103.974 Base-Backbone interact. energy: -3.378 local terms energy: -165.562360 where: bonds (distance) C4'-P energy: -40.874 bonds (distance) P-C4' energy: -49.709 flat angles C4'-P-C4' energy: -37.319 flat angles P-C4'-P energy: -26.688 tors. eta vs tors. theta energy: -10.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -235.620789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.620789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.620789 (E_RNA) where: Base-Base interactions energy: -91.438 where: short stacking energy: -76.812 Base-Backbone interact. energy: -0.707 local terms energy: -143.476442 where: bonds (distance) C4'-P energy: -40.881 bonds (distance) P-C4' energy: -37.177 flat angles C4'-P-C4' energy: -36.497 flat angles P-C4'-P energy: -18.391 tors. eta vs tors. theta energy: -10.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -218.676892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.676892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.676892 (E_RNA) where: Base-Base interactions energy: -95.028 where: short stacking energy: -72.161 Base-Backbone interact. energy: -2.015 local terms energy: -121.634283 where: bonds (distance) C4'-P energy: -31.936 bonds (distance) P-C4' energy: -42.567 flat angles C4'-P-C4' energy: -40.697 flat angles P-C4'-P energy: -12.531 tors. eta vs tors. theta energy: 6.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -203.782659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.782659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.782659 (E_RNA) where: Base-Base interactions energy: -78.321 where: short stacking energy: -68.537 Base-Backbone interact. energy: 0.104 local terms energy: -125.565184 where: bonds (distance) C4'-P energy: -35.600 bonds (distance) P-C4' energy: -42.242 flat angles C4'-P-C4' energy: -36.430 flat angles P-C4'-P energy: -11.714 tors. eta vs tors. theta energy: 0.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -196.820966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.820966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.820966 (E_RNA) where: Base-Base interactions energy: -66.433 where: short stacking energy: -49.019 Base-Backbone interact. energy: -2.397 local terms energy: -127.990896 where: bonds (distance) C4'-P energy: -42.782 bonds (distance) P-C4' energy: -39.437 flat angles C4'-P-C4' energy: -32.512 flat angles P-C4'-P energy: -21.354 tors. eta vs tors. theta energy: 8.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -754.093388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.093388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.093388 (E_RNA) where: Base-Base interactions energy: -516.593 where: short stacking energy: -234.921 Base-Backbone interact. energy: -0.718 local terms energy: -236.782052 where: bonds (distance) C4'-P energy: -46.432 bonds (distance) P-C4' energy: -41.525 flat angles C4'-P-C4' energy: -52.316 flat angles P-C4'-P energy: -26.255 tors. eta vs tors. theta energy: -70.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -691.935047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.935047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.935047 (E_RNA) where: Base-Base interactions energy: -467.437 where: short stacking energy: -204.725 Base-Backbone interact. energy: 0.895 local terms energy: -225.393294 where: bonds (distance) C4'-P energy: -48.370 bonds (distance) P-C4' energy: -35.826 flat angles C4'-P-C4' energy: -45.573 flat angles P-C4'-P energy: -32.999 tors. eta vs tors. theta energy: -62.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -646.879312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.879312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.879312 (E_RNA) where: Base-Base interactions energy: -447.553 where: short stacking energy: -184.598 Base-Backbone interact. energy: -1.426 local terms energy: -197.900241 where: bonds (distance) C4'-P energy: -32.781 bonds (distance) P-C4' energy: -39.224 flat angles C4'-P-C4' energy: -50.774 flat angles P-C4'-P energy: -30.506 tors. eta vs tors. theta energy: -44.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -539.132216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.132216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.132216 (E_RNA) where: Base-Base interactions energy: -336.743 where: short stacking energy: -175.170 Base-Backbone interact. energy: -0.958 local terms energy: -201.431260 where: bonds (distance) C4'-P energy: -35.505 bonds (distance) P-C4' energy: -38.145 flat angles C4'-P-C4' energy: -48.162 flat angles P-C4'-P energy: -32.093 tors. eta vs tors. theta energy: -47.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -553.428833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.428833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.428833 (E_RNA) where: Base-Base interactions energy: -356.381 where: short stacking energy: -175.233 Base-Backbone interact. energy: -2.016 local terms energy: -195.031651 where: bonds (distance) C4'-P energy: -42.782 bonds (distance) P-C4' energy: -42.333 flat angles C4'-P-C4' energy: -41.492 flat angles P-C4'-P energy: -22.047 tors. eta vs tors. theta energy: -46.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -390.009094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.009094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.009094 (E_RNA) where: Base-Base interactions energy: -205.519 where: short stacking energy: -117.363 Base-Backbone interact. energy: -1.363 local terms energy: -183.127455 where: bonds (distance) C4'-P energy: -35.951 bonds (distance) P-C4' energy: -44.470 flat angles C4'-P-C4' energy: -44.896 flat angles P-C4'-P energy: -23.360 tors. eta vs tors. theta energy: -34.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -262.523480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.523480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.523480 (E_RNA) where: Base-Base interactions energy: -109.475 where: short stacking energy: -89.304 Base-Backbone interact. energy: -0.572 local terms energy: -152.476677 where: bonds (distance) C4'-P energy: -40.613 bonds (distance) P-C4' energy: -44.838 flat angles C4'-P-C4' energy: -34.835 flat angles P-C4'-P energy: -24.914 tors. eta vs tors. theta energy: -7.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -240.129012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.129012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.129012 (E_RNA) where: Base-Base interactions energy: -99.295 where: short stacking energy: -69.997 Base-Backbone interact. energy: -0.811 local terms energy: -140.023048 where: bonds (distance) C4'-P energy: -37.691 bonds (distance) P-C4' energy: -41.901 flat angles C4'-P-C4' energy: -32.199 flat angles P-C4'-P energy: -14.970 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -212.422559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.422559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.422559 (E_RNA) where: Base-Base interactions energy: -63.836 where: short stacking energy: -52.197 Base-Backbone interact. energy: 0.078 local terms energy: -148.664949 where: bonds (distance) C4'-P energy: -47.946 bonds (distance) P-C4' energy: -48.142 flat angles C4'-P-C4' energy: -27.963 flat angles P-C4'-P energy: -18.826 tors. eta vs tors. theta energy: -5.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -197.760171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.760171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.760171 (E_RNA) where: Base-Base interactions energy: -49.430 where: short stacking energy: -47.433 Base-Backbone interact. energy: 1.845 local terms energy: -150.174673 where: bonds (distance) C4'-P energy: -42.153 bonds (distance) P-C4' energy: -48.881 flat angles C4'-P-C4' energy: -39.165 flat angles P-C4'-P energy: -28.129 tors. eta vs tors. theta energy: 8.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -736.462457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.462457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.462457 (E_RNA) where: Base-Base interactions energy: -486.982 where: short stacking energy: -205.509 Base-Backbone interact. energy: -0.782 local terms energy: -248.698592 where: bonds (distance) C4'-P energy: -45.737 bonds (distance) P-C4' energy: -46.261 flat angles C4'-P-C4' energy: -54.124 flat angles P-C4'-P energy: -39.155 tors. eta vs tors. theta energy: -63.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -731.940534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.940534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.940534 (E_RNA) where: Base-Base interactions energy: -480.940 where: short stacking energy: -215.827 Base-Backbone interact. energy: -0.483 local terms energy: -250.517516 where: bonds (distance) C4'-P energy: -46.313 bonds (distance) P-C4' energy: -49.011 flat angles C4'-P-C4' energy: -48.073 flat angles P-C4'-P energy: -38.510 tors. eta vs tors. theta energy: -68.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -625.975980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.975980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.975980 (E_RNA) where: Base-Base interactions energy: -428.238 where: short stacking energy: -172.855 Base-Backbone interact. energy: -1.297 local terms energy: -196.441169 where: bonds (distance) C4'-P energy: -37.220 bonds (distance) P-C4' energy: -45.514 flat angles C4'-P-C4' energy: -39.460 flat angles P-C4'-P energy: -27.980 tors. eta vs tors. theta energy: -46.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -542.897611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.897611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.897611 (E_RNA) where: Base-Base interactions energy: -354.744 where: short stacking energy: -153.591 Base-Backbone interact. energy: 0.292 local terms energy: -188.445883 where: bonds (distance) C4'-P energy: -32.409 bonds (distance) P-C4' energy: -47.499 flat angles C4'-P-C4' energy: -46.171 flat angles P-C4'-P energy: -27.292 tors. eta vs tors. theta energy: -35.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -492.945586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.945586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.945586 (E_RNA) where: Base-Base interactions energy: -291.465 where: short stacking energy: -132.285 Base-Backbone interact. energy: -0.580 local terms energy: -200.901285 where: bonds (distance) C4'-P energy: -40.907 bonds (distance) P-C4' energy: -42.687 flat angles C4'-P-C4' energy: -46.110 flat angles P-C4'-P energy: -32.491 tors. eta vs tors. theta energy: -38.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -356.990368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.990368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.990368 (E_RNA) where: Base-Base interactions energy: -188.872 where: short stacking energy: -101.993 Base-Backbone interact. energy: -1.715 local terms energy: -166.403369 where: bonds (distance) C4'-P energy: -41.461 bonds (distance) P-C4' energy: -45.460 flat angles C4'-P-C4' energy: -36.448 flat angles P-C4'-P energy: -29.730 tors. eta vs tors. theta energy: -13.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -288.111346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.111346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.111346 (E_RNA) where: Base-Base interactions energy: -133.950 where: short stacking energy: -80.613 Base-Backbone interact. energy: -0.852 local terms energy: -153.309644 where: bonds (distance) C4'-P energy: -28.204 bonds (distance) P-C4' energy: -38.639 flat angles C4'-P-C4' energy: -40.321 flat angles P-C4'-P energy: -30.333 tors. eta vs tors. theta energy: -15.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -241.361000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.361000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.361000 (E_RNA) where: Base-Base interactions energy: -94.932 where: short stacking energy: -83.545 Base-Backbone interact. energy: -0.601 local terms energy: -145.828234 where: bonds (distance) C4'-P energy: -29.571 bonds (distance) P-C4' energy: -44.623 flat angles C4'-P-C4' energy: -40.766 flat angles P-C4'-P energy: -29.690 tors. eta vs tors. theta energy: -1.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -213.607092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.607092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.607092 (E_RNA) where: Base-Base interactions energy: -92.861 where: short stacking energy: -64.918 Base-Backbone interact. energy: 3.322 local terms energy: -124.067448 where: bonds (distance) C4'-P energy: -41.397 bonds (distance) P-C4' energy: -34.137 flat angles C4'-P-C4' energy: -41.887 flat angles P-C4'-P energy: -14.110 tors. eta vs tors. theta energy: 7.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -187.672136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.672136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.672136 (E_RNA) where: Base-Base interactions energy: -48.331 where: short stacking energy: -42.578 Base-Backbone interact. energy: -0.519 local terms energy: -138.821852 where: bonds (distance) C4'-P energy: -44.945 bonds (distance) P-C4' energy: -44.300 flat angles C4'-P-C4' energy: -30.013 flat angles P-C4'-P energy: -23.129 tors. eta vs tors. theta energy: 3.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -754.703599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.703599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.703599 (E_RNA) where: Base-Base interactions energy: -503.018 where: short stacking energy: -207.948 Base-Backbone interact. energy: -0.419 local terms energy: -251.266442 where: bonds (distance) C4'-P energy: -49.007 bonds (distance) P-C4' energy: -42.992 flat angles C4'-P-C4' energy: -57.150 flat angles P-C4'-P energy: -36.066 tors. eta vs tors. theta energy: -66.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -725.154002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.154002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.154002 (E_RNA) where: Base-Base interactions energy: -486.721 where: short stacking energy: -210.408 Base-Backbone interact. energy: -0.416 local terms energy: -238.016899 where: bonds (distance) C4'-P energy: -46.002 bonds (distance) P-C4' energy: -38.161 flat angles C4'-P-C4' energy: -50.057 flat angles P-C4'-P energy: -34.207 tors. eta vs tors. theta energy: -69.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -636.401151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.401151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.401151 (E_RNA) where: Base-Base interactions energy: -416.712 where: short stacking energy: -182.690 Base-Backbone interact. energy: 1.666 local terms energy: -221.355017 where: bonds (distance) C4'-P energy: -44.476 bonds (distance) P-C4' energy: -48.811 flat angles C4'-P-C4' energy: -49.834 flat angles P-C4'-P energy: -28.160 tors. eta vs tors. theta energy: -50.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -558.520570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.520570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.520570 (E_RNA) where: Base-Base interactions energy: -337.815 where: short stacking energy: -160.710 Base-Backbone interact. energy: -1.345 local terms energy: -219.361126 where: bonds (distance) C4'-P energy: -47.952 bonds (distance) P-C4' energy: -40.956 flat angles C4'-P-C4' energy: -48.292 flat angles P-C4'-P energy: -37.989 tors. eta vs tors. theta energy: -44.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -536.620979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.620979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.620979 (E_RNA) where: Base-Base interactions energy: -333.761 where: short stacking energy: -163.560 Base-Backbone interact. energy: -1.603 local terms energy: -201.256487 where: bonds (distance) C4'-P energy: -40.086 bonds (distance) P-C4' energy: -34.687 flat angles C4'-P-C4' energy: -43.354 flat angles P-C4'-P energy: -34.475 tors. eta vs tors. theta energy: -48.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -380.605440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.605440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.605440 (E_RNA) where: Base-Base interactions energy: -197.989 where: short stacking energy: -121.567 Base-Backbone interact. energy: -0.450 local terms energy: -182.166255 where: bonds (distance) C4'-P energy: -42.938 bonds (distance) P-C4' energy: -38.503 flat angles C4'-P-C4' energy: -42.767 flat angles P-C4'-P energy: -29.689 tors. eta vs tors. theta energy: -28.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -279.247511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.247511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.247511 (E_RNA) where: Base-Base interactions energy: -138.751 where: short stacking energy: -64.717 Base-Backbone interact. energy: -0.980 local terms energy: -139.516395 where: bonds (distance) C4'-P energy: -37.491 bonds (distance) P-C4' energy: -32.759 flat angles C4'-P-C4' energy: -42.494 flat angles P-C4'-P energy: -29.955 tors. eta vs tors. theta energy: 3.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -206.546800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.546800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.546800 (E_RNA) where: Base-Base interactions energy: -71.239 where: short stacking energy: -61.403 Base-Backbone interact. energy: -0.639 local terms energy: -134.668642 where: bonds (distance) C4'-P energy: -38.739 bonds (distance) P-C4' energy: -42.884 flat angles C4'-P-C4' energy: -42.305 flat angles P-C4'-P energy: -14.436 tors. eta vs tors. theta energy: 3.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -196.419149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.419149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.419149 (E_RNA) where: Base-Base interactions energy: -65.059 where: short stacking energy: -57.733 Base-Backbone interact. energy: -0.889 local terms energy: -130.470764 where: bonds (distance) C4'-P energy: -36.307 bonds (distance) P-C4' energy: -41.566 flat angles C4'-P-C4' energy: -33.796 flat angles P-C4'-P energy: -18.164 tors. eta vs tors. theta energy: -0.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -176.488486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.488486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.488486 (E_RNA) where: Base-Base interactions energy: -58.432 where: short stacking energy: -54.167 Base-Backbone interact. energy: 5.882 local terms energy: -123.938969 where: bonds (distance) C4'-P energy: -29.036 bonds (distance) P-C4' energy: -53.647 flat angles C4'-P-C4' energy: -28.916 flat angles P-C4'-P energy: -17.029 tors. eta vs tors. theta energy: 4.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -742.634796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.634796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.634796 (E_RNA) where: Base-Base interactions energy: -492.997 where: short stacking energy: -219.209 Base-Backbone interact. energy: -0.203 local terms energy: -249.435199 where: bonds (distance) C4'-P energy: -49.689 bonds (distance) P-C4' energy: -47.859 flat angles C4'-P-C4' energy: -48.782 flat angles P-C4'-P energy: -33.334 tors. eta vs tors. theta energy: -69.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -712.520347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.520347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.520347 (E_RNA) where: Base-Base interactions energy: -470.075 where: short stacking energy: -201.606 Base-Backbone interact. energy: -0.353 local terms energy: -242.093129 where: bonds (distance) C4'-P energy: -44.431 bonds (distance) P-C4' energy: -47.014 flat angles C4'-P-C4' energy: -47.175 flat angles P-C4'-P energy: -36.242 tors. eta vs tors. theta energy: -67.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -650.170770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.170770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.170770 (E_RNA) where: Base-Base interactions energy: -420.459 where: short stacking energy: -201.910 Base-Backbone interact. energy: -0.689 local terms energy: -229.022136 where: bonds (distance) C4'-P energy: -39.574 bonds (distance) P-C4' energy: -51.868 flat angles C4'-P-C4' energy: -48.714 flat angles P-C4'-P energy: -35.348 tors. eta vs tors. theta energy: -53.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -571.294771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.294771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.294771 (E_RNA) where: Base-Base interactions energy: -371.626 where: short stacking energy: -164.986 Base-Backbone interact. energy: 1.859 local terms energy: -201.527779 where: bonds (distance) C4'-P energy: -39.009 bonds (distance) P-C4' energy: -41.222 flat angles C4'-P-C4' energy: -48.033 flat angles P-C4'-P energy: -23.779 tors. eta vs tors. theta energy: -49.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -513.540732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.540732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.540732 (E_RNA) where: Base-Base interactions energy: -316.684 where: short stacking energy: -153.592 Base-Backbone interact. energy: -0.216 local terms energy: -196.640965 where: bonds (distance) C4'-P energy: -40.891 bonds (distance) P-C4' energy: -48.395 flat angles C4'-P-C4' energy: -40.267 flat angles P-C4'-P energy: -28.170 tors. eta vs tors. theta energy: -38.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -357.773877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.773877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.773877 (E_RNA) where: Base-Base interactions energy: -179.948 where: short stacking energy: -103.130 Base-Backbone interact. energy: -2.546 local terms energy: -175.279678 where: bonds (distance) C4'-P energy: -44.008 bonds (distance) P-C4' energy: -42.062 flat angles C4'-P-C4' energy: -42.446 flat angles P-C4'-P energy: -28.996 tors. eta vs tors. theta energy: -17.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -277.001019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.001019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.001019 (E_RNA) where: Base-Base interactions energy: -113.532 where: short stacking energy: -73.625 Base-Backbone interact. energy: 0.119 local terms energy: -163.588309 where: bonds (distance) C4'-P energy: -47.511 bonds (distance) P-C4' energy: -41.025 flat angles C4'-P-C4' energy: -39.280 flat angles P-C4'-P energy: -24.876 tors. eta vs tors. theta energy: -10.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -226.032565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.032565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.032565 (E_RNA) where: Base-Base interactions energy: -87.035 where: short stacking energy: -71.445 Base-Backbone interact. energy: -1.676 local terms energy: -137.321790 where: bonds (distance) C4'-P energy: -41.161 bonds (distance) P-C4' energy: -49.409 flat angles C4'-P-C4' energy: -27.686 flat angles P-C4'-P energy: -22.355 tors. eta vs tors. theta energy: 3.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -207.821558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.821558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.821558 (E_RNA) where: Base-Base interactions energy: -69.752 where: short stacking energy: -71.607 Base-Backbone interact. energy: -1.072 local terms energy: -136.997581 where: bonds (distance) C4'-P energy: -40.084 bonds (distance) P-C4' energy: -39.629 flat angles C4'-P-C4' energy: -29.298 flat angles P-C4'-P energy: -26.302 tors. eta vs tors. theta energy: -1.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -191.763025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.763025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.763025 (E_RNA) where: Base-Base interactions energy: -60.075 where: short stacking energy: -41.447 Base-Backbone interact. energy: -1.618 local terms energy: -130.069896 where: bonds (distance) C4'-P energy: -38.447 bonds (distance) P-C4' energy: -42.024 flat angles C4'-P-C4' energy: -36.271 flat angles P-C4'-P energy: -20.028 tors. eta vs tors. theta energy: 6.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -753.323333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.323333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.323333 (E_RNA) where: Base-Base interactions energy: -501.301 where: short stacking energy: -226.100 Base-Backbone interact. energy: 1.542 local terms energy: -253.563859 where: bonds (distance) C4'-P energy: -45.830 bonds (distance) P-C4' energy: -48.278 flat angles C4'-P-C4' energy: -53.629 flat angles P-C4'-P energy: -34.544 tors. eta vs tors. theta energy: -71.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -696.075528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.075528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.075528 (E_RNA) where: Base-Base interactions energy: -465.955 where: short stacking energy: -194.604 Base-Backbone interact. energy: -0.485 local terms energy: -229.635889 where: bonds (distance) C4'-P energy: -46.778 bonds (distance) P-C4' energy: -41.143 flat angles C4'-P-C4' energy: -48.292 flat angles P-C4'-P energy: -31.080 tors. eta vs tors. theta energy: -62.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -695.451489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.451489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.451489 (E_RNA) where: Base-Base interactions energy: -473.415 where: short stacking energy: -201.045 Base-Backbone interact. energy: -0.859 local terms energy: -221.177893 where: bonds (distance) C4'-P energy: -39.897 bonds (distance) P-C4' energy: -45.635 flat angles C4'-P-C4' energy: -49.144 flat angles P-C4'-P energy: -33.207 tors. eta vs tors. theta energy: -53.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -591.235680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.235680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.235680 (E_RNA) where: Base-Base interactions energy: -373.885 where: short stacking energy: -175.724 Base-Backbone interact. energy: -0.797 local terms energy: -216.553999 where: bonds (distance) C4'-P energy: -40.229 bonds (distance) P-C4' energy: -41.049 flat angles C4'-P-C4' energy: -46.500 flat angles P-C4'-P energy: -30.952 tors. eta vs tors. theta energy: -57.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -512.604941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.604941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.604941 (E_RNA) where: Base-Base interactions energy: -307.933 where: short stacking energy: -164.306 Base-Backbone interact. energy: -0.443 local terms energy: -204.228520 where: bonds (distance) C4'-P energy: -45.051 bonds (distance) P-C4' energy: -41.994 flat angles C4'-P-C4' energy: -47.187 flat angles P-C4'-P energy: -30.732 tors. eta vs tors. theta energy: -39.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -379.574829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.574829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.574829 (E_RNA) where: Base-Base interactions energy: -207.876 where: short stacking energy: -90.979 Base-Backbone interact. energy: 0.125 local terms energy: -171.823313 where: bonds (distance) C4'-P energy: -36.001 bonds (distance) P-C4' energy: -39.996 flat angles C4'-P-C4' energy: -48.073 flat angles P-C4'-P energy: -29.329 tors. eta vs tors. theta energy: -18.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -288.708970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.708970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.708970 (E_RNA) where: Base-Base interactions energy: -146.386 where: short stacking energy: -71.225 Base-Backbone interact. energy: -0.167 local terms energy: -142.155887 where: bonds (distance) C4'-P energy: -36.774 bonds (distance) P-C4' energy: -45.083 flat angles C4'-P-C4' energy: -36.001 flat angles P-C4'-P energy: -13.002 tors. eta vs tors. theta energy: -11.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -229.357312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.357312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.357312 (E_RNA) where: Base-Base interactions energy: -81.150 where: short stacking energy: -57.917 Base-Backbone interact. energy: -0.789 local terms energy: -147.417510 where: bonds (distance) C4'-P energy: -45.083 bonds (distance) P-C4' energy: -35.180 flat angles C4'-P-C4' energy: -39.776 flat angles P-C4'-P energy: -15.740 tors. eta vs tors. theta energy: -11.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -210.268903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.268903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.268903 (E_RNA) where: Base-Base interactions energy: -71.544 where: short stacking energy: -51.415 Base-Backbone interact. energy: 1.832 local terms energy: -140.556980 where: bonds (distance) C4'-P energy: -39.328 bonds (distance) P-C4' energy: -45.455 flat angles C4'-P-C4' energy: -29.958 flat angles P-C4'-P energy: -17.603 tors. eta vs tors. theta energy: -8.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -200.902017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.902017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.902017 (E_RNA) where: Base-Base interactions energy: -60.633 where: short stacking energy: -53.358 Base-Backbone interact. energy: 0.391 local terms energy: -140.660362 where: bonds (distance) C4'-P energy: -43.620 bonds (distance) P-C4' energy: -43.227 flat angles C4'-P-C4' energy: -28.362 flat angles P-C4'-P energy: -21.334 tors. eta vs tors. theta energy: -4.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -777.624952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.624952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.624952 (E_RNA) where: Base-Base interactions energy: -518.555 where: short stacking energy: -243.445 Base-Backbone interact. energy: -0.036 local terms energy: -259.033990 where: bonds (distance) C4'-P energy: -50.255 bonds (distance) P-C4' energy: -50.135 flat angles C4'-P-C4' energy: -50.309 flat angles P-C4'-P energy: -33.233 tors. eta vs tors. theta energy: -75.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -722.474552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.474552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.474552 (E_RNA) where: Base-Base interactions energy: -481.889 where: short stacking energy: -211.443 Base-Backbone interact. energy: -0.301 local terms energy: -240.284544 where: bonds (distance) C4'-P energy: -44.093 bonds (distance) P-C4' energy: -48.428 flat angles C4'-P-C4' energy: -52.128 flat angles P-C4'-P energy: -30.788 tors. eta vs tors. theta energy: -64.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -671.927561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.927561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.927561 (E_RNA) where: Base-Base interactions energy: -450.414 where: short stacking energy: -184.524 Base-Backbone interact. energy: -1.132 local terms energy: -220.381152 where: bonds (distance) C4'-P energy: -45.015 bonds (distance) P-C4' energy: -53.280 flat angles C4'-P-C4' energy: -47.997 flat angles P-C4'-P energy: -21.977 tors. eta vs tors. theta energy: -52.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -594.690496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.690496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.690496 (E_RNA) where: Base-Base interactions energy: -376.313 where: short stacking energy: -183.570 Base-Backbone interact. energy: -0.267 local terms energy: -218.110187 where: bonds (distance) C4'-P energy: -33.579 bonds (distance) P-C4' energy: -44.429 flat angles C4'-P-C4' energy: -50.059 flat angles P-C4'-P energy: -33.314 tors. eta vs tors. theta energy: -56.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -507.540989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.540989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.540989 (E_RNA) where: Base-Base interactions energy: -317.045 where: short stacking energy: -153.276 Base-Backbone interact. energy: -0.998 local terms energy: -189.498296 where: bonds (distance) C4'-P energy: -37.067 bonds (distance) P-C4' energy: -46.151 flat angles C4'-P-C4' energy: -42.201 flat angles P-C4'-P energy: -30.155 tors. eta vs tors. theta energy: -33.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -416.921119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.921119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.921119 (E_RNA) where: Base-Base interactions energy: -234.932 where: short stacking energy: -122.105 Base-Backbone interact. energy: -1.847 local terms energy: -180.142281 where: bonds (distance) C4'-P energy: -39.813 bonds (distance) P-C4' energy: -42.180 flat angles C4'-P-C4' energy: -42.455 flat angles P-C4'-P energy: -29.997 tors. eta vs tors. theta energy: -25.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -310.966073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.966073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.966073 (E_RNA) where: Base-Base interactions energy: -144.927 where: short stacking energy: -100.119 Base-Backbone interact. energy: -2.428 local terms energy: -163.611962 where: bonds (distance) C4'-P energy: -36.904 bonds (distance) P-C4' energy: -43.435 flat angles C4'-P-C4' energy: -39.025 flat angles P-C4'-P energy: -28.558 tors. eta vs tors. theta energy: -15.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -220.714978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.714978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.714978 (E_RNA) where: Base-Base interactions energy: -84.339 where: short stacking energy: -83.004 Base-Backbone interact. energy: -0.749 local terms energy: -135.627576 where: bonds (distance) C4'-P energy: -39.021 bonds (distance) P-C4' energy: -41.488 flat angles C4'-P-C4' energy: -30.636 flat angles P-C4'-P energy: -21.684 tors. eta vs tors. theta energy: -2.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -211.629921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.629921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.629921 (E_RNA) where: Base-Base interactions energy: -74.096 where: short stacking energy: -65.277 Base-Backbone interact. energy: 1.113 local terms energy: -138.646727 where: bonds (distance) C4'-P energy: -31.023 bonds (distance) P-C4' energy: -45.842 flat angles C4'-P-C4' energy: -24.904 flat angles P-C4'-P energy: -30.184 tors. eta vs tors. theta energy: -6.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -186.653762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.653762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.653762 (E_RNA) where: Base-Base interactions energy: -58.753 where: short stacking energy: -57.133 Base-Backbone interact. energy: 0.892 local terms energy: -128.792559 where: bonds (distance) C4'-P energy: -41.470 bonds (distance) P-C4' energy: -44.798 flat angles C4'-P-C4' energy: -31.270 flat angles P-C4'-P energy: -12.476 tors. eta vs tors. theta energy: 1.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -779.043039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.043039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.043039 (E_RNA) where: Base-Base interactions energy: -532.469 where: short stacking energy: -234.185 Base-Backbone interact. energy: -0.556 local terms energy: -246.017413 where: bonds (distance) C4'-P energy: -43.259 bonds (distance) P-C4' energy: -46.920 flat angles C4'-P-C4' energy: -51.599 flat angles P-C4'-P energy: -29.453 tors. eta vs tors. theta energy: -74.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -752.162806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.162806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.162806 (E_RNA) where: Base-Base interactions energy: -508.391 where: short stacking energy: -222.155 Base-Backbone interact. energy: -1.778 local terms energy: -241.993938 where: bonds (distance) C4'-P energy: -42.850 bonds (distance) P-C4' energy: -48.519 flat angles C4'-P-C4' energy: -49.645 flat angles P-C4'-P energy: -30.809 tors. eta vs tors. theta energy: -70.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -658.219738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.219738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.219738 (E_RNA) where: Base-Base interactions energy: -439.183 where: short stacking energy: -180.450 Base-Backbone interact. energy: -1.931 local terms energy: -217.105454 where: bonds (distance) C4'-P energy: -36.990 bonds (distance) P-C4' energy: -41.860 flat angles C4'-P-C4' energy: -52.081 flat angles P-C4'-P energy: -30.923 tors. eta vs tors. theta energy: -55.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -585.131716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.131716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.131716 (E_RNA) where: Base-Base interactions energy: -377.521 where: short stacking energy: -179.698 Base-Backbone interact. energy: -1.590 local terms energy: -206.020599 where: bonds (distance) C4'-P energy: -45.056 bonds (distance) P-C4' energy: -35.836 flat angles C4'-P-C4' energy: -45.330 flat angles P-C4'-P energy: -31.185 tors. eta vs tors. theta energy: -48.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -510.343044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.343044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.343044 (E_RNA) where: Base-Base interactions energy: -314.843 where: short stacking energy: -163.367 Base-Backbone interact. energy: -1.421 local terms energy: -194.079512 where: bonds (distance) C4'-P energy: -43.265 bonds (distance) P-C4' energy: -38.546 flat angles C4'-P-C4' energy: -38.074 flat angles P-C4'-P energy: -31.937 tors. eta vs tors. theta energy: -42.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -419.709665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.709665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.709665 (E_RNA) where: Base-Base interactions energy: -240.312 where: short stacking energy: -126.134 Base-Backbone interact. energy: -1.311 local terms energy: -178.086847 where: bonds (distance) C4'-P energy: -42.937 bonds (distance) P-C4' energy: -43.817 flat angles C4'-P-C4' energy: -41.033 flat angles P-C4'-P energy: -26.486 tors. eta vs tors. theta energy: -23.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -327.488001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.488001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.488001 (E_RNA) where: Base-Base interactions energy: -172.707 where: short stacking energy: -100.846 Base-Backbone interact. energy: -0.475 local terms energy: -154.305412 where: bonds (distance) C4'-P energy: -29.149 bonds (distance) P-C4' energy: -46.568 flat angles C4'-P-C4' energy: -42.524 flat angles P-C4'-P energy: -20.679 tors. eta vs tors. theta energy: -15.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -222.254992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.254992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.254992 (E_RNA) where: Base-Base interactions energy: -95.335 where: short stacking energy: -72.471 Base-Backbone interact. energy: -0.743 local terms energy: -126.177518 where: bonds (distance) C4'-P energy: -31.595 bonds (distance) P-C4' energy: -37.932 flat angles C4'-P-C4' energy: -32.245 flat angles P-C4'-P energy: -23.390 tors. eta vs tors. theta energy: -1.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -210.834081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.834081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.834081 (E_RNA) where: Base-Base interactions energy: -71.128 where: short stacking energy: -62.491 Base-Backbone interact. energy: 0.817 local terms energy: -140.523743 where: bonds (distance) C4'-P energy: -46.692 bonds (distance) P-C4' energy: -40.590 flat angles C4'-P-C4' energy: -27.383 flat angles P-C4'-P energy: -25.832 tors. eta vs tors. theta energy: -0.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -188.972046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.972046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.972046 (E_RNA) where: Base-Base interactions energy: -56.876 where: short stacking energy: -56.823 Base-Backbone interact. energy: 1.736 local terms energy: -133.831834 where: bonds (distance) C4'-P energy: -38.782 bonds (distance) P-C4' energy: -44.917 flat angles C4'-P-C4' energy: -38.540 flat angles P-C4'-P energy: -13.243 tors. eta vs tors. theta energy: 1.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -794.868700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.868700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.868700 (E_RNA) where: Base-Base interactions energy: -543.637 where: short stacking energy: -223.045 Base-Backbone interact. energy: -0.390 local terms energy: -250.842414 where: bonds (distance) C4'-P energy: -38.441 bonds (distance) P-C4' energy: -49.972 flat angles C4'-P-C4' energy: -52.768 flat angles P-C4'-P energy: -33.296 tors. eta vs tors. theta energy: -76.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -735.296411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.296411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.296411 (E_RNA) where: Base-Base interactions energy: -510.769 where: short stacking energy: -209.951 Base-Backbone interact. energy: -0.799 local terms energy: -223.728832 where: bonds (distance) C4'-P energy: -38.672 bonds (distance) P-C4' energy: -48.162 flat angles C4'-P-C4' energy: -43.087 flat angles P-C4'-P energy: -31.144 tors. eta vs tors. theta energy: -62.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -659.438415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.438415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.438415 (E_RNA) where: Base-Base interactions energy: -459.670 where: short stacking energy: -188.118 Base-Backbone interact. energy: 1.646 local terms energy: -201.414559 where: bonds (distance) C4'-P energy: -40.382 bonds (distance) P-C4' energy: -35.106 flat angles C4'-P-C4' energy: -49.564 flat angles P-C4'-P energy: -24.223 tors. eta vs tors. theta energy: -52.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -573.812895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.812895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.812895 (E_RNA) where: Base-Base interactions energy: -358.716 where: short stacking energy: -181.881 Base-Backbone interact. energy: -0.529 local terms energy: -214.567903 where: bonds (distance) C4'-P energy: -43.968 bonds (distance) P-C4' energy: -50.950 flat angles C4'-P-C4' energy: -42.264 flat angles P-C4'-P energy: -25.367 tors. eta vs tors. theta energy: -52.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -521.445216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.445216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.445216 (E_RNA) where: Base-Base interactions energy: -333.828 where: short stacking energy: -161.130 Base-Backbone interact. energy: -1.459 local terms energy: -186.157531 where: bonds (distance) C4'-P energy: -31.818 bonds (distance) P-C4' energy: -40.008 flat angles C4'-P-C4' energy: -39.720 flat angles P-C4'-P energy: -29.339 tors. eta vs tors. theta energy: -45.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -401.804558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.804558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.804558 (E_RNA) where: Base-Base interactions energy: -215.457 where: short stacking energy: -114.247 Base-Backbone interact. energy: 0.294 local terms energy: -186.641731 where: bonds (distance) C4'-P energy: -42.687 bonds (distance) P-C4' energy: -47.655 flat angles C4'-P-C4' energy: -39.663 flat angles P-C4'-P energy: -30.606 tors. eta vs tors. theta energy: -26.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -318.428931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.428931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.428931 (E_RNA) where: Base-Base interactions energy: -155.888 where: short stacking energy: -103.977 Base-Backbone interact. energy: 1.059 local terms energy: -163.599976 where: bonds (distance) C4'-P energy: -42.811 bonds (distance) P-C4' energy: -40.154 flat angles C4'-P-C4' energy: -32.071 flat angles P-C4'-P energy: -27.343 tors. eta vs tors. theta energy: -21.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -218.638180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.638180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.638180 (E_RNA) where: Base-Base interactions energy: -76.743 where: short stacking energy: -62.815 Base-Backbone interact. energy: -0.824 local terms energy: -141.071189 where: bonds (distance) C4'-P energy: -29.366 bonds (distance) P-C4' energy: -53.439 flat angles C4'-P-C4' energy: -33.315 flat angles P-C4'-P energy: -24.955 tors. eta vs tors. theta energy: 0.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -196.699359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.699359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.699359 (E_RNA) where: Base-Base interactions energy: -68.825 where: short stacking energy: -52.723 Base-Backbone interact. energy: -0.805 local terms energy: -127.068861 where: bonds (distance) C4'-P energy: -32.404 bonds (distance) P-C4' energy: -44.262 flat angles C4'-P-C4' energy: -37.408 flat angles P-C4'-P energy: -18.977 tors. eta vs tors. theta energy: 5.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -182.810330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.810330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.810330 (E_RNA) where: Base-Base interactions energy: -51.720 where: short stacking energy: -37.306 Base-Backbone interact. energy: 1.022 local terms energy: -132.112463 where: bonds (distance) C4'-P energy: -39.991 bonds (distance) P-C4' energy: -50.165 flat angles C4'-P-C4' energy: -40.791 flat angles P-C4'-P energy: -13.886 tors. eta vs tors. theta energy: 12.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -789.832238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.832238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.832238 (E_RNA) where: Base-Base interactions energy: -529.735 where: short stacking energy: -229.905 Base-Backbone interact. energy: -0.123 local terms energy: -259.973305 where: bonds (distance) C4'-P energy: -51.039 bonds (distance) P-C4' energy: -53.221 flat angles C4'-P-C4' energy: -46.490 flat angles P-C4'-P energy: -37.178 tors. eta vs tors. theta energy: -72.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -727.472928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.472928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.472928 (E_RNA) where: Base-Base interactions energy: -505.490 where: short stacking energy: -214.165 Base-Backbone interact. energy: -0.644 local terms energy: -221.338974 where: bonds (distance) C4'-P energy: -38.193 bonds (distance) P-C4' energy: -45.159 flat angles C4'-P-C4' energy: -46.946 flat angles P-C4'-P energy: -26.351 tors. eta vs tors. theta energy: -64.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -655.366328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.366328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.366328 (E_RNA) where: Base-Base interactions energy: -446.178 where: short stacking energy: -190.653 Base-Backbone interact. energy: -1.618 local terms energy: -207.569773 where: bonds (distance) C4'-P energy: -38.701 bonds (distance) P-C4' energy: -45.402 flat angles C4'-P-C4' energy: -44.435 flat angles P-C4'-P energy: -29.613 tors. eta vs tors. theta energy: -49.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -594.675307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.675307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.675307 (E_RNA) where: Base-Base interactions energy: -369.753 where: short stacking energy: -195.492 Base-Backbone interact. energy: 2.359 local terms energy: -227.281894 where: bonds (distance) C4'-P energy: -44.770 bonds (distance) P-C4' energy: -41.016 flat angles C4'-P-C4' energy: -45.667 flat angles P-C4'-P energy: -34.921 tors. eta vs tors. theta energy: -60.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -517.396523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.396523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.396523 (E_RNA) where: Base-Base interactions energy: -330.814 where: short stacking energy: -141.938 Base-Backbone interact. energy: -1.509 local terms energy: -185.072881 where: bonds (distance) C4'-P energy: -39.938 bonds (distance) P-C4' energy: -36.628 flat angles C4'-P-C4' energy: -43.801 flat angles P-C4'-P energy: -31.026 tors. eta vs tors. theta energy: -33.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -356.160588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.160588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.160588 (E_RNA) where: Base-Base interactions energy: -176.756 where: short stacking energy: -98.943 Base-Backbone interact. energy: -1.398 local terms energy: -178.006113 where: bonds (distance) C4'-P energy: -46.018 bonds (distance) P-C4' energy: -45.481 flat angles C4'-P-C4' energy: -41.188 flat angles P-C4'-P energy: -31.849 tors. eta vs tors. theta energy: -13.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -308.299551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.299551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.299551 (E_RNA) where: Base-Base interactions energy: -130.932 where: short stacking energy: -92.378 Base-Backbone interact. energy: -1.812 local terms energy: -175.556169 where: bonds (distance) C4'-P energy: -39.047 bonds (distance) P-C4' energy: -47.768 flat angles C4'-P-C4' energy: -44.733 flat angles P-C4'-P energy: -26.606 tors. eta vs tors. theta energy: -17.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -216.087837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.087837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.087837 (E_RNA) where: Base-Base interactions energy: -74.528 where: short stacking energy: -51.937 Base-Backbone interact. energy: -2.511 local terms energy: -139.049112 where: bonds (distance) C4'-P energy: -36.833 bonds (distance) P-C4' energy: -41.389 flat angles C4'-P-C4' energy: -39.552 flat angles P-C4'-P energy: -33.275 tors. eta vs tors. theta energy: 12.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -211.474846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.474846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.474846 (E_RNA) where: Base-Base interactions energy: -81.487 where: short stacking energy: -61.591 Base-Backbone interact. energy: 0.237 local terms energy: -130.224089 where: bonds (distance) C4'-P energy: -46.416 bonds (distance) P-C4' energy: -37.512 flat angles C4'-P-C4' energy: -26.868 flat angles P-C4'-P energy: -23.191 tors. eta vs tors. theta energy: 3.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -203.264474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.264474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.264474 (E_RNA) where: Base-Base interactions energy: -61.429 where: short stacking energy: -51.015 Base-Backbone interact. energy: -0.773 local terms energy: -141.062272 where: bonds (distance) C4'-P energy: -39.277 bonds (distance) P-C4' energy: -37.970 flat angles C4'-P-C4' energy: -38.476 flat angles P-C4'-P energy: -20.732 tors. eta vs tors. theta energy: -4.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -772.473878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.473878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.473878 (E_RNA) where: Base-Base interactions energy: -515.499 where: short stacking energy: -225.688 Base-Backbone interact. energy: -1.717 local terms energy: -255.257504 where: bonds (distance) C4'-P energy: -42.206 bonds (distance) P-C4' energy: -47.994 flat angles C4'-P-C4' energy: -55.837 flat angles P-C4'-P energy: -38.872 tors. eta vs tors. theta energy: -70.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -731.419432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.419432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.419432 (E_RNA) where: Base-Base interactions energy: -497.810 where: short stacking energy: -203.302 Base-Backbone interact. energy: -1.238 local terms energy: -232.371552 where: bonds (distance) C4'-P energy: -46.770 bonds (distance) P-C4' energy: -46.557 flat angles C4'-P-C4' energy: -47.216 flat angles P-C4'-P energy: -25.887 tors. eta vs tors. theta energy: -65.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -662.236518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.236518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.236518 (E_RNA) where: Base-Base interactions energy: -433.696 where: short stacking energy: -185.561 Base-Backbone interact. energy: -0.980 local terms energy: -227.560607 where: bonds (distance) C4'-P energy: -41.397 bonds (distance) P-C4' energy: -50.183 flat angles C4'-P-C4' energy: -40.836 flat angles P-C4'-P energy: -36.778 tors. eta vs tors. theta energy: -58.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -586.628980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.628980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.628980 (E_RNA) where: Base-Base interactions energy: -367.122 where: short stacking energy: -168.188 Base-Backbone interact. energy: -0.787 local terms energy: -218.720101 where: bonds (distance) C4'-P energy: -53.478 bonds (distance) P-C4' energy: -46.360 flat angles C4'-P-C4' energy: -43.882 flat angles P-C4'-P energy: -31.671 tors. eta vs tors. theta energy: -43.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -502.177931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.177931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.177931 (E_RNA) where: Base-Base interactions energy: -325.403 where: short stacking energy: -145.862 Base-Backbone interact. energy: -2.027 local terms energy: -174.747999 where: bonds (distance) C4'-P energy: -39.587 bonds (distance) P-C4' energy: -48.964 flat angles C4'-P-C4' energy: -36.550 flat angles P-C4'-P energy: -15.384 tors. eta vs tors. theta energy: -34.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -365.639592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.639592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.639592 (E_RNA) where: Base-Base interactions energy: -187.383 where: short stacking energy: -98.946 Base-Backbone interact. energy: -0.844 local terms energy: -177.412624 where: bonds (distance) C4'-P energy: -37.000 bonds (distance) P-C4' energy: -45.871 flat angles C4'-P-C4' energy: -42.167 flat angles P-C4'-P energy: -31.835 tors. eta vs tors. theta energy: -20.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -334.013996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.013996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.013996 (E_RNA) where: Base-Base interactions energy: -166.445 where: short stacking energy: -112.013 Base-Backbone interact. energy: -0.644 local terms energy: -166.924893 where: bonds (distance) C4'-P energy: -40.615 bonds (distance) P-C4' energy: -46.014 flat angles C4'-P-C4' energy: -43.607 flat angles P-C4'-P energy: -24.709 tors. eta vs tors. theta energy: -11.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -223.434544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.434544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.434544 (E_RNA) where: Base-Base interactions energy: -80.645 where: short stacking energy: -66.760 Base-Backbone interact. energy: -0.347 local terms energy: -142.443226 where: bonds (distance) C4'-P energy: -35.452 bonds (distance) P-C4' energy: -33.967 flat angles C4'-P-C4' energy: -34.654 flat angles P-C4'-P energy: -31.610 tors. eta vs tors. theta energy: -6.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -200.668710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.668710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.668710 (E_RNA) where: Base-Base interactions energy: -57.807 where: short stacking energy: -49.643 Base-Backbone interact. energy: -0.502 local terms energy: -142.359805 where: bonds (distance) C4'-P energy: -43.066 bonds (distance) P-C4' energy: -45.879 flat angles C4'-P-C4' energy: -32.921 flat angles P-C4'-P energy: -23.824 tors. eta vs tors. theta energy: 3.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -192.291749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.291749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.291749 (E_RNA) where: Base-Base interactions energy: -84.498 where: short stacking energy: -42.178 Base-Backbone interact. energy: -1.147 local terms energy: -106.646301 where: bonds (distance) C4'-P energy: -29.956 bonds (distance) P-C4' energy: -31.564 flat angles C4'-P-C4' energy: -36.943 flat angles P-C4'-P energy: -16.728 tors. eta vs tors. theta energy: 8.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -769.612565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.612565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.612565 (E_RNA) where: Base-Base interactions energy: -541.809 where: short stacking energy: -218.754 Base-Backbone interact. energy: -0.644 local terms energy: -227.159236 where: bonds (distance) C4'-P energy: -35.612 bonds (distance) P-C4' energy: -45.032 flat angles C4'-P-C4' energy: -48.307 flat angles P-C4'-P energy: -30.008 tors. eta vs tors. theta energy: -68.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -720.916271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.916271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.916271 (E_RNA) where: Base-Base interactions energy: -482.953 where: short stacking energy: -199.823 Base-Backbone interact. energy: -0.244 local terms energy: -237.719362 where: bonds (distance) C4'-P energy: -41.394 bonds (distance) P-C4' energy: -46.540 flat angles C4'-P-C4' energy: -51.110 flat angles P-C4'-P energy: -35.766 tors. eta vs tors. theta energy: -62.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -674.097035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.097035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.097035 (E_RNA) where: Base-Base interactions energy: -453.511 where: short stacking energy: -193.574 Base-Backbone interact. energy: -0.723 local terms energy: -219.863456 where: bonds (distance) C4'-P energy: -45.044 bonds (distance) P-C4' energy: -43.128 flat angles C4'-P-C4' energy: -43.038 flat angles P-C4'-P energy: -31.453 tors. eta vs tors. theta energy: -57.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -557.104574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.104574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.104574 (E_RNA) where: Base-Base interactions energy: -333.690 where: short stacking energy: -177.681 Base-Backbone interact. energy: -0.050 local terms energy: -223.363817 where: bonds (distance) C4'-P energy: -40.380 bonds (distance) P-C4' energy: -43.716 flat angles C4'-P-C4' energy: -49.536 flat angles P-C4'-P energy: -37.431 tors. eta vs tors. theta energy: -52.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -507.257235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.257235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.257235 (E_RNA) where: Base-Base interactions energy: -310.433 where: short stacking energy: -151.380 Base-Backbone interact. energy: -1.136 local terms energy: -195.688838 where: bonds (distance) C4'-P energy: -42.162 bonds (distance) P-C4' energy: -43.818 flat angles C4'-P-C4' energy: -34.505 flat angles P-C4'-P energy: -36.828 tors. eta vs tors. theta energy: -38.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -403.241629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.241629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.241629 (E_RNA) where: Base-Base interactions energy: -240.318 where: short stacking energy: -106.059 Base-Backbone interact. energy: 0.152 local terms energy: -163.075136 where: bonds (distance) C4'-P energy: -44.207 bonds (distance) P-C4' energy: -36.974 flat angles C4'-P-C4' energy: -27.715 flat angles P-C4'-P energy: -30.060 tors. eta vs tors. theta energy: -24.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -315.821182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.821182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.821182 (E_RNA) where: Base-Base interactions energy: -163.906 where: short stacking energy: -85.062 Base-Backbone interact. energy: -1.782 local terms energy: -150.133066 where: bonds (distance) C4'-P energy: -45.466 bonds (distance) P-C4' energy: -44.636 flat angles C4'-P-C4' energy: -37.090 flat angles P-C4'-P energy: -18.455 tors. eta vs tors. theta energy: -4.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -204.296523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.296523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.296523 (E_RNA) where: Base-Base interactions energy: -64.900 where: short stacking energy: -46.574 Base-Backbone interact. energy: -1.026 local terms energy: -138.370998 where: bonds (distance) C4'-P energy: -42.950 bonds (distance) P-C4' energy: -45.462 flat angles C4'-P-C4' energy: -36.830 flat angles P-C4'-P energy: -22.273 tors. eta vs tors. theta energy: 9.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -206.283430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.283430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.283430 (E_RNA) where: Base-Base interactions energy: -68.814 where: short stacking energy: -61.800 Base-Backbone interact. energy: 2.404 local terms energy: -139.872702 where: bonds (distance) C4'-P energy: -42.959 bonds (distance) P-C4' energy: -47.872 flat angles C4'-P-C4' energy: -29.416 flat angles P-C4'-P energy: -21.534 tors. eta vs tors. theta energy: 1.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -188.159422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.159422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.159422 (E_RNA) where: Base-Base interactions energy: -54.314 where: short stacking energy: -53.005 Base-Backbone interact. energy: -0.556 local terms energy: -133.289399 where: bonds (distance) C4'-P energy: -38.253 bonds (distance) P-C4' energy: -39.763 flat angles C4'-P-C4' energy: -41.375 flat angles P-C4'-P energy: -23.467 tors. eta vs tors. theta energy: 9.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -765.929461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.929461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.929461 (E_RNA) where: Base-Base interactions energy: -524.371 where: short stacking energy: -225.196 Base-Backbone interact. energy: -0.165 local terms energy: -241.393050 where: bonds (distance) C4'-P energy: -44.555 bonds (distance) P-C4' energy: -39.802 flat angles C4'-P-C4' energy: -52.116 flat angles P-C4'-P energy: -30.444 tors. eta vs tors. theta energy: -74.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -731.080029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.080029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.080029 (E_RNA) where: Base-Base interactions energy: -502.418 where: short stacking energy: -209.087 Base-Backbone interact. energy: -0.593 local terms energy: -228.068767 where: bonds (distance) C4'-P energy: -37.887 bonds (distance) P-C4' energy: -42.173 flat angles C4'-P-C4' energy: -46.870 flat angles P-C4'-P energy: -33.430 tors. eta vs tors. theta energy: -67.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -664.643013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.643013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.643013 (E_RNA) where: Base-Base interactions energy: -446.122 where: short stacking energy: -176.445 Base-Backbone interact. energy: -1.747 local terms energy: -216.773919 where: bonds (distance) C4'-P energy: -43.821 bonds (distance) P-C4' energy: -42.421 flat angles C4'-P-C4' energy: -44.029 flat angles P-C4'-P energy: -34.522 tors. eta vs tors. theta energy: -51.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -550.530599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.530599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.530599 (E_RNA) where: Base-Base interactions energy: -349.478 where: short stacking energy: -170.348 Base-Backbone interact. energy: -0.771 local terms energy: -200.281019 where: bonds (distance) C4'-P energy: -46.297 bonds (distance) P-C4' energy: -42.941 flat angles C4'-P-C4' energy: -45.673 flat angles P-C4'-P energy: -27.998 tors. eta vs tors. theta energy: -37.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -518.349350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.349350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.349350 (E_RNA) where: Base-Base interactions energy: -320.322 where: short stacking energy: -151.104 Base-Backbone interact. energy: -0.992 local terms energy: -197.034648 where: bonds (distance) C4'-P energy: -44.117 bonds (distance) P-C4' energy: -40.221 flat angles C4'-P-C4' energy: -47.458 flat angles P-C4'-P energy: -28.900 tors. eta vs tors. theta energy: -36.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -358.769954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.769954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.769954 (E_RNA) where: Base-Base interactions energy: -197.339 where: short stacking energy: -104.900 Base-Backbone interact. energy: 0.530 local terms energy: -161.961135 where: bonds (distance) C4'-P energy: -35.076 bonds (distance) P-C4' energy: -39.838 flat angles C4'-P-C4' energy: -47.728 flat angles P-C4'-P energy: -24.488 tors. eta vs tors. theta energy: -14.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -381.923047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.923047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.923047 (E_RNA) where: Base-Base interactions energy: -207.746 where: short stacking energy: -128.695 Base-Backbone interact. energy: -1.130 local terms energy: -173.046804 where: bonds (distance) C4'-P energy: -41.563 bonds (distance) P-C4' energy: -40.974 flat angles C4'-P-C4' energy: -37.252 flat angles P-C4'-P energy: -24.088 tors. eta vs tors. theta energy: -29.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -271.574427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.574427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.574427 (E_RNA) where: Base-Base interactions energy: -123.458 where: short stacking energy: -63.395 Base-Backbone interact. energy: -0.674 local terms energy: -147.442023 where: bonds (distance) C4'-P energy: -39.368 bonds (distance) P-C4' energy: -44.935 flat angles C4'-P-C4' energy: -41.279 flat angles P-C4'-P energy: -18.342 tors. eta vs tors. theta energy: -3.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -208.208588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.208588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.208588 (E_RNA) where: Base-Base interactions energy: -74.201 where: short stacking energy: -60.509 Base-Backbone interact. energy: 2.010 local terms energy: -136.017753 where: bonds (distance) C4'-P energy: -32.179 bonds (distance) P-C4' energy: -37.171 flat angles C4'-P-C4' energy: -34.444 flat angles P-C4'-P energy: -30.597 tors. eta vs tors. theta energy: -1.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -194.420797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.420797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.420797 (E_RNA) where: Base-Base interactions energy: -65.701 where: short stacking energy: -48.109 Base-Backbone interact. energy: -0.159 local terms energy: -128.560999 where: bonds (distance) C4'-P energy: -40.461 bonds (distance) P-C4' energy: -40.128 flat angles C4'-P-C4' energy: -29.697 flat angles P-C4'-P energy: -26.699 tors. eta vs tors. theta energy: 8.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -766.839707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.839707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.839707 (E_RNA) where: Base-Base interactions energy: -514.127 where: short stacking energy: -237.758 Base-Backbone interact. energy: 0.633 local terms energy: -253.345393 where: bonds (distance) C4'-P energy: -47.332 bonds (distance) P-C4' energy: -44.502 flat angles C4'-P-C4' energy: -54.680 flat angles P-C4'-P energy: -30.789 tors. eta vs tors. theta energy: -76.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -735.022151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.022151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.022151 (E_RNA) where: Base-Base interactions energy: -489.552 where: short stacking energy: -213.468 Base-Backbone interact. energy: -2.905 local terms energy: -242.564863 where: bonds (distance) C4'-P energy: -43.594 bonds (distance) P-C4' energy: -44.747 flat angles C4'-P-C4' energy: -50.440 flat angles P-C4'-P energy: -38.168 tors. eta vs tors. theta energy: -65.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -665.966322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.966322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.966322 (E_RNA) where: Base-Base interactions energy: -452.042 where: short stacking energy: -190.802 Base-Backbone interact. energy: -2.799 local terms energy: -211.125622 where: bonds (distance) C4'-P energy: -43.965 bonds (distance) P-C4' energy: -42.924 flat angles C4'-P-C4' energy: -45.216 flat angles P-C4'-P energy: -24.454 tors. eta vs tors. theta energy: -54.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -557.187618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.187618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.187618 (E_RNA) where: Base-Base interactions energy: -346.812 where: short stacking energy: -159.817 Base-Backbone interact. energy: -0.120 local terms energy: -210.255266 where: bonds (distance) C4'-P energy: -42.888 bonds (distance) P-C4' energy: -42.129 flat angles C4'-P-C4' energy: -32.374 flat angles P-C4'-P energy: -37.388 tors. eta vs tors. theta energy: -55.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -544.136089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.136089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.136089 (E_RNA) where: Base-Base interactions energy: -356.676 where: short stacking energy: -175.901 Base-Backbone interact. energy: -1.839 local terms energy: -185.621297 where: bonds (distance) C4'-P energy: -32.453 bonds (distance) P-C4' energy: -33.172 flat angles C4'-P-C4' energy: -47.266 flat angles P-C4'-P energy: -23.905 tors. eta vs tors. theta energy: -48.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -365.029982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.029982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.029982 (E_RNA) where: Base-Base interactions energy: -175.219 where: short stacking energy: -118.121 Base-Backbone interact. energy: -0.891 local terms energy: -188.919309 where: bonds (distance) C4'-P energy: -46.813 bonds (distance) P-C4' energy: -42.910 flat angles C4'-P-C4' energy: -38.900 flat angles P-C4'-P energy: -32.883 tors. eta vs tors. theta energy: -27.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -361.766371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.766371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.766371 (E_RNA) where: Base-Base interactions energy: -183.798 where: short stacking energy: -113.868 Base-Backbone interact. energy: -0.636 local terms energy: -177.332702 where: bonds (distance) C4'-P energy: -44.334 bonds (distance) P-C4' energy: -45.475 flat angles C4'-P-C4' energy: -35.057 flat angles P-C4'-P energy: -22.942 tors. eta vs tors. theta energy: -29.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -235.003025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.003025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.003025 (E_RNA) where: Base-Base interactions energy: -104.284 where: short stacking energy: -67.121 Base-Backbone interact. energy: -1.306 local terms energy: -129.413198 where: bonds (distance) C4'-P energy: -39.945 bonds (distance) P-C4' energy: -41.846 flat angles C4'-P-C4' energy: -34.749 flat angles P-C4'-P energy: -23.071 tors. eta vs tors. theta energy: 10.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -206.886787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.886787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.886787 (E_RNA) where: Base-Base interactions energy: -78.715 where: short stacking energy: -64.701 Base-Backbone interact. energy: -1.601 local terms energy: -126.571055 where: bonds (distance) C4'-P energy: -30.922 bonds (distance) P-C4' energy: -37.720 flat angles C4'-P-C4' energy: -24.920 flat angles P-C4'-P energy: -20.942 tors. eta vs tors. theta energy: -12.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -194.784755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.784755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.784755 (E_RNA) where: Base-Base interactions energy: -65.225 where: short stacking energy: -56.064 Base-Backbone interact. energy: -0.941 local terms energy: -128.619519 where: bonds (distance) C4'-P energy: -42.143 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -32.771 flat angles P-C4'-P energy: -21.672 tors. eta vs tors. theta energy: 7.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -766.802157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.802157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.802157 (E_RNA) where: Base-Base interactions energy: -523.785 where: short stacking energy: -229.513 Base-Backbone interact. energy: -0.386 local terms energy: -242.631311 where: bonds (distance) C4'-P energy: -41.916 bonds (distance) P-C4' energy: -44.786 flat angles C4'-P-C4' energy: -47.832 flat angles P-C4'-P energy: -32.530 tors. eta vs tors. theta energy: -75.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -721.282890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.282890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.282890 (E_RNA) where: Base-Base interactions energy: -497.191 where: short stacking energy: -215.591 Base-Backbone interact. energy: 0.246 local terms energy: -224.337224 where: bonds (distance) C4'-P energy: -34.959 bonds (distance) P-C4' energy: -52.701 flat angles C4'-P-C4' energy: -44.872 flat angles P-C4'-P energy: -25.251 tors. eta vs tors. theta energy: -66.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -674.222159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.222159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.222159 (E_RNA) where: Base-Base interactions energy: -465.633 where: short stacking energy: -196.093 Base-Backbone interact. energy: -0.898 local terms energy: -207.691179 where: bonds (distance) C4'-P energy: -38.077 bonds (distance) P-C4' energy: -37.131 flat angles C4'-P-C4' energy: -47.117 flat angles P-C4'-P energy: -32.205 tors. eta vs tors. theta energy: -53.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -559.072733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.072733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.072733 (E_RNA) where: Base-Base interactions energy: -343.992 where: short stacking energy: -154.569 Base-Backbone interact. energy: -0.541 local terms energy: -214.539806 where: bonds (distance) C4'-P energy: -42.887 bonds (distance) P-C4' energy: -43.402 flat angles C4'-P-C4' energy: -56.689 flat angles P-C4'-P energy: -29.025 tors. eta vs tors. theta energy: -42.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -521.213994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.213994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.213994 (E_RNA) where: Base-Base interactions energy: -319.061 where: short stacking energy: -142.685 Base-Backbone interact. energy: -0.307 local terms energy: -201.846650 where: bonds (distance) C4'-P energy: -39.308 bonds (distance) P-C4' energy: -43.995 flat angles C4'-P-C4' energy: -50.815 flat angles P-C4'-P energy: -27.081 tors. eta vs tors. theta energy: -40.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -360.173385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.173385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.173385 (E_RNA) where: Base-Base interactions energy: -190.924 where: short stacking energy: -100.795 Base-Backbone interact. energy: -0.472 local terms energy: -168.777590 where: bonds (distance) C4'-P energy: -45.561 bonds (distance) P-C4' energy: -44.560 flat angles C4'-P-C4' energy: -46.677 flat angles P-C4'-P energy: -11.418 tors. eta vs tors. theta energy: -20.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -360.729914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.729914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.729914 (E_RNA) where: Base-Base interactions energy: -188.759 where: short stacking energy: -111.695 Base-Backbone interact. energy: 0.362 local terms energy: -172.333488 where: bonds (distance) C4'-P energy: -38.630 bonds (distance) P-C4' energy: -41.587 flat angles C4'-P-C4' energy: -39.716 flat angles P-C4'-P energy: -23.998 tors. eta vs tors. theta energy: -28.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -219.877960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.877960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.877960 (E_RNA) where: Base-Base interactions energy: -69.289 where: short stacking energy: -69.713 Base-Backbone interact. energy: 1.037 local terms energy: -151.625943 where: bonds (distance) C4'-P energy: -41.363 bonds (distance) P-C4' energy: -51.249 flat angles C4'-P-C4' energy: -30.698 flat angles P-C4'-P energy: -22.545 tors. eta vs tors. theta energy: -5.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -199.068164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.068164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.068164 (E_RNA) where: Base-Base interactions energy: -71.520 where: short stacking energy: -65.085 Base-Backbone interact. energy: -0.498 local terms energy: -127.049595 where: bonds (distance) C4'-P energy: -30.924 bonds (distance) P-C4' energy: -38.849 flat angles C4'-P-C4' energy: -30.479 flat angles P-C4'-P energy: -22.075 tors. eta vs tors. theta energy: -4.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -197.941151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.941151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.941151 (E_RNA) where: Base-Base interactions energy: -68.852 where: short stacking energy: -55.579 Base-Backbone interact. energy: 4.465 local terms energy: -133.554385 where: bonds (distance) C4'-P energy: -36.931 bonds (distance) P-C4' energy: -41.612 flat angles C4'-P-C4' energy: -38.960 flat angles P-C4'-P energy: -22.307 tors. eta vs tors. theta energy: 6.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -760.424575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.424575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.424575 (E_RNA) where: Base-Base interactions energy: -505.076 where: short stacking energy: -222.741 Base-Backbone interact. energy: -1.201 local terms energy: -254.147813 where: bonds (distance) C4'-P energy: -45.335 bonds (distance) P-C4' energy: -51.489 flat angles C4'-P-C4' energy: -53.030 flat angles P-C4'-P energy: -33.363 tors. eta vs tors. theta energy: -70.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -739.639373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.639373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.639373 (E_RNA) where: Base-Base interactions energy: -507.265 where: short stacking energy: -205.661 Base-Backbone interact. energy: 0.453 local terms energy: -232.827168 where: bonds (distance) C4'-P energy: -49.774 bonds (distance) P-C4' energy: -45.056 flat angles C4'-P-C4' energy: -41.390 flat angles P-C4'-P energy: -36.964 tors. eta vs tors. theta energy: -59.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -675.309495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.309495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.309495 (E_RNA) where: Base-Base interactions energy: -463.098 where: short stacking energy: -191.725 Base-Backbone interact. energy: -1.428 local terms energy: -210.783686 where: bonds (distance) C4'-P energy: -39.514 bonds (distance) P-C4' energy: -37.390 flat angles C4'-P-C4' energy: -51.439 flat angles P-C4'-P energy: -28.208 tors. eta vs tors. theta energy: -54.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -544.557095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.557095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.557095 (E_RNA) where: Base-Base interactions energy: -348.053 where: short stacking energy: -166.065 Base-Backbone interact. energy: -1.131 local terms energy: -195.372728 where: bonds (distance) C4'-P energy: -34.459 bonds (distance) P-C4' energy: -44.744 flat angles C4'-P-C4' energy: -46.553 flat angles P-C4'-P energy: -24.157 tors. eta vs tors. theta energy: -45.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -515.342202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.342202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.342202 (E_RNA) where: Base-Base interactions energy: -323.346 where: short stacking energy: -147.576 Base-Backbone interact. energy: -1.756 local terms energy: -190.239820 where: bonds (distance) C4'-P energy: -38.681 bonds (distance) P-C4' energy: -43.041 flat angles C4'-P-C4' energy: -42.178 flat angles P-C4'-P energy: -27.669 tors. eta vs tors. theta energy: -38.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -343.706021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.706021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.706021 (E_RNA) where: Base-Base interactions energy: -183.353 where: short stacking energy: -108.334 Base-Backbone interact. energy: 0.681 local terms energy: -161.033200 where: bonds (distance) C4'-P energy: -40.224 bonds (distance) P-C4' energy: -45.943 flat angles C4'-P-C4' energy: -34.710 flat angles P-C4'-P energy: -19.824 tors. eta vs tors. theta energy: -20.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -338.052790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.052790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.052790 (E_RNA) where: Base-Base interactions energy: -193.344 where: short stacking energy: -117.346 Base-Backbone interact. energy: -0.778 local terms energy: -143.931007 where: bonds (distance) C4'-P energy: -38.054 bonds (distance) P-C4' energy: -38.174 flat angles C4'-P-C4' energy: -26.643 flat angles P-C4'-P energy: -24.704 tors. eta vs tors. theta energy: -16.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -222.740484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.740484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.740484 (E_RNA) where: Base-Base interactions energy: -85.353 where: short stacking energy: -77.861 Base-Backbone interact. energy: -0.322 local terms energy: -137.065955 where: bonds (distance) C4'-P energy: -36.223 bonds (distance) P-C4' energy: -45.618 flat angles C4'-P-C4' energy: -25.741 flat angles P-C4'-P energy: -23.464 tors. eta vs tors. theta energy: -6.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -204.668313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.668313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.668313 (E_RNA) where: Base-Base interactions energy: -73.885 where: short stacking energy: -62.083 Base-Backbone interact. energy: -1.155 local terms energy: -129.627765 where: bonds (distance) C4'-P energy: -35.058 bonds (distance) P-C4' energy: -43.552 flat angles C4'-P-C4' energy: -34.785 flat angles P-C4'-P energy: -15.130 tors. eta vs tors. theta energy: -1.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -192.046102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.046102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.046102 (E_RNA) where: Base-Base interactions energy: -67.328 where: short stacking energy: -35.400 Base-Backbone interact. energy: -0.386 local terms energy: -124.331872 where: bonds (distance) C4'-P energy: -47.212 bonds (distance) P-C4' energy: -42.461 flat angles C4'-P-C4' energy: -37.464 flat angles P-C4'-P energy: -8.153 tors. eta vs tors. theta energy: 10.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -769.048978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.048978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.048978 (E_RNA) where: Base-Base interactions energy: -512.425 where: short stacking energy: -228.180 Base-Backbone interact. energy: -0.382 local terms energy: -256.241740 where: bonds (distance) C4'-P energy: -47.873 bonds (distance) P-C4' energy: -43.644 flat angles C4'-P-C4' energy: -52.641 flat angles P-C4'-P energy: -41.380 tors. eta vs tors. theta energy: -70.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -684.344799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.344799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.344799 (E_RNA) where: Base-Base interactions energy: -467.951 where: short stacking energy: -200.902 Base-Backbone interact. energy: 1.571 local terms energy: -217.964004 where: bonds (distance) C4'-P energy: -37.092 bonds (distance) P-C4' energy: -50.417 flat angles C4'-P-C4' energy: -49.325 flat angles P-C4'-P energy: -30.308 tors. eta vs tors. theta energy: -50.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -719.050472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.050472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.050472 (E_RNA) where: Base-Base interactions energy: -489.034 where: short stacking energy: -216.895 Base-Backbone interact. energy: -0.597 local terms energy: -229.420066 where: bonds (distance) C4'-P energy: -38.521 bonds (distance) P-C4' energy: -42.164 flat angles C4'-P-C4' energy: -49.850 flat angles P-C4'-P energy: -31.396 tors. eta vs tors. theta energy: -67.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -546.826610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.826610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.826610 (E_RNA) where: Base-Base interactions energy: -349.421 where: short stacking energy: -163.732 Base-Backbone interact. energy: -0.374 local terms energy: -197.030940 where: bonds (distance) C4'-P energy: -39.856 bonds (distance) P-C4' energy: -40.698 flat angles C4'-P-C4' energy: -47.593 flat angles P-C4'-P energy: -23.361 tors. eta vs tors. theta energy: -45.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -514.829783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.829783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.829783 (E_RNA) where: Base-Base interactions energy: -326.362 where: short stacking energy: -140.285 Base-Backbone interact. energy: 2.440 local terms energy: -190.908389 where: bonds (distance) C4'-P energy: -37.416 bonds (distance) P-C4' energy: -40.114 flat angles C4'-P-C4' energy: -41.897 flat angles P-C4'-P energy: -28.739 tors. eta vs tors. theta energy: -42.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -398.991112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.991112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.991112 (E_RNA) where: Base-Base interactions energy: -224.151 where: short stacking energy: -136.926 Base-Backbone interact. energy: -1.301 local terms energy: -173.539401 where: bonds (distance) C4'-P energy: -33.376 bonds (distance) P-C4' energy: -45.124 flat angles C4'-P-C4' energy: -38.260 flat angles P-C4'-P energy: -24.304 tors. eta vs tors. theta energy: -32.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -325.162709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.162709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.162709 (E_RNA) where: Base-Base interactions energy: -178.629 where: short stacking energy: -90.234 Base-Backbone interact. energy: -2.099 local terms energy: -144.434832 where: bonds (distance) C4'-P energy: -45.416 bonds (distance) P-C4' energy: -33.125 flat angles C4'-P-C4' energy: -39.623 flat angles P-C4'-P energy: -19.350 tors. eta vs tors. theta energy: -6.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -212.375810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.375810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.375810 (E_RNA) where: Base-Base interactions energy: -73.838 where: short stacking energy: -61.476 Base-Backbone interact. energy: -1.186 local terms energy: -137.351715 where: bonds (distance) C4'-P energy: -32.373 bonds (distance) P-C4' energy: -37.482 flat angles C4'-P-C4' energy: -41.526 flat angles P-C4'-P energy: -26.691 tors. eta vs tors. theta energy: 0.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -219.757434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.757434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.757434 (E_RNA) where: Base-Base interactions energy: -97.554 where: short stacking energy: -66.394 Base-Backbone interact. energy: 0.563 local terms energy: -122.766134 where: bonds (distance) C4'-P energy: -30.815 bonds (distance) P-C4' energy: -41.636 flat angles C4'-P-C4' energy: -28.888 flat angles P-C4'-P energy: -24.545 tors. eta vs tors. theta energy: 3.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -192.493156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.493156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.493156 (E_RNA) where: Base-Base interactions energy: -52.160 where: short stacking energy: -41.712 Base-Backbone interact. energy: -3.061 local terms energy: -137.272049 where: bonds (distance) C4'-P energy: -42.577 bonds (distance) P-C4' energy: -33.886 flat angles C4'-P-C4' energy: -38.796 flat angles P-C4'-P energy: -30.341 tors. eta vs tors. theta energy: 8.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -761.038333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.038333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.038333 (E_RNA) where: Base-Base interactions energy: -511.227 where: short stacking energy: -231.494 Base-Backbone interact. energy: -2.627 local terms energy: -247.184648 where: bonds (distance) C4'-P energy: -42.402 bonds (distance) P-C4' energy: -44.770 flat angles C4'-P-C4' energy: -51.209 flat angles P-C4'-P energy: -36.998 tors. eta vs tors. theta energy: -71.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -683.297380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.297380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.297380 (E_RNA) where: Base-Base interactions energy: -463.345 where: short stacking energy: -214.501 Base-Backbone interact. energy: -0.207 local terms energy: -219.745244 where: bonds (distance) C4'-P energy: -41.911 bonds (distance) P-C4' energy: -43.595 flat angles C4'-P-C4' energy: -47.676 flat angles P-C4'-P energy: -33.186 tors. eta vs tors. theta energy: -53.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -696.397402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.397402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.397402 (E_RNA) where: Base-Base interactions energy: -463.341 where: short stacking energy: -193.363 Base-Backbone interact. energy: -0.718 local terms energy: -232.338812 where: bonds (distance) C4'-P energy: -41.074 bonds (distance) P-C4' energy: -45.364 flat angles C4'-P-C4' energy: -50.079 flat angles P-C4'-P energy: -33.313 tors. eta vs tors. theta energy: -62.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -527.227126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.227126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.227126 (E_RNA) where: Base-Base interactions energy: -312.136 where: short stacking energy: -155.583 Base-Backbone interact. energy: 1.680 local terms energy: -216.770421 where: bonds (distance) C4'-P energy: -53.769 bonds (distance) P-C4' energy: -45.865 flat angles C4'-P-C4' energy: -43.681 flat angles P-C4'-P energy: -32.378 tors. eta vs tors. theta energy: -41.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -491.029054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.029054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.029054 (E_RNA) where: Base-Base interactions energy: -311.234 where: short stacking energy: -155.519 Base-Backbone interact. energy: 3.048 local terms energy: -182.843406 where: bonds (distance) C4'-P energy: -36.643 bonds (distance) P-C4' energy: -34.425 flat angles C4'-P-C4' energy: -53.065 flat angles P-C4'-P energy: -21.799 tors. eta vs tors. theta energy: -36.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -371.469697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.469697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.469697 (E_RNA) where: Base-Base interactions energy: -211.590 where: short stacking energy: -117.106 Base-Backbone interact. energy: 0.223 local terms energy: -160.101874 where: bonds (distance) C4'-P energy: -42.606 bonds (distance) P-C4' energy: -40.298 flat angles C4'-P-C4' energy: -36.444 flat angles P-C4'-P energy: -20.011 tors. eta vs tors. theta energy: -20.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -319.270932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.270932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.270932 (E_RNA) where: Base-Base interactions energy: -160.180 where: short stacking energy: -81.325 Base-Backbone interact. energy: -0.877 local terms energy: -158.214066 where: bonds (distance) C4'-P energy: -40.959 bonds (distance) P-C4' energy: -34.281 flat angles C4'-P-C4' energy: -48.687 flat angles P-C4'-P energy: -14.604 tors. eta vs tors. theta energy: -19.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -209.167771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.167771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.167771 (E_RNA) where: Base-Base interactions energy: -67.787 where: short stacking energy: -52.249 Base-Backbone interact. energy: -1.107 local terms energy: -140.274480 where: bonds (distance) C4'-P energy: -36.370 bonds (distance) P-C4' energy: -47.300 flat angles C4'-P-C4' energy: -25.500 flat angles P-C4'-P energy: -23.183 tors. eta vs tors. theta energy: -7.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -195.864179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.864179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.864179 (E_RNA) where: Base-Base interactions energy: -81.916 where: short stacking energy: -50.593 Base-Backbone interact. energy: -1.405 local terms energy: -112.543326 where: bonds (distance) C4'-P energy: -32.066 bonds (distance) P-C4' energy: -36.624 flat angles C4'-P-C4' energy: -28.002 flat angles P-C4'-P energy: -22.949 tors. eta vs tors. theta energy: 7.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -200.784705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.784705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.784705 (E_RNA) where: Base-Base interactions energy: -80.540 where: short stacking energy: -48.429 Base-Backbone interact. energy: 1.261 local terms energy: -121.505581 where: bonds (distance) C4'-P energy: -42.860 bonds (distance) P-C4' energy: -43.729 flat angles C4'-P-C4' energy: -24.022 flat angles P-C4'-P energy: -19.241 tors. eta vs tors. theta energy: 8.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -782.813847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.813847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.813847 (E_RNA) where: Base-Base interactions energy: -528.313 where: short stacking energy: -231.256 Base-Backbone interact. energy: -0.570 local terms energy: -253.930696 where: bonds (distance) C4'-P energy: -46.521 bonds (distance) P-C4' energy: -48.337 flat angles C4'-P-C4' energy: -54.002 flat angles P-C4'-P energy: -34.908 tors. eta vs tors. theta energy: -70.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -741.678115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.678115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.678115 (E_RNA) where: Base-Base interactions energy: -493.895 where: short stacking energy: -211.162 Base-Backbone interact. energy: -1.097 local terms energy: -246.686091 where: bonds (distance) C4'-P energy: -50.943 bonds (distance) P-C4' energy: -44.062 flat angles C4'-P-C4' energy: -47.462 flat angles P-C4'-P energy: -39.509 tors. eta vs tors. theta energy: -64.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -689.324401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.324401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.324401 (E_RNA) where: Base-Base interactions energy: -470.558 where: short stacking energy: -208.760 Base-Backbone interact. energy: 0.855 local terms energy: -219.621527 where: bonds (distance) C4'-P energy: -31.333 bonds (distance) P-C4' energy: -41.622 flat angles C4'-P-C4' energy: -54.105 flat angles P-C4'-P energy: -30.418 tors. eta vs tors. theta energy: -62.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -548.521606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.521606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.521606 (E_RNA) where: Base-Base interactions energy: -335.901 where: short stacking energy: -161.198 Base-Backbone interact. energy: -0.497 local terms energy: -212.122838 where: bonds (distance) C4'-P energy: -40.654 bonds (distance) P-C4' energy: -47.283 flat angles C4'-P-C4' energy: -48.897 flat angles P-C4'-P energy: -23.361 tors. eta vs tors. theta energy: -51.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -501.298396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.298396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.298396 (E_RNA) where: Base-Base interactions energy: -314.378 where: short stacking energy: -155.283 Base-Backbone interact. energy: 0.057 local terms energy: -186.976921 where: bonds (distance) C4'-P energy: -36.081 bonds (distance) P-C4' energy: -43.000 flat angles C4'-P-C4' energy: -42.331 flat angles P-C4'-P energy: -25.488 tors. eta vs tors. theta energy: -40.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -396.920820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.920820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.920820 (E_RNA) where: Base-Base interactions energy: -225.187 where: short stacking energy: -114.860 Base-Backbone interact. energy: -0.958 local terms energy: -170.775704 where: bonds (distance) C4'-P energy: -41.305 bonds (distance) P-C4' energy: -39.044 flat angles C4'-P-C4' energy: -44.600 flat angles P-C4'-P energy: -25.049 tors. eta vs tors. theta energy: -20.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -306.678517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.678517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.678517 (E_RNA) where: Base-Base interactions energy: -151.678 where: short stacking energy: -91.108 Base-Backbone interact. energy: -0.422 local terms energy: -154.578406 where: bonds (distance) C4'-P energy: -44.992 bonds (distance) P-C4' energy: -40.504 flat angles C4'-P-C4' energy: -36.017 flat angles P-C4'-P energy: -13.014 tors. eta vs tors. theta energy: -20.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -231.767314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.767314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.767314 (E_RNA) where: Base-Base interactions energy: -85.880 where: short stacking energy: -65.961 Base-Backbone interact. energy: -0.900 local terms energy: -144.987723 where: bonds (distance) C4'-P energy: -34.892 bonds (distance) P-C4' energy: -46.917 flat angles C4'-P-C4' energy: -39.664 flat angles P-C4'-P energy: -22.971 tors. eta vs tors. theta energy: -0.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -199.986126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.986126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.986126 (E_RNA) where: Base-Base interactions energy: -70.696 where: short stacking energy: -62.128 Base-Backbone interact. energy: 0.573 local terms energy: -129.863233 where: bonds (distance) C4'-P energy: -37.275 bonds (distance) P-C4' energy: -43.635 flat angles C4'-P-C4' energy: -32.572 flat angles P-C4'-P energy: -24.518 tors. eta vs tors. theta energy: 8.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -195.231728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.231728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.231728 (E_RNA) where: Base-Base interactions energy: -74.892 where: short stacking energy: -42.638 Base-Backbone interact. energy: 1.496 local terms energy: -121.835524 where: bonds (distance) C4'-P energy: -40.924 bonds (distance) P-C4' energy: -37.935 flat angles C4'-P-C4' energy: -35.014 flat angles P-C4'-P energy: -24.833 tors. eta vs tors. theta energy: 16.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -775.091043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.091043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.091043 (E_RNA) where: Base-Base interactions energy: -517.290 where: short stacking energy: -228.962 Base-Backbone interact. energy: -0.388 local terms energy: -257.413370 where: bonds (distance) C4'-P energy: -51.255 bonds (distance) P-C4' energy: -44.605 flat angles C4'-P-C4' energy: -53.717 flat angles P-C4'-P energy: -38.129 tors. eta vs tors. theta energy: -69.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -739.330848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.330848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.330848 (E_RNA) where: Base-Base interactions energy: -496.506 where: short stacking energy: -209.772 Base-Backbone interact. energy: -0.120 local terms energy: -242.704514 where: bonds (distance) C4'-P energy: -49.982 bonds (distance) P-C4' energy: -44.181 flat angles C4'-P-C4' energy: -50.943 flat angles P-C4'-P energy: -35.460 tors. eta vs tors. theta energy: -62.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -664.146070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.146070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.146070 (E_RNA) where: Base-Base interactions energy: -447.109 where: short stacking energy: -175.379 Base-Backbone interact. energy: -0.687 local terms energy: -216.350131 where: bonds (distance) C4'-P energy: -39.671 bonds (distance) P-C4' energy: -45.207 flat angles C4'-P-C4' energy: -46.392 flat angles P-C4'-P energy: -29.738 tors. eta vs tors. theta energy: -55.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -556.983928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.983928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.983928 (E_RNA) where: Base-Base interactions energy: -348.222 where: short stacking energy: -158.282 Base-Backbone interact. energy: -0.928 local terms energy: -207.834194 where: bonds (distance) C4'-P energy: -50.379 bonds (distance) P-C4' energy: -48.442 flat angles C4'-P-C4' energy: -44.932 flat angles P-C4'-P energy: -22.035 tors. eta vs tors. theta energy: -42.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -562.297807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.297807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.297807 (E_RNA) where: Base-Base interactions energy: -337.105 where: short stacking energy: -156.750 Base-Backbone interact. energy: -1.167 local terms energy: -224.025741 where: bonds (distance) C4'-P energy: -48.968 bonds (distance) P-C4' energy: -48.041 flat angles C4'-P-C4' energy: -48.135 flat angles P-C4'-P energy: -31.459 tors. eta vs tors. theta energy: -47.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -415.870094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.870094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.870094 (E_RNA) where: Base-Base interactions energy: -237.084 where: short stacking energy: -127.529 Base-Backbone interact. energy: 1.088 local terms energy: -179.874049 where: bonds (distance) C4'-P energy: -44.032 bonds (distance) P-C4' energy: -39.645 flat angles C4'-P-C4' energy: -42.896 flat angles P-C4'-P energy: -26.877 tors. eta vs tors. theta energy: -26.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -328.201592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.201592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.201592 (E_RNA) where: Base-Base interactions energy: -179.991 where: short stacking energy: -111.427 Base-Backbone interact. energy: -0.121 local terms energy: -148.089656 where: bonds (distance) C4'-P energy: -36.910 bonds (distance) P-C4' energy: -39.477 flat angles C4'-P-C4' energy: -26.092 flat angles P-C4'-P energy: -22.597 tors. eta vs tors. theta energy: -23.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -272.022088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.022088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.022088 (E_RNA) where: Base-Base interactions energy: -130.991 where: short stacking energy: -74.908 Base-Backbone interact. energy: -1.841 local terms energy: -139.190332 where: bonds (distance) C4'-P energy: -48.845 bonds (distance) P-C4' energy: -35.056 flat angles C4'-P-C4' energy: -38.821 flat angles P-C4'-P energy: -16.073 tors. eta vs tors. theta energy: -0.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -268.196144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.196144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.196144 (E_RNA) where: Base-Base interactions energy: -112.341 where: short stacking energy: -68.015 Base-Backbone interact. energy: 0.714 local terms energy: -156.569389 where: bonds (distance) C4'-P energy: -45.496 bonds (distance) P-C4' energy: -48.701 flat angles C4'-P-C4' energy: -35.743 flat angles P-C4'-P energy: -25.840 tors. eta vs tors. theta energy: -0.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -182.630857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.630857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.630857 (E_RNA) where: Base-Base interactions energy: -63.171 where: short stacking energy: -46.793 Base-Backbone interact. energy: 0.507 local terms energy: -119.967137 where: bonds (distance) C4'-P energy: -32.801 bonds (distance) P-C4' energy: -37.451 flat angles C4'-P-C4' energy: -35.362 flat angles P-C4'-P energy: -29.648 tors. eta vs tors. theta energy: 15.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -763.536120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.536120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.536120 (E_RNA) where: Base-Base interactions energy: -521.036 where: short stacking energy: -222.434 Base-Backbone interact. energy: -1.501 local terms energy: -240.998750 where: bonds (distance) C4'-P energy: -46.886 bonds (distance) P-C4' energy: -45.433 flat angles C4'-P-C4' energy: -55.006 flat angles P-C4'-P energy: -28.824 tors. eta vs tors. theta energy: -64.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -727.390513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.390513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.390513 (E_RNA) where: Base-Base interactions energy: -482.002 where: short stacking energy: -209.725 Base-Backbone interact. energy: -1.283 local terms energy: -244.105909 where: bonds (distance) C4'-P energy: -46.885 bonds (distance) P-C4' energy: -48.302 flat angles C4'-P-C4' energy: -49.284 flat angles P-C4'-P energy: -32.354 tors. eta vs tors. theta energy: -67.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -655.325140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.325140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.325140 (E_RNA) where: Base-Base interactions energy: -433.695 where: short stacking energy: -193.464 Base-Backbone interact. energy: -0.397 local terms energy: -221.233266 where: bonds (distance) C4'-P energy: -43.519 bonds (distance) P-C4' energy: -45.397 flat angles C4'-P-C4' energy: -50.120 flat angles P-C4'-P energy: -30.962 tors. eta vs tors. theta energy: -51.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -598.386665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.386665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.386665 (E_RNA) where: Base-Base interactions energy: -392.416 where: short stacking energy: -188.198 Base-Backbone interact. energy: -0.618 local terms energy: -205.353579 where: bonds (distance) C4'-P energy: -41.437 bonds (distance) P-C4' energy: -35.746 flat angles C4'-P-C4' energy: -46.312 flat angles P-C4'-P energy: -34.410 tors. eta vs tors. theta energy: -47.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -507.609211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.609211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.609211 (E_RNA) where: Base-Base interactions energy: -317.827 where: short stacking energy: -145.864 Base-Backbone interact. energy: 0.199 local terms energy: -189.981039 where: bonds (distance) C4'-P energy: -43.276 bonds (distance) P-C4' energy: -33.854 flat angles C4'-P-C4' energy: -39.564 flat angles P-C4'-P energy: -30.325 tors. eta vs tors. theta energy: -42.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -361.092100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.092100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.092100 (E_RNA) where: Base-Base interactions energy: -185.184 where: short stacking energy: -103.430 Base-Backbone interact. energy: -0.241 local terms energy: -175.666344 where: bonds (distance) C4'-P energy: -43.565 bonds (distance) P-C4' energy: -41.302 flat angles C4'-P-C4' energy: -48.262 flat angles P-C4'-P energy: -27.894 tors. eta vs tors. theta energy: -14.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -318.289921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.289921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.289921 (E_RNA) where: Base-Base interactions energy: -162.058 where: short stacking energy: -91.359 Base-Backbone interact. energy: -0.564 local terms energy: -155.667498 where: bonds (distance) C4'-P energy: -39.794 bonds (distance) P-C4' energy: -35.892 flat angles C4'-P-C4' energy: -38.125 flat angles P-C4'-P energy: -27.060 tors. eta vs tors. theta energy: -14.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -241.256407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.256407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.256407 (E_RNA) where: Base-Base interactions energy: -113.034 where: short stacking energy: -71.336 Base-Backbone interact. energy: -0.773 local terms energy: -127.449656 where: bonds (distance) C4'-P energy: -43.036 bonds (distance) P-C4' energy: -39.052 flat angles C4'-P-C4' energy: -25.737 flat angles P-C4'-P energy: -16.038 tors. eta vs tors. theta energy: -3.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -215.210098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.210098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.210098 (E_RNA) where: Base-Base interactions energy: -86.247 where: short stacking energy: -76.922 Base-Backbone interact. energy: -1.092 local terms energy: -127.870913 where: bonds (distance) C4'-P energy: -27.063 bonds (distance) P-C4' energy: -47.395 flat angles C4'-P-C4' energy: -36.804 flat angles P-C4'-P energy: -14.255 tors. eta vs tors. theta energy: -2.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -187.217728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.217728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.217728 (E_RNA) where: Base-Base interactions energy: -65.655 where: short stacking energy: -29.283 Base-Backbone interact. energy: 2.224 local terms energy: -123.786747 where: bonds (distance) C4'-P energy: -40.729 bonds (distance) P-C4' energy: -46.006 flat angles C4'-P-C4' energy: -34.505 flat angles P-C4'-P energy: -18.794 tors. eta vs tors. theta energy: 16.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -752.230146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.230146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.230146 (E_RNA) where: Base-Base interactions energy: -505.998 where: short stacking energy: -228.740 Base-Backbone interact. energy: -0.735 local terms energy: -245.497145 where: bonds (distance) C4'-P energy: -52.453 bonds (distance) P-C4' energy: -51.755 flat angles C4'-P-C4' energy: -45.149 flat angles P-C4'-P energy: -27.697 tors. eta vs tors. theta energy: -68.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -731.064656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.064656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.064656 (E_RNA) where: Base-Base interactions energy: -499.573 where: short stacking energy: -205.325 Base-Backbone interact. energy: -0.501 local terms energy: -230.990324 where: bonds (distance) C4'-P energy: -46.561 bonds (distance) P-C4' energy: -39.763 flat angles C4'-P-C4' energy: -48.550 flat angles P-C4'-P energy: -34.898 tors. eta vs tors. theta energy: -61.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -644.584309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.584309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.584309 (E_RNA) where: Base-Base interactions energy: -430.992 where: short stacking energy: -182.999 Base-Backbone interact. energy: -1.121 local terms energy: -212.470925 where: bonds (distance) C4'-P energy: -37.347 bonds (distance) P-C4' energy: -43.510 flat angles C4'-P-C4' energy: -55.849 flat angles P-C4'-P energy: -26.115 tors. eta vs tors. theta energy: -49.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -604.980304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.980304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.980304 (E_RNA) where: Base-Base interactions energy: -399.738 where: short stacking energy: -162.409 Base-Backbone interact. energy: -0.670 local terms energy: -204.572922 where: bonds (distance) C4'-P energy: -44.914 bonds (distance) P-C4' energy: -43.667 flat angles C4'-P-C4' energy: -45.379 flat angles P-C4'-P energy: -29.559 tors. eta vs tors. theta energy: -41.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -499.956505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.956505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.956505 (E_RNA) where: Base-Base interactions energy: -313.153 where: short stacking energy: -145.651 Base-Backbone interact. energy: -0.783 local terms energy: -186.020292 where: bonds (distance) C4'-P energy: -42.755 bonds (distance) P-C4' energy: -28.426 flat angles C4'-P-C4' energy: -42.453 flat angles P-C4'-P energy: -34.315 tors. eta vs tors. theta energy: -38.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -388.126307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.126307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.126307 (E_RNA) where: Base-Base interactions energy: -195.306 where: short stacking energy: -122.673 Base-Backbone interact. energy: 0.398 local terms energy: -193.217866 where: bonds (distance) C4'-P energy: -45.912 bonds (distance) P-C4' energy: -47.150 flat angles C4'-P-C4' energy: -41.206 flat angles P-C4'-P energy: -28.892 tors. eta vs tors. theta energy: -30.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -317.794267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.794267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.794267 (E_RNA) where: Base-Base interactions energy: -162.071 where: short stacking energy: -88.922 Base-Backbone interact. energy: -0.537 local terms energy: -155.185987 where: bonds (distance) C4'-P energy: -41.067 bonds (distance) P-C4' energy: -45.845 flat angles C4'-P-C4' energy: -34.500 flat angles P-C4'-P energy: -18.095 tors. eta vs tors. theta energy: -15.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -262.814066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.814066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.814066 (E_RNA) where: Base-Base interactions energy: -112.520 where: short stacking energy: -69.131 Base-Backbone interact. energy: 2.304 local terms energy: -152.597920 where: bonds (distance) C4'-P energy: -37.084 bonds (distance) P-C4' energy: -35.578 flat angles C4'-P-C4' energy: -43.199 flat angles P-C4'-P energy: -25.600 tors. eta vs tors. theta energy: -11.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -210.806990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.806990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.806990 (E_RNA) where: Base-Base interactions energy: -77.521 where: short stacking energy: -57.117 Base-Backbone interact. energy: -0.766 local terms energy: -132.520768 where: bonds (distance) C4'-P energy: -39.422 bonds (distance) P-C4' energy: -36.821 flat angles C4'-P-C4' energy: -31.967 flat angles P-C4'-P energy: -23.509 tors. eta vs tors. theta energy: -0.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -213.246975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.246975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.246975 (E_RNA) where: Base-Base interactions energy: -89.044 where: short stacking energy: -44.173 Base-Backbone interact. energy: 1.515 local terms energy: -125.717449 where: bonds (distance) C4'-P energy: -35.464 bonds (distance) P-C4' energy: -43.474 flat angles C4'-P-C4' energy: -30.114 flat angles P-C4'-P energy: -22.709 tors. eta vs tors. theta energy: 6.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -760.292709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.292709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.292709 (E_RNA) where: Base-Base interactions energy: -513.958 where: short stacking energy: -229.906 Base-Backbone interact. energy: -0.280 local terms energy: -246.054857 where: bonds (distance) C4'-P energy: -45.646 bonds (distance) P-C4' energy: -44.774 flat angles C4'-P-C4' energy: -49.744 flat angles P-C4'-P energy: -36.484 tors. eta vs tors. theta energy: -69.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -739.011586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.011586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.011586 (E_RNA) where: Base-Base interactions energy: -495.950 where: short stacking energy: -213.953 Base-Backbone interact. energy: -0.593 local terms energy: -242.468682 where: bonds (distance) C4'-P energy: -45.588 bonds (distance) P-C4' energy: -49.933 flat angles C4'-P-C4' energy: -45.253 flat angles P-C4'-P energy: -30.256 tors. eta vs tors. theta energy: -71.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -628.640221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.640221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.640221 (E_RNA) where: Base-Base interactions energy: -411.792 where: short stacking energy: -194.180 Base-Backbone interact. energy: -1.023 local terms energy: -215.825077 where: bonds (distance) C4'-P energy: -47.138 bonds (distance) P-C4' energy: -45.591 flat angles C4'-P-C4' energy: -45.358 flat angles P-C4'-P energy: -29.451 tors. eta vs tors. theta energy: -48.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -565.305463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.305463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.305463 (E_RNA) where: Base-Base interactions energy: -370.774 where: short stacking energy: -153.518 Base-Backbone interact. energy: -0.128 local terms energy: -194.403489 where: bonds (distance) C4'-P energy: -40.016 bonds (distance) P-C4' energy: -46.934 flat angles C4'-P-C4' energy: -50.384 flat angles P-C4'-P energy: -19.962 tors. eta vs tors. theta energy: -37.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -498.956076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.956076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.956076 (E_RNA) where: Base-Base interactions energy: -307.276 where: short stacking energy: -150.292 Base-Backbone interact. energy: -0.136 local terms energy: -191.544572 where: bonds (distance) C4'-P energy: -43.544 bonds (distance) P-C4' energy: -39.528 flat angles C4'-P-C4' energy: -40.968 flat angles P-C4'-P energy: -21.052 tors. eta vs tors. theta energy: -46.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -372.377642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.377642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.377642 (E_RNA) where: Base-Base interactions energy: -216.425 where: short stacking energy: -110.496 Base-Backbone interact. energy: 0.419 local terms energy: -156.371777 where: bonds (distance) C4'-P energy: -37.728 bonds (distance) P-C4' energy: -41.386 flat angles C4'-P-C4' energy: -33.480 flat angles P-C4'-P energy: -27.215 tors. eta vs tors. theta energy: -16.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -300.896979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.896979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.896979 (E_RNA) where: Base-Base interactions energy: -147.395 where: short stacking energy: -99.557 Base-Backbone interact. energy: -1.079 local terms energy: -152.422566 where: bonds (distance) C4'-P energy: -40.041 bonds (distance) P-C4' energy: -42.553 flat angles C4'-P-C4' energy: -32.888 flat angles P-C4'-P energy: -17.943 tors. eta vs tors. theta energy: -18.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -266.384660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.384660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.384660 (E_RNA) where: Base-Base interactions energy: -109.790 where: short stacking energy: -71.680 Base-Backbone interact. energy: -1.501 local terms energy: -155.093693 where: bonds (distance) C4'-P energy: -43.368 bonds (distance) P-C4' energy: -31.933 flat angles C4'-P-C4' energy: -42.102 flat angles P-C4'-P energy: -29.271 tors. eta vs tors. theta energy: -8.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -205.454482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.454482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.454482 (E_RNA) where: Base-Base interactions energy: -89.841 where: short stacking energy: -72.860 Base-Backbone interact. energy: -1.151 local terms energy: -114.462625 where: bonds (distance) C4'-P energy: -34.623 bonds (distance) P-C4' energy: -41.602 flat angles C4'-P-C4' energy: -30.568 flat angles P-C4'-P energy: -14.249 tors. eta vs tors. theta energy: 6.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -181.839071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.839071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.839071 (E_RNA) where: Base-Base interactions energy: -63.891 where: short stacking energy: -52.835 Base-Backbone interact. energy: 0.912 local terms energy: -118.860294 where: bonds (distance) C4'-P energy: -35.555 bonds (distance) P-C4' energy: -40.009 flat angles C4'-P-C4' energy: -28.689 flat angles P-C4'-P energy: -16.620 tors. eta vs tors. theta energy: 2.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 8 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 9810765 moves confirmed later: 11214709 all moves confirmed: 21025474 percent of confirmed moves: 13.140921 current total energy: -702.181946 recalc. total energy: -702.181946 replica 1 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 6868798 moves confirmed later: 7306852 all moves confirmed: 14175650 percent of confirmed moves: 8.859781 current total energy: -704.973129 recalc. total energy: -704.973129 replica 2 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 8828618 moves confirmed later: 9815476 all moves confirmed: 18644094 percent of confirmed moves: 11.652559 current total energy: -536.643470 recalc. total energy: -536.643470 replica 6 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 9077643 moves confirmed later: 10157751 all moves confirmed: 19235394 percent of confirmed moves: 12.022121 current total energy: -519.900052 recalc. total energy: -519.900052 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 11203107 moves confirmed later: 12890118 all moves confirmed: 24093225 percent of confirmed moves: 15.058266 current total energy: -380.689723 recalc. total energy: -380.689723 replica 9 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 16288833 moves confirmed later: 19633917 all moves confirmed: 35922750 percent of confirmed moves: 22.451719 current total energy: -320.194405 recalc. total energy: -320.194405 replica 4 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 15721700 moves confirmed later: 18903459 all moves confirmed: 34625159 percent of confirmed moves: 21.640724 current total energy: -202.823841 recalc. total energy: -202.823841 replica 7 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 15558635 moves confirmed later: 18679174 all moves confirmed: 34237809 percent of confirmed moves: 21.398631 current total energy: -154.599432 recalc. total energy: -154.599432 replica 5 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 16493928 moves confirmed later: 19955735 all moves confirmed: 36449663 percent of confirmed moves: 22.781039 current total energy: -92.090892 recalc. total energy: -92.090892 replica 10 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 17447568 moves confirmed later: 21212396 all moves confirmed: 38659964 percent of confirmed moves: 24.162478 current total energy: -114.713146 recalc. total energy: -114.713146 out arg RESULTS//1/Tetraloop_10_steps-ab4e3981_01 Time of doing 1600000 iterations: 1927.073 seconds