SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-ab157b55/inputs/seq.fa: 1 curr_seq: _cgcgaucauauggugcuggaaacagcaccauaugaucgcg_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: cgcgaucauauggugcuggaaacagcaccauaugaucgcg RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 40 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 205 n_atoms_counter: 205 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 40.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -159.229002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.229002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.229002 (E_RNA) where: Base-Base interactions energy: -3.183 where: short stacking energy: -3.183 Base-Backbone interact. energy: -0.000 local terms energy: -156.045542 where: bonds (distance) C4'-P energy: -38.863 bonds (distance) P-C4' energy: -36.681 flat angles C4'-P-C4' energy: -29.369 flat angles P-C4'-P energy: -33.595 tors. eta vs tors. theta energy: -17.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -224.010626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.010626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.010626 (E_RNA) where: Base-Base interactions energy: -103.865 where: short stacking energy: -86.757 Base-Backbone interact. energy: -0.115 local terms energy: -120.029875 where: bonds (distance) C4'-P energy: -27.802 bonds (distance) P-C4' energy: -25.883 flat angles C4'-P-C4' energy: -27.311 flat angles P-C4'-P energy: -20.310 tors. eta vs tors. theta energy: -18.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -217.623399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.623399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.623399 (E_RNA) where: Base-Base interactions energy: -98.821 where: short stacking energy: -98.821 Base-Backbone interact. energy: -0.021 local terms energy: -118.780985 where: bonds (distance) C4'-P energy: -28.460 bonds (distance) P-C4' energy: -22.428 flat angles C4'-P-C4' energy: -27.708 flat angles P-C4'-P energy: -15.220 tors. eta vs tors. theta energy: -24.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -195.859562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.859562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.859562 (E_RNA) where: Base-Base interactions energy: -79.517 where: short stacking energy: -78.915 Base-Backbone interact. energy: -0.032 local terms energy: -116.310867 where: bonds (distance) C4'-P energy: -19.041 bonds (distance) P-C4' energy: -31.580 flat angles C4'-P-C4' energy: -27.480 flat angles P-C4'-P energy: -16.465 tors. eta vs tors. theta energy: -21.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -186.494409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.494409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.494409 (E_RNA) where: Base-Base interactions energy: -77.313 where: short stacking energy: -76.977 Base-Backbone interact. energy: -0.127 local terms energy: -109.054408 where: bonds (distance) C4'-P energy: -23.292 bonds (distance) P-C4' energy: -26.039 flat angles C4'-P-C4' energy: -25.636 flat angles P-C4'-P energy: -20.447 tors. eta vs tors. theta energy: -13.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -185.044510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.044510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.044510 (E_RNA) where: Base-Base interactions energy: -76.991 where: short stacking energy: -77.044 Base-Backbone interact. energy: -0.058 local terms energy: -107.995438 where: bonds (distance) C4'-P energy: -24.532 bonds (distance) P-C4' energy: -29.236 flat angles C4'-P-C4' energy: -23.365 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -14.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -171.318388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.318388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.318388 (E_RNA) where: Base-Base interactions energy: -75.186 where: short stacking energy: -49.570 Base-Backbone interact. energy: -0.296 local terms energy: -95.836825 where: bonds (distance) C4'-P energy: -24.787 bonds (distance) P-C4' energy: -21.571 flat angles C4'-P-C4' energy: -20.179 flat angles P-C4'-P energy: -20.396 tors. eta vs tors. theta energy: -8.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -180.531509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.531509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.531509 (E_RNA) where: Base-Base interactions energy: -89.902 where: short stacking energy: -65.939 Base-Backbone interact. energy: -0.558 local terms energy: -90.071695 where: bonds (distance) C4'-P energy: -25.083 bonds (distance) P-C4' energy: -23.313 flat angles C4'-P-C4' energy: -21.280 flat angles P-C4'-P energy: -7.564 tors. eta vs tors. theta energy: -12.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -158.291025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.291025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.291025 (E_RNA) where: Base-Base interactions energy: -3.224 where: short stacking energy: -3.224 Base-Backbone interact. energy: -0.000 local terms energy: -155.067157 where: bonds (distance) C4'-P energy: -38.747 bonds (distance) P-C4' energy: -36.674 flat angles C4'-P-C4' energy: -28.784 flat angles P-C4'-P energy: -33.558 tors. eta vs tors. theta energy: -17.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -163.997844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.997844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.997844 (E_RNA) where: Base-Base interactions energy: -86.837 where: short stacking energy: -46.329 Base-Backbone interact. energy: 0.396 local terms energy: -77.556652 where: bonds (distance) C4'-P energy: -21.167 bonds (distance) P-C4' energy: -21.508 flat angles C4'-P-C4' energy: -21.090 flat angles P-C4'-P energy: -13.282 tors. eta vs tors. theta energy: -0.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -158.291016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.291016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.291016 (E_RNA) where: Base-Base interactions energy: -3.224 where: short stacking energy: -3.224 Base-Backbone interact. energy: -0.000 local terms energy: -155.067157 where: bonds (distance) C4'-P energy: -38.747 bonds (distance) P-C4' energy: -36.674 flat angles C4'-P-C4' energy: -28.784 flat angles P-C4'-P energy: -33.558 tors. eta vs tors. theta energy: -17.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -290.847816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.847816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.847816 (E_RNA) where: Base-Base interactions energy: -158.423 where: short stacking energy: -93.657 Base-Backbone interact. energy: -0.201 local terms energy: -132.223345 where: bonds (distance) C4'-P energy: -29.581 bonds (distance) P-C4' energy: -28.177 flat angles C4'-P-C4' energy: -29.298 flat angles P-C4'-P energy: -19.508 tors. eta vs tors. theta energy: -25.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -248.711617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.711617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.711617 (E_RNA) where: Base-Base interactions energy: -132.554 where: short stacking energy: -91.784 Base-Backbone interact. energy: 0.792 local terms energy: -116.950172 where: bonds (distance) C4'-P energy: -21.928 bonds (distance) P-C4' energy: -30.844 flat angles C4'-P-C4' energy: -27.344 flat angles P-C4'-P energy: -16.203 tors. eta vs tors. theta energy: -20.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -239.850656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.850656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.850656 (E_RNA) where: Base-Base interactions energy: -140.109 where: short stacking energy: -79.147 Base-Backbone interact. energy: -1.158 local terms energy: -98.583410 where: bonds (distance) C4'-P energy: -27.318 bonds (distance) P-C4' energy: -27.602 flat angles C4'-P-C4' energy: -19.976 flat angles P-C4'-P energy: -11.771 tors. eta vs tors. theta energy: -11.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -209.911309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.911309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.911309 (E_RNA) where: Base-Base interactions energy: -106.842 where: short stacking energy: -72.974 Base-Backbone interact. energy: -1.754 local terms energy: -101.314886 where: bonds (distance) C4'-P energy: -25.240 bonds (distance) P-C4' energy: -26.132 flat angles C4'-P-C4' energy: -17.847 flat angles P-C4'-P energy: -13.394 tors. eta vs tors. theta energy: -18.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -221.051875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.051875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.051875 (E_RNA) where: Base-Base interactions energy: -117.996 where: short stacking energy: -57.590 Base-Backbone interact. energy: -1.115 local terms energy: -101.941275 where: bonds (distance) C4'-P energy: -26.788 bonds (distance) P-C4' energy: -27.522 flat angles C4'-P-C4' energy: -19.770 flat angles P-C4'-P energy: -18.110 tors. eta vs tors. theta energy: -9.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -183.049805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.049805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.049805 (E_RNA) where: Base-Base interactions energy: -75.208 where: short stacking energy: -60.855 Base-Backbone interact. energy: 0.509 local terms energy: -108.350982 where: bonds (distance) C4'-P energy: -23.695 bonds (distance) P-C4' energy: -27.232 flat angles C4'-P-C4' energy: -28.309 flat angles P-C4'-P energy: -19.749 tors. eta vs tors. theta energy: -9.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -159.088219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.088219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.088219 (E_RNA) where: Base-Base interactions energy: -68.744 where: short stacking energy: -59.488 Base-Backbone interact. energy: 0.415 local terms energy: -90.759045 where: bonds (distance) C4'-P energy: -23.658 bonds (distance) P-C4' energy: -24.859 flat angles C4'-P-C4' energy: -23.387 flat angles P-C4'-P energy: -6.807 tors. eta vs tors. theta energy: -12.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -234.437275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.437275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.437275 (E_RNA) where: Base-Base interactions energy: -131.974 where: short stacking energy: -73.520 Base-Backbone interact. energy: -0.483 local terms energy: -101.980445 where: bonds (distance) C4'-P energy: -17.811 bonds (distance) P-C4' energy: -26.193 flat angles C4'-P-C4' energy: -23.718 flat angles P-C4'-P energy: -12.122 tors. eta vs tors. theta energy: -22.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -137.925732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.925732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.925732 (E_RNA) where: Base-Base interactions energy: -54.060 where: short stacking energy: -41.683 Base-Backbone interact. energy: -0.440 local terms energy: -83.426299 where: bonds (distance) C4'-P energy: -24.252 bonds (distance) P-C4' energy: -20.076 flat angles C4'-P-C4' energy: -23.143 flat angles P-C4'-P energy: -14.356 tors. eta vs tors. theta energy: -1.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -136.464318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.464318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.464318 (E_RNA) where: Base-Base interactions energy: -45.966 where: short stacking energy: -39.215 Base-Backbone interact. energy: 0.374 local terms energy: -90.872126 where: bonds (distance) C4'-P energy: -26.103 bonds (distance) P-C4' energy: -22.759 flat angles C4'-P-C4' energy: -21.706 flat angles P-C4'-P energy: -13.635 tors. eta vs tors. theta energy: -6.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -283.280216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.280216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.280216 (E_RNA) where: Base-Base interactions energy: -170.757 where: short stacking energy: -102.393 Base-Backbone interact. energy: -0.787 local terms energy: -111.736754 where: bonds (distance) C4'-P energy: -22.279 bonds (distance) P-C4' energy: -21.229 flat angles C4'-P-C4' energy: -24.339 flat angles P-C4'-P energy: -18.672 tors. eta vs tors. theta energy: -25.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -332.104817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.104817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.104817 (E_RNA) where: Base-Base interactions energy: -206.938 where: short stacking energy: -99.584 Base-Backbone interact. energy: -0.830 local terms energy: -124.336321 where: bonds (distance) C4'-P energy: -26.965 bonds (distance) P-C4' energy: -29.259 flat angles C4'-P-C4' energy: -29.743 flat angles P-C4'-P energy: -15.461 tors. eta vs tors. theta energy: -22.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -249.319544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.319544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.319544 (E_RNA) where: Base-Base interactions energy: -150.844 where: short stacking energy: -53.540 Base-Backbone interact. energy: -0.420 local terms energy: -98.055851 where: bonds (distance) C4'-P energy: -22.436 bonds (distance) P-C4' energy: -27.955 flat angles C4'-P-C4' energy: -26.835 flat angles P-C4'-P energy: -15.680 tors. eta vs tors. theta energy: -5.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -223.774449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.774449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.774449 (E_RNA) where: Base-Base interactions energy: -98.212 where: short stacking energy: -69.814 Base-Backbone interact. energy: -1.483 local terms energy: -124.079152 where: bonds (distance) C4'-P energy: -24.222 bonds (distance) P-C4' energy: -27.483 flat angles C4'-P-C4' energy: -30.790 flat angles P-C4'-P energy: -18.746 tors. eta vs tors. theta energy: -22.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -245.026071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.026071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.026071 (E_RNA) where: Base-Base interactions energy: -138.655 where: short stacking energy: -88.937 Base-Backbone interact. energy: -0.109 local terms energy: -106.262692 where: bonds (distance) C4'-P energy: -27.731 bonds (distance) P-C4' energy: -23.516 flat angles C4'-P-C4' energy: -19.555 flat angles P-C4'-P energy: -20.030 tors. eta vs tors. theta energy: -15.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -206.283023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.283023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.283023 (E_RNA) where: Base-Base interactions energy: -102.322 where: short stacking energy: -49.744 Base-Backbone interact. energy: -0.424 local terms energy: -103.536843 where: bonds (distance) C4'-P energy: -29.523 bonds (distance) P-C4' energy: -26.256 flat angles C4'-P-C4' energy: -20.104 flat angles P-C4'-P energy: -20.076 tors. eta vs tors. theta energy: -7.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -209.899342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.899342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.899342 (E_RNA) where: Base-Base interactions energy: -113.956 where: short stacking energy: -63.488 Base-Backbone interact. energy: -0.465 local terms energy: -95.478058 where: bonds (distance) C4'-P energy: -24.085 bonds (distance) P-C4' energy: -22.602 flat angles C4'-P-C4' energy: -22.445 flat angles P-C4'-P energy: -11.017 tors. eta vs tors. theta energy: -15.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -189.673125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.673125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.673125 (E_RNA) where: Base-Base interactions energy: -102.670 where: short stacking energy: -52.206 Base-Backbone interact. energy: -0.226 local terms energy: -86.776571 where: bonds (distance) C4'-P energy: -27.211 bonds (distance) P-C4' energy: -19.303 flat angles C4'-P-C4' energy: -19.685 flat angles P-C4'-P energy: -13.739 tors. eta vs tors. theta energy: -6.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -139.888639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.888639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.888639 (E_RNA) where: Base-Base interactions energy: -49.258 where: short stacking energy: -49.258 Base-Backbone interact. energy: -0.392 local terms energy: -90.238154 where: bonds (distance) C4'-P energy: -28.794 bonds (distance) P-C4' energy: -21.672 flat angles C4'-P-C4' energy: -18.297 flat angles P-C4'-P energy: -12.439 tors. eta vs tors. theta energy: -9.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -135.802786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.802786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.802786 (E_RNA) where: Base-Base interactions energy: -61.748 where: short stacking energy: -41.781 Base-Backbone interact. energy: -1.095 local terms energy: -72.960298 where: bonds (distance) C4'-P energy: -21.476 bonds (distance) P-C4' energy: -16.918 flat angles C4'-P-C4' energy: -15.746 flat angles P-C4'-P energy: -12.969 tors. eta vs tors. theta energy: -5.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -300.356337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.356337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.356337 (E_RNA) where: Base-Base interactions energy: -173.390 where: short stacking energy: -97.986 Base-Backbone interact. energy: 0.366 local terms energy: -127.332509 where: bonds (distance) C4'-P energy: -29.069 bonds (distance) P-C4' energy: -30.076 flat angles C4'-P-C4' energy: -20.777 flat angles P-C4'-P energy: -18.850 tors. eta vs tors. theta energy: -28.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -359.352714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.352714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.352714 (E_RNA) where: Base-Base interactions energy: -234.797 where: short stacking energy: -118.090 Base-Backbone interact. energy: -0.027 local terms energy: -124.528719 where: bonds (distance) C4'-P energy: -27.845 bonds (distance) P-C4' energy: -24.913 flat angles C4'-P-C4' energy: -26.535 flat angles P-C4'-P energy: -16.181 tors. eta vs tors. theta energy: -29.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -235.422278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.422278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.422278 (E_RNA) where: Base-Base interactions energy: -132.465 where: short stacking energy: -70.970 Base-Backbone interact. energy: -0.678 local terms energy: -102.279287 where: bonds (distance) C4'-P energy: -23.103 bonds (distance) P-C4' energy: -27.522 flat angles C4'-P-C4' energy: -22.717 flat angles P-C4'-P energy: -13.919 tors. eta vs tors. theta energy: -15.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -244.422550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.422550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.422550 (E_RNA) where: Base-Base interactions energy: -139.175 where: short stacking energy: -86.649 Base-Backbone interact. energy: -0.255 local terms energy: -104.991770 where: bonds (distance) C4'-P energy: -19.351 bonds (distance) P-C4' energy: -27.937 flat angles C4'-P-C4' energy: -26.645 flat angles P-C4'-P energy: -17.601 tors. eta vs tors. theta energy: -13.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -190.370785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.370785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.370785 (E_RNA) where: Base-Base interactions energy: -80.369 where: short stacking energy: -64.084 Base-Backbone interact. energy: -1.006 local terms energy: -108.996262 where: bonds (distance) C4'-P energy: -30.542 bonds (distance) P-C4' energy: -27.415 flat angles C4'-P-C4' energy: -22.712 flat angles P-C4'-P energy: -18.453 tors. eta vs tors. theta energy: -9.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -221.788331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.788331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.788331 (E_RNA) where: Base-Base interactions energy: -113.959 where: short stacking energy: -59.452 Base-Backbone interact. energy: 0.007 local terms energy: -107.835807 where: bonds (distance) C4'-P energy: -22.583 bonds (distance) P-C4' energy: -26.587 flat angles C4'-P-C4' energy: -25.686 flat angles P-C4'-P energy: -19.559 tors. eta vs tors. theta energy: -13.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -174.214185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.214185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.214185 (E_RNA) where: Base-Base interactions energy: -81.598 where: short stacking energy: -56.107 Base-Backbone interact. energy: -0.084 local terms energy: -92.532184 where: bonds (distance) C4'-P energy: -23.853 bonds (distance) P-C4' energy: -20.801 flat angles C4'-P-C4' energy: -26.151 flat angles P-C4'-P energy: -15.861 tors. eta vs tors. theta energy: -5.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -164.823743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.823743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.823743 (E_RNA) where: Base-Base interactions energy: -65.378 where: short stacking energy: -49.187 Base-Backbone interact. energy: -1.351 local terms energy: -98.095046 where: bonds (distance) C4'-P energy: -27.558 bonds (distance) P-C4' energy: -23.225 flat angles C4'-P-C4' energy: -26.639 flat angles P-C4'-P energy: -16.801 tors. eta vs tors. theta energy: -3.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -269.858682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.858682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.858682 (E_RNA) where: Base-Base interactions energy: -167.317 where: short stacking energy: -76.057 Base-Backbone interact. energy: 0.159 local terms energy: -102.700481 where: bonds (distance) C4'-P energy: -27.727 bonds (distance) P-C4' energy: -15.441 flat angles C4'-P-C4' energy: -23.663 flat angles P-C4'-P energy: -15.649 tors. eta vs tors. theta energy: -20.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -113.239222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.239222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.239222 (E_RNA) where: Base-Base interactions energy: -35.920 where: short stacking energy: -31.664 Base-Backbone interact. energy: -0.219 local terms energy: -77.100261 where: bonds (distance) C4'-P energy: -21.960 bonds (distance) P-C4' energy: -20.693 flat angles C4'-P-C4' energy: -23.891 flat angles P-C4'-P energy: -9.711 tors. eta vs tors. theta energy: -0.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -358.718359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.718359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.718359 (E_RNA) where: Base-Base interactions energy: -225.927 where: short stacking energy: -104.063 Base-Backbone interact. energy: -1.577 local terms energy: -131.213499 where: bonds (distance) C4'-P energy: -29.673 bonds (distance) P-C4' energy: -29.508 flat angles C4'-P-C4' energy: -29.552 flat angles P-C4'-P energy: -15.936 tors. eta vs tors. theta energy: -26.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -310.977049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.977049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.977049 (E_RNA) where: Base-Base interactions energy: -185.501 where: short stacking energy: -114.852 Base-Backbone interact. energy: -0.600 local terms energy: -124.875756 where: bonds (distance) C4'-P energy: -26.087 bonds (distance) P-C4' energy: -21.831 flat angles C4'-P-C4' energy: -30.598 flat angles P-C4'-P energy: -17.917 tors. eta vs tors. theta energy: -28.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -272.720580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.720580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.720580 (E_RNA) where: Base-Base interactions energy: -151.501 where: short stacking energy: -105.732 Base-Backbone interact. energy: -0.119 local terms energy: -121.100209 where: bonds (distance) C4'-P energy: -25.649 bonds (distance) P-C4' energy: -22.515 flat angles C4'-P-C4' energy: -27.541 flat angles P-C4'-P energy: -16.531 tors. eta vs tors. theta energy: -28.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -247.970528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.970528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.970528 (E_RNA) where: Base-Base interactions energy: -146.389 where: short stacking energy: -70.119 Base-Backbone interact. energy: -1.040 local terms energy: -100.541221 where: bonds (distance) C4'-P energy: -24.042 bonds (distance) P-C4' energy: -23.603 flat angles C4'-P-C4' energy: -21.095 flat angles P-C4'-P energy: -22.553 tors. eta vs tors. theta energy: -9.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -221.393930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.393930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.393930 (E_RNA) where: Base-Base interactions energy: -115.546 where: short stacking energy: -67.466 Base-Backbone interact. energy: 0.568 local terms energy: -106.415797 where: bonds (distance) C4'-P energy: -20.191 bonds (distance) P-C4' energy: -28.597 flat angles C4'-P-C4' energy: -31.109 flat angles P-C4'-P energy: -14.892 tors. eta vs tors. theta energy: -11.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -206.194007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.194007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.194007 (E_RNA) where: Base-Base interactions energy: -115.275 where: short stacking energy: -57.275 Base-Backbone interact. energy: -0.394 local terms energy: -90.524721 where: bonds (distance) C4'-P energy: -22.969 bonds (distance) P-C4' energy: -22.212 flat angles C4'-P-C4' energy: -22.772 flat angles P-C4'-P energy: -13.036 tors. eta vs tors. theta energy: -9.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -147.443869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.443869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.443869 (E_RNA) where: Base-Base interactions energy: -67.521 where: short stacking energy: -59.449 Base-Backbone interact. energy: 0.173 local terms energy: -80.095509 where: bonds (distance) C4'-P energy: -25.454 bonds (distance) P-C4' energy: -20.594 flat angles C4'-P-C4' energy: -13.446 flat angles P-C4'-P energy: -12.602 tors. eta vs tors. theta energy: -8.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -240.692738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.692738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.692738 (E_RNA) where: Base-Base interactions energy: -152.427 where: short stacking energy: -79.849 Base-Backbone interact. energy: -0.171 local terms energy: -88.095089 where: bonds (distance) C4'-P energy: -21.074 bonds (distance) P-C4' energy: -19.543 flat angles C4'-P-C4' energy: -16.577 flat angles P-C4'-P energy: -10.987 tors. eta vs tors. theta energy: -19.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -301.099543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.099543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.099543 (E_RNA) where: Base-Base interactions energy: -203.807 where: short stacking energy: -81.272 Base-Backbone interact. energy: 0.860 local terms energy: -98.152972 where: bonds (distance) C4'-P energy: -23.366 bonds (distance) P-C4' energy: -25.602 flat angles C4'-P-C4' energy: -20.467 flat angles P-C4'-P energy: -10.538 tors. eta vs tors. theta energy: -18.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -129.457087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.457087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.457087 (E_RNA) where: Base-Base interactions energy: -49.540 where: short stacking energy: -49.363 Base-Backbone interact. energy: -0.877 local terms energy: -79.039958 where: bonds (distance) C4'-P energy: -16.671 bonds (distance) P-C4' energy: -20.028 flat angles C4'-P-C4' energy: -25.280 flat angles P-C4'-P energy: -14.069 tors. eta vs tors. theta energy: -2.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -395.706888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.706888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.706888 (E_RNA) where: Base-Base interactions energy: -252.647 where: short stacking energy: -117.554 Base-Backbone interact. energy: -1.096 local terms energy: -141.963646 where: bonds (distance) C4'-P energy: -24.754 bonds (distance) P-C4' energy: -30.238 flat angles C4'-P-C4' energy: -31.552 flat angles P-C4'-P energy: -22.231 tors. eta vs tors. theta energy: -33.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -295.301514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.301514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.301514 (E_RNA) where: Base-Base interactions energy: -172.808 where: short stacking energy: -100.263 Base-Backbone interact. energy: -0.968 local terms energy: -121.525850 where: bonds (distance) C4'-P energy: -21.836 bonds (distance) P-C4' energy: -27.825 flat angles C4'-P-C4' energy: -27.341 flat angles P-C4'-P energy: -20.739 tors. eta vs tors. theta energy: -23.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -301.236918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.236918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.236918 (E_RNA) where: Base-Base interactions energy: -178.593 where: short stacking energy: -89.291 Base-Backbone interact. energy: -1.405 local terms energy: -121.238967 where: bonds (distance) C4'-P energy: -27.869 bonds (distance) P-C4' energy: -24.770 flat angles C4'-P-C4' energy: -26.076 flat angles P-C4'-P energy: -20.441 tors. eta vs tors. theta energy: -22.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -259.145914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.145914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.145914 (E_RNA) where: Base-Base interactions energy: -157.677 where: short stacking energy: -65.010 Base-Backbone interact. energy: -1.788 local terms energy: -99.681400 where: bonds (distance) C4'-P energy: -24.406 bonds (distance) P-C4' energy: -27.798 flat angles C4'-P-C4' energy: -20.902 flat angles P-C4'-P energy: -14.056 tors. eta vs tors. theta energy: -12.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -198.685490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.685490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.685490 (E_RNA) where: Base-Base interactions energy: -104.073 where: short stacking energy: -71.354 Base-Backbone interact. energy: -0.377 local terms energy: -94.235763 where: bonds (distance) C4'-P energy: -29.720 bonds (distance) P-C4' energy: -22.557 flat angles C4'-P-C4' energy: -25.049 flat angles P-C4'-P energy: -9.518 tors. eta vs tors. theta energy: -7.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -223.588304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.588304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.588304 (E_RNA) where: Base-Base interactions energy: -128.071 where: short stacking energy: -75.664 Base-Backbone interact. energy: -0.290 local terms energy: -95.227666 where: bonds (distance) C4'-P energy: -24.279 bonds (distance) P-C4' energy: -17.283 flat angles C4'-P-C4' energy: -22.217 flat angles P-C4'-P energy: -16.912 tors. eta vs tors. theta energy: -14.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -203.576105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.576105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.576105 (E_RNA) where: Base-Base interactions energy: -105.295 where: short stacking energy: -61.998 Base-Backbone interact. energy: -0.924 local terms energy: -97.357244 where: bonds (distance) C4'-P energy: -18.253 bonds (distance) P-C4' energy: -22.741 flat angles C4'-P-C4' energy: -21.445 flat angles P-C4'-P energy: -22.294 tors. eta vs tors. theta energy: -12.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -315.795068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.795068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.795068 (E_RNA) where: Base-Base interactions energy: -207.433 where: short stacking energy: -91.557 Base-Backbone interact. energy: -0.408 local terms energy: -107.953905 where: bonds (distance) C4'-P energy: -19.922 bonds (distance) P-C4' energy: -24.160 flat angles C4'-P-C4' energy: -29.711 flat angles P-C4'-P energy: -13.820 tors. eta vs tors. theta energy: -20.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -284.986103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.986103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.986103 (E_RNA) where: Base-Base interactions energy: -182.826 where: short stacking energy: -76.116 Base-Backbone interact. energy: 0.043 local terms energy: -102.202889 where: bonds (distance) C4'-P energy: -25.235 bonds (distance) P-C4' energy: -19.251 flat angles C4'-P-C4' energy: -24.516 flat angles P-C4'-P energy: -15.839 tors. eta vs tors. theta energy: -17.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -123.017634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.017634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.017634 (E_RNA) where: Base-Base interactions energy: -36.117 where: short stacking energy: -35.331 Base-Backbone interact. energy: -0.199 local terms energy: -86.702236 where: bonds (distance) C4'-P energy: -22.436 bonds (distance) P-C4' energy: -23.961 flat angles C4'-P-C4' energy: -18.387 flat angles P-C4'-P energy: -17.088 tors. eta vs tors. theta energy: -4.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -397.335515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.335515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.335515 (E_RNA) where: Base-Base interactions energy: -250.316 where: short stacking energy: -111.743 Base-Backbone interact. energy: -1.130 local terms energy: -145.889796 where: bonds (distance) C4'-P energy: -28.121 bonds (distance) P-C4' energy: -28.472 flat angles C4'-P-C4' energy: -31.306 flat angles P-C4'-P energy: -23.392 tors. eta vs tors. theta energy: -34.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -310.603961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.603961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.603961 (E_RNA) where: Base-Base interactions energy: -180.494 where: short stacking energy: -114.568 Base-Backbone interact. energy: -0.588 local terms energy: -129.521717 where: bonds (distance) C4'-P energy: -27.631 bonds (distance) P-C4' energy: -25.442 flat angles C4'-P-C4' energy: -30.577 flat angles P-C4'-P energy: -19.645 tors. eta vs tors. theta energy: -26.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -322.058070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.058070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.058070 (E_RNA) where: Base-Base interactions energy: -205.701 where: short stacking energy: -108.648 Base-Backbone interact. energy: -0.496 local terms energy: -115.861043 where: bonds (distance) C4'-P energy: -25.006 bonds (distance) P-C4' energy: -22.359 flat angles C4'-P-C4' energy: -25.939 flat angles P-C4'-P energy: -14.890 tors. eta vs tors. theta energy: -27.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -277.949857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.949857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.949857 (E_RNA) where: Base-Base interactions energy: -175.069 where: short stacking energy: -72.117 Base-Backbone interact. energy: -1.140 local terms energy: -101.740593 where: bonds (distance) C4'-P energy: -20.341 bonds (distance) P-C4' energy: -22.830 flat angles C4'-P-C4' energy: -26.380 flat angles P-C4'-P energy: -20.866 tors. eta vs tors. theta energy: -11.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -257.809514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.809514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.809514 (E_RNA) where: Base-Base interactions energy: -156.703 where: short stacking energy: -74.542 Base-Backbone interact. energy: -0.221 local terms energy: -100.885724 where: bonds (distance) C4'-P energy: -19.225 bonds (distance) P-C4' energy: -24.296 flat angles C4'-P-C4' energy: -28.864 flat angles P-C4'-P energy: -15.216 tors. eta vs tors. theta energy: -13.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -207.800000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.800000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.800000 (E_RNA) where: Base-Base interactions energy: -98.109 where: short stacking energy: -83.868 Base-Backbone interact. energy: 0.074 local terms energy: -109.764886 where: bonds (distance) C4'-P energy: -21.435 bonds (distance) P-C4' energy: -25.368 flat angles C4'-P-C4' energy: -21.876 flat angles P-C4'-P energy: -23.412 tors. eta vs tors. theta energy: -17.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -330.764628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.764628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.764628 (E_RNA) where: Base-Base interactions energy: -208.803 where: short stacking energy: -83.249 Base-Backbone interact. energy: -0.240 local terms energy: -121.721608 where: bonds (distance) C4'-P energy: -27.065 bonds (distance) P-C4' energy: -28.255 flat angles C4'-P-C4' energy: -29.582 flat angles P-C4'-P energy: -16.929 tors. eta vs tors. theta energy: -19.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -208.830816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.830816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.830816 (E_RNA) where: Base-Base interactions energy: -112.397 where: short stacking energy: -64.822 Base-Backbone interact. energy: -0.327 local terms energy: -96.107631 where: bonds (distance) C4'-P energy: -23.537 bonds (distance) P-C4' energy: -24.409 flat angles C4'-P-C4' energy: -21.363 flat angles P-C4'-P energy: -11.802 tors. eta vs tors. theta energy: -14.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -288.672832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.672832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.672832 (E_RNA) where: Base-Base interactions energy: -194.252 where: short stacking energy: -77.758 Base-Backbone interact. energy: -0.047 local terms energy: -94.373161 where: bonds (distance) C4'-P energy: -12.282 bonds (distance) P-C4' energy: -17.205 flat angles C4'-P-C4' energy: -29.465 flat angles P-C4'-P energy: -15.089 tors. eta vs tors. theta energy: -20.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -127.530342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.530342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.530342 (E_RNA) where: Base-Base interactions energy: -46.059 where: short stacking energy: -44.497 Base-Backbone interact. energy: -0.250 local terms energy: -81.220889 where: bonds (distance) C4'-P energy: -21.898 bonds (distance) P-C4' energy: -21.778 flat angles C4'-P-C4' energy: -23.472 flat angles P-C4'-P energy: -6.505 tors. eta vs tors. theta energy: -7.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -400.765539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.765539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.765539 (E_RNA) where: Base-Base interactions energy: -271.253 where: short stacking energy: -120.950 Base-Backbone interact. energy: 1.473 local terms energy: -130.985630 where: bonds (distance) C4'-P energy: -26.452 bonds (distance) P-C4' energy: -23.012 flat angles C4'-P-C4' energy: -28.112 flat angles P-C4'-P energy: -15.712 tors. eta vs tors. theta energy: -37.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -350.783445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.783445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.783445 (E_RNA) where: Base-Base interactions energy: -216.978 where: short stacking energy: -117.537 Base-Backbone interact. energy: -0.744 local terms energy: -133.061624 where: bonds (distance) C4'-P energy: -22.908 bonds (distance) P-C4' energy: -29.192 flat angles C4'-P-C4' energy: -28.135 flat angles P-C4'-P energy: -21.686 tors. eta vs tors. theta energy: -31.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -285.456009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.456009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.456009 (E_RNA) where: Base-Base interactions energy: -172.317 where: short stacking energy: -93.807 Base-Backbone interact. energy: -0.679 local terms energy: -112.459831 where: bonds (distance) C4'-P energy: -24.101 bonds (distance) P-C4' energy: -22.632 flat angles C4'-P-C4' energy: -25.465 flat angles P-C4'-P energy: -14.875 tors. eta vs tors. theta energy: -25.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -270.314368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.314368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.314368 (E_RNA) where: Base-Base interactions energy: -150.798 where: short stacking energy: -83.507 Base-Backbone interact. energy: -0.689 local terms energy: -118.827491 where: bonds (distance) C4'-P energy: -25.270 bonds (distance) P-C4' energy: -31.563 flat angles C4'-P-C4' energy: -25.422 flat angles P-C4'-P energy: -16.461 tors. eta vs tors. theta energy: -20.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -252.334251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.334251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.334251 (E_RNA) where: Base-Base interactions energy: -152.559 where: short stacking energy: -78.130 Base-Backbone interact. energy: -0.423 local terms energy: -99.352445 where: bonds (distance) C4'-P energy: -25.117 bonds (distance) P-C4' energy: -25.205 flat angles C4'-P-C4' energy: -23.463 flat angles P-C4'-P energy: -13.009 tors. eta vs tors. theta energy: -12.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -350.183623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.183623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.183623 (E_RNA) where: Base-Base interactions energy: -224.686 where: short stacking energy: -103.923 Base-Backbone interact. energy: -0.452 local terms energy: -125.045963 where: bonds (distance) C4'-P energy: -21.484 bonds (distance) P-C4' energy: -25.575 flat angles C4'-P-C4' energy: -25.884 flat angles P-C4'-P energy: -19.716 tors. eta vs tors. theta energy: -32.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -161.826711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.826711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.826711 (E_RNA) where: Base-Base interactions energy: -67.700 where: short stacking energy: -48.001 Base-Backbone interact. energy: -0.962 local terms energy: -93.165059 where: bonds (distance) C4'-P energy: -26.160 bonds (distance) P-C4' energy: -24.211 flat angles C4'-P-C4' energy: -25.594 flat angles P-C4'-P energy: -13.107 tors. eta vs tors. theta energy: -4.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -286.455426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.455426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.455426 (E_RNA) where: Base-Base interactions energy: -187.450 where: short stacking energy: -82.895 Base-Backbone interact. energy: -1.258 local terms energy: -97.747664 where: bonds (distance) C4'-P energy: -21.061 bonds (distance) P-C4' energy: -18.984 flat angles C4'-P-C4' energy: -26.074 flat angles P-C4'-P energy: -12.711 tors. eta vs tors. theta energy: -18.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -233.121061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.121061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.121061 (E_RNA) where: Base-Base interactions energy: -139.247 where: short stacking energy: -68.065 Base-Backbone interact. energy: -0.385 local terms energy: -93.489035 where: bonds (distance) C4'-P energy: -26.114 bonds (distance) P-C4' energy: -20.110 flat angles C4'-P-C4' energy: -24.521 flat angles P-C4'-P energy: -10.274 tors. eta vs tors. theta energy: -12.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -131.478096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.478096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.478096 (E_RNA) where: Base-Base interactions energy: -43.749 where: short stacking energy: -35.714 Base-Backbone interact. energy: -0.783 local terms energy: -86.946161 where: bonds (distance) C4'-P energy: -26.684 bonds (distance) P-C4' energy: -27.070 flat angles C4'-P-C4' energy: -22.783 flat angles P-C4'-P energy: -19.127 tors. eta vs tors. theta energy: 8.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -400.240474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.240474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.240474 (E_RNA) where: Base-Base interactions energy: -272.561 where: short stacking energy: -122.248 Base-Backbone interact. energy: -0.618 local terms energy: -127.061648 where: bonds (distance) C4'-P energy: -26.687 bonds (distance) P-C4' energy: -22.435 flat angles C4'-P-C4' energy: -22.801 flat angles P-C4'-P energy: -18.900 tors. eta vs tors. theta energy: -36.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -348.687851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.687851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.687851 (E_RNA) where: Base-Base interactions energy: -212.912 where: short stacking energy: -91.381 Base-Backbone interact. energy: -1.336 local terms energy: -134.439679 where: bonds (distance) C4'-P energy: -25.629 bonds (distance) P-C4' energy: -31.057 flat angles C4'-P-C4' energy: -31.501 flat angles P-C4'-P energy: -19.481 tors. eta vs tors. theta energy: -26.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -321.024666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.024666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.024666 (E_RNA) where: Base-Base interactions energy: -203.898 where: short stacking energy: -100.509 Base-Backbone interact. energy: -0.060 local terms energy: -117.066081 where: bonds (distance) C4'-P energy: -25.188 bonds (distance) P-C4' energy: -24.659 flat angles C4'-P-C4' energy: -28.774 flat angles P-C4'-P energy: -12.501 tors. eta vs tors. theta energy: -25.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -261.660550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.660550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.660550 (E_RNA) where: Base-Base interactions energy: -147.499 where: short stacking energy: -71.243 Base-Backbone interact. energy: -0.149 local terms energy: -114.012905 where: bonds (distance) C4'-P energy: -26.677 bonds (distance) P-C4' energy: -29.068 flat angles C4'-P-C4' energy: -26.627 flat angles P-C4'-P energy: -17.420 tors. eta vs tors. theta energy: -14.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -372.428452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.428452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.428452 (E_RNA) where: Base-Base interactions energy: -247.032 where: short stacking energy: -103.107 Base-Backbone interact. energy: -0.104 local terms energy: -125.292695 where: bonds (distance) C4'-P energy: -28.051 bonds (distance) P-C4' energy: -27.490 flat angles C4'-P-C4' energy: -26.713 flat angles P-C4'-P energy: -22.360 tors. eta vs tors. theta energy: -20.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -262.154360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.154360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.154360 (E_RNA) where: Base-Base interactions energy: -152.059 where: short stacking energy: -76.763 Base-Backbone interact. energy: 0.322 local terms energy: -110.418119 where: bonds (distance) C4'-P energy: -25.650 bonds (distance) P-C4' energy: -26.656 flat angles C4'-P-C4' energy: -23.088 flat angles P-C4'-P energy: -22.222 tors. eta vs tors. theta energy: -12.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -316.432235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.432235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.432235 (E_RNA) where: Base-Base interactions energy: -203.812 where: short stacking energy: -84.564 Base-Backbone interact. energy: -1.624 local terms energy: -110.996596 where: bonds (distance) C4'-P energy: -20.433 bonds (distance) P-C4' energy: -31.317 flat angles C4'-P-C4' energy: -26.690 flat angles P-C4'-P energy: -15.384 tors. eta vs tors. theta energy: -17.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -139.355886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.355886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.355886 (E_RNA) where: Base-Base interactions energy: -52.148 where: short stacking energy: -46.348 Base-Backbone interact. energy: -0.195 local terms energy: -87.012446 where: bonds (distance) C4'-P energy: -29.301 bonds (distance) P-C4' energy: -18.749 flat angles C4'-P-C4' energy: -15.464 flat angles P-C4'-P energy: -20.871 tors. eta vs tors. theta energy: -2.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -236.246894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.246894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.246894 (E_RNA) where: Base-Base interactions energy: -140.316 where: short stacking energy: -61.867 Base-Backbone interact. energy: -0.711 local terms energy: -95.219549 where: bonds (distance) C4'-P energy: -20.631 bonds (distance) P-C4' energy: -22.460 flat angles C4'-P-C4' energy: -25.297 flat angles P-C4'-P energy: -14.141 tors. eta vs tors. theta energy: -12.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -127.207446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.207446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.207446 (E_RNA) where: Base-Base interactions energy: -50.926 where: short stacking energy: -50.875 Base-Backbone interact. energy: 1.164 local terms energy: -77.445292 where: bonds (distance) C4'-P energy: -16.171 bonds (distance) P-C4' energy: -23.105 flat angles C4'-P-C4' energy: -25.954 flat angles P-C4'-P energy: -15.315 tors. eta vs tors. theta energy: 3.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -391.988424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.988424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.988424 (E_RNA) where: Base-Base interactions energy: -265.952 where: short stacking energy: -110.608 Base-Backbone interact. energy: -0.289 local terms energy: -125.748045 where: bonds (distance) C4'-P energy: -30.174 bonds (distance) P-C4' energy: -21.711 flat angles C4'-P-C4' energy: -29.873 flat angles P-C4'-P energy: -16.203 tors. eta vs tors. theta energy: -27.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -359.013591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.013591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.013591 (E_RNA) where: Base-Base interactions energy: -233.832 where: short stacking energy: -107.275 Base-Backbone interact. energy: -1.490 local terms energy: -123.691322 where: bonds (distance) C4'-P energy: -28.040 bonds (distance) P-C4' energy: -27.317 flat angles C4'-P-C4' energy: -20.766 flat angles P-C4'-P energy: -20.853 tors. eta vs tors. theta energy: -26.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -308.065997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.065997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.065997 (E_RNA) where: Base-Base interactions energy: -194.137 where: short stacking energy: -87.083 Base-Backbone interact. energy: -0.727 local terms energy: -113.201370 where: bonds (distance) C4'-P energy: -21.454 bonds (distance) P-C4' energy: -24.836 flat angles C4'-P-C4' energy: -24.997 flat angles P-C4'-P energy: -25.341 tors. eta vs tors. theta energy: -16.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -400.329030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.329030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.329030 (E_RNA) where: Base-Base interactions energy: -269.599 where: short stacking energy: -114.757 Base-Backbone interact. energy: 1.670 local terms energy: -132.399948 where: bonds (distance) C4'-P energy: -26.204 bonds (distance) P-C4' energy: -22.122 flat angles C4'-P-C4' energy: -30.579 flat angles P-C4'-P energy: -19.202 tors. eta vs tors. theta energy: -34.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -231.317160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.317160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.317160 (E_RNA) where: Base-Base interactions energy: -129.178 where: short stacking energy: -80.000 Base-Backbone interact. energy: 0.040 local terms energy: -102.179118 where: bonds (distance) C4'-P energy: -28.651 bonds (distance) P-C4' energy: -21.901 flat angles C4'-P-C4' energy: -21.352 flat angles P-C4'-P energy: -15.578 tors. eta vs tors. theta energy: -14.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -330.993382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.993382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.993382 (E_RNA) where: Base-Base interactions energy: -221.624 where: short stacking energy: -100.791 Base-Backbone interact. energy: -1.797 local terms energy: -107.572271 where: bonds (distance) C4'-P energy: -20.615 bonds (distance) P-C4' energy: -23.895 flat angles C4'-P-C4' energy: -26.417 flat angles P-C4'-P energy: -15.882 tors. eta vs tors. theta energy: -20.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -242.967569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.967569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.967569 (E_RNA) where: Base-Base interactions energy: -146.511 where: short stacking energy: -85.955 Base-Backbone interact. energy: -0.079 local terms energy: -96.377562 where: bonds (distance) C4'-P energy: -26.026 bonds (distance) P-C4' energy: -16.585 flat angles C4'-P-C4' energy: -28.630 flat angles P-C4'-P energy: -6.692 tors. eta vs tors. theta energy: -18.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -233.710121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.710121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.710121 (E_RNA) where: Base-Base interactions energy: -144.877 where: short stacking energy: -63.761 Base-Backbone interact. energy: -1.249 local terms energy: -87.583748 where: bonds (distance) C4'-P energy: -26.088 bonds (distance) P-C4' energy: -27.181 flat angles C4'-P-C4' energy: -17.127 flat angles P-C4'-P energy: -4.773 tors. eta vs tors. theta energy: -12.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -129.485543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.485543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.485543 (E_RNA) where: Base-Base interactions energy: -63.047 where: short stacking energy: -37.748 Base-Backbone interact. energy: 3.422 local terms energy: -69.860429 where: bonds (distance) C4'-P energy: -23.847 bonds (distance) P-C4' energy: -18.346 flat angles C4'-P-C4' energy: -22.971 flat angles P-C4'-P energy: -9.984 tors. eta vs tors. theta energy: 5.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -115.951696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.951696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.951696 (E_RNA) where: Base-Base interactions energy: -25.965 where: short stacking energy: -21.856 Base-Backbone interact. energy: -0.786 local terms energy: -89.200509 where: bonds (distance) C4'-P energy: -29.442 bonds (distance) P-C4' energy: -27.090 flat angles C4'-P-C4' energy: -18.508 flat angles P-C4'-P energy: -15.889 tors. eta vs tors. theta energy: 1.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -393.353994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.353994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.353994 (E_RNA) where: Base-Base interactions energy: -263.826 where: short stacking energy: -112.192 Base-Backbone interact. energy: -1.657 local terms energy: -127.871413 where: bonds (distance) C4'-P energy: -25.715 bonds (distance) P-C4' energy: -24.517 flat angles C4'-P-C4' energy: -30.194 flat angles P-C4'-P energy: -19.436 tors. eta vs tors. theta energy: -28.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -356.663183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.663183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.663183 (E_RNA) where: Base-Base interactions energy: -216.001 where: short stacking energy: -110.937 Base-Backbone interact. energy: -1.444 local terms energy: -139.218040 where: bonds (distance) C4'-P energy: -29.893 bonds (distance) P-C4' energy: -28.121 flat angles C4'-P-C4' energy: -29.119 flat angles P-C4'-P energy: -22.941 tors. eta vs tors. theta energy: -29.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -440.406301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.406301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.406301 (E_RNA) where: Base-Base interactions energy: -305.687 where: short stacking energy: -123.895 Base-Backbone interact. energy: -0.808 local terms energy: -133.912179 where: bonds (distance) C4'-P energy: -24.845 bonds (distance) P-C4' energy: -26.909 flat angles C4'-P-C4' energy: -30.639 flat angles P-C4'-P energy: -16.039 tors. eta vs tors. theta energy: -35.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -328.664141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.664141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.664141 (E_RNA) where: Base-Base interactions energy: -214.602 where: short stacking energy: -89.599 Base-Backbone interact. energy: -1.650 local terms energy: -112.412576 where: bonds (distance) C4'-P energy: -23.768 bonds (distance) P-C4' energy: -28.357 flat angles C4'-P-C4' energy: -21.604 flat angles P-C4'-P energy: -10.275 tors. eta vs tors. theta energy: -28.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -350.543155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.543155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.543155 (E_RNA) where: Base-Base interactions energy: -221.455 where: short stacking energy: -102.462 Base-Backbone interact. energy: -0.974 local terms energy: -128.114700 where: bonds (distance) C4'-P energy: -21.107 bonds (distance) P-C4' energy: -26.572 flat angles C4'-P-C4' energy: -32.469 flat angles P-C4'-P energy: -20.021 tors. eta vs tors. theta energy: -27.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -231.469152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.469152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.469152 (E_RNA) where: Base-Base interactions energy: -125.453 where: short stacking energy: -79.405 Base-Backbone interact. energy: 0.379 local terms energy: -106.395380 where: bonds (distance) C4'-P energy: -24.192 bonds (distance) P-C4' energy: -24.115 flat angles C4'-P-C4' energy: -27.082 flat angles P-C4'-P energy: -13.223 tors. eta vs tors. theta energy: -17.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -282.262315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.262315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.262315 (E_RNA) where: Base-Base interactions energy: -184.032 where: short stacking energy: -80.421 Base-Backbone interact. energy: -0.566 local terms energy: -97.664987 where: bonds (distance) C4'-P energy: -12.574 bonds (distance) P-C4' energy: -27.149 flat angles C4'-P-C4' energy: -21.556 flat angles P-C4'-P energy: -20.396 tors. eta vs tors. theta energy: -15.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -232.919797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.919797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.919797 (E_RNA) where: Base-Base interactions energy: -141.916 where: short stacking energy: -78.131 Base-Backbone interact. energy: -0.266 local terms energy: -90.738424 where: bonds (distance) C4'-P energy: -26.380 bonds (distance) P-C4' energy: -20.548 flat angles C4'-P-C4' energy: -13.385 flat angles P-C4'-P energy: -17.692 tors. eta vs tors. theta energy: -12.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -168.752181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.752181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.752181 (E_RNA) where: Base-Base interactions energy: -92.754 where: short stacking energy: -58.727 Base-Backbone interact. energy: 0.691 local terms energy: -76.689919 where: bonds (distance) C4'-P energy: -17.528 bonds (distance) P-C4' energy: -21.767 flat angles C4'-P-C4' energy: -18.518 flat angles P-C4'-P energy: -14.993 tors. eta vs tors. theta energy: -3.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -117.382038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.382038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.382038 (E_RNA) where: Base-Base interactions energy: -33.482 where: short stacking energy: -33.482 Base-Backbone interact. energy: -0.233 local terms energy: -83.666913 where: bonds (distance) C4'-P energy: -22.078 bonds (distance) P-C4' energy: -26.861 flat angles C4'-P-C4' energy: -19.564 flat angles P-C4'-P energy: -13.908 tors. eta vs tors. theta energy: -1.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -400.830142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.830142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.830142 (E_RNA) where: Base-Base interactions energy: -270.446 where: short stacking energy: -115.500 Base-Backbone interact. energy: -0.112 local terms energy: -130.272323 where: bonds (distance) C4'-P energy: -30.671 bonds (distance) P-C4' energy: -22.358 flat angles C4'-P-C4' energy: -31.759 flat angles P-C4'-P energy: -16.123 tors. eta vs tors. theta energy: -29.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -456.275145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.275145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.275145 (E_RNA) where: Base-Base interactions energy: -310.591 where: short stacking energy: -131.376 Base-Backbone interact. energy: -1.047 local terms energy: -144.637995 where: bonds (distance) C4'-P energy: -29.375 bonds (distance) P-C4' energy: -29.051 flat angles C4'-P-C4' energy: -31.329 flat angles P-C4'-P energy: -16.589 tors. eta vs tors. theta energy: -38.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -353.772972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.772972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.772972 (E_RNA) where: Base-Base interactions energy: -221.437 where: short stacking energy: -94.733 Base-Backbone interact. energy: -0.342 local terms energy: -131.993762 where: bonds (distance) C4'-P energy: -29.091 bonds (distance) P-C4' energy: -28.801 flat angles C4'-P-C4' energy: -27.510 flat angles P-C4'-P energy: -15.636 tors. eta vs tors. theta energy: -30.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -408.716064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.716064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.716064 (E_RNA) where: Base-Base interactions energy: -281.358 where: short stacking energy: -116.960 Base-Backbone interact. energy: -0.103 local terms energy: -127.255285 where: bonds (distance) C4'-P energy: -26.837 bonds (distance) P-C4' energy: -24.767 flat angles C4'-P-C4' energy: -25.038 flat angles P-C4'-P energy: -20.988 tors. eta vs tors. theta energy: -29.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -346.366942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.366942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.366942 (E_RNA) where: Base-Base interactions energy: -225.238 where: short stacking energy: -101.764 Base-Backbone interact. energy: -1.529 local terms energy: -119.599852 where: bonds (distance) C4'-P energy: -20.768 bonds (distance) P-C4' energy: -27.969 flat angles C4'-P-C4' energy: -25.693 flat angles P-C4'-P energy: -19.211 tors. eta vs tors. theta energy: -25.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -303.538820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.538820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.538820 (E_RNA) where: Base-Base interactions energy: -195.200 where: short stacking energy: -90.132 Base-Backbone interact. energy: -0.186 local terms energy: -108.153286 where: bonds (distance) C4'-P energy: -28.663 bonds (distance) P-C4' energy: -24.945 flat angles C4'-P-C4' energy: -19.336 flat angles P-C4'-P energy: -16.869 tors. eta vs tors. theta energy: -18.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -221.555809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.555809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.555809 (E_RNA) where: Base-Base interactions energy: -113.238 where: short stacking energy: -64.545 Base-Backbone interact. energy: -1.085 local terms energy: -107.232869 where: bonds (distance) C4'-P energy: -27.226 bonds (distance) P-C4' energy: -26.157 flat angles C4'-P-C4' energy: -22.842 flat angles P-C4'-P energy: -20.891 tors. eta vs tors. theta energy: -10.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -309.450018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.450018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.450018 (E_RNA) where: Base-Base interactions energy: -193.007 where: short stacking energy: -95.365 Base-Backbone interact. energy: -0.696 local terms energy: -115.747695 where: bonds (distance) C4'-P energy: -17.545 bonds (distance) P-C4' energy: -30.078 flat angles C4'-P-C4' energy: -27.003 flat angles P-C4'-P energy: -15.724 tors. eta vs tors. theta energy: -25.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -155.055013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.055013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.055013 (E_RNA) where: Base-Base interactions energy: -69.250 where: short stacking energy: -50.842 Base-Backbone interact. energy: -0.790 local terms energy: -85.014706 where: bonds (distance) C4'-P energy: -21.480 bonds (distance) P-C4' energy: -20.634 flat angles C4'-P-C4' energy: -22.678 flat angles P-C4'-P energy: -14.125 tors. eta vs tors. theta energy: -6.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -131.420589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.420589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.420589 (E_RNA) where: Base-Base interactions energy: -49.262 where: short stacking energy: -36.982 Base-Backbone interact. energy: -0.392 local terms energy: -81.766544 where: bonds (distance) C4'-P energy: -24.808 bonds (distance) P-C4' energy: -22.375 flat angles C4'-P-C4' energy: -23.286 flat angles P-C4'-P energy: -11.365 tors. eta vs tors. theta energy: 0.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -459.532948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.532948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.532948 (E_RNA) where: Base-Base interactions energy: -320.210 where: short stacking energy: -126.358 Base-Backbone interact. energy: -2.130 local terms energy: -137.192924 where: bonds (distance) C4'-P energy: -24.252 bonds (distance) P-C4' energy: -26.823 flat angles C4'-P-C4' energy: -27.953 flat angles P-C4'-P energy: -21.879 tors. eta vs tors. theta energy: -36.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -389.377968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.377968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.377968 (E_RNA) where: Base-Base interactions energy: -260.180 where: short stacking energy: -119.139 Base-Backbone interact. energy: -0.227 local terms energy: -128.971110 where: bonds (distance) C4'-P energy: -18.504 bonds (distance) P-C4' energy: -31.049 flat angles C4'-P-C4' energy: -27.292 flat angles P-C4'-P energy: -20.122 tors. eta vs tors. theta energy: -32.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -451.289432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.289432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.289432 (E_RNA) where: Base-Base interactions energy: -317.015 where: short stacking energy: -135.841 Base-Backbone interact. energy: -0.001 local terms energy: -134.273571 where: bonds (distance) C4'-P energy: -16.507 bonds (distance) P-C4' energy: -29.410 flat angles C4'-P-C4' energy: -30.757 flat angles P-C4'-P energy: -16.814 tors. eta vs tors. theta energy: -40.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -342.197593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.197593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.197593 (E_RNA) where: Base-Base interactions energy: -216.413 where: short stacking energy: -93.576 Base-Backbone interact. energy: 2.288 local terms energy: -128.072250 where: bonds (distance) C4'-P energy: -26.006 bonds (distance) P-C4' energy: -28.669 flat angles C4'-P-C4' energy: -27.048 flat angles P-C4'-P energy: -17.541 tors. eta vs tors. theta energy: -28.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -331.357532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.357532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.357532 (E_RNA) where: Base-Base interactions energy: -210.754 where: short stacking energy: -89.931 Base-Backbone interact. energy: -0.192 local terms energy: -120.411266 where: bonds (distance) C4'-P energy: -26.407 bonds (distance) P-C4' energy: -26.678 flat angles C4'-P-C4' energy: -27.598 flat angles P-C4'-P energy: -17.369 tors. eta vs tors. theta energy: -22.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -334.022026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.022026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.022026 (E_RNA) where: Base-Base interactions energy: -213.025 where: short stacking energy: -96.762 Base-Backbone interact. energy: -0.338 local terms energy: -120.658622 where: bonds (distance) C4'-P energy: -26.593 bonds (distance) P-C4' energy: -23.007 flat angles C4'-P-C4' energy: -24.573 flat angles P-C4'-P energy: -19.305 tors. eta vs tors. theta energy: -27.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -260.341890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.341890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.341890 (E_RNA) where: Base-Base interactions energy: -152.973 where: short stacking energy: -79.468 Base-Backbone interact. energy: -0.072 local terms energy: -107.297131 where: bonds (distance) C4'-P energy: -23.356 bonds (distance) P-C4' energy: -24.769 flat angles C4'-P-C4' energy: -28.630 flat angles P-C4'-P energy: -15.462 tors. eta vs tors. theta energy: -15.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -192.135825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.135825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.135825 (E_RNA) where: Base-Base interactions energy: -103.114 where: short stacking energy: -65.767 Base-Backbone interact. energy: -0.353 local terms energy: -88.668037 where: bonds (distance) C4'-P energy: -25.094 bonds (distance) P-C4' energy: -22.032 flat angles C4'-P-C4' energy: -18.943 flat angles P-C4'-P energy: -13.261 tors. eta vs tors. theta energy: -9.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -144.366082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.366082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.366082 (E_RNA) where: Base-Base interactions energy: -50.036 where: short stacking energy: -46.377 Base-Backbone interact. energy: -0.182 local terms energy: -94.148375 where: bonds (distance) C4'-P energy: -22.838 bonds (distance) P-C4' energy: -29.410 flat angles C4'-P-C4' energy: -26.666 flat angles P-C4'-P energy: -13.154 tors. eta vs tors. theta energy: -2.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -122.057891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.057891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.057891 (E_RNA) where: Base-Base interactions energy: -32.904 where: short stacking energy: -29.629 Base-Backbone interact. energy: -1.379 local terms energy: -87.774963 where: bonds (distance) C4'-P energy: -27.955 bonds (distance) P-C4' energy: -28.148 flat angles C4'-P-C4' energy: -20.530 flat angles P-C4'-P energy: -12.292 tors. eta vs tors. theta energy: 1.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -486.947301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.947301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.947301 (E_RNA) where: Base-Base interactions energy: -339.016 where: short stacking energy: -134.065 Base-Backbone interact. energy: -1.421 local terms energy: -146.510190 where: bonds (distance) C4'-P energy: -19.430 bonds (distance) P-C4' energy: -32.464 flat angles C4'-P-C4' energy: -30.364 flat angles P-C4'-P energy: -22.125 tors. eta vs tors. theta energy: -42.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -478.659582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.659582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.659582 (E_RNA) where: Base-Base interactions energy: -340.953 where: short stacking energy: -129.075 Base-Backbone interact. energy: -1.224 local terms energy: -136.482269 where: bonds (distance) C4'-P energy: -23.074 bonds (distance) P-C4' energy: -29.760 flat angles C4'-P-C4' energy: -25.994 flat angles P-C4'-P energy: -19.182 tors. eta vs tors. theta energy: -38.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -363.854669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.854669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.854669 (E_RNA) where: Base-Base interactions energy: -240.463 where: short stacking energy: -111.774 Base-Backbone interact. energy: 0.416 local terms energy: -123.807940 where: bonds (distance) C4'-P energy: -23.281 bonds (distance) P-C4' energy: -26.231 flat angles C4'-P-C4' energy: -20.109 flat angles P-C4'-P energy: -22.703 tors. eta vs tors. theta energy: -31.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -352.545295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.545295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.545295 (E_RNA) where: Base-Base interactions energy: -219.330 where: short stacking energy: -111.386 Base-Backbone interact. energy: -2.068 local terms energy: -131.146636 where: bonds (distance) C4'-P energy: -24.057 bonds (distance) P-C4' energy: -27.360 flat angles C4'-P-C4' energy: -26.705 flat angles P-C4'-P energy: -22.130 tors. eta vs tors. theta energy: -30.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -325.099617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.099617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.099617 (E_RNA) where: Base-Base interactions energy: -203.173 where: short stacking energy: -85.296 Base-Backbone interact. energy: -0.416 local terms energy: -121.509858 where: bonds (distance) C4'-P energy: -26.514 bonds (distance) P-C4' energy: -28.921 flat angles C4'-P-C4' energy: -25.976 flat angles P-C4'-P energy: -13.945 tors. eta vs tors. theta energy: -26.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -321.390525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.390525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.390525 (E_RNA) where: Base-Base interactions energy: -221.860 where: short stacking energy: -92.401 Base-Backbone interact. energy: -0.206 local terms energy: -99.324828 where: bonds (distance) C4'-P energy: -19.348 bonds (distance) P-C4' energy: -28.250 flat angles C4'-P-C4' energy: -22.932 flat angles P-C4'-P energy: -12.555 tors. eta vs tors. theta energy: -16.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -267.865629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.865629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.865629 (E_RNA) where: Base-Base interactions energy: -156.923 where: short stacking energy: -89.050 Base-Backbone interact. energy: 0.029 local terms energy: -110.971332 where: bonds (distance) C4'-P energy: -24.768 bonds (distance) P-C4' energy: -24.138 flat angles C4'-P-C4' energy: -28.843 flat angles P-C4'-P energy: -11.645 tors. eta vs tors. theta energy: -21.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -149.561169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.561169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.561169 (E_RNA) where: Base-Base interactions energy: -56.954 where: short stacking energy: -55.481 Base-Backbone interact. energy: -0.131 local terms energy: -92.476292 where: bonds (distance) C4'-P energy: -18.639 bonds (distance) P-C4' energy: -30.217 flat angles C4'-P-C4' energy: -22.966 flat angles P-C4'-P energy: -13.447 tors. eta vs tors. theta energy: -7.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -179.658062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.658062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.658062 (E_RNA) where: Base-Base interactions energy: -88.296 where: short stacking energy: -47.578 Base-Backbone interact. energy: -0.115 local terms energy: -91.247753 where: bonds (distance) C4'-P energy: -27.383 bonds (distance) P-C4' energy: -29.816 flat angles C4'-P-C4' energy: -22.500 flat angles P-C4'-P energy: -10.860 tors. eta vs tors. theta energy: -0.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -127.576107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.576107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.576107 (E_RNA) where: Base-Base interactions energy: -44.635 where: short stacking energy: -29.896 Base-Backbone interact. energy: -0.359 local terms energy: -82.581978 where: bonds (distance) C4'-P energy: -19.708 bonds (distance) P-C4' energy: -30.872 flat angles C4'-P-C4' energy: -23.759 flat angles P-C4'-P energy: -9.576 tors. eta vs tors. theta energy: 1.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -488.527963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.527963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.527963 (E_RNA) where: Base-Base interactions energy: -334.502 where: short stacking energy: -142.036 Base-Backbone interact. energy: -1.869 local terms energy: -152.156812 where: bonds (distance) C4'-P energy: -27.352 bonds (distance) P-C4' energy: -26.301 flat angles C4'-P-C4' energy: -30.867 flat angles P-C4'-P energy: -24.891 tors. eta vs tors. theta energy: -42.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -522.174332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.174332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.174332 (E_RNA) where: Base-Base interactions energy: -372.275 where: short stacking energy: -146.785 Base-Backbone interact. energy: -2.051 local terms energy: -147.848327 where: bonds (distance) C4'-P energy: -26.998 bonds (distance) P-C4' energy: -31.030 flat angles C4'-P-C4' energy: -26.212 flat angles P-C4'-P energy: -21.430 tors. eta vs tors. theta energy: -42.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -394.081446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.081446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.081446 (E_RNA) where: Base-Base interactions energy: -259.247 where: short stacking energy: -114.016 Base-Backbone interact. energy: -0.247 local terms energy: -134.587904 where: bonds (distance) C4'-P energy: -28.661 bonds (distance) P-C4' energy: -23.370 flat angles C4'-P-C4' energy: -28.057 flat angles P-C4'-P energy: -19.869 tors. eta vs tors. theta energy: -34.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -373.502730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.502730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.502730 (E_RNA) where: Base-Base interactions energy: -255.923 where: short stacking energy: -122.436 Base-Backbone interact. energy: -0.167 local terms energy: -117.412669 where: bonds (distance) C4'-P energy: -23.492 bonds (distance) P-C4' energy: -22.929 flat angles C4'-P-C4' energy: -24.742 flat angles P-C4'-P energy: -15.364 tors. eta vs tors. theta energy: -30.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -342.535770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.535770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.535770 (E_RNA) where: Base-Base interactions energy: -222.133 where: short stacking energy: -104.387 Base-Backbone interact. energy: 0.210 local terms energy: -120.613428 where: bonds (distance) C4'-P energy: -24.824 bonds (distance) P-C4' energy: -25.458 flat angles C4'-P-C4' energy: -23.828 flat angles P-C4'-P energy: -19.389 tors. eta vs tors. theta energy: -27.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -307.519984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.519984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.519984 (E_RNA) where: Base-Base interactions energy: -194.469 where: short stacking energy: -90.471 Base-Backbone interact. energy: -0.118 local terms energy: -112.933226 where: bonds (distance) C4'-P energy: -20.697 bonds (distance) P-C4' energy: -27.116 flat angles C4'-P-C4' energy: -25.216 flat angles P-C4'-P energy: -13.714 tors. eta vs tors. theta energy: -26.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -247.263703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.263703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.263703 (E_RNA) where: Base-Base interactions energy: -149.270 where: short stacking energy: -81.254 Base-Backbone interact. energy: -0.355 local terms energy: -97.638645 where: bonds (distance) C4'-P energy: -22.479 bonds (distance) P-C4' energy: -22.532 flat angles C4'-P-C4' energy: -23.727 flat angles P-C4'-P energy: -11.576 tors. eta vs tors. theta energy: -17.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -141.727975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.727975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.727975 (E_RNA) where: Base-Base interactions energy: -63.829 where: short stacking energy: -62.410 Base-Backbone interact. energy: 0.865 local terms energy: -78.764009 where: bonds (distance) C4'-P energy: -19.029 bonds (distance) P-C4' energy: -19.188 flat angles C4'-P-C4' energy: -18.611 flat angles P-C4'-P energy: -9.888 tors. eta vs tors. theta energy: -12.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -142.563441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.563441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.563441 (E_RNA) where: Base-Base interactions energy: -54.554 where: short stacking energy: -43.609 Base-Backbone interact. energy: -0.255 local terms energy: -87.754755 where: bonds (distance) C4'-P energy: -23.707 bonds (distance) P-C4' energy: -22.964 flat angles C4'-P-C4' energy: -23.175 flat angles P-C4'-P energy: -9.049 tors. eta vs tors. theta energy: -8.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -188.515766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.515766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.515766 (E_RNA) where: Base-Base interactions energy: -102.420 where: short stacking energy: -50.166 Base-Backbone interact. energy: 1.687 local terms energy: -87.781801 where: bonds (distance) C4'-P energy: -24.474 bonds (distance) P-C4' energy: -19.583 flat angles C4'-P-C4' energy: -19.745 flat angles P-C4'-P energy: -15.286 tors. eta vs tors. theta energy: -8.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -516.324537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.324537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.324537 (E_RNA) where: Base-Base interactions energy: -364.053 where: short stacking energy: -150.549 Base-Backbone interact. energy: -0.600 local terms energy: -151.671028 where: bonds (distance) C4'-P energy: -25.706 bonds (distance) P-C4' energy: -28.933 flat angles C4'-P-C4' energy: -31.919 flat angles P-C4'-P energy: -20.546 tors. eta vs tors. theta energy: -44.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -537.153542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.153542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.153542 (E_RNA) where: Base-Base interactions energy: -392.023 where: short stacking energy: -155.257 Base-Backbone interact. energy: -0.196 local terms energy: -144.934128 where: bonds (distance) C4'-P energy: -26.967 bonds (distance) P-C4' energy: -24.445 flat angles C4'-P-C4' energy: -31.082 flat angles P-C4'-P energy: -18.862 tors. eta vs tors. theta energy: -43.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -379.760492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.760492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.760492 (E_RNA) where: Base-Base interactions energy: -251.503 where: short stacking energy: -98.379 Base-Backbone interact. energy: -0.227 local terms energy: -128.029968 where: bonds (distance) C4'-P energy: -27.997 bonds (distance) P-C4' energy: -25.100 flat angles C4'-P-C4' energy: -26.069 flat angles P-C4'-P energy: -20.786 tors. eta vs tors. theta energy: -28.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -400.120270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.120270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.120270 (E_RNA) where: Base-Base interactions energy: -266.565 where: short stacking energy: -109.453 Base-Backbone interact. energy: -1.263 local terms energy: -132.292563 where: bonds (distance) C4'-P energy: -27.694 bonds (distance) P-C4' energy: -29.996 flat angles C4'-P-C4' energy: -28.892 flat angles P-C4'-P energy: -19.006 tors. eta vs tors. theta energy: -26.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -345.485107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.485107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.485107 (E_RNA) where: Base-Base interactions energy: -234.561 where: short stacking energy: -101.219 Base-Backbone interact. energy: -1.216 local terms energy: -109.707947 where: bonds (distance) C4'-P energy: -20.691 bonds (distance) P-C4' energy: -26.320 flat angles C4'-P-C4' energy: -21.162 flat angles P-C4'-P energy: -10.278 tors. eta vs tors. theta energy: -31.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -295.834508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.834508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.834508 (E_RNA) where: Base-Base interactions energy: -187.287 where: short stacking energy: -92.066 Base-Backbone interact. energy: -0.476 local terms energy: -108.071029 where: bonds (distance) C4'-P energy: -31.204 bonds (distance) P-C4' energy: -23.076 flat angles C4'-P-C4' energy: -16.362 flat angles P-C4'-P energy: -15.428 tors. eta vs tors. theta energy: -21.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -250.154388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.154388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.154388 (E_RNA) where: Base-Base interactions energy: -155.160 where: short stacking energy: -89.255 Base-Backbone interact. energy: 1.146 local terms energy: -96.139479 where: bonds (distance) C4'-P energy: -17.391 bonds (distance) P-C4' energy: -22.389 flat angles C4'-P-C4' energy: -16.153 flat angles P-C4'-P energy: -22.117 tors. eta vs tors. theta energy: -18.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -141.298908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.298908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.298908 (E_RNA) where: Base-Base interactions energy: -57.299 where: short stacking energy: -55.585 Base-Backbone interact. energy: -0.917 local terms energy: -83.083212 where: bonds (distance) C4'-P energy: -22.815 bonds (distance) P-C4' energy: -22.015 flat angles C4'-P-C4' energy: -22.908 flat angles P-C4'-P energy: -12.082 tors. eta vs tors. theta energy: -3.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -155.034961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.034961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.034961 (E_RNA) where: Base-Base interactions energy: -70.110 where: short stacking energy: -56.608 Base-Backbone interact. energy: 0.950 local terms energy: -85.874676 where: bonds (distance) C4'-P energy: -19.378 bonds (distance) P-C4' energy: -23.313 flat angles C4'-P-C4' energy: -24.580 flat angles P-C4'-P energy: -7.376 tors. eta vs tors. theta energy: -11.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -130.034680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.034680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.034680 (E_RNA) where: Base-Base interactions energy: -57.217 where: short stacking energy: -34.717 Base-Backbone interact. energy: 0.119 local terms energy: -72.937482 where: bonds (distance) C4'-P energy: -23.247 bonds (distance) P-C4' energy: -23.176 flat angles C4'-P-C4' energy: -18.721 flat angles P-C4'-P energy: -7.837 tors. eta vs tors. theta energy: 0.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -552.053246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.053246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.053246 (E_RNA) where: Base-Base interactions energy: -399.982 where: short stacking energy: -153.319 Base-Backbone interact. energy: -0.365 local terms energy: -151.706352 where: bonds (distance) C4'-P energy: -24.158 bonds (distance) P-C4' energy: -23.274 flat angles C4'-P-C4' energy: -33.711 flat angles P-C4'-P energy: -23.628 tors. eta vs tors. theta energy: -46.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -507.757428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.757428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.757428 (E_RNA) where: Base-Base interactions energy: -366.017 where: short stacking energy: -150.049 Base-Backbone interact. energy: -0.849 local terms energy: -140.891207 where: bonds (distance) C4'-P energy: -24.939 bonds (distance) P-C4' energy: -24.935 flat angles C4'-P-C4' energy: -27.440 flat angles P-C4'-P energy: -18.915 tors. eta vs tors. theta energy: -44.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -412.012048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.012048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.012048 (E_RNA) where: Base-Base interactions energy: -277.010 where: short stacking energy: -123.079 Base-Backbone interact. energy: -1.398 local terms energy: -133.604229 where: bonds (distance) C4'-P energy: -23.981 bonds (distance) P-C4' energy: -25.411 flat angles C4'-P-C4' energy: -27.366 flat angles P-C4'-P energy: -15.934 tors. eta vs tors. theta energy: -40.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -371.500224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.500224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.500224 (E_RNA) where: Base-Base interactions energy: -249.961 where: short stacking energy: -109.052 Base-Backbone interact. energy: -0.350 local terms energy: -121.189094 where: bonds (distance) C4'-P energy: -25.079 bonds (distance) P-C4' energy: -24.172 flat angles C4'-P-C4' energy: -26.598 flat angles P-C4'-P energy: -16.855 tors. eta vs tors. theta energy: -28.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -318.649500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.649500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.649500 (E_RNA) where: Base-Base interactions energy: -207.583 where: short stacking energy: -94.361 Base-Backbone interact. energy: -1.508 local terms energy: -109.558501 where: bonds (distance) C4'-P energy: -23.558 bonds (distance) P-C4' energy: -22.902 flat angles C4'-P-C4' energy: -18.289 flat angles P-C4'-P energy: -14.993 tors. eta vs tors. theta energy: -29.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -285.086606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.086606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.086606 (E_RNA) where: Base-Base interactions energy: -178.828 where: short stacking energy: -104.064 Base-Backbone interact. energy: 0.820 local terms energy: -107.079300 where: bonds (distance) C4'-P energy: -19.916 bonds (distance) P-C4' energy: -16.602 flat angles C4'-P-C4' energy: -26.234 flat angles P-C4'-P energy: -19.226 tors. eta vs tors. theta energy: -25.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -282.145373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.145373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.145373 (E_RNA) where: Base-Base interactions energy: -173.718 where: short stacking energy: -96.593 Base-Backbone interact. energy: -0.102 local terms energy: -108.325107 where: bonds (distance) C4'-P energy: -16.234 bonds (distance) P-C4' energy: -23.951 flat angles C4'-P-C4' energy: -25.925 flat angles P-C4'-P energy: -15.268 tors. eta vs tors. theta energy: -26.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -147.849553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.849553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.849553 (E_RNA) where: Base-Base interactions energy: -54.330 where: short stacking energy: -48.182 Base-Backbone interact. energy: 2.020 local terms energy: -95.538796 where: bonds (distance) C4'-P energy: -27.947 bonds (distance) P-C4' energy: -19.752 flat angles C4'-P-C4' energy: -23.688 flat angles P-C4'-P energy: -17.021 tors. eta vs tors. theta energy: -7.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -148.274990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.274990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.274990 (E_RNA) where: Base-Base interactions energy: -54.421 where: short stacking energy: -52.778 Base-Backbone interact. energy: -0.263 local terms energy: -93.590616 where: bonds (distance) C4'-P energy: -23.269 bonds (distance) P-C4' energy: -24.455 flat angles C4'-P-C4' energy: -24.953 flat angles P-C4'-P energy: -15.581 tors. eta vs tors. theta energy: -5.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -132.048354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.048354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.048354 (E_RNA) where: Base-Base interactions energy: -62.869 where: short stacking energy: -47.814 Base-Backbone interact. energy: -0.975 local terms energy: -68.204697 where: bonds (distance) C4'-P energy: -16.585 bonds (distance) P-C4' energy: -17.054 flat angles C4'-P-C4' energy: -14.447 flat angles P-C4'-P energy: -10.409 tors. eta vs tors. theta energy: -9.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -553.113655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.113655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.113655 (E_RNA) where: Base-Base interactions energy: -401.363 where: short stacking energy: -156.238 Base-Backbone interact. energy: -0.898 local terms energy: -150.852412 where: bonds (distance) C4'-P energy: -19.881 bonds (distance) P-C4' energy: -30.556 flat angles C4'-P-C4' energy: -31.581 flat angles P-C4'-P energy: -23.151 tors. eta vs tors. theta energy: -45.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -545.276324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.276324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.276324 (E_RNA) where: Base-Base interactions energy: -392.928 where: short stacking energy: -154.729 Base-Backbone interact. energy: -0.782 local terms energy: -151.566927 where: bonds (distance) C4'-P energy: -24.820 bonds (distance) P-C4' energy: -29.641 flat angles C4'-P-C4' energy: -29.018 flat angles P-C4'-P energy: -21.478 tors. eta vs tors. theta energy: -46.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -416.664177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.664177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.664177 (E_RNA) where: Base-Base interactions energy: -290.728 where: short stacking energy: -120.336 Base-Backbone interact. energy: -0.637 local terms energy: -125.299901 where: bonds (distance) C4'-P energy: -18.039 bonds (distance) P-C4' energy: -25.774 flat angles C4'-P-C4' energy: -28.245 flat angles P-C4'-P energy: -18.471 tors. eta vs tors. theta energy: -34.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -371.707646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.707646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.707646 (E_RNA) where: Base-Base interactions energy: -246.029 where: short stacking energy: -115.111 Base-Backbone interact. energy: -0.163 local terms energy: -125.515481 where: bonds (distance) C4'-P energy: -16.881 bonds (distance) P-C4' energy: -25.661 flat angles C4'-P-C4' energy: -28.863 flat angles P-C4'-P energy: -18.917 tors. eta vs tors. theta energy: -35.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -325.764368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.764368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.764368 (E_RNA) where: Base-Base interactions energy: -226.694 where: short stacking energy: -99.633 Base-Backbone interact. energy: 3.023 local terms energy: -102.093425 where: bonds (distance) C4'-P energy: -23.845 bonds (distance) P-C4' energy: -22.376 flat angles C4'-P-C4' energy: -16.833 flat angles P-C4'-P energy: -17.000 tors. eta vs tors. theta energy: -22.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -279.620746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.620746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.620746 (E_RNA) where: Base-Base interactions energy: -166.569 where: short stacking energy: -69.867 Base-Backbone interact. energy: -1.411 local terms energy: -111.640377 where: bonds (distance) C4'-P energy: -23.222 bonds (distance) P-C4' energy: -21.803 flat angles C4'-P-C4' energy: -25.794 flat angles P-C4'-P energy: -18.561 tors. eta vs tors. theta energy: -22.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -265.772057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.772057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.772057 (E_RNA) where: Base-Base interactions energy: -155.918 where: short stacking energy: -82.540 Base-Backbone interact. energy: 0.527 local terms energy: -110.381303 where: bonds (distance) C4'-P energy: -26.178 bonds (distance) P-C4' energy: -28.001 flat angles C4'-P-C4' energy: -23.819 flat angles P-C4'-P energy: -9.637 tors. eta vs tors. theta energy: -22.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -196.305800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.305800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.305800 (E_RNA) where: Base-Base interactions energy: -107.836 where: short stacking energy: -56.115 Base-Backbone interact. energy: -0.248 local terms energy: -88.221695 where: bonds (distance) C4'-P energy: -19.937 bonds (distance) P-C4' energy: -25.074 flat angles C4'-P-C4' energy: -26.731 flat angles P-C4'-P energy: -18.523 tors. eta vs tors. theta energy: 2.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -133.038280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.038280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.038280 (E_RNA) where: Base-Base interactions energy: -62.256 where: short stacking energy: -62.256 Base-Backbone interact. energy: 1.600 local terms energy: -72.382828 where: bonds (distance) C4'-P energy: -18.115 bonds (distance) P-C4' energy: -22.530 flat angles C4'-P-C4' energy: -20.719 flat angles P-C4'-P energy: -5.118 tors. eta vs tors. theta energy: -5.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -128.216521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.216521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.216521 (E_RNA) where: Base-Base interactions energy: -45.826 where: short stacking energy: -35.713 Base-Backbone interact. energy: -0.652 local terms energy: -81.739105 where: bonds (distance) C4'-P energy: -24.400 bonds (distance) P-C4' energy: -26.065 flat angles C4'-P-C4' energy: -20.877 flat angles P-C4'-P energy: -12.228 tors. eta vs tors. theta energy: 1.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -557.063835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.063835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.063835 (E_RNA) where: Base-Base interactions energy: -389.464 where: short stacking energy: -150.503 Base-Backbone interact. energy: -0.681 local terms energy: -166.919675 where: bonds (distance) C4'-P energy: -30.680 bonds (distance) P-C4' energy: -29.792 flat angles C4'-P-C4' energy: -32.671 flat angles P-C4'-P energy: -25.543 tors. eta vs tors. theta energy: -48.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -546.256202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.256202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.256202 (E_RNA) where: Base-Base interactions energy: -388.714 where: short stacking energy: -148.590 Base-Backbone interact. energy: -1.076 local terms energy: -156.465785 where: bonds (distance) C4'-P energy: -24.828 bonds (distance) P-C4' energy: -24.313 flat angles C4'-P-C4' energy: -32.996 flat angles P-C4'-P energy: -26.015 tors. eta vs tors. theta energy: -48.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -437.341985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.341985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.341985 (E_RNA) where: Base-Base interactions energy: -299.233 where: short stacking energy: -137.793 Base-Backbone interact. energy: -0.261 local terms energy: -137.848219 where: bonds (distance) C4'-P energy: -25.235 bonds (distance) P-C4' energy: -25.993 flat angles C4'-P-C4' energy: -30.180 flat angles P-C4'-P energy: -17.998 tors. eta vs tors. theta energy: -38.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -364.148077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.148077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.148077 (E_RNA) where: Base-Base interactions energy: -247.443 where: short stacking energy: -116.816 Base-Backbone interact. energy: 1.567 local terms energy: -118.272114 where: bonds (distance) C4'-P energy: -26.039 bonds (distance) P-C4' energy: -21.127 flat angles C4'-P-C4' energy: -27.700 flat angles P-C4'-P energy: -14.961 tors. eta vs tors. theta energy: -28.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -325.417352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.417352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.417352 (E_RNA) where: Base-Base interactions energy: -216.211 where: short stacking energy: -88.172 Base-Backbone interact. energy: -0.629 local terms energy: -108.577362 where: bonds (distance) C4'-P energy: -23.194 bonds (distance) P-C4' energy: -29.178 flat angles C4'-P-C4' energy: -17.708 flat angles P-C4'-P energy: -18.309 tors. eta vs tors. theta energy: -20.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -303.961140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.961140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.961140 (E_RNA) where: Base-Base interactions energy: -194.421 where: short stacking energy: -95.636 Base-Backbone interact. energy: -0.784 local terms energy: -108.756067 where: bonds (distance) C4'-P energy: -20.290 bonds (distance) P-C4' energy: -23.912 flat angles C4'-P-C4' energy: -27.556 flat angles P-C4'-P energy: -14.396 tors. eta vs tors. theta energy: -22.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -253.405751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.405751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.405751 (E_RNA) where: Base-Base interactions energy: -153.751 where: short stacking energy: -82.111 Base-Backbone interact. energy: -0.017 local terms energy: -99.638118 where: bonds (distance) C4'-P energy: -18.957 bonds (distance) P-C4' energy: -20.475 flat angles C4'-P-C4' energy: -27.378 flat angles P-C4'-P energy: -9.553 tors. eta vs tors. theta energy: -23.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -211.983616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.983616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.983616 (E_RNA) where: Base-Base interactions energy: -116.443 where: short stacking energy: -65.573 Base-Backbone interact. energy: 1.747 local terms energy: -97.287138 where: bonds (distance) C4'-P energy: -23.700 bonds (distance) P-C4' energy: -23.703 flat angles C4'-P-C4' energy: -23.127 flat angles P-C4'-P energy: -13.039 tors. eta vs tors. theta energy: -13.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -145.415088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.415088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.415088 (E_RNA) where: Base-Base interactions energy: -52.507 where: short stacking energy: -39.720 Base-Backbone interact. energy: -0.704 local terms energy: -92.204179 where: bonds (distance) C4'-P energy: -29.079 bonds (distance) P-C4' energy: -27.125 flat angles C4'-P-C4' energy: -18.042 flat angles P-C4'-P energy: -14.911 tors. eta vs tors. theta energy: -3.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -123.024027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.024027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.024027 (E_RNA) where: Base-Base interactions energy: -45.271 where: short stacking energy: -30.485 Base-Backbone interact. energy: -0.557 local terms energy: -77.195760 where: bonds (distance) C4'-P energy: -26.168 bonds (distance) P-C4' energy: -23.096 flat angles C4'-P-C4' energy: -23.846 flat angles P-C4'-P energy: -15.348 tors. eta vs tors. theta energy: 11.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -555.388234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.388234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.388234 (E_RNA) where: Base-Base interactions energy: -403.971 where: short stacking energy: -156.102 Base-Backbone interact. energy: -0.442 local terms energy: -150.974550 where: bonds (distance) C4'-P energy: -24.035 bonds (distance) P-C4' energy: -23.810 flat angles C4'-P-C4' energy: -30.517 flat angles P-C4'-P energy: -24.653 tors. eta vs tors. theta energy: -47.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -552.583441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.583441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.583441 (E_RNA) where: Base-Base interactions energy: -397.589 where: short stacking energy: -154.959 Base-Backbone interact. energy: -0.649 local terms energy: -154.346001 where: bonds (distance) C4'-P energy: -28.304 bonds (distance) P-C4' energy: -23.966 flat angles C4'-P-C4' energy: -30.703 flat angles P-C4'-P energy: -22.950 tors. eta vs tors. theta energy: -48.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -462.460237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.460237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.460237 (E_RNA) where: Base-Base interactions energy: -325.413 where: short stacking energy: -143.109 Base-Backbone interact. energy: -0.002 local terms energy: -137.044307 where: bonds (distance) C4'-P energy: -22.759 bonds (distance) P-C4' energy: -23.017 flat angles C4'-P-C4' energy: -27.530 flat angles P-C4'-P energy: -20.637 tors. eta vs tors. theta energy: -43.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -369.829837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.829837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.829837 (E_RNA) where: Base-Base interactions energy: -249.425 where: short stacking energy: -117.208 Base-Backbone interact. energy: -0.620 local terms energy: -119.785082 where: bonds (distance) C4'-P energy: -24.688 bonds (distance) P-C4' energy: -22.577 flat angles C4'-P-C4' energy: -25.941 flat angles P-C4'-P energy: -13.905 tors. eta vs tors. theta energy: -32.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -332.361202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.361202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.361202 (E_RNA) where: Base-Base interactions energy: -220.916 where: short stacking energy: -99.712 Base-Backbone interact. energy: -0.924 local terms energy: -110.521263 where: bonds (distance) C4'-P energy: -23.352 bonds (distance) P-C4' energy: -22.845 flat angles C4'-P-C4' energy: -18.986 flat angles P-C4'-P energy: -15.016 tors. eta vs tors. theta energy: -30.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -318.416415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.416415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.416415 (E_RNA) where: Base-Base interactions energy: -195.350 where: short stacking energy: -102.977 Base-Backbone interact. energy: -0.133 local terms energy: -122.933695 where: bonds (distance) C4'-P energy: -23.678 bonds (distance) P-C4' energy: -21.969 flat angles C4'-P-C4' energy: -24.709 flat angles P-C4'-P energy: -19.306 tors. eta vs tors. theta energy: -33.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -250.834048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.834048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.834048 (E_RNA) where: Base-Base interactions energy: -143.412 where: short stacking energy: -81.494 Base-Backbone interact. energy: -1.404 local terms energy: -106.018026 where: bonds (distance) C4'-P energy: -24.270 bonds (distance) P-C4' energy: -27.520 flat angles C4'-P-C4' energy: -26.327 flat angles P-C4'-P energy: -11.836 tors. eta vs tors. theta energy: -16.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -141.009857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.009857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.009857 (E_RNA) where: Base-Base interactions energy: -60.931 where: short stacking energy: -39.727 Base-Backbone interact. energy: -0.312 local terms energy: -79.767251 where: bonds (distance) C4'-P energy: -17.167 bonds (distance) P-C4' energy: -26.118 flat angles C4'-P-C4' energy: -25.525 flat angles P-C4'-P energy: -9.111 tors. eta vs tors. theta energy: -1.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -170.468308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.468308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.468308 (E_RNA) where: Base-Base interactions energy: -93.109 where: short stacking energy: -36.938 Base-Backbone interact. energy: 0.108 local terms energy: -77.467208 where: bonds (distance) C4'-P energy: -13.666 bonds (distance) P-C4' energy: -24.741 flat angles C4'-P-C4' energy: -21.896 flat angles P-C4'-P energy: -19.184 tors. eta vs tors. theta energy: 2.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -142.025715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.025715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.025715 (E_RNA) where: Base-Base interactions energy: -58.258 where: short stacking energy: -54.235 Base-Backbone interact. energy: -0.129 local terms energy: -83.638468 where: bonds (distance) C4'-P energy: -20.202 bonds (distance) P-C4' energy: -27.612 flat angles C4'-P-C4' energy: -17.320 flat angles P-C4'-P energy: -8.056 tors. eta vs tors. theta energy: -10.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -568.507458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.507458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.507458 (E_RNA) where: Base-Base interactions energy: -405.781 where: short stacking energy: -164.241 Base-Backbone interact. energy: -1.951 local terms energy: -160.775730 where: bonds (distance) C4'-P energy: -23.355 bonds (distance) P-C4' energy: -29.863 flat angles C4'-P-C4' energy: -32.786 flat angles P-C4'-P energy: -24.984 tors. eta vs tors. theta energy: -49.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -547.903898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.903898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.903898 (E_RNA) where: Base-Base interactions energy: -390.143 where: short stacking energy: -152.404 Base-Backbone interact. energy: -1.782 local terms energy: -155.978346 where: bonds (distance) C4'-P energy: -30.962 bonds (distance) P-C4' energy: -29.216 flat angles C4'-P-C4' energy: -28.726 flat angles P-C4'-P energy: -19.079 tors. eta vs tors. theta energy: -47.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -454.028386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.028386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.028386 (E_RNA) where: Base-Base interactions energy: -312.041 where: short stacking energy: -129.621 Base-Backbone interact. energy: -0.505 local terms energy: -141.482361 where: bonds (distance) C4'-P energy: -25.050 bonds (distance) P-C4' energy: -25.024 flat angles C4'-P-C4' energy: -28.319 flat angles P-C4'-P energy: -22.396 tors. eta vs tors. theta energy: -40.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -376.065111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.065111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.065111 (E_RNA) where: Base-Base interactions energy: -239.567 where: short stacking energy: -111.040 Base-Backbone interact. energy: -0.057 local terms energy: -136.441200 where: bonds (distance) C4'-P energy: -19.222 bonds (distance) P-C4' energy: -32.110 flat angles C4'-P-C4' energy: -28.155 flat angles P-C4'-P energy: -25.389 tors. eta vs tors. theta energy: -31.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -353.648948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.648948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.648948 (E_RNA) where: Base-Base interactions energy: -236.584 where: short stacking energy: -107.359 Base-Backbone interact. energy: -0.092 local terms energy: -116.973072 where: bonds (distance) C4'-P energy: -20.168 bonds (distance) P-C4' energy: -28.728 flat angles C4'-P-C4' energy: -29.857 flat angles P-C4'-P energy: -13.834 tors. eta vs tors. theta energy: -24.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -314.901041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.901041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.901041 (E_RNA) where: Base-Base interactions energy: -196.383 where: short stacking energy: -97.095 Base-Backbone interact. energy: -0.268 local terms energy: -118.250361 where: bonds (distance) C4'-P energy: -26.341 bonds (distance) P-C4' energy: -32.259 flat angles C4'-P-C4' energy: -16.254 flat angles P-C4'-P energy: -17.920 tors. eta vs tors. theta energy: -25.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -152.740935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.740935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.740935 (E_RNA) where: Base-Base interactions energy: -61.202 where: short stacking energy: -42.739 Base-Backbone interact. energy: -0.552 local terms energy: -90.986946 where: bonds (distance) C4'-P energy: -15.341 bonds (distance) P-C4' energy: -28.938 flat angles C4'-P-C4' energy: -22.345 flat angles P-C4'-P energy: -18.228 tors. eta vs tors. theta energy: -6.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -217.819345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.819345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.819345 (E_RNA) where: Base-Base interactions energy: -123.776 where: short stacking energy: -58.803 Base-Backbone interact. energy: -0.672 local terms energy: -93.371467 where: bonds (distance) C4'-P energy: -17.463 bonds (distance) P-C4' energy: -25.957 flat angles C4'-P-C4' energy: -26.856 flat angles P-C4'-P energy: -9.008 tors. eta vs tors. theta energy: -14.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -144.256161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.256161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.256161 (E_RNA) where: Base-Base interactions energy: -52.135 where: short stacking energy: -42.959 Base-Backbone interact. energy: 0.328 local terms energy: -92.448722 where: bonds (distance) C4'-P energy: -27.727 bonds (distance) P-C4' energy: -24.272 flat angles C4'-P-C4' energy: -23.001 flat angles P-C4'-P energy: -14.791 tors. eta vs tors. theta energy: -2.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -123.441367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.441367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.441367 (E_RNA) where: Base-Base interactions energy: -37.838 where: short stacking energy: -30.252 Base-Backbone interact. energy: -0.326 local terms energy: -85.276670 where: bonds (distance) C4'-P energy: -27.739 bonds (distance) P-C4' energy: -24.037 flat angles C4'-P-C4' energy: -19.119 flat angles P-C4'-P energy: -16.740 tors. eta vs tors. theta energy: 2.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -562.819373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.819373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.819373 (E_RNA) where: Base-Base interactions energy: -399.807 where: short stacking energy: -152.752 Base-Backbone interact. energy: -0.001 local terms energy: -163.010471 where: bonds (distance) C4'-P energy: -28.832 bonds (distance) P-C4' energy: -28.739 flat angles C4'-P-C4' energy: -33.576 flat angles P-C4'-P energy: -22.985 tors. eta vs tors. theta energy: -48.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -545.780382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.780382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.780382 (E_RNA) where: Base-Base interactions energy: -398.648 where: short stacking energy: -154.782 Base-Backbone interact. energy: -0.365 local terms energy: -146.767701 where: bonds (distance) C4'-P energy: -26.138 bonds (distance) P-C4' energy: -22.427 flat angles C4'-P-C4' energy: -32.138 flat angles P-C4'-P energy: -19.807 tors. eta vs tors. theta energy: -46.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -477.706130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.706130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.706130 (E_RNA) where: Base-Base interactions energy: -337.988 where: short stacking energy: -135.763 Base-Backbone interact. energy: -1.385 local terms energy: -138.333509 where: bonds (distance) C4'-P energy: -25.477 bonds (distance) P-C4' energy: -24.102 flat angles C4'-P-C4' energy: -30.356 flat angles P-C4'-P energy: -18.863 tors. eta vs tors. theta energy: -39.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -380.187430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.187430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.187430 (E_RNA) where: Base-Base interactions energy: -243.622 where: short stacking energy: -108.127 Base-Backbone interact. energy: -1.028 local terms energy: -135.537258 where: bonds (distance) C4'-P energy: -28.469 bonds (distance) P-C4' energy: -28.171 flat angles C4'-P-C4' energy: -27.708 flat angles P-C4'-P energy: -19.107 tors. eta vs tors. theta energy: -32.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -346.912339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.912339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.912339 (E_RNA) where: Base-Base interactions energy: -227.833 where: short stacking energy: -90.480 Base-Backbone interact. energy: 0.950 local terms energy: -120.029417 where: bonds (distance) C4'-P energy: -22.475 bonds (distance) P-C4' energy: -24.620 flat angles C4'-P-C4' energy: -29.671 flat angles P-C4'-P energy: -17.442 tors. eta vs tors. theta energy: -25.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -310.961471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.961471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.961471 (E_RNA) where: Base-Base interactions energy: -177.765 where: short stacking energy: -90.256 Base-Backbone interact. energy: -0.213 local terms energy: -132.983623 where: bonds (distance) C4'-P energy: -26.563 bonds (distance) P-C4' energy: -23.021 flat angles C4'-P-C4' energy: -31.127 flat angles P-C4'-P energy: -22.109 tors. eta vs tors. theta energy: -30.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -179.175938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.175938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.175938 (E_RNA) where: Base-Base interactions energy: -85.922 where: short stacking energy: -47.292 Base-Backbone interact. energy: -0.291 local terms energy: -92.963136 where: bonds (distance) C4'-P energy: -22.722 bonds (distance) P-C4' energy: -28.621 flat angles C4'-P-C4' energy: -25.068 flat angles P-C4'-P energy: -12.867 tors. eta vs tors. theta energy: -3.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -248.736856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.736856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.736856 (E_RNA) where: Base-Base interactions energy: -159.785 where: short stacking energy: -67.009 Base-Backbone interact. energy: -0.257 local terms energy: -88.695502 where: bonds (distance) C4'-P energy: -21.125 bonds (distance) P-C4' energy: -22.229 flat angles C4'-P-C4' energy: -19.635 flat angles P-C4'-P energy: -16.280 tors. eta vs tors. theta energy: -9.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -123.649548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.649548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.649548 (E_RNA) where: Base-Base interactions energy: -36.204 where: short stacking energy: -34.302 Base-Backbone interact. energy: 3.418 local terms energy: -90.864248 where: bonds (distance) C4'-P energy: -25.121 bonds (distance) P-C4' energy: -28.486 flat angles C4'-P-C4' energy: -22.855 flat angles P-C4'-P energy: -9.762 tors. eta vs tors. theta energy: -4.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -126.753847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.753847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.753847 (E_RNA) where: Base-Base interactions energy: -54.737 where: short stacking energy: -34.512 Base-Backbone interact. energy: -0.286 local terms energy: -71.730309 where: bonds (distance) C4'-P energy: -17.071 bonds (distance) P-C4' energy: -30.365 flat angles C4'-P-C4' energy: -17.359 flat angles P-C4'-P energy: -14.410 tors. eta vs tors. theta energy: 7.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -558.098621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.098621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.098621 (E_RNA) where: Base-Base interactions energy: -401.106 where: short stacking energy: -158.689 Base-Backbone interact. energy: -0.692 local terms energy: -156.300711 where: bonds (distance) C4'-P energy: -28.775 bonds (distance) P-C4' energy: -26.973 flat angles C4'-P-C4' energy: -33.178 flat angles P-C4'-P energy: -21.400 tors. eta vs tors. theta energy: -45.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -548.205279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.205279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.205279 (E_RNA) where: Base-Base interactions energy: -398.677 where: short stacking energy: -158.338 Base-Backbone interact. energy: -1.068 local terms energy: -148.460837 where: bonds (distance) C4'-P energy: -27.780 bonds (distance) P-C4' energy: -24.012 flat angles C4'-P-C4' energy: -27.651 flat angles P-C4'-P energy: -22.703 tors. eta vs tors. theta energy: -46.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -508.242441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.242441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.242441 (E_RNA) where: Base-Base interactions energy: -354.114 where: short stacking energy: -140.049 Base-Backbone interact. energy: -2.219 local terms energy: -151.909061 where: bonds (distance) C4'-P energy: -25.617 bonds (distance) P-C4' energy: -25.474 flat angles C4'-P-C4' energy: -30.345 flat angles P-C4'-P energy: -25.539 tors. eta vs tors. theta energy: -44.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -374.951079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.951079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.951079 (E_RNA) where: Base-Base interactions energy: -250.928 where: short stacking energy: -119.477 Base-Backbone interact. energy: -0.324 local terms energy: -123.699551 where: bonds (distance) C4'-P energy: -24.639 bonds (distance) P-C4' energy: -21.774 flat angles C4'-P-C4' energy: -29.200 flat angles P-C4'-P energy: -16.606 tors. eta vs tors. theta energy: -31.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -324.647451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.647451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.647451 (E_RNA) where: Base-Base interactions energy: -202.365 where: short stacking energy: -99.764 Base-Backbone interact. energy: -0.261 local terms energy: -122.020917 where: bonds (distance) C4'-P energy: -17.655 bonds (distance) P-C4' energy: -30.370 flat angles C4'-P-C4' energy: -25.754 flat angles P-C4'-P energy: -17.576 tors. eta vs tors. theta energy: -30.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -319.639905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.639905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.639905 (E_RNA) where: Base-Base interactions energy: -210.807 where: short stacking energy: -84.557 Base-Backbone interact. energy: 0.237 local terms energy: -109.069608 where: bonds (distance) C4'-P energy: -26.588 bonds (distance) P-C4' energy: -27.744 flat angles C4'-P-C4' energy: -26.068 flat angles P-C4'-P energy: -14.056 tors. eta vs tors. theta energy: -14.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -256.502391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.502391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.502391 (E_RNA) where: Base-Base interactions energy: -148.978 where: short stacking energy: -85.703 Base-Backbone interact. energy: -0.728 local terms energy: -106.796433 where: bonds (distance) C4'-P energy: -27.241 bonds (distance) P-C4' energy: -24.629 flat angles C4'-P-C4' energy: -23.722 flat angles P-C4'-P energy: -12.113 tors. eta vs tors. theta energy: -19.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -147.165175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.165175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.165175 (E_RNA) where: Base-Base interactions energy: -54.630 where: short stacking energy: -46.230 Base-Backbone interact. energy: 0.144 local terms energy: -92.679572 where: bonds (distance) C4'-P energy: -21.891 bonds (distance) P-C4' energy: -28.958 flat angles C4'-P-C4' energy: -21.122 flat angles P-C4'-P energy: -16.674 tors. eta vs tors. theta energy: -4.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -153.932908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.932908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.932908 (E_RNA) where: Base-Base interactions energy: -60.225 where: short stacking energy: -59.273 Base-Backbone interact. energy: -0.266 local terms energy: -93.442065 where: bonds (distance) C4'-P energy: -22.003 bonds (distance) P-C4' energy: -29.752 flat angles C4'-P-C4' energy: -27.680 flat angles P-C4'-P energy: -7.021 tors. eta vs tors. theta energy: -6.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -123.338285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.338285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.338285 (E_RNA) where: Base-Base interactions energy: -56.722 where: short stacking energy: -36.512 Base-Backbone interact. energy: -0.800 local terms energy: -65.816353 where: bonds (distance) C4'-P energy: -22.643 bonds (distance) P-C4' energy: -26.948 flat angles C4'-P-C4' energy: -19.495 flat angles P-C4'-P energy: 1.616 tors. eta vs tors. theta energy: 1.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -552.061286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.061286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.061286 (E_RNA) where: Base-Base interactions energy: -395.407 where: short stacking energy: -150.877 Base-Backbone interact. energy: -1.984 local terms energy: -154.670013 where: bonds (distance) C4'-P energy: -26.586 bonds (distance) P-C4' energy: -25.917 flat angles C4'-P-C4' energy: -33.344 flat angles P-C4'-P energy: -22.355 tors. eta vs tors. theta energy: -46.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -556.032363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.032363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.032363 (E_RNA) where: Base-Base interactions energy: -400.495 where: short stacking energy: -159.312 Base-Backbone interact. energy: -0.635 local terms energy: -154.902351 where: bonds (distance) C4'-P energy: -26.302 bonds (distance) P-C4' energy: -24.925 flat angles C4'-P-C4' energy: -31.307 flat angles P-C4'-P energy: -24.164 tors. eta vs tors. theta energy: -48.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -535.043665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.043665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.043665 (E_RNA) where: Base-Base interactions energy: -385.661 where: short stacking energy: -151.356 Base-Backbone interact. energy: -0.188 local terms energy: -149.194234 where: bonds (distance) C4'-P energy: -28.569 bonds (distance) P-C4' energy: -25.442 flat angles C4'-P-C4' energy: -30.258 flat angles P-C4'-P energy: -19.200 tors. eta vs tors. theta energy: -45.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -367.840794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.840794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.840794 (E_RNA) where: Base-Base interactions energy: -241.348 where: short stacking energy: -111.869 Base-Backbone interact. energy: 1.135 local terms energy: -127.628496 where: bonds (distance) C4'-P energy: -23.356 bonds (distance) P-C4' energy: -27.010 flat angles C4'-P-C4' energy: -24.431 flat angles P-C4'-P energy: -19.701 tors. eta vs tors. theta energy: -33.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -332.237652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.237652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.237652 (E_RNA) where: Base-Base interactions energy: -207.418 where: short stacking energy: -105.559 Base-Backbone interact. energy: -0.424 local terms energy: -124.396014 where: bonds (distance) C4'-P energy: -26.049 bonds (distance) P-C4' energy: -23.870 flat angles C4'-P-C4' energy: -24.606 flat angles P-C4'-P energy: -16.783 tors. eta vs tors. theta energy: -33.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -348.413272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.413272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.413272 (E_RNA) where: Base-Base interactions energy: -221.811 where: short stacking energy: -105.731 Base-Backbone interact. energy: -0.654 local terms energy: -125.948149 where: bonds (distance) C4'-P energy: -25.866 bonds (distance) P-C4' energy: -25.552 flat angles C4'-P-C4' energy: -27.314 flat angles P-C4'-P energy: -19.273 tors. eta vs tors. theta energy: -27.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -271.877921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.877921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.877921 (E_RNA) where: Base-Base interactions energy: -161.217 where: short stacking energy: -71.244 Base-Backbone interact. energy: -0.562 local terms energy: -110.098908 where: bonds (distance) C4'-P energy: -20.163 bonds (distance) P-C4' energy: -29.138 flat angles C4'-P-C4' energy: -26.024 flat angles P-C4'-P energy: -20.727 tors. eta vs tors. theta energy: -14.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -133.105160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.105160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.105160 (E_RNA) where: Base-Base interactions energy: -50.192 where: short stacking energy: -46.976 Base-Backbone interact. energy: -0.531 local terms energy: -82.381973 where: bonds (distance) C4'-P energy: -26.336 bonds (distance) P-C4' energy: -28.421 flat angles C4'-P-C4' energy: -17.198 flat angles P-C4'-P energy: -11.290 tors. eta vs tors. theta energy: 0.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -137.998405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.998405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.998405 (E_RNA) where: Base-Base interactions energy: -45.834 where: short stacking energy: -37.300 Base-Backbone interact. energy: -1.676 local terms energy: -90.488684 where: bonds (distance) C4'-P energy: -21.841 bonds (distance) P-C4' energy: -27.212 flat angles C4'-P-C4' energy: -25.190 flat angles P-C4'-P energy: -13.502 tors. eta vs tors. theta energy: -2.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -135.479882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.479882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.479882 (E_RNA) where: Base-Base interactions energy: -49.752 where: short stacking energy: -37.320 Base-Backbone interact. energy: 0.467 local terms energy: -86.194750 where: bonds (distance) C4'-P energy: -28.966 bonds (distance) P-C4' energy: -27.721 flat angles C4'-P-C4' energy: -17.320 flat angles P-C4'-P energy: -11.051 tors. eta vs tors. theta energy: -1.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -552.830825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.830825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.830825 (E_RNA) where: Base-Base interactions energy: -395.404 where: short stacking energy: -150.383 Base-Backbone interact. energy: -1.282 local terms energy: -156.144728 where: bonds (distance) C4'-P energy: -28.211 bonds (distance) P-C4' energy: -27.540 flat angles C4'-P-C4' energy: -31.762 flat angles P-C4'-P energy: -22.590 tors. eta vs tors. theta energy: -46.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -546.232215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.232215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.232215 (E_RNA) where: Base-Base interactions energy: -393.899 where: short stacking energy: -149.890 Base-Backbone interact. energy: -0.798 local terms energy: -151.535546 where: bonds (distance) C4'-P energy: -30.128 bonds (distance) P-C4' energy: -24.750 flat angles C4'-P-C4' energy: -24.974 flat angles P-C4'-P energy: -25.426 tors. eta vs tors. theta energy: -46.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -547.939886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.939886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.939886 (E_RNA) where: Base-Base interactions energy: -388.698 where: short stacking energy: -153.613 Base-Backbone interact. energy: -0.004 local terms energy: -159.238273 where: bonds (distance) C4'-P energy: -24.809 bonds (distance) P-C4' energy: -28.255 flat angles C4'-P-C4' energy: -30.124 flat angles P-C4'-P energy: -27.999 tors. eta vs tors. theta energy: -48.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -376.007095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.007095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.007095 (E_RNA) where: Base-Base interactions energy: -252.556 where: short stacking energy: -116.347 Base-Backbone interact. energy: -0.142 local terms energy: -123.309190 where: bonds (distance) C4'-P energy: -23.899 bonds (distance) P-C4' energy: -28.291 flat angles C4'-P-C4' energy: -23.576 flat angles P-C4'-P energy: -16.921 tors. eta vs tors. theta energy: -30.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -325.614932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.614932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.614932 (E_RNA) where: Base-Base interactions energy: -212.725 where: short stacking energy: -94.846 Base-Backbone interact. energy: -0.112 local terms energy: -112.778365 where: bonds (distance) C4'-P energy: -16.270 bonds (distance) P-C4' energy: -24.777 flat angles C4'-P-C4' energy: -27.873 flat angles P-C4'-P energy: -18.395 tors. eta vs tors. theta energy: -25.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -329.208011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.208011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.208011 (E_RNA) where: Base-Base interactions energy: -212.148 where: short stacking energy: -112.762 Base-Backbone interact. energy: -0.051 local terms energy: -117.008721 where: bonds (distance) C4'-P energy: -22.749 bonds (distance) P-C4' energy: -24.935 flat angles C4'-P-C4' energy: -24.010 flat angles P-C4'-P energy: -15.063 tors. eta vs tors. theta energy: -30.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -239.500387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.500387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.500387 (E_RNA) where: Base-Base interactions energy: -125.431 where: short stacking energy: -65.492 Base-Backbone interact. energy: -2.002 local terms energy: -112.067904 where: bonds (distance) C4'-P energy: -29.015 bonds (distance) P-C4' energy: -32.195 flat angles C4'-P-C4' energy: -23.270 flat angles P-C4'-P energy: -15.610 tors. eta vs tors. theta energy: -11.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -147.573207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.573207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.573207 (E_RNA) where: Base-Base interactions energy: -58.645 where: short stacking energy: -53.201 Base-Backbone interact. energy: 1.307 local terms energy: -90.235452 where: bonds (distance) C4'-P energy: -22.852 bonds (distance) P-C4' energy: -24.322 flat angles C4'-P-C4' energy: -22.097 flat angles P-C4'-P energy: -10.919 tors. eta vs tors. theta energy: -10.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -167.907579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.907579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.907579 (E_RNA) where: Base-Base interactions energy: -80.212 where: short stacking energy: -55.332 Base-Backbone interact. energy: 1.569 local terms energy: -89.265125 where: bonds (distance) C4'-P energy: -21.229 bonds (distance) P-C4' energy: -25.204 flat angles C4'-P-C4' energy: -17.412 flat angles P-C4'-P energy: -14.902 tors. eta vs tors. theta energy: -10.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -123.743458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.743458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.743458 (E_RNA) where: Base-Base interactions energy: -35.164 where: short stacking energy: -32.116 Base-Backbone interact. energy: 0.116 local terms energy: -88.695865 where: bonds (distance) C4'-P energy: -28.992 bonds (distance) P-C4' energy: -27.965 flat angles C4'-P-C4' energy: -18.933 flat angles P-C4'-P energy: -16.692 tors. eta vs tors. theta energy: 3.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -563.813697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.813697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.813697 (E_RNA) where: Base-Base interactions energy: -400.592 where: short stacking energy: -158.272 Base-Backbone interact. energy: -1.270 local terms energy: -161.952247 where: bonds (distance) C4'-P energy: -29.281 bonds (distance) P-C4' energy: -29.496 flat angles C4'-P-C4' energy: -33.018 flat angles P-C4'-P energy: -20.276 tors. eta vs tors. theta energy: -49.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -548.112385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.112385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.112385 (E_RNA) where: Base-Base interactions energy: -384.991 where: short stacking energy: -157.395 Base-Backbone interact. energy: -1.441 local terms energy: -161.679768 where: bonds (distance) C4'-P energy: -30.290 bonds (distance) P-C4' energy: -25.771 flat angles C4'-P-C4' energy: -32.157 flat angles P-C4'-P energy: -24.528 tors. eta vs tors. theta energy: -48.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -546.247135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.247135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.247135 (E_RNA) where: Base-Base interactions energy: -389.533 where: short stacking energy: -148.121 Base-Backbone interact. energy: -1.073 local terms energy: -155.641177 where: bonds (distance) C4'-P energy: -27.253 bonds (distance) P-C4' energy: -25.319 flat angles C4'-P-C4' energy: -31.824 flat angles P-C4'-P energy: -25.546 tors. eta vs tors. theta energy: -45.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -379.383711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.383711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.383711 (E_RNA) where: Base-Base interactions energy: -252.186 where: short stacking energy: -106.669 Base-Backbone interact. energy: -0.685 local terms energy: -126.513532 where: bonds (distance) C4'-P energy: -24.772 bonds (distance) P-C4' energy: -23.030 flat angles C4'-P-C4' energy: -29.094 flat angles P-C4'-P energy: -16.824 tors. eta vs tors. theta energy: -32.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -347.773672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.773672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.773672 (E_RNA) where: Base-Base interactions energy: -227.569 where: short stacking energy: -96.221 Base-Backbone interact. energy: -0.309 local terms energy: -119.895556 where: bonds (distance) C4'-P energy: -26.858 bonds (distance) P-C4' energy: -24.413 flat angles C4'-P-C4' energy: -26.820 flat angles P-C4'-P energy: -20.556 tors. eta vs tors. theta energy: -21.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -321.483913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.483913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.483913 (E_RNA) where: Base-Base interactions energy: -195.910 where: short stacking energy: -99.871 Base-Backbone interact. energy: -0.581 local terms energy: -124.993056 where: bonds (distance) C4'-P energy: -25.802 bonds (distance) P-C4' energy: -26.427 flat angles C4'-P-C4' energy: -25.105 flat angles P-C4'-P energy: -21.603 tors. eta vs tors. theta energy: -26.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -257.618442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.618442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.618442 (E_RNA) where: Base-Base interactions energy: -154.787 where: short stacking energy: -78.091 Base-Backbone interact. energy: 1.294 local terms energy: -104.124842 where: bonds (distance) C4'-P energy: -17.881 bonds (distance) P-C4' energy: -28.751 flat angles C4'-P-C4' energy: -22.768 flat angles P-C4'-P energy: -18.297 tors. eta vs tors. theta energy: -16.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -141.878522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.878522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.878522 (E_RNA) where: Base-Base interactions energy: -66.736 where: short stacking energy: -50.498 Base-Backbone interact. energy: -0.301 local terms energy: -74.840678 where: bonds (distance) C4'-P energy: -21.165 bonds (distance) P-C4' energy: -21.223 flat angles C4'-P-C4' energy: -18.866 flat angles P-C4'-P energy: -9.469 tors. eta vs tors. theta energy: -4.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -175.822774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.822774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.822774 (E_RNA) where: Base-Base interactions energy: -85.518 where: short stacking energy: -44.927 Base-Backbone interact. energy: -1.117 local terms energy: -89.188140 where: bonds (distance) C4'-P energy: -27.826 bonds (distance) P-C4' energy: -25.951 flat angles C4'-P-C4' energy: -17.387 flat angles P-C4'-P energy: -15.551 tors. eta vs tors. theta energy: -2.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -131.318651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.318651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.318651 (E_RNA) where: Base-Base interactions energy: -44.827 where: short stacking energy: -31.192 Base-Backbone interact. energy: 2.893 local terms energy: -89.384542 where: bonds (distance) C4'-P energy: -28.336 bonds (distance) P-C4' energy: -22.002 flat angles C4'-P-C4' energy: -26.472 flat angles P-C4'-P energy: -13.606 tors. eta vs tors. theta energy: 1.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -548.596805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.596805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.596805 (E_RNA) where: Base-Base interactions energy: -387.200 where: short stacking energy: -150.892 Base-Backbone interact. energy: -2.282 local terms energy: -159.115405 where: bonds (distance) C4'-P energy: -31.475 bonds (distance) P-C4' energy: -23.987 flat angles C4'-P-C4' energy: -31.228 flat angles P-C4'-P energy: -24.514 tors. eta vs tors. theta energy: -47.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -552.222740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.222740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.222740 (E_RNA) where: Base-Base interactions energy: -400.481 where: short stacking energy: -153.763 Base-Backbone interact. energy: -1.349 local terms energy: -150.392996 where: bonds (distance) C4'-P energy: -28.201 bonds (distance) P-C4' energy: -26.004 flat angles C4'-P-C4' energy: -25.560 flat angles P-C4'-P energy: -25.255 tors. eta vs tors. theta energy: -45.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -538.808370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.808370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.808370 (E_RNA) where: Base-Base interactions energy: -384.770 where: short stacking energy: -148.280 Base-Backbone interact. energy: -1.839 local terms energy: -152.199623 where: bonds (distance) C4'-P energy: -29.835 bonds (distance) P-C4' energy: -29.821 flat angles C4'-P-C4' energy: -28.764 flat angles P-C4'-P energy: -19.384 tors. eta vs tors. theta energy: -44.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -387.568537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.568537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.568537 (E_RNA) where: Base-Base interactions energy: -258.471 where: short stacking energy: -102.987 Base-Backbone interact. energy: -0.200 local terms energy: -128.898227 where: bonds (distance) C4'-P energy: -26.912 bonds (distance) P-C4' energy: -28.613 flat angles C4'-P-C4' energy: -26.523 flat angles P-C4'-P energy: -12.626 tors. eta vs tors. theta energy: -34.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -330.622221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.622221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.622221 (E_RNA) where: Base-Base interactions energy: -218.841 where: short stacking energy: -91.742 Base-Backbone interact. energy: -0.242 local terms energy: -111.538870 where: bonds (distance) C4'-P energy: -24.867 bonds (distance) P-C4' energy: -23.666 flat angles C4'-P-C4' energy: -18.906 flat angles P-C4'-P energy: -21.023 tors. eta vs tors. theta energy: -23.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -300.868877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.868877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.868877 (E_RNA) where: Base-Base interactions energy: -194.393 where: short stacking energy: -96.410 Base-Backbone interact. energy: -0.221 local terms energy: -106.255172 where: bonds (distance) C4'-P energy: -20.146 bonds (distance) P-C4' energy: -27.023 flat angles C4'-P-C4' energy: -16.393 flat angles P-C4'-P energy: -17.665 tors. eta vs tors. theta energy: -25.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -251.139018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.139018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.139018 (E_RNA) where: Base-Base interactions energy: -155.151 where: short stacking energy: -82.713 Base-Backbone interact. energy: -0.818 local terms energy: -95.169756 where: bonds (distance) C4'-P energy: -21.058 bonds (distance) P-C4' energy: -21.361 flat angles C4'-P-C4' energy: -20.556 flat angles P-C4'-P energy: -14.138 tors. eta vs tors. theta energy: -18.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -128.584842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.584842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.584842 (E_RNA) where: Base-Base interactions energy: -41.388 where: short stacking energy: -41.388 Base-Backbone interact. energy: 0.020 local terms energy: -87.216601 where: bonds (distance) C4'-P energy: -20.069 bonds (distance) P-C4' energy: -23.676 flat angles C4'-P-C4' energy: -24.865 flat angles P-C4'-P energy: -18.670 tors. eta vs tors. theta energy: 0.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -137.438783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.438783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.438783 (E_RNA) where: Base-Base interactions energy: -50.639 where: short stacking energy: -49.258 Base-Backbone interact. energy: -0.271 local terms energy: -86.528094 where: bonds (distance) C4'-P energy: -27.604 bonds (distance) P-C4' energy: -23.585 flat angles C4'-P-C4' energy: -15.257 flat angles P-C4'-P energy: -15.292 tors. eta vs tors. theta energy: -4.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -148.749646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.749646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.749646 (E_RNA) where: Base-Base interactions energy: -77.135 where: short stacking energy: -30.516 Base-Backbone interact. energy: 0.135 local terms energy: -71.749865 where: bonds (distance) C4'-P energy: -26.015 bonds (distance) P-C4' energy: -20.378 flat angles C4'-P-C4' energy: -12.462 flat angles P-C4'-P energy: -12.300 tors. eta vs tors. theta energy: -0.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -554.808687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.808687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.808687 (E_RNA) where: Base-Base interactions energy: -397.568 where: short stacking energy: -157.022 Base-Backbone interact. energy: -0.880 local terms energy: -156.360410 where: bonds (distance) C4'-P energy: -27.727 bonds (distance) P-C4' energy: -23.437 flat angles C4'-P-C4' energy: -34.810 flat angles P-C4'-P energy: -23.479 tors. eta vs tors. theta energy: -46.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -552.601298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.601298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.601298 (E_RNA) where: Base-Base interactions energy: -398.638 where: short stacking energy: -155.095 Base-Backbone interact. energy: -1.370 local terms energy: -152.593681 where: bonds (distance) C4'-P energy: -29.414 bonds (distance) P-C4' energy: -25.348 flat angles C4'-P-C4' energy: -27.619 flat angles P-C4'-P energy: -22.232 tors. eta vs tors. theta energy: -47.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -543.245724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.245724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.245724 (E_RNA) where: Base-Base interactions energy: -394.840 where: short stacking energy: -149.028 Base-Backbone interact. energy: -0.655 local terms energy: -147.750505 where: bonds (distance) C4'-P energy: -28.651 bonds (distance) P-C4' energy: -27.542 flat angles C4'-P-C4' energy: -24.379 flat angles P-C4'-P energy: -19.201 tors. eta vs tors. theta energy: -47.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -373.787713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.787713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.787713 (E_RNA) where: Base-Base interactions energy: -252.284 where: short stacking energy: -103.292 Base-Backbone interact. energy: 0.021 local terms energy: -121.524591 where: bonds (distance) C4'-P energy: -23.329 bonds (distance) P-C4' energy: -27.354 flat angles C4'-P-C4' energy: -27.542 flat angles P-C4'-P energy: -18.040 tors. eta vs tors. theta energy: -25.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -369.516816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.516816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.516816 (E_RNA) where: Base-Base interactions energy: -244.694 where: short stacking energy: -104.814 Base-Backbone interact. energy: -0.188 local terms energy: -124.635432 where: bonds (distance) C4'-P energy: -21.058 bonds (distance) P-C4' energy: -22.953 flat angles C4'-P-C4' energy: -24.530 flat angles P-C4'-P energy: -21.880 tors. eta vs tors. theta energy: -34.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -331.845913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.845913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.845913 (E_RNA) where: Base-Base interactions energy: -207.586 where: short stacking energy: -106.726 Base-Backbone interact. energy: -0.586 local terms energy: -123.673149 where: bonds (distance) C4'-P energy: -29.367 bonds (distance) P-C4' energy: -27.821 flat angles C4'-P-C4' energy: -25.360 flat angles P-C4'-P energy: -15.301 tors. eta vs tors. theta energy: -25.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -246.419461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.419461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.419461 (E_RNA) where: Base-Base interactions energy: -139.440 where: short stacking energy: -74.690 Base-Backbone interact. energy: 1.062 local terms energy: -108.041427 where: bonds (distance) C4'-P energy: -23.925 bonds (distance) P-C4' energy: -23.091 flat angles C4'-P-C4' energy: -27.452 flat angles P-C4'-P energy: -16.259 tors. eta vs tors. theta energy: -17.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -140.801744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.801744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.801744 (E_RNA) where: Base-Base interactions energy: -54.434 where: short stacking energy: -51.755 Base-Backbone interact. energy: 0.116 local terms energy: -86.483963 where: bonds (distance) C4'-P energy: -20.622 bonds (distance) P-C4' energy: -26.886 flat angles C4'-P-C4' energy: -16.629 flat angles P-C4'-P energy: -15.842 tors. eta vs tors. theta energy: -6.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -134.285250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.285250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.285250 (E_RNA) where: Base-Base interactions energy: -43.917 where: short stacking energy: -36.424 Base-Backbone interact. energy: -1.398 local terms energy: -88.969732 where: bonds (distance) C4'-P energy: -23.314 bonds (distance) P-C4' energy: -28.795 flat angles C4'-P-C4' energy: -19.127 flat angles P-C4'-P energy: -14.394 tors. eta vs tors. theta energy: -3.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -172.440062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.440062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.440062 (E_RNA) where: Base-Base interactions energy: -85.341 where: short stacking energy: -46.036 Base-Backbone interact. energy: -0.307 local terms energy: -86.792093 where: bonds (distance) C4'-P energy: -23.260 bonds (distance) P-C4' energy: -25.715 flat angles C4'-P-C4' energy: -25.430 flat angles P-C4'-P energy: -13.941 tors. eta vs tors. theta energy: 1.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -552.545675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.545675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.545675 (E_RNA) where: Base-Base interactions energy: -396.860 where: short stacking energy: -155.621 Base-Backbone interact. energy: -0.969 local terms energy: -154.716877 where: bonds (distance) C4'-P energy: -29.338 bonds (distance) P-C4' energy: -22.198 flat angles C4'-P-C4' energy: -32.495 flat angles P-C4'-P energy: -21.113 tors. eta vs tors. theta energy: -49.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -561.633094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.633094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.633094 (E_RNA) where: Base-Base interactions energy: -395.042 where: short stacking energy: -155.670 Base-Backbone interact. energy: -0.396 local terms energy: -166.194647 where: bonds (distance) C4'-P energy: -32.003 bonds (distance) P-C4' energy: -30.320 flat angles C4'-P-C4' energy: -30.277 flat angles P-C4'-P energy: -27.110 tors. eta vs tors. theta energy: -46.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -534.219797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.219797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.219797 (E_RNA) where: Base-Base interactions energy: -385.549 where: short stacking energy: -154.852 Base-Backbone interact. energy: -0.026 local terms energy: -148.645057 where: bonds (distance) C4'-P energy: -26.813 bonds (distance) P-C4' energy: -22.928 flat angles C4'-P-C4' energy: -30.855 flat angles P-C4'-P energy: -21.885 tors. eta vs tors. theta energy: -46.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -383.396014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.396014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.396014 (E_RNA) where: Base-Base interactions energy: -246.910 where: short stacking energy: -104.742 Base-Backbone interact. energy: -1.666 local terms energy: -134.819153 where: bonds (distance) C4'-P energy: -22.833 bonds (distance) P-C4' energy: -28.328 flat angles C4'-P-C4' energy: -29.238 flat angles P-C4'-P energy: -20.618 tors. eta vs tors. theta energy: -33.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -330.831910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.831910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.831910 (E_RNA) where: Base-Base interactions energy: -200.058 where: short stacking energy: -104.335 Base-Backbone interact. energy: -0.245 local terms energy: -130.528839 where: bonds (distance) C4'-P energy: -18.340 bonds (distance) P-C4' energy: -29.949 flat angles C4'-P-C4' energy: -29.585 flat angles P-C4'-P energy: -18.175 tors. eta vs tors. theta energy: -34.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -352.115901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.115901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.115901 (E_RNA) where: Base-Base interactions energy: -231.011 where: short stacking energy: -95.217 Base-Backbone interact. energy: -1.302 local terms energy: -119.803065 where: bonds (distance) C4'-P energy: -20.362 bonds (distance) P-C4' energy: -26.017 flat angles C4'-P-C4' energy: -25.916 flat angles P-C4'-P energy: -13.998 tors. eta vs tors. theta energy: -33.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -210.256250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.256250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.256250 (E_RNA) where: Base-Base interactions energy: -109.525 where: short stacking energy: -64.191 Base-Backbone interact. energy: -0.619 local terms energy: -100.111744 where: bonds (distance) C4'-P energy: -23.634 bonds (distance) P-C4' energy: -28.595 flat angles C4'-P-C4' energy: -26.002 flat angles P-C4'-P energy: -15.583 tors. eta vs tors. theta energy: -6.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -143.935574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.935574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.935574 (E_RNA) where: Base-Base interactions energy: -53.514 where: short stacking energy: -53.714 Base-Backbone interact. energy: -0.347 local terms energy: -90.074302 where: bonds (distance) C4'-P energy: -22.342 bonds (distance) P-C4' energy: -20.559 flat angles C4'-P-C4' energy: -25.881 flat angles P-C4'-P energy: -17.111 tors. eta vs tors. theta energy: -4.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -200.818124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.818124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.818124 (E_RNA) where: Base-Base interactions energy: -101.581 where: short stacking energy: -63.566 Base-Backbone interact. energy: -0.530 local terms energy: -98.707216 where: bonds (distance) C4'-P energy: -20.205 bonds (distance) P-C4' energy: -27.827 flat angles C4'-P-C4' energy: -21.066 flat angles P-C4'-P energy: -15.237 tors. eta vs tors. theta energy: -14.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -124.380225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.380225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.380225 (E_RNA) where: Base-Base interactions energy: -42.254 where: short stacking energy: -42.554 Base-Backbone interact. energy: -0.122 local terms energy: -82.004192 where: bonds (distance) C4'-P energy: -27.446 bonds (distance) P-C4' energy: -21.319 flat angles C4'-P-C4' energy: -25.017 flat angles P-C4'-P energy: -6.283 tors. eta vs tors. theta energy: -1.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -556.303776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.303776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.303776 (E_RNA) where: Base-Base interactions energy: -400.297 where: short stacking energy: -154.358 Base-Backbone interact. energy: -1.188 local terms energy: -154.819210 where: bonds (distance) C4'-P energy: -28.882 bonds (distance) P-C4' energy: -21.329 flat angles C4'-P-C4' energy: -30.778 flat angles P-C4'-P energy: -27.347 tors. eta vs tors. theta energy: -46.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -544.638930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.638930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.638930 (E_RNA) where: Base-Base interactions energy: -387.506 where: short stacking energy: -152.256 Base-Backbone interact. energy: 0.230 local terms energy: -157.362869 where: bonds (distance) C4'-P energy: -25.765 bonds (distance) P-C4' energy: -30.742 flat angles C4'-P-C4' energy: -33.170 flat angles P-C4'-P energy: -21.238 tors. eta vs tors. theta energy: -46.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -544.431386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.431386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.431386 (E_RNA) where: Base-Base interactions energy: -385.049 where: short stacking energy: -149.617 Base-Backbone interact. energy: -1.433 local terms energy: -157.948880 where: bonds (distance) C4'-P energy: -30.136 bonds (distance) P-C4' energy: -31.593 flat angles C4'-P-C4' energy: -27.139 flat angles P-C4'-P energy: -22.452 tors. eta vs tors. theta energy: -46.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -339.732244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.732244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.732244 (E_RNA) where: Base-Base interactions energy: -217.136 where: short stacking energy: -117.888 Base-Backbone interact. energy: -0.110 local terms energy: -122.486685 where: bonds (distance) C4'-P energy: -25.726 bonds (distance) P-C4' energy: -23.479 flat angles C4'-P-C4' energy: -25.324 flat angles P-C4'-P energy: -19.987 tors. eta vs tors. theta energy: -27.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -377.233564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.233564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.233564 (E_RNA) where: Base-Base interactions energy: -255.936 where: short stacking energy: -113.362 Base-Backbone interact. energy: -0.227 local terms energy: -121.070367 where: bonds (distance) C4'-P energy: -23.574 bonds (distance) P-C4' energy: -20.962 flat angles C4'-P-C4' energy: -25.692 flat angles P-C4'-P energy: -19.729 tors. eta vs tors. theta energy: -31.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -362.179945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.179945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.179945 (E_RNA) where: Base-Base interactions energy: -235.308 where: short stacking energy: -108.175 Base-Backbone interact. energy: -0.496 local terms energy: -126.376703 where: bonds (distance) C4'-P energy: -26.567 bonds (distance) P-C4' energy: -18.581 flat angles C4'-P-C4' energy: -31.485 flat angles P-C4'-P energy: -18.504 tors. eta vs tors. theta energy: -31.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -263.056701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.056701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.056701 (E_RNA) where: Base-Base interactions energy: -168.193 where: short stacking energy: -91.927 Base-Backbone interact. energy: 0.100 local terms energy: -94.963175 where: bonds (distance) C4'-P energy: -19.683 bonds (distance) P-C4' energy: -20.281 flat angles C4'-P-C4' energy: -20.132 flat angles P-C4'-P energy: -18.512 tors. eta vs tors. theta energy: -16.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -172.719366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.719366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.719366 (E_RNA) where: Base-Base interactions energy: -89.950 where: short stacking energy: -57.759 Base-Backbone interact. energy: -1.014 local terms energy: -81.754533 where: bonds (distance) C4'-P energy: -23.189 bonds (distance) P-C4' energy: -25.072 flat angles C4'-P-C4' energy: -23.580 flat angles P-C4'-P energy: -8.491 tors. eta vs tors. theta energy: -1.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -126.757040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.757040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.757040 (E_RNA) where: Base-Base interactions energy: -38.896 where: short stacking energy: -35.315 Base-Backbone interact. energy: -0.250 local terms energy: -87.610944 where: bonds (distance) C4'-P energy: -27.194 bonds (distance) P-C4' energy: -30.190 flat angles C4'-P-C4' energy: -19.308 flat angles P-C4'-P energy: -16.644 tors. eta vs tors. theta energy: 5.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -141.035312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.035312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.035312 (E_RNA) where: Base-Base interactions energy: -51.564 where: short stacking energy: -48.366 Base-Backbone interact. energy: -0.941 local terms energy: -88.529795 where: bonds (distance) C4'-P energy: -30.738 bonds (distance) P-C4' energy: -26.610 flat angles C4'-P-C4' energy: -22.490 flat angles P-C4'-P energy: -12.904 tors. eta vs tors. theta energy: 4.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -557.069594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.069594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.069594 (E_RNA) where: Base-Base interactions energy: -401.179 where: short stacking energy: -155.266 Base-Backbone interact. energy: -0.857 local terms energy: -155.033679 where: bonds (distance) C4'-P energy: -29.327 bonds (distance) P-C4' energy: -23.063 flat angles C4'-P-C4' energy: -33.246 flat angles P-C4'-P energy: -24.134 tors. eta vs tors. theta energy: -45.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -550.995997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.995997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.995997 (E_RNA) where: Base-Base interactions energy: -398.380 where: short stacking energy: -154.950 Base-Backbone interact. energy: -0.308 local terms energy: -152.308143 where: bonds (distance) C4'-P energy: -27.371 bonds (distance) P-C4' energy: -25.581 flat angles C4'-P-C4' energy: -31.289 flat angles P-C4'-P energy: -21.741 tors. eta vs tors. theta energy: -46.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -543.898286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.898286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.898286 (E_RNA) where: Base-Base interactions energy: -388.645 where: short stacking energy: -156.870 Base-Backbone interact. energy: -0.002 local terms energy: -155.250990 where: bonds (distance) C4'-P energy: -29.371 bonds (distance) P-C4' energy: -22.503 flat angles C4'-P-C4' energy: -30.254 flat angles P-C4'-P energy: -24.252 tors. eta vs tors. theta energy: -48.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -343.530521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.530521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.530521 (E_RNA) where: Base-Base interactions energy: -216.084 where: short stacking energy: -108.308 Base-Backbone interact. energy: -0.061 local terms energy: -127.385314 where: bonds (distance) C4'-P energy: -23.990 bonds (distance) P-C4' energy: -21.251 flat angles C4'-P-C4' energy: -27.328 flat angles P-C4'-P energy: -19.292 tors. eta vs tors. theta energy: -35.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -370.912064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.912064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.912064 (E_RNA) where: Base-Base interactions energy: -251.229 where: short stacking energy: -106.982 Base-Backbone interact. energy: -0.013 local terms energy: -119.670345 where: bonds (distance) C4'-P energy: -29.114 bonds (distance) P-C4' energy: -15.823 flat angles C4'-P-C4' energy: -27.854 flat angles P-C4'-P energy: -15.565 tors. eta vs tors. theta energy: -31.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -349.723710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.723710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.723710 (E_RNA) where: Base-Base interactions energy: -241.306 where: short stacking energy: -97.068 Base-Backbone interact. energy: -0.421 local terms energy: -107.997134 where: bonds (distance) C4'-P energy: -15.469 bonds (distance) P-C4' energy: -23.480 flat angles C4'-P-C4' energy: -29.776 flat angles P-C4'-P energy: -17.474 tors. eta vs tors. theta energy: -21.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -305.226644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.226644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.226644 (E_RNA) where: Base-Base interactions energy: -189.580 where: short stacking energy: -93.981 Base-Backbone interact. energy: -0.207 local terms energy: -115.439580 where: bonds (distance) C4'-P energy: -25.307 bonds (distance) P-C4' energy: -19.116 flat angles C4'-P-C4' energy: -28.514 flat angles P-C4'-P energy: -18.361 tors. eta vs tors. theta energy: -24.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -159.534888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.534888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.534888 (E_RNA) where: Base-Base interactions energy: -72.762 where: short stacking energy: -40.692 Base-Backbone interact. energy: -0.571 local terms energy: -86.202074 where: bonds (distance) C4'-P energy: -20.343 bonds (distance) P-C4' energy: -25.006 flat angles C4'-P-C4' energy: -25.806 flat angles P-C4'-P energy: -12.907 tors. eta vs tors. theta energy: -2.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -124.471601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.471601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.471601 (E_RNA) where: Base-Base interactions energy: -47.420 where: short stacking energy: -41.085 Base-Backbone interact. energy: -0.781 local terms energy: -76.270489 where: bonds (distance) C4'-P energy: -28.505 bonds (distance) P-C4' energy: -28.360 flat angles C4'-P-C4' energy: -10.840 flat angles P-C4'-P energy: -8.553 tors. eta vs tors. theta energy: -0.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -133.359245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.359245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.359245 (E_RNA) where: Base-Base interactions energy: -43.572 where: short stacking energy: -43.572 Base-Backbone interact. energy: -0.837 local terms energy: -88.949793 where: bonds (distance) C4'-P energy: -22.412 bonds (distance) P-C4' energy: -25.372 flat angles C4'-P-C4' energy: -19.987 flat angles P-C4'-P energy: -16.842 tors. eta vs tors. theta energy: -4.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -555.701093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.701093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.701093 (E_RNA) where: Base-Base interactions energy: -396.567 where: short stacking energy: -155.918 Base-Backbone interact. energy: -1.388 local terms energy: -157.746131 where: bonds (distance) C4'-P energy: -29.379 bonds (distance) P-C4' energy: -29.552 flat angles C4'-P-C4' energy: -33.473 flat angles P-C4'-P energy: -21.322 tors. eta vs tors. theta energy: -44.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -547.322433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.322433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.322433 (E_RNA) where: Base-Base interactions energy: -399.751 where: short stacking energy: -159.257 Base-Backbone interact. energy: -1.665 local terms energy: -145.906199 where: bonds (distance) C4'-P energy: -24.951 bonds (distance) P-C4' energy: -27.723 flat angles C4'-P-C4' energy: -29.160 flat angles P-C4'-P energy: -17.126 tors. eta vs tors. theta energy: -46.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -538.794523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.794523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.794523 (E_RNA) where: Base-Base interactions energy: -388.120 where: short stacking energy: -152.464 Base-Backbone interact. energy: -0.989 local terms energy: -149.685104 where: bonds (distance) C4'-P energy: -29.094 bonds (distance) P-C4' energy: -26.512 flat angles C4'-P-C4' energy: -27.661 flat angles P-C4'-P energy: -20.283 tors. eta vs tors. theta energy: -46.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -389.036449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.036449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.036449 (E_RNA) where: Base-Base interactions energy: -261.496 where: short stacking energy: -111.367 Base-Backbone interact. energy: -0.681 local terms energy: -126.859589 where: bonds (distance) C4'-P energy: -23.385 bonds (distance) P-C4' energy: -28.384 flat angles C4'-P-C4' energy: -25.526 flat angles P-C4'-P energy: -19.439 tors. eta vs tors. theta energy: -30.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -330.660365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.660365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.660365 (E_RNA) where: Base-Base interactions energy: -208.604 where: short stacking energy: -112.015 Base-Backbone interact. energy: -0.013 local terms energy: -122.043228 where: bonds (distance) C4'-P energy: -28.485 bonds (distance) P-C4' energy: -20.679 flat angles C4'-P-C4' energy: -28.549 flat angles P-C4'-P energy: -15.724 tors. eta vs tors. theta energy: -28.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -313.620873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.620873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.620873 (E_RNA) where: Base-Base interactions energy: -191.790 where: short stacking energy: -88.487 Base-Backbone interact. energy: -0.057 local terms energy: -121.773179 where: bonds (distance) C4'-P energy: -21.972 bonds (distance) P-C4' energy: -28.563 flat angles C4'-P-C4' energy: -28.758 flat angles P-C4'-P energy: -18.066 tors. eta vs tors. theta energy: -24.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -358.797649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.797649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.797649 (E_RNA) where: Base-Base interactions energy: -240.778 where: short stacking energy: -101.300 Base-Backbone interact. energy: -0.045 local terms energy: -117.974371 where: bonds (distance) C4'-P energy: -24.524 bonds (distance) P-C4' energy: -25.119 flat angles C4'-P-C4' energy: -20.860 flat angles P-C4'-P energy: -15.968 tors. eta vs tors. theta energy: -31.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -153.849477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.849477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.849477 (E_RNA) where: Base-Base interactions energy: -58.658 where: short stacking energy: -40.241 Base-Backbone interact. energy: -0.352 local terms energy: -94.839378 where: bonds (distance) C4'-P energy: -27.989 bonds (distance) P-C4' energy: -24.832 flat angles C4'-P-C4' energy: -25.834 flat angles P-C4'-P energy: -15.168 tors. eta vs tors. theta energy: -1.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -127.176502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.176502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.176502 (E_RNA) where: Base-Base interactions energy: -39.100 where: short stacking energy: -37.712 Base-Backbone interact. energy: -0.180 local terms energy: -87.896894 where: bonds (distance) C4'-P energy: -24.088 bonds (distance) P-C4' energy: -28.634 flat angles C4'-P-C4' energy: -21.222 flat angles P-C4'-P energy: -11.363 tors. eta vs tors. theta energy: -2.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -128.763867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.763867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.763867 (E_RNA) where: Base-Base interactions energy: -40.331 where: short stacking energy: -40.624 Base-Backbone interact. energy: -0.343 local terms energy: -88.090304 where: bonds (distance) C4'-P energy: -18.693 bonds (distance) P-C4' energy: -29.452 flat angles C4'-P-C4' energy: -22.099 flat angles P-C4'-P energy: -8.590 tors. eta vs tors. theta energy: -9.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -563.757502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.757502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.757502 (E_RNA) where: Base-Base interactions energy: -405.840 where: short stacking energy: -154.789 Base-Backbone interact. energy: -1.434 local terms energy: -156.483623 where: bonds (distance) C4'-P energy: -26.815 bonds (distance) P-C4' energy: -22.705 flat angles C4'-P-C4' energy: -34.442 flat angles P-C4'-P energy: -22.858 tors. eta vs tors. theta energy: -49.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -548.604613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.604613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.604613 (E_RNA) where: Base-Base interactions energy: -391.620 where: short stacking energy: -155.446 Base-Backbone interact. energy: -0.376 local terms energy: -156.609306 where: bonds (distance) C4'-P energy: -27.171 bonds (distance) P-C4' energy: -30.357 flat angles C4'-P-C4' energy: -27.904 flat angles P-C4'-P energy: -23.187 tors. eta vs tors. theta energy: -47.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -550.724122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.724122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.724122 (E_RNA) where: Base-Base interactions energy: -400.345 where: short stacking energy: -158.584 Base-Backbone interact. energy: -0.007 local terms energy: -150.371781 where: bonds (distance) C4'-P energy: -30.687 bonds (distance) P-C4' energy: -26.028 flat angles C4'-P-C4' energy: -27.169 flat angles P-C4'-P energy: -21.323 tors. eta vs tors. theta energy: -45.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -375.204459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.204459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.204459 (E_RNA) where: Base-Base interactions energy: -265.631 where: short stacking energy: -119.352 Base-Backbone interact. energy: -0.091 local terms energy: -109.482948 where: bonds (distance) C4'-P energy: -27.455 bonds (distance) P-C4' energy: -19.790 flat angles C4'-P-C4' energy: -21.915 flat angles P-C4'-P energy: -6.720 tors. eta vs tors. theta energy: -33.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -363.249800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.249800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.249800 (E_RNA) where: Base-Base interactions energy: -231.591 where: short stacking energy: -109.869 Base-Backbone interact. energy: -0.069 local terms energy: -131.589325 where: bonds (distance) C4'-P energy: -24.162 bonds (distance) P-C4' energy: -22.790 flat angles C4'-P-C4' energy: -23.006 flat angles P-C4'-P energy: -23.716 tors. eta vs tors. theta energy: -37.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -320.060639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.060639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.060639 (E_RNA) where: Base-Base interactions energy: -215.223 where: short stacking energy: -98.761 Base-Backbone interact. energy: -0.106 local terms energy: -104.731467 where: bonds (distance) C4'-P energy: -18.168 bonds (distance) P-C4' energy: -23.654 flat angles C4'-P-C4' energy: -21.314 flat angles P-C4'-P energy: -19.506 tors. eta vs tors. theta energy: -22.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -379.117578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.117578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.117578 (E_RNA) where: Base-Base interactions energy: -254.644 where: short stacking energy: -99.668 Base-Backbone interact. energy: -0.269 local terms energy: -124.205113 where: bonds (distance) C4'-P energy: -23.727 bonds (distance) P-C4' energy: -21.487 flat angles C4'-P-C4' energy: -27.931 flat angles P-C4'-P energy: -19.905 tors. eta vs tors. theta energy: -31.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -192.737270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.737270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.737270 (E_RNA) where: Base-Base interactions energy: -93.952 where: short stacking energy: -56.649 Base-Backbone interact. energy: -0.206 local terms energy: -98.579305 where: bonds (distance) C4'-P energy: -26.162 bonds (distance) P-C4' energy: -26.195 flat angles C4'-P-C4' energy: -23.297 flat angles P-C4'-P energy: -12.307 tors. eta vs tors. theta energy: -10.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -142.077003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.077003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.077003 (E_RNA) where: Base-Base interactions energy: -61.096 where: short stacking energy: -61.096 Base-Backbone interact. energy: -0.209 local terms energy: -80.771530 where: bonds (distance) C4'-P energy: -23.496 bonds (distance) P-C4' energy: -19.292 flat angles C4'-P-C4' energy: -18.454 flat angles P-C4'-P energy: -6.962 tors. eta vs tors. theta energy: -12.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -127.573509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.573509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.573509 (E_RNA) where: Base-Base interactions energy: -41.629 where: short stacking energy: -40.134 Base-Backbone interact. energy: -0.113 local terms energy: -85.831991 where: bonds (distance) C4'-P energy: -25.007 bonds (distance) P-C4' energy: -27.394 flat angles C4'-P-C4' energy: -19.944 flat angles P-C4'-P energy: -14.619 tors. eta vs tors. theta energy: 1.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -556.426730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.426730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.426730 (E_RNA) where: Base-Base interactions energy: -400.443 where: short stacking energy: -154.596 Base-Backbone interact. energy: -0.143 local terms energy: -155.841445 where: bonds (distance) C4'-P energy: -24.448 bonds (distance) P-C4' energy: -32.070 flat angles C4'-P-C4' energy: -29.745 flat angles P-C4'-P energy: -23.371 tors. eta vs tors. theta energy: -46.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -565.059204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.059204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.059204 (E_RNA) where: Base-Base interactions energy: -409.734 where: short stacking energy: -161.054 Base-Backbone interact. energy: -0.612 local terms energy: -154.713765 where: bonds (distance) C4'-P energy: -27.921 bonds (distance) P-C4' energy: -30.772 flat angles C4'-P-C4' energy: -26.337 flat angles P-C4'-P energy: -22.763 tors. eta vs tors. theta energy: -46.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -542.475318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.475318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.475318 (E_RNA) where: Base-Base interactions energy: -385.945 where: short stacking energy: -149.745 Base-Backbone interact. energy: -0.002 local terms energy: -156.527483 where: bonds (distance) C4'-P energy: -29.734 bonds (distance) P-C4' energy: -26.095 flat angles C4'-P-C4' energy: -32.492 flat angles P-C4'-P energy: -20.886 tors. eta vs tors. theta energy: -47.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -389.101711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.101711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.101711 (E_RNA) where: Base-Base interactions energy: -247.720 where: short stacking energy: -141.084 Base-Backbone interact. energy: -0.597 local terms energy: -140.784807 where: bonds (distance) C4'-P energy: -27.265 bonds (distance) P-C4' energy: -24.250 flat angles C4'-P-C4' energy: -25.956 flat angles P-C4'-P energy: -21.913 tors. eta vs tors. theta energy: -41.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -370.077500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.077500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.077500 (E_RNA) where: Base-Base interactions energy: -244.695 where: short stacking energy: -101.199 Base-Backbone interact. energy: -0.817 local terms energy: -124.565066 where: bonds (distance) C4'-P energy: -27.718 bonds (distance) P-C4' energy: -25.185 flat angles C4'-P-C4' energy: -29.501 flat angles P-C4'-P energy: -10.421 tors. eta vs tors. theta energy: -31.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -385.441722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.441722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.441722 (E_RNA) where: Base-Base interactions energy: -251.044 where: short stacking energy: -102.259 Base-Backbone interact. energy: 0.196 local terms energy: -134.594141 where: bonds (distance) C4'-P energy: -24.501 bonds (distance) P-C4' energy: -29.213 flat angles C4'-P-C4' energy: -28.773 flat angles P-C4'-P energy: -17.827 tors. eta vs tors. theta energy: -34.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -310.837911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.837911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.837911 (E_RNA) where: Base-Base interactions energy: -195.301 where: short stacking energy: -86.984 Base-Backbone interact. energy: 0.044 local terms energy: -115.580950 where: bonds (distance) C4'-P energy: -25.886 bonds (distance) P-C4' energy: -27.913 flat angles C4'-P-C4' energy: -23.233 flat angles P-C4'-P energy: -12.546 tors. eta vs tors. theta energy: -26.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -203.098194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.098194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.098194 (E_RNA) where: Base-Base interactions energy: -105.017 where: short stacking energy: -60.837 Base-Backbone interact. energy: -2.643 local terms energy: -95.438575 where: bonds (distance) C4'-P energy: -20.196 bonds (distance) P-C4' energy: -27.527 flat angles C4'-P-C4' energy: -27.634 flat angles P-C4'-P energy: -11.218 tors. eta vs tors. theta energy: -8.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -144.792426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.792426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.792426 (E_RNA) where: Base-Base interactions energy: -69.800 where: short stacking energy: -59.542 Base-Backbone interact. energy: 1.695 local terms energy: -76.687268 where: bonds (distance) C4'-P energy: -25.020 bonds (distance) P-C4' energy: -23.777 flat angles C4'-P-C4' energy: -6.836 flat angles P-C4'-P energy: -12.570 tors. eta vs tors. theta energy: -8.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -119.472013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.472013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.472013 (E_RNA) where: Base-Base interactions energy: -51.452 where: short stacking energy: -35.761 Base-Backbone interact. energy: -0.525 local terms energy: -67.494871 where: bonds (distance) C4'-P energy: -13.300 bonds (distance) P-C4' energy: -17.295 flat angles C4'-P-C4' energy: -21.689 flat angles P-C4'-P energy: -16.079 tors. eta vs tors. theta energy: 0.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -560.086357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.086357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.086357 (E_RNA) where: Base-Base interactions energy: -406.690 where: short stacking energy: -162.028 Base-Backbone interact. energy: -0.398 local terms energy: -152.998525 where: bonds (distance) C4'-P energy: -25.422 bonds (distance) P-C4' energy: -28.002 flat angles C4'-P-C4' energy: -33.525 flat angles P-C4'-P energy: -17.315 tors. eta vs tors. theta energy: -48.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -548.202556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.202556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.202556 (E_RNA) where: Base-Base interactions energy: -397.920 where: short stacking energy: -156.139 Base-Backbone interact. energy: -0.249 local terms energy: -150.033894 where: bonds (distance) C4'-P energy: -27.592 bonds (distance) P-C4' energy: -23.363 flat angles C4'-P-C4' energy: -28.911 flat angles P-C4'-P energy: -23.107 tors. eta vs tors. theta energy: -47.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -546.944366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.944366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.944366 (E_RNA) where: Base-Base interactions energy: -386.871 where: short stacking energy: -150.497 Base-Backbone interact. energy: -0.000 local terms energy: -160.073191 where: bonds (distance) C4'-P energy: -29.567 bonds (distance) P-C4' energy: -27.564 flat angles C4'-P-C4' energy: -34.234 flat angles P-C4'-P energy: -21.002 tors. eta vs tors. theta energy: -47.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -378.387609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.387609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.387609 (E_RNA) where: Base-Base interactions energy: -238.317 where: short stacking energy: -126.358 Base-Backbone interact. energy: -0.038 local terms energy: -140.032440 where: bonds (distance) C4'-P energy: -28.053 bonds (distance) P-C4' energy: -22.099 flat angles C4'-P-C4' energy: -30.262 flat angles P-C4'-P energy: -17.523 tors. eta vs tors. theta energy: -42.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -392.432075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.432075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.432075 (E_RNA) where: Base-Base interactions energy: -256.931 where: short stacking energy: -118.820 Base-Backbone interact. energy: -0.311 local terms energy: -135.189470 where: bonds (distance) C4'-P energy: -26.171 bonds (distance) P-C4' energy: -24.375 flat angles C4'-P-C4' energy: -28.324 flat angles P-C4'-P energy: -20.760 tors. eta vs tors. theta energy: -35.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -360.779328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.779328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.779328 (E_RNA) where: Base-Base interactions energy: -236.216 where: short stacking energy: -108.155 Base-Backbone interact. energy: -0.970 local terms energy: -123.592869 where: bonds (distance) C4'-P energy: -24.057 bonds (distance) P-C4' energy: -28.333 flat angles C4'-P-C4' energy: -26.938 flat angles P-C4'-P energy: -10.752 tors. eta vs tors. theta energy: -33.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -301.253566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.253566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.253566 (E_RNA) where: Base-Base interactions energy: -185.022 where: short stacking energy: -90.530 Base-Backbone interact. energy: -0.129 local terms energy: -116.102759 where: bonds (distance) C4'-P energy: -27.868 bonds (distance) P-C4' energy: -21.016 flat angles C4'-P-C4' energy: -25.926 flat angles P-C4'-P energy: -17.248 tors. eta vs tors. theta energy: -24.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -188.470956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.470956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.470956 (E_RNA) where: Base-Base interactions energy: -96.550 where: short stacking energy: -60.356 Base-Backbone interact. energy: 0.760 local terms energy: -92.681156 where: bonds (distance) C4'-P energy: -25.567 bonds (distance) P-C4' energy: -24.756 flat angles C4'-P-C4' energy: -22.767 flat angles P-C4'-P energy: -15.487 tors. eta vs tors. theta energy: -4.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -137.606952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.606952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.606952 (E_RNA) where: Base-Base interactions energy: -45.193 where: short stacking energy: -31.314 Base-Backbone interact. energy: -0.119 local terms energy: -92.295102 where: bonds (distance) C4'-P energy: -23.392 bonds (distance) P-C4' energy: -28.801 flat angles C4'-P-C4' energy: -22.342 flat angles P-C4'-P energy: -17.913 tors. eta vs tors. theta energy: 0.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -126.219228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.219228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.219228 (E_RNA) where: Base-Base interactions energy: -59.355 where: short stacking energy: -40.392 Base-Backbone interact. energy: -0.318 local terms energy: -66.545735 where: bonds (distance) C4'-P energy: -20.660 bonds (distance) P-C4' energy: -22.374 flat angles C4'-P-C4' energy: -25.372 flat angles P-C4'-P energy: -1.333 tors. eta vs tors. theta energy: 3.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -563.810965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.810965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.810965 (E_RNA) where: Base-Base interactions energy: -398.493 where: short stacking energy: -153.019 Base-Backbone interact. energy: -1.059 local terms energy: -164.259660 where: bonds (distance) C4'-P energy: -26.425 bonds (distance) P-C4' energy: -31.227 flat angles C4'-P-C4' energy: -32.485 flat angles P-C4'-P energy: -25.206 tors. eta vs tors. theta energy: -48.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -545.105488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.105488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.105488 (E_RNA) where: Base-Base interactions energy: -393.240 where: short stacking energy: -155.143 Base-Backbone interact. energy: -0.010 local terms energy: -151.855269 where: bonds (distance) C4'-P energy: -25.053 bonds (distance) P-C4' energy: -26.651 flat angles C4'-P-C4' energy: -32.729 flat angles P-C4'-P energy: -19.312 tors. eta vs tors. theta energy: -48.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -534.909920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.909920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.909920 (E_RNA) where: Base-Base interactions energy: -397.212 where: short stacking energy: -154.821 Base-Backbone interact. energy: -0.001 local terms energy: -137.696895 where: bonds (distance) C4'-P energy: -23.682 bonds (distance) P-C4' energy: -23.772 flat angles C4'-P-C4' energy: -28.719 flat angles P-C4'-P energy: -18.212 tors. eta vs tors. theta energy: -43.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -383.841578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.841578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.841578 (E_RNA) where: Base-Base interactions energy: -254.710 where: short stacking energy: -104.372 Base-Backbone interact. energy: -0.680 local terms energy: -128.451761 where: bonds (distance) C4'-P energy: -21.393 bonds (distance) P-C4' energy: -28.544 flat angles C4'-P-C4' energy: -27.823 flat angles P-C4'-P energy: -17.297 tors. eta vs tors. theta energy: -33.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -354.323271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.323271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.323271 (E_RNA) where: Base-Base interactions energy: -218.076 where: short stacking energy: -101.263 Base-Backbone interact. energy: -0.653 local terms energy: -135.593995 where: bonds (distance) C4'-P energy: -24.239 bonds (distance) P-C4' energy: -29.108 flat angles C4'-P-C4' energy: -30.080 flat angles P-C4'-P energy: -16.579 tors. eta vs tors. theta energy: -35.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -325.787862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.787862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.787862 (E_RNA) where: Base-Base interactions energy: -202.134 where: short stacking energy: -83.023 Base-Backbone interact. energy: -0.425 local terms energy: -123.228686 where: bonds (distance) C4'-P energy: -27.915 bonds (distance) P-C4' energy: -29.910 flat angles C4'-P-C4' energy: -21.344 flat angles P-C4'-P energy: -16.819 tors. eta vs tors. theta energy: -27.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -294.172671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.172671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.172671 (E_RNA) where: Base-Base interactions energy: -190.792 where: short stacking energy: -73.778 Base-Backbone interact. energy: 0.508 local terms energy: -103.889196 where: bonds (distance) C4'-P energy: -26.926 bonds (distance) P-C4' energy: -17.766 flat angles C4'-P-C4' energy: -24.606 flat angles P-C4'-P energy: -17.339 tors. eta vs tors. theta energy: -17.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -155.976453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.976453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.976453 (E_RNA) where: Base-Base interactions energy: -62.156 where: short stacking energy: -38.213 Base-Backbone interact. energy: -0.507 local terms energy: -93.313721 where: bonds (distance) C4'-P energy: -29.012 bonds (distance) P-C4' energy: -27.964 flat angles C4'-P-C4' energy: -24.502 flat angles P-C4'-P energy: -10.710 tors. eta vs tors. theta energy: -1.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -123.345670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.345670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.345670 (E_RNA) where: Base-Base interactions energy: -59.639 where: short stacking energy: -51.740 Base-Backbone interact. energy: -0.353 local terms energy: -63.353307 where: bonds (distance) C4'-P energy: -15.470 bonds (distance) P-C4' energy: -20.146 flat angles C4'-P-C4' energy: -17.929 flat angles P-C4'-P energy: -11.458 tors. eta vs tors. theta energy: 1.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -128.367381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.367381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.367381 (E_RNA) where: Base-Base interactions energy: -56.203 where: short stacking energy: -33.827 Base-Backbone interact. energy: -1.935 local terms energy: -70.229699 where: bonds (distance) C4'-P energy: -20.745 bonds (distance) P-C4' energy: -21.877 flat angles C4'-P-C4' energy: -24.315 flat angles P-C4'-P energy: -6.160 tors. eta vs tors. theta energy: 2.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -559.029869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.029869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.029869 (E_RNA) where: Base-Base interactions energy: -402.939 where: short stacking energy: -161.972 Base-Backbone interact. energy: -0.997 local terms energy: -155.093944 where: bonds (distance) C4'-P energy: -28.274 bonds (distance) P-C4' energy: -26.749 flat angles C4'-P-C4' energy: -30.482 flat angles P-C4'-P energy: -22.382 tors. eta vs tors. theta energy: -47.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -550.347485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.347485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.347485 (E_RNA) where: Base-Base interactions energy: -400.351 where: short stacking energy: -157.836 Base-Backbone interact. energy: -0.908 local terms energy: -149.088808 where: bonds (distance) C4'-P energy: -23.836 bonds (distance) P-C4' energy: -26.574 flat angles C4'-P-C4' energy: -28.210 flat angles P-C4'-P energy: -22.435 tors. eta vs tors. theta energy: -48.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -542.904737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.904737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.904737 (E_RNA) where: Base-Base interactions energy: -398.071 where: short stacking energy: -158.013 Base-Backbone interact. energy: -0.643 local terms energy: -144.191043 where: bonds (distance) C4'-P energy: -25.390 bonds (distance) P-C4' energy: -21.213 flat angles C4'-P-C4' energy: -28.455 flat angles P-C4'-P energy: -25.359 tors. eta vs tors. theta energy: -43.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -392.966392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.966392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.966392 (E_RNA) where: Base-Base interactions energy: -272.951 where: short stacking energy: -106.107 Base-Backbone interact. energy: -0.632 local terms energy: -119.382763 where: bonds (distance) C4'-P energy: -19.796 bonds (distance) P-C4' energy: -26.614 flat angles C4'-P-C4' energy: -22.574 flat angles P-C4'-P energy: -19.850 tors. eta vs tors. theta energy: -30.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -362.612946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.612946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.612946 (E_RNA) where: Base-Base interactions energy: -229.602 where: short stacking energy: -125.994 Base-Backbone interact. energy: -0.334 local terms energy: -132.676888 where: bonds (distance) C4'-P energy: -20.677 bonds (distance) P-C4' energy: -22.011 flat angles C4'-P-C4' energy: -27.628 flat angles P-C4'-P energy: -20.864 tors. eta vs tors. theta energy: -41.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -344.301305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.301305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.301305 (E_RNA) where: Base-Base interactions energy: -232.308 where: short stacking energy: -115.558 Base-Backbone interact. energy: -0.549 local terms energy: -111.444549 where: bonds (distance) C4'-P energy: -17.062 bonds (distance) P-C4' energy: -22.290 flat angles C4'-P-C4' energy: -19.899 flat angles P-C4'-P energy: -20.045 tors. eta vs tors. theta energy: -32.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -297.672033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.672033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.672033 (E_RNA) where: Base-Base interactions energy: -184.599 where: short stacking energy: -90.245 Base-Backbone interact. energy: 0.133 local terms energy: -113.206239 where: bonds (distance) C4'-P energy: -24.081 bonds (distance) P-C4' energy: -30.911 flat angles C4'-P-C4' energy: -23.617 flat angles P-C4'-P energy: -20.412 tors. eta vs tors. theta energy: -14.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -151.407334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.407334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.407334 (E_RNA) where: Base-Base interactions energy: -67.066 where: short stacking energy: -41.412 Base-Backbone interact. energy: -0.960 local terms energy: -83.381200 where: bonds (distance) C4'-P energy: -15.753 bonds (distance) P-C4' energy: -25.285 flat angles C4'-P-C4' energy: -28.166 flat angles P-C4'-P energy: -15.232 tors. eta vs tors. theta energy: 1.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -134.785839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.785839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.785839 (E_RNA) where: Base-Base interactions energy: -56.630 where: short stacking energy: -53.310 Base-Backbone interact. energy: -0.588 local terms energy: -77.568632 where: bonds (distance) C4'-P energy: -19.364 bonds (distance) P-C4' energy: -24.734 flat angles C4'-P-C4' energy: -20.014 flat angles P-C4'-P energy: -11.990 tors. eta vs tors. theta energy: -1.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -132.703539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.703539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.703539 (E_RNA) where: Base-Base interactions energy: -40.887 where: short stacking energy: -40.887 Base-Backbone interact. energy: -1.507 local terms energy: -90.309369 where: bonds (distance) C4'-P energy: -17.161 bonds (distance) P-C4' energy: -24.462 flat angles C4'-P-C4' energy: -23.322 flat angles P-C4'-P energy: -15.498 tors. eta vs tors. theta energy: -9.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -559.066489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.066489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.066489 (E_RNA) where: Base-Base interactions energy: -406.879 where: short stacking energy: -163.148 Base-Backbone interact. energy: -0.002 local terms energy: -152.184993 where: bonds (distance) C4'-P energy: -20.961 bonds (distance) P-C4' energy: -29.478 flat angles C4'-P-C4' energy: -30.809 flat angles P-C4'-P energy: -23.286 tors. eta vs tors. theta energy: -47.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -539.968206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.968206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.968206 (E_RNA) where: Base-Base interactions energy: -384.010 where: short stacking energy: -151.329 Base-Backbone interact. energy: -0.763 local terms energy: -155.195991 where: bonds (distance) C4'-P energy: -30.001 bonds (distance) P-C4' energy: -25.221 flat angles C4'-P-C4' energy: -28.602 flat angles P-C4'-P energy: -23.676 tors. eta vs tors. theta energy: -47.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -550.292675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.292675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.292675 (E_RNA) where: Base-Base interactions energy: -405.472 where: short stacking energy: -154.814 Base-Backbone interact. energy: -2.093 local terms energy: -142.727213 where: bonds (distance) C4'-P energy: -22.744 bonds (distance) P-C4' energy: -20.454 flat angles C4'-P-C4' energy: -30.192 flat angles P-C4'-P energy: -20.499 tors. eta vs tors. theta energy: -48.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -383.903254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.903254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.903254 (E_RNA) where: Base-Base interactions energy: -242.209 where: short stacking energy: -117.867 Base-Backbone interact. energy: -1.207 local terms energy: -140.487477 where: bonds (distance) C4'-P energy: -26.158 bonds (distance) P-C4' energy: -32.087 flat angles C4'-P-C4' energy: -27.429 flat angles P-C4'-P energy: -16.806 tors. eta vs tors. theta energy: -38.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -381.517325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.517325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.517325 (E_RNA) where: Base-Base interactions energy: -253.892 where: short stacking energy: -104.899 Base-Backbone interact. energy: -0.448 local terms energy: -127.176894 where: bonds (distance) C4'-P energy: -23.387 bonds (distance) P-C4' energy: -30.417 flat angles C4'-P-C4' energy: -24.601 flat angles P-C4'-P energy: -21.242 tors. eta vs tors. theta energy: -27.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -322.637430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.637430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.637430 (E_RNA) where: Base-Base interactions energy: -217.350 where: short stacking energy: -93.560 Base-Backbone interact. energy: 0.004 local terms energy: -105.291181 where: bonds (distance) C4'-P energy: -22.765 bonds (distance) P-C4' energy: -25.285 flat angles C4'-P-C4' energy: -19.524 flat angles P-C4'-P energy: -17.496 tors. eta vs tors. theta energy: -20.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -290.788477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.788477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.788477 (E_RNA) where: Base-Base interactions energy: -182.239 where: short stacking energy: -77.978 Base-Backbone interact. energy: 0.250 local terms energy: -108.799972 where: bonds (distance) C4'-P energy: -27.151 bonds (distance) P-C4' energy: -27.560 flat angles C4'-P-C4' energy: -26.975 flat angles P-C4'-P energy: -9.629 tors. eta vs tors. theta energy: -17.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -148.015356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.015356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.015356 (E_RNA) where: Base-Base interactions energy: -43.653 where: short stacking energy: -41.845 Base-Backbone interact. energy: -0.205 local terms energy: -104.156712 where: bonds (distance) C4'-P energy: -26.305 bonds (distance) P-C4' energy: -27.742 flat angles C4'-P-C4' energy: -28.866 flat angles P-C4'-P energy: -15.216 tors. eta vs tors. theta energy: -6.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -145.720122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.720122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.720122 (E_RNA) where: Base-Base interactions energy: -55.678 where: short stacking energy: -47.958 Base-Backbone interact. energy: 0.057 local terms energy: -90.099150 where: bonds (distance) C4'-P energy: -25.081 bonds (distance) P-C4' energy: -29.242 flat angles C4'-P-C4' energy: -12.966 flat angles P-C4'-P energy: -18.014 tors. eta vs tors. theta energy: -4.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -129.719066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.719066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.719066 (E_RNA) where: Base-Base interactions energy: -54.347 where: short stacking energy: -44.627 Base-Backbone interact. energy: -1.219 local terms energy: -74.153494 where: bonds (distance) C4'-P energy: -21.813 bonds (distance) P-C4' energy: -21.405 flat angles C4'-P-C4' energy: -23.896 flat angles P-C4'-P energy: -8.658 tors. eta vs tors. theta energy: 1.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -553.999959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.999959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.999959 (E_RNA) where: Base-Base interactions energy: -392.645 where: short stacking energy: -153.702 Base-Backbone interact. energy: -0.430 local terms energy: -160.925502 where: bonds (distance) C4'-P energy: -29.127 bonds (distance) P-C4' energy: -31.386 flat angles C4'-P-C4' energy: -29.232 flat angles P-C4'-P energy: -24.957 tors. eta vs tors. theta energy: -46.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -553.444646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.444646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.444646 (E_RNA) where: Base-Base interactions energy: -393.706 where: short stacking energy: -154.555 Base-Backbone interact. energy: -1.183 local terms energy: -158.555150 where: bonds (distance) C4'-P energy: -28.953 bonds (distance) P-C4' energy: -29.233 flat angles C4'-P-C4' energy: -29.240 flat angles P-C4'-P energy: -24.177 tors. eta vs tors. theta energy: -46.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -543.363421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.363421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.363421 (E_RNA) where: Base-Base interactions energy: -382.316 where: short stacking energy: -144.618 Base-Backbone interact. energy: -1.397 local terms energy: -159.650388 where: bonds (distance) C4'-P energy: -29.819 bonds (distance) P-C4' energy: -30.656 flat angles C4'-P-C4' energy: -29.877 flat angles P-C4'-P energy: -22.841 tors. eta vs tors. theta energy: -46.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -361.887701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.887701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.887701 (E_RNA) where: Base-Base interactions energy: -233.580 where: short stacking energy: -129.010 Base-Backbone interact. energy: -0.298 local terms energy: -128.009819 where: bonds (distance) C4'-P energy: -23.330 bonds (distance) P-C4' energy: -27.309 flat angles C4'-P-C4' energy: -19.954 flat angles P-C4'-P energy: -16.614 tors. eta vs tors. theta energy: -40.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -388.501936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.501936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.501936 (E_RNA) where: Base-Base interactions energy: -262.879 where: short stacking energy: -105.163 Base-Backbone interact. energy: -0.561 local terms energy: -125.061703 where: bonds (distance) C4'-P energy: -24.992 bonds (distance) P-C4' energy: -25.915 flat angles C4'-P-C4' energy: -27.876 flat angles P-C4'-P energy: -21.834 tors. eta vs tors. theta energy: -24.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -330.937514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.937514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.937514 (E_RNA) where: Base-Base interactions energy: -220.504 where: short stacking energy: -91.294 Base-Backbone interact. energy: -0.186 local terms energy: -110.247406 where: bonds (distance) C4'-P energy: -24.415 bonds (distance) P-C4' energy: -18.358 flat angles C4'-P-C4' energy: -25.938 flat angles P-C4'-P energy: -17.713 tors. eta vs tors. theta energy: -23.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -262.464449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.464449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.464449 (E_RNA) where: Base-Base interactions energy: -165.632 where: short stacking energy: -79.817 Base-Backbone interact. energy: -0.559 local terms energy: -96.273132 where: bonds (distance) C4'-P energy: -23.476 bonds (distance) P-C4' energy: -15.783 flat angles C4'-P-C4' energy: -21.726 flat angles P-C4'-P energy: -19.050 tors. eta vs tors. theta energy: -16.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -166.031724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.031724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.031724 (E_RNA) where: Base-Base interactions energy: -78.581 where: short stacking energy: -35.623 Base-Backbone interact. energy: -2.019 local terms energy: -85.431925 where: bonds (distance) C4'-P energy: -18.192 bonds (distance) P-C4' energy: -21.330 flat angles C4'-P-C4' energy: -26.113 flat angles P-C4'-P energy: -15.024 tors. eta vs tors. theta energy: -4.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -134.182981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.182981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.182981 (E_RNA) where: Base-Base interactions energy: -58.151 where: short stacking energy: -42.619 Base-Backbone interact. energy: -1.440 local terms energy: -74.591826 where: bonds (distance) C4'-P energy: -22.950 bonds (distance) P-C4' energy: -20.146 flat angles C4'-P-C4' energy: -24.317 flat angles P-C4'-P energy: -8.395 tors. eta vs tors. theta energy: 1.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -121.044632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.044632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.044632 (E_RNA) where: Base-Base interactions energy: -52.045 where: short stacking energy: -46.805 Base-Backbone interact. energy: -0.117 local terms energy: -68.882291 where: bonds (distance) C4'-P energy: -17.753 bonds (distance) P-C4' energy: -17.734 flat angles C4'-P-C4' energy: -15.761 flat angles P-C4'-P energy: -12.872 tors. eta vs tors. theta energy: -4.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -555.681022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.681022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.681022 (E_RNA) where: Base-Base interactions energy: -396.507 where: short stacking energy: -154.025 Base-Backbone interact. energy: -0.540 local terms energy: -158.634355 where: bonds (distance) C4'-P energy: -27.085 bonds (distance) P-C4' energy: -26.212 flat angles C4'-P-C4' energy: -32.723 flat angles P-C4'-P energy: -25.731 tors. eta vs tors. theta energy: -46.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -557.243857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.243857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.243857 (E_RNA) where: Base-Base interactions energy: -397.589 where: short stacking energy: -156.412 Base-Backbone interact. energy: -1.631 local terms energy: -158.024022 where: bonds (distance) C4'-P energy: -30.576 bonds (distance) P-C4' energy: -28.565 flat angles C4'-P-C4' energy: -26.610 flat angles P-C4'-P energy: -24.554 tors. eta vs tors. theta energy: -47.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -553.783872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.783872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.783872 (E_RNA) where: Base-Base interactions energy: -398.378 where: short stacking energy: -156.950 Base-Backbone interact. energy: -0.790 local terms energy: -154.615790 where: bonds (distance) C4'-P energy: -26.792 bonds (distance) P-C4' energy: -29.384 flat angles C4'-P-C4' energy: -31.799 flat angles P-C4'-P energy: -20.974 tors. eta vs tors. theta energy: -45.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -403.025155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.025155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.025155 (E_RNA) where: Base-Base interactions energy: -284.501 where: short stacking energy: -106.817 Base-Backbone interact. energy: -0.680 local terms energy: -117.844306 where: bonds (distance) C4'-P energy: -25.182 bonds (distance) P-C4' energy: -28.393 flat angles C4'-P-C4' energy: -26.672 flat angles P-C4'-P energy: -14.957 tors. eta vs tors. theta energy: -22.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -350.158773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.158773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.158773 (E_RNA) where: Base-Base interactions energy: -221.526 where: short stacking energy: -97.373 Base-Backbone interact. energy: -0.493 local terms energy: -128.139414 where: bonds (distance) C4'-P energy: -23.595 bonds (distance) P-C4' energy: -27.028 flat angles C4'-P-C4' energy: -30.192 flat angles P-C4'-P energy: -17.754 tors. eta vs tors. theta energy: -29.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -348.043171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.043171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.043171 (E_RNA) where: Base-Base interactions energy: -219.081 where: short stacking energy: -101.367 Base-Backbone interact. energy: -1.174 local terms energy: -127.787953 where: bonds (distance) C4'-P energy: -25.091 bonds (distance) P-C4' energy: -29.705 flat angles C4'-P-C4' energy: -23.329 flat angles P-C4'-P energy: -19.762 tors. eta vs tors. theta energy: -29.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -288.654314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.654314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.654314 (E_RNA) where: Base-Base interactions energy: -184.272 where: short stacking energy: -77.844 Base-Backbone interact. energy: 1.274 local terms energy: -105.657190 where: bonds (distance) C4'-P energy: -21.473 bonds (distance) P-C4' energy: -26.082 flat angles C4'-P-C4' energy: -17.927 flat angles P-C4'-P energy: -15.562 tors. eta vs tors. theta energy: -24.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -141.684238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.684238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.684238 (E_RNA) where: Base-Base interactions energy: -53.112 where: short stacking energy: -40.057 Base-Backbone interact. energy: -0.706 local terms energy: -87.866262 where: bonds (distance) C4'-P energy: -23.750 bonds (distance) P-C4' energy: -22.944 flat angles C4'-P-C4' energy: -23.767 flat angles P-C4'-P energy: -17.555 tors. eta vs tors. theta energy: 0.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -148.446242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.446242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.446242 (E_RNA) where: Base-Base interactions energy: -50.064 where: short stacking energy: -24.975 Base-Backbone interact. energy: -0.815 local terms energy: -97.567253 where: bonds (distance) C4'-P energy: -25.981 bonds (distance) P-C4' energy: -24.816 flat angles C4'-P-C4' energy: -21.090 flat angles P-C4'-P energy: -20.424 tors. eta vs tors. theta energy: -5.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -119.833385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.833385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.833385 (E_RNA) where: Base-Base interactions energy: -35.714 where: short stacking energy: -30.475 Base-Backbone interact. energy: -0.422 local terms energy: -83.697828 where: bonds (distance) C4'-P energy: -18.757 bonds (distance) P-C4' energy: -30.167 flat angles C4'-P-C4' energy: -26.898 flat angles P-C4'-P energy: -10.488 tors. eta vs tors. theta energy: 2.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -557.997330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.997330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.997330 (E_RNA) where: Base-Base interactions energy: -397.052 where: short stacking energy: -156.590 Base-Backbone interact. energy: -1.822 local terms energy: -159.123822 where: bonds (distance) C4'-P energy: -28.090 bonds (distance) P-C4' energy: -31.027 flat angles C4'-P-C4' energy: -27.108 flat angles P-C4'-P energy: -25.362 tors. eta vs tors. theta energy: -47.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -545.392143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.392143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.392143 (E_RNA) where: Base-Base interactions energy: -395.984 where: short stacking energy: -154.970 Base-Backbone interact. energy: -1.573 local terms energy: -147.834962 where: bonds (distance) C4'-P energy: -19.490 bonds (distance) P-C4' energy: -21.261 flat angles C4'-P-C4' energy: -33.446 flat angles P-C4'-P energy: -25.824 tors. eta vs tors. theta energy: -47.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -541.260184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.260184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.260184 (E_RNA) where: Base-Base interactions energy: -391.026 where: short stacking energy: -154.251 Base-Backbone interact. energy: -0.460 local terms energy: -149.774399 where: bonds (distance) C4'-P energy: -25.196 bonds (distance) P-C4' energy: -26.110 flat angles C4'-P-C4' energy: -29.031 flat angles P-C4'-P energy: -23.441 tors. eta vs tors. theta energy: -45.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -386.022815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.022815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.022815 (E_RNA) where: Base-Base interactions energy: -260.639 where: short stacking energy: -112.314 Base-Backbone interact. energy: 1.194 local terms energy: -126.578257 where: bonds (distance) C4'-P energy: -22.712 bonds (distance) P-C4' energy: -28.477 flat angles C4'-P-C4' energy: -24.311 flat angles P-C4'-P energy: -20.138 tors. eta vs tors. theta energy: -30.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -365.416800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.416800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.416800 (E_RNA) where: Base-Base interactions energy: -240.759 where: short stacking energy: -105.443 Base-Backbone interact. energy: -2.199 local terms energy: -122.458227 where: bonds (distance) C4'-P energy: -24.682 bonds (distance) P-C4' energy: -24.864 flat angles C4'-P-C4' energy: -26.325 flat angles P-C4'-P energy: -15.657 tors. eta vs tors. theta energy: -30.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -338.057448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.057448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.057448 (E_RNA) where: Base-Base interactions energy: -222.714 where: short stacking energy: -116.303 Base-Backbone interact. energy: -0.173 local terms energy: -115.170503 where: bonds (distance) C4'-P energy: -20.032 bonds (distance) P-C4' energy: -23.845 flat angles C4'-P-C4' energy: -27.432 flat angles P-C4'-P energy: -15.820 tors. eta vs tors. theta energy: -28.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -300.908435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.908435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.908435 (E_RNA) where: Base-Base interactions energy: -189.698 where: short stacking energy: -87.259 Base-Backbone interact. energy: -1.513 local terms energy: -109.697410 where: bonds (distance) C4'-P energy: -30.812 bonds (distance) P-C4' energy: -25.171 flat angles C4'-P-C4' energy: -22.471 flat angles P-C4'-P energy: -8.797 tors. eta vs tors. theta energy: -22.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -146.552303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.552303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.552303 (E_RNA) where: Base-Base interactions energy: -51.396 where: short stacking energy: -41.177 Base-Backbone interact. energy: -0.360 local terms energy: -94.796203 where: bonds (distance) C4'-P energy: -25.615 bonds (distance) P-C4' energy: -26.385 flat angles C4'-P-C4' energy: -25.932 flat angles P-C4'-P energy: -13.777 tors. eta vs tors. theta energy: -3.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -137.835217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.835217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.835217 (E_RNA) where: Base-Base interactions energy: -49.402 where: short stacking energy: -48.486 Base-Backbone interact. energy: -0.449 local terms energy: -87.984048 where: bonds (distance) C4'-P energy: -24.619 bonds (distance) P-C4' energy: -25.694 flat angles C4'-P-C4' energy: -22.960 flat angles P-C4'-P energy: -9.368 tors. eta vs tors. theta energy: -5.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -137.518157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.518157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.518157 (E_RNA) where: Base-Base interactions energy: -57.479 where: short stacking energy: -38.286 Base-Backbone interact. energy: -0.159 local terms energy: -79.880946 where: bonds (distance) C4'-P energy: -23.156 bonds (distance) P-C4' energy: -24.918 flat angles C4'-P-C4' energy: -21.381 flat angles P-C4'-P energy: -15.943 tors. eta vs tors. theta energy: 5.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -547.679878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.679878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.679878 (E_RNA) where: Base-Base interactions energy: -391.023 where: short stacking energy: -147.403 Base-Backbone interact. energy: -0.373 local terms energy: -156.283958 where: bonds (distance) C4'-P energy: -28.808 bonds (distance) P-C4' energy: -26.473 flat angles C4'-P-C4' energy: -31.018 flat angles P-C4'-P energy: -24.814 tors. eta vs tors. theta energy: -45.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -546.231972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.231972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.231972 (E_RNA) where: Base-Base interactions energy: -391.905 where: short stacking energy: -153.453 Base-Backbone interact. energy: -2.663 local terms energy: -151.664809 where: bonds (distance) C4'-P energy: -24.801 bonds (distance) P-C4' energy: -27.222 flat angles C4'-P-C4' energy: -30.525 flat angles P-C4'-P energy: -23.044 tors. eta vs tors. theta energy: -46.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -548.018623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.018623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.018623 (E_RNA) where: Base-Base interactions energy: -399.206 where: short stacking energy: -159.250 Base-Backbone interact. energy: -0.736 local terms energy: -148.077402 where: bonds (distance) C4'-P energy: -24.359 bonds (distance) P-C4' energy: -26.410 flat angles C4'-P-C4' energy: -31.679 flat angles P-C4'-P energy: -21.924 tors. eta vs tors. theta energy: -43.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -384.876356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.876356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.876356 (E_RNA) where: Base-Base interactions energy: -266.048 where: short stacking energy: -110.124 Base-Backbone interact. energy: -0.299 local terms energy: -118.529567 where: bonds (distance) C4'-P energy: -20.364 bonds (distance) P-C4' energy: -24.955 flat angles C4'-P-C4' energy: -22.797 flat angles P-C4'-P energy: -19.551 tors. eta vs tors. theta energy: -30.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -359.428627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.428627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.428627 (E_RNA) where: Base-Base interactions energy: -236.393 where: short stacking energy: -106.350 Base-Backbone interact. energy: -1.171 local terms energy: -121.864838 where: bonds (distance) C4'-P energy: -24.591 bonds (distance) P-C4' energy: -24.974 flat angles C4'-P-C4' energy: -24.971 flat angles P-C4'-P energy: -19.874 tors. eta vs tors. theta energy: -27.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -346.745538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.745538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.745538 (E_RNA) where: Base-Base interactions energy: -218.529 where: short stacking energy: -99.444 Base-Backbone interact. energy: -0.277 local terms energy: -127.939250 where: bonds (distance) C4'-P energy: -22.669 bonds (distance) P-C4' energy: -28.241 flat angles C4'-P-C4' energy: -27.945 flat angles P-C4'-P energy: -19.792 tors. eta vs tors. theta energy: -29.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -313.657128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.657128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.657128 (E_RNA) where: Base-Base interactions energy: -197.671 where: short stacking energy: -89.248 Base-Backbone interact. energy: 1.178 local terms energy: -117.164510 where: bonds (distance) C4'-P energy: -26.232 bonds (distance) P-C4' energy: -26.137 flat angles C4'-P-C4' energy: -24.007 flat angles P-C4'-P energy: -18.822 tors. eta vs tors. theta energy: -21.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -130.887432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.887432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.887432 (E_RNA) where: Base-Base interactions energy: -47.080 where: short stacking energy: -43.264 Base-Backbone interact. energy: -0.368 local terms energy: -83.439573 where: bonds (distance) C4'-P energy: -27.922 bonds (distance) P-C4' energy: -25.277 flat angles C4'-P-C4' energy: -10.394 flat angles P-C4'-P energy: -13.523 tors. eta vs tors. theta energy: -6.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -123.214567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.214567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.214567 (E_RNA) where: Base-Base interactions energy: -39.831 where: short stacking energy: -39.831 Base-Backbone interact. energy: -0.665 local terms energy: -82.718796 where: bonds (distance) C4'-P energy: -26.421 bonds (distance) P-C4' energy: -27.219 flat angles C4'-P-C4' energy: -24.518 flat angles P-C4'-P energy: -5.300 tors. eta vs tors. theta energy: 0.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -124.652303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.652303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.652303 (E_RNA) where: Base-Base interactions energy: -47.151 where: short stacking energy: -32.820 Base-Backbone interact. energy: 1.502 local terms energy: -79.002757 where: bonds (distance) C4'-P energy: -23.107 bonds (distance) P-C4' energy: -23.491 flat angles C4'-P-C4' energy: -21.807 flat angles P-C4'-P energy: -12.432 tors. eta vs tors. theta energy: 1.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -558.876669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.876669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.876669 (E_RNA) where: Base-Base interactions energy: -399.531 where: short stacking energy: -155.219 Base-Backbone interact. energy: -0.002 local terms energy: -159.343158 where: bonds (distance) C4'-P energy: -24.873 bonds (distance) P-C4' energy: -31.545 flat angles C4'-P-C4' energy: -30.339 flat angles P-C4'-P energy: -24.204 tors. eta vs tors. theta energy: -48.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -554.414514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.414514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.414514 (E_RNA) where: Base-Base interactions energy: -395.530 where: short stacking energy: -153.810 Base-Backbone interact. energy: -0.717 local terms energy: -158.167616 where: bonds (distance) C4'-P energy: -24.964 bonds (distance) P-C4' energy: -31.234 flat angles C4'-P-C4' energy: -33.744 flat angles P-C4'-P energy: -22.088 tors. eta vs tors. theta energy: -46.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -548.393923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.393923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.393923 (E_RNA) where: Base-Base interactions energy: -402.272 where: short stacking energy: -158.841 Base-Backbone interact. energy: -0.620 local terms energy: -145.501641 where: bonds (distance) C4'-P energy: -25.908 bonds (distance) P-C4' energy: -19.100 flat angles C4'-P-C4' energy: -32.433 flat angles P-C4'-P energy: -22.077 tors. eta vs tors. theta energy: -45.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -409.031965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.031965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.031965 (E_RNA) where: Base-Base interactions energy: -269.902 where: short stacking energy: -119.599 Base-Backbone interact. energy: -0.177 local terms energy: -138.953057 where: bonds (distance) C4'-P energy: -25.693 bonds (distance) P-C4' energy: -26.553 flat angles C4'-P-C4' energy: -28.822 flat angles P-C4'-P energy: -22.749 tors. eta vs tors. theta energy: -35.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -351.583749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.583749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.583749 (E_RNA) where: Base-Base interactions energy: -218.627 where: short stacking energy: -97.447 Base-Backbone interact. energy: -0.681 local terms energy: -132.274928 where: bonds (distance) C4'-P energy: -24.759 bonds (distance) P-C4' energy: -29.725 flat angles C4'-P-C4' energy: -27.577 flat angles P-C4'-P energy: -20.463 tors. eta vs tors. theta energy: -29.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -331.896904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.896904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.896904 (E_RNA) where: Base-Base interactions energy: -214.278 where: short stacking energy: -104.866 Base-Backbone interact. energy: -0.731 local terms energy: -116.888314 where: bonds (distance) C4'-P energy: -16.429 bonds (distance) P-C4' energy: -20.888 flat angles C4'-P-C4' energy: -27.177 flat angles P-C4'-P energy: -19.489 tors. eta vs tors. theta energy: -32.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -286.068853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.068853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.068853 (E_RNA) where: Base-Base interactions energy: -182.393 where: short stacking energy: -79.270 Base-Backbone interact. energy: -0.553 local terms energy: -103.123224 where: bonds (distance) C4'-P energy: -23.033 bonds (distance) P-C4' energy: -26.630 flat angles C4'-P-C4' energy: -28.099 flat angles P-C4'-P energy: -6.146 tors. eta vs tors. theta energy: -19.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -144.031372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.031372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.031372 (E_RNA) where: Base-Base interactions energy: -57.622 where: short stacking energy: -49.778 Base-Backbone interact. energy: -0.303 local terms energy: -86.106056 where: bonds (distance) C4'-P energy: -25.726 bonds (distance) P-C4' energy: -15.881 flat angles C4'-P-C4' energy: -25.275 flat angles P-C4'-P energy: -12.724 tors. eta vs tors. theta energy: -6.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -135.617406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.617406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.617406 (E_RNA) where: Base-Base interactions energy: -46.966 where: short stacking energy: -41.011 Base-Backbone interact. energy: -2.029 local terms energy: -86.622488 where: bonds (distance) C4'-P energy: -24.713 bonds (distance) P-C4' energy: -20.892 flat angles C4'-P-C4' energy: -25.666 flat angles P-C4'-P energy: -17.343 tors. eta vs tors. theta energy: 1.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -138.320068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.320068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.320068 (E_RNA) where: Base-Base interactions energy: -65.024 where: short stacking energy: -46.409 Base-Backbone interact. energy: -0.693 local terms energy: -72.602969 where: bonds (distance) C4'-P energy: -20.682 bonds (distance) P-C4' energy: -23.118 flat angles C4'-P-C4' energy: -14.547 flat angles P-C4'-P energy: -15.201 tors. eta vs tors. theta energy: 0.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -557.759212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.759212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.759212 (E_RNA) where: Base-Base interactions energy: -398.184 where: short stacking energy: -154.080 Base-Backbone interact. energy: -0.025 local terms energy: -159.550302 where: bonds (distance) C4'-P energy: -30.621 bonds (distance) P-C4' energy: -24.835 flat angles C4'-P-C4' energy: -32.602 flat angles P-C4'-P energy: -23.443 tors. eta vs tors. theta energy: -48.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -558.846275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.846275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.846275 (E_RNA) where: Base-Base interactions energy: -402.949 where: short stacking energy: -158.148 Base-Backbone interact. energy: -1.428 local terms energy: -154.469750 where: bonds (distance) C4'-P energy: -22.699 bonds (distance) P-C4' energy: -27.050 flat angles C4'-P-C4' energy: -33.527 flat angles P-C4'-P energy: -23.730 tors. eta vs tors. theta energy: -47.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -540.149871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.149871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.149871 (E_RNA) where: Base-Base interactions energy: -389.154 where: short stacking energy: -150.382 Base-Backbone interact. energy: -0.921 local terms energy: -150.074691 where: bonds (distance) C4'-P energy: -28.385 bonds (distance) P-C4' energy: -21.137 flat angles C4'-P-C4' energy: -31.862 flat angles P-C4'-P energy: -24.125 tors. eta vs tors. theta energy: -44.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -408.212588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.212588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.212588 (E_RNA) where: Base-Base interactions energy: -282.304 where: short stacking energy: -122.011 Base-Backbone interact. energy: -0.513 local terms energy: -125.395936 where: bonds (distance) C4'-P energy: -28.300 bonds (distance) P-C4' energy: -23.386 flat angles C4'-P-C4' energy: -27.139 flat angles P-C4'-P energy: -15.745 tors. eta vs tors. theta energy: -30.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -356.174884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.174884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.174884 (E_RNA) where: Base-Base interactions energy: -225.199 where: short stacking energy: -113.251 Base-Backbone interact. energy: -0.115 local terms energy: -130.860818 where: bonds (distance) C4'-P energy: -24.186 bonds (distance) P-C4' energy: -29.034 flat angles C4'-P-C4' energy: -28.710 flat angles P-C4'-P energy: -21.109 tors. eta vs tors. theta energy: -27.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -334.648754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.648754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.648754 (E_RNA) where: Base-Base interactions energy: -210.669 where: short stacking energy: -106.443 Base-Backbone interact. energy: -0.109 local terms energy: -123.870843 where: bonds (distance) C4'-P energy: -24.293 bonds (distance) P-C4' energy: -26.878 flat angles C4'-P-C4' energy: -25.050 flat angles P-C4'-P energy: -14.582 tors. eta vs tors. theta energy: -33.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -307.180490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.180490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.180490 (E_RNA) where: Base-Base interactions energy: -181.932 where: short stacking energy: -93.628 Base-Backbone interact. energy: -0.005 local terms energy: -125.243574 where: bonds (distance) C4'-P energy: -28.887 bonds (distance) P-C4' energy: -24.182 flat angles C4'-P-C4' energy: -28.952 flat angles P-C4'-P energy: -21.422 tors. eta vs tors. theta energy: -21.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -144.985300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.985300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.985300 (E_RNA) where: Base-Base interactions energy: -50.716 where: short stacking energy: -38.303 Base-Backbone interact. energy: -1.396 local terms energy: -92.873533 where: bonds (distance) C4'-P energy: -24.289 bonds (distance) P-C4' energy: -22.533 flat angles C4'-P-C4' energy: -22.872 flat angles P-C4'-P energy: -16.806 tors. eta vs tors. theta energy: -6.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -129.567325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.567325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.567325 (E_RNA) where: Base-Base interactions energy: -52.518 where: short stacking energy: -34.313 Base-Backbone interact. energy: -0.480 local terms energy: -76.568965 where: bonds (distance) C4'-P energy: -17.778 bonds (distance) P-C4' energy: -20.610 flat angles C4'-P-C4' energy: -26.578 flat angles P-C4'-P energy: -12.446 tors. eta vs tors. theta energy: 0.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -125.223063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.223063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.223063 (E_RNA) where: Base-Base interactions energy: -49.498 where: short stacking energy: -49.498 Base-Backbone interact. energy: 1.298 local terms energy: -77.023363 where: bonds (distance) C4'-P energy: -23.996 bonds (distance) P-C4' energy: -27.219 flat angles C4'-P-C4' energy: -11.023 flat angles P-C4'-P energy: -10.232 tors. eta vs tors. theta energy: -4.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -560.002253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.002253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.002253 (E_RNA) where: Base-Base interactions energy: -395.979 where: short stacking energy: -157.486 Base-Backbone interact. energy: -2.688 local terms energy: -161.335540 where: bonds (distance) C4'-P energy: -29.085 bonds (distance) P-C4' energy: -26.683 flat angles C4'-P-C4' energy: -32.477 flat angles P-C4'-P energy: -24.698 tors. eta vs tors. theta energy: -48.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -551.844547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.844547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.844547 (E_RNA) where: Base-Base interactions energy: -402.989 where: short stacking energy: -159.699 Base-Backbone interact. energy: -0.008 local terms energy: -148.848084 where: bonds (distance) C4'-P energy: -21.391 bonds (distance) P-C4' energy: -20.839 flat angles C4'-P-C4' energy: -35.198 flat angles P-C4'-P energy: -21.873 tors. eta vs tors. theta energy: -49.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -536.801067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.801067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.801067 (E_RNA) where: Base-Base interactions energy: -382.109 where: short stacking energy: -144.883 Base-Backbone interact. energy: -0.006 local terms energy: -154.686349 where: bonds (distance) C4'-P energy: -27.412 bonds (distance) P-C4' energy: -30.826 flat angles C4'-P-C4' energy: -29.616 flat angles P-C4'-P energy: -24.195 tors. eta vs tors. theta energy: -42.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -401.864542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.864542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.864542 (E_RNA) where: Base-Base interactions energy: -271.912 where: short stacking energy: -117.109 Base-Backbone interact. energy: -0.852 local terms energy: -129.100300 where: bonds (distance) C4'-P energy: -18.999 bonds (distance) P-C4' energy: -28.552 flat angles C4'-P-C4' energy: -27.034 flat angles P-C4'-P energy: -18.789 tors. eta vs tors. theta energy: -35.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -345.589947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.589947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.589947 (E_RNA) where: Base-Base interactions energy: -242.162 where: short stacking energy: -104.352 Base-Backbone interact. energy: -0.344 local terms energy: -103.083483 where: bonds (distance) C4'-P energy: -20.193 bonds (distance) P-C4' energy: -28.506 flat angles C4'-P-C4' energy: -17.912 flat angles P-C4'-P energy: -14.175 tors. eta vs tors. theta energy: -22.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -334.331197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.331197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.331197 (E_RNA) where: Base-Base interactions energy: -209.306 where: short stacking energy: -107.934 Base-Backbone interact. energy: 0.651 local terms energy: -125.676948 where: bonds (distance) C4'-P energy: -27.922 bonds (distance) P-C4' energy: -28.215 flat angles C4'-P-C4' energy: -23.567 flat angles P-C4'-P energy: -16.862 tors. eta vs tors. theta energy: -29.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -320.740404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.740404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.740404 (E_RNA) where: Base-Base interactions energy: -201.187 where: short stacking energy: -99.909 Base-Backbone interact. energy: -1.080 local terms energy: -118.473604 where: bonds (distance) C4'-P energy: -28.369 bonds (distance) P-C4' energy: -20.777 flat angles C4'-P-C4' energy: -26.099 flat angles P-C4'-P energy: -16.744 tors. eta vs tors. theta energy: -26.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -137.244999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.244999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.244999 (E_RNA) where: Base-Base interactions energy: -46.174 where: short stacking energy: -46.174 Base-Backbone interact. energy: 0.640 local terms energy: -91.710884 where: bonds (distance) C4'-P energy: -24.324 bonds (distance) P-C4' energy: -21.340 flat angles C4'-P-C4' energy: -25.466 flat angles P-C4'-P energy: -15.470 tors. eta vs tors. theta energy: -5.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -147.198950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.198950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.198950 (E_RNA) where: Base-Base interactions energy: -67.527 where: short stacking energy: -54.829 Base-Backbone interact. energy: -0.132 local terms energy: -79.539809 where: bonds (distance) C4'-P energy: -25.516 bonds (distance) P-C4' energy: -23.137 flat angles C4'-P-C4' energy: -14.269 flat angles P-C4'-P energy: -11.576 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -118.203184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.203184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.203184 (E_RNA) where: Base-Base interactions energy: -34.696 where: short stacking energy: -34.696 Base-Backbone interact. energy: 0.076 local terms energy: -83.583158 where: bonds (distance) C4'-P energy: -25.778 bonds (distance) P-C4' energy: -22.080 flat angles C4'-P-C4' energy: -24.768 flat angles P-C4'-P energy: -5.687 tors. eta vs tors. theta energy: -5.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -564.653775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.653775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.653775 (E_RNA) where: Base-Base interactions energy: -407.303 where: short stacking energy: -159.776 Base-Backbone interact. energy: -0.001 local terms energy: -157.350518 where: bonds (distance) C4'-P energy: -30.224 bonds (distance) P-C4' energy: -24.742 flat angles C4'-P-C4' energy: -32.738 flat angles P-C4'-P energy: -20.166 tors. eta vs tors. theta energy: -49.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -549.609958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.609958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.609958 (E_RNA) where: Base-Base interactions energy: -398.532 where: short stacking energy: -153.969 Base-Backbone interact. energy: -0.174 local terms energy: -150.903194 where: bonds (distance) C4'-P energy: -23.720 bonds (distance) P-C4' energy: -30.871 flat angles C4'-P-C4' energy: -28.770 flat angles P-C4'-P energy: -24.424 tors. eta vs tors. theta energy: -43.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -546.599398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.599398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.599398 (E_RNA) where: Base-Base interactions energy: -394.336 where: short stacking energy: -152.116 Base-Backbone interact. energy: -0.000 local terms energy: -152.263056 where: bonds (distance) C4'-P energy: -24.466 bonds (distance) P-C4' energy: -25.718 flat angles C4'-P-C4' energy: -30.896 flat angles P-C4'-P energy: -23.110 tors. eta vs tors. theta energy: -48.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -394.725815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.725815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.725815 (E_RNA) where: Base-Base interactions energy: -266.118 where: short stacking energy: -119.551 Base-Backbone interact. energy: -0.437 local terms energy: -128.170593 where: bonds (distance) C4'-P energy: -25.417 bonds (distance) P-C4' energy: -26.585 flat angles C4'-P-C4' energy: -29.253 flat angles P-C4'-P energy: -15.512 tors. eta vs tors. theta energy: -31.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -365.110779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.110779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.110779 (E_RNA) where: Base-Base interactions energy: -247.629 where: short stacking energy: -110.513 Base-Backbone interact. energy: -0.914 local terms energy: -116.567391 where: bonds (distance) C4'-P energy: -20.569 bonds (distance) P-C4' energy: -24.851 flat angles C4'-P-C4' energy: -22.991 flat angles P-C4'-P energy: -13.841 tors. eta vs tors. theta energy: -34.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -308.116314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.116314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.116314 (E_RNA) where: Base-Base interactions energy: -192.833 where: short stacking energy: -94.367 Base-Backbone interact. energy: -1.057 local terms energy: -114.225753 where: bonds (distance) C4'-P energy: -23.520 bonds (distance) P-C4' energy: -20.031 flat angles C4'-P-C4' energy: -26.841 flat angles P-C4'-P energy: -12.414 tors. eta vs tors. theta energy: -31.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -305.346212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.346212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.346212 (E_RNA) where: Base-Base interactions energy: -192.239 where: short stacking energy: -85.631 Base-Backbone interact. energy: -0.245 local terms energy: -112.861880 where: bonds (distance) C4'-P energy: -20.959 bonds (distance) P-C4' energy: -31.260 flat angles C4'-P-C4' energy: -22.584 flat angles P-C4'-P energy: -16.377 tors. eta vs tors. theta energy: -21.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -159.279520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.279520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.279520 (E_RNA) where: Base-Base interactions energy: -64.984 where: short stacking energy: -37.382 Base-Backbone interact. energy: -0.649 local terms energy: -93.646977 where: bonds (distance) C4'-P energy: -25.292 bonds (distance) P-C4' energy: -21.037 flat angles C4'-P-C4' energy: -25.988 flat angles P-C4'-P energy: -14.839 tors. eta vs tors. theta energy: -6.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -145.792865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.792865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.792865 (E_RNA) where: Base-Base interactions energy: -58.348 where: short stacking energy: -31.292 Base-Backbone interact. energy: 0.069 local terms energy: -87.514638 where: bonds (distance) C4'-P energy: -27.472 bonds (distance) P-C4' energy: -27.593 flat angles C4'-P-C4' energy: -17.654 flat angles P-C4'-P energy: -17.425 tors. eta vs tors. theta energy: 2.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -124.723623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.723623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.723623 (E_RNA) where: Base-Base interactions energy: -45.274 where: short stacking energy: -39.163 Base-Backbone interact. energy: -0.187 local terms energy: -79.263100 where: bonds (distance) C4'-P energy: -20.183 bonds (distance) P-C4' energy: -27.000 flat angles C4'-P-C4' energy: -18.795 flat angles P-C4'-P energy: -15.303 tors. eta vs tors. theta energy: 2.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -554.535381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.535381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.535381 (E_RNA) where: Base-Base interactions energy: -391.953 where: short stacking energy: -156.941 Base-Backbone interact. energy: -0.037 local terms energy: -162.545059 where: bonds (distance) C4'-P energy: -28.994 bonds (distance) P-C4' energy: -28.555 flat angles C4'-P-C4' energy: -31.867 flat angles P-C4'-P energy: -25.779 tors. eta vs tors. theta energy: -47.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -547.402778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.402778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.402778 (E_RNA) where: Base-Base interactions energy: -388.938 where: short stacking energy: -149.707 Base-Backbone interact. energy: -1.691 local terms energy: -156.773383 where: bonds (distance) C4'-P energy: -25.787 bonds (distance) P-C4' energy: -26.381 flat angles C4'-P-C4' energy: -32.673 flat angles P-C4'-P energy: -24.884 tors. eta vs tors. theta energy: -47.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -540.964083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.964083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.964083 (E_RNA) where: Base-Base interactions energy: -390.765 where: short stacking energy: -150.411 Base-Backbone interact. energy: -0.493 local terms energy: -149.705376 where: bonds (distance) C4'-P energy: -22.932 bonds (distance) P-C4' energy: -32.214 flat angles C4'-P-C4' energy: -25.437 flat angles P-C4'-P energy: -22.133 tors. eta vs tors. theta energy: -46.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -398.951459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.951459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.951459 (E_RNA) where: Base-Base interactions energy: -275.874 where: short stacking energy: -104.370 Base-Backbone interact. energy: -0.599 local terms energy: -122.478953 where: bonds (distance) C4'-P energy: -26.406 bonds (distance) P-C4' energy: -27.321 flat angles C4'-P-C4' energy: -25.329 flat angles P-C4'-P energy: -10.195 tors. eta vs tors. theta energy: -33.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -318.308108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.308108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.308108 (E_RNA) where: Base-Base interactions energy: -203.518 where: short stacking energy: -95.619 Base-Backbone interact. energy: -0.522 local terms energy: -114.267510 where: bonds (distance) C4'-P energy: -27.988 bonds (distance) P-C4' energy: -23.226 flat angles C4'-P-C4' energy: -26.643 flat angles P-C4'-P energy: -16.465 tors. eta vs tors. theta energy: -19.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -352.391067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.391067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.391067 (E_RNA) where: Base-Base interactions energy: -237.492 where: short stacking energy: -95.225 Base-Backbone interact. energy: -0.320 local terms energy: -114.578795 where: bonds (distance) C4'-P energy: -23.364 bonds (distance) P-C4' energy: -23.647 flat angles C4'-P-C4' energy: -22.950 flat angles P-C4'-P energy: -15.522 tors. eta vs tors. theta energy: -29.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -311.861397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.861397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.861397 (E_RNA) where: Base-Base interactions energy: -198.267 where: short stacking energy: -97.057 Base-Backbone interact. energy: -0.433 local terms energy: -113.161262 where: bonds (distance) C4'-P energy: -20.516 bonds (distance) P-C4' energy: -23.972 flat angles C4'-P-C4' energy: -29.059 flat angles P-C4'-P energy: -14.801 tors. eta vs tors. theta energy: -24.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -164.058320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.058320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.058320 (E_RNA) where: Base-Base interactions energy: -73.839 where: short stacking energy: -59.325 Base-Backbone interact. energy: 0.063 local terms energy: -90.282809 where: bonds (distance) C4'-P energy: -16.012 bonds (distance) P-C4' energy: -18.351 flat angles C4'-P-C4' energy: -20.361 flat angles P-C4'-P energy: -17.587 tors. eta vs tors. theta energy: -17.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -142.192149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.192149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.192149 (E_RNA) where: Base-Base interactions energy: -69.362 where: short stacking energy: -46.788 Base-Backbone interact. energy: -1.660 local terms energy: -71.169606 where: bonds (distance) C4'-P energy: -12.158 bonds (distance) P-C4' energy: -23.405 flat angles C4'-P-C4' energy: -19.021 flat angles P-C4'-P energy: -11.096 tors. eta vs tors. theta energy: -5.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -132.429194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.429194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.429194 (E_RNA) where: Base-Base interactions energy: -44.700 where: short stacking energy: -44.700 Base-Backbone interact. energy: 0.556 local terms energy: -88.284821 where: bonds (distance) C4'-P energy: -20.661 bonds (distance) P-C4' energy: -23.651 flat angles C4'-P-C4' energy: -23.506 flat angles P-C4'-P energy: -9.662 tors. eta vs tors. theta energy: -10.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -552.695507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.695507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.695507 (E_RNA) where: Base-Base interactions energy: -400.359 where: short stacking energy: -156.030 Base-Backbone interact. energy: 1.422 local terms energy: -153.758682 where: bonds (distance) C4'-P energy: -32.730 bonds (distance) P-C4' energy: -26.547 flat angles C4'-P-C4' energy: -29.325 flat angles P-C4'-P energy: -19.480 tors. eta vs tors. theta energy: -45.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -562.042032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.042032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.042032 (E_RNA) where: Base-Base interactions energy: -400.201 where: short stacking energy: -155.687 Base-Backbone interact. energy: -0.871 local terms energy: -160.969951 where: bonds (distance) C4'-P energy: -29.171 bonds (distance) P-C4' energy: -29.709 flat angles C4'-P-C4' energy: -31.131 flat angles P-C4'-P energy: -26.571 tors. eta vs tors. theta energy: -44.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -534.644718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.644718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.644718 (E_RNA) where: Base-Base interactions energy: -385.187 where: short stacking energy: -149.869 Base-Backbone interact. energy: -2.158 local terms energy: -147.300057 where: bonds (distance) C4'-P energy: -21.504 bonds (distance) P-C4' energy: -26.131 flat angles C4'-P-C4' energy: -31.334 flat angles P-C4'-P energy: -23.365 tors. eta vs tors. theta energy: -44.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -380.748383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.748383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.748383 (E_RNA) where: Base-Base interactions energy: -255.763 where: short stacking energy: -111.146 Base-Backbone interact. energy: -0.096 local terms energy: -124.889521 where: bonds (distance) C4'-P energy: -25.623 bonds (distance) P-C4' energy: -25.599 flat angles C4'-P-C4' energy: -27.499 flat angles P-C4'-P energy: -18.823 tors. eta vs tors. theta energy: -27.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -326.696957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.696957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.696957 (E_RNA) where: Base-Base interactions energy: -193.590 where: short stacking energy: -98.616 Base-Backbone interact. energy: -0.824 local terms energy: -132.283607 where: bonds (distance) C4'-P energy: -26.221 bonds (distance) P-C4' energy: -30.499 flat angles C4'-P-C4' energy: -24.466 flat angles P-C4'-P energy: -21.845 tors. eta vs tors. theta energy: -29.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -351.307907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.307907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.307907 (E_RNA) where: Base-Base interactions energy: -221.879 where: short stacking energy: -98.189 Base-Backbone interact. energy: -0.472 local terms energy: -128.956983 where: bonds (distance) C4'-P energy: -27.893 bonds (distance) P-C4' energy: -25.947 flat angles C4'-P-C4' energy: -26.998 flat angles P-C4'-P energy: -19.491 tors. eta vs tors. theta energy: -28.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -301.125525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.125525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.125525 (E_RNA) where: Base-Base interactions energy: -184.326 where: short stacking energy: -84.457 Base-Backbone interact. energy: -0.542 local terms energy: -116.257614 where: bonds (distance) C4'-P energy: -26.167 bonds (distance) P-C4' energy: -28.045 flat angles C4'-P-C4' energy: -27.102 flat angles P-C4'-P energy: -8.744 tors. eta vs tors. theta energy: -26.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -149.867775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.867775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.867775 (E_RNA) where: Base-Base interactions energy: -65.500 where: short stacking energy: -55.072 Base-Backbone interact. energy: 0.662 local terms energy: -85.029667 where: bonds (distance) C4'-P energy: -17.257 bonds (distance) P-C4' energy: -22.104 flat angles C4'-P-C4' energy: -25.252 flat angles P-C4'-P energy: -15.450 tors. eta vs tors. theta energy: -4.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -135.237201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.237201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.237201 (E_RNA) where: Base-Base interactions energy: -62.494 where: short stacking energy: -39.727 Base-Backbone interact. energy: -0.768 local terms energy: -71.975246 where: bonds (distance) C4'-P energy: -15.651 bonds (distance) P-C4' energy: -25.346 flat angles C4'-P-C4' energy: -12.312 flat angles P-C4'-P energy: -20.585 tors. eta vs tors. theta energy: 1.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -122.596149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.596149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.596149 (E_RNA) where: Base-Base interactions energy: -44.477 where: short stacking energy: -41.147 Base-Backbone interact. energy: -0.361 local terms energy: -77.758064 where: bonds (distance) C4'-P energy: -20.103 bonds (distance) P-C4' energy: -19.196 flat angles C4'-P-C4' energy: -16.827 flat angles P-C4'-P energy: -12.426 tors. eta vs tors. theta energy: -9.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -568.789651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.789651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.789651 (E_RNA) where: Base-Base interactions energy: -408.639 where: short stacking energy: -161.505 Base-Backbone interact. energy: -1.263 local terms energy: -158.887753 where: bonds (distance) C4'-P energy: -30.362 bonds (distance) P-C4' energy: -29.931 flat angles C4'-P-C4' energy: -28.471 flat angles P-C4'-P energy: -22.644 tors. eta vs tors. theta energy: -47.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -556.585405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.585405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.585405 (E_RNA) where: Base-Base interactions energy: -399.678 where: short stacking energy: -156.086 Base-Backbone interact. energy: -1.885 local terms energy: -155.022928 where: bonds (distance) C4'-P energy: -25.228 bonds (distance) P-C4' energy: -27.325 flat angles C4'-P-C4' energy: -31.888 flat angles P-C4'-P energy: -23.779 tors. eta vs tors. theta energy: -46.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -543.880656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.880656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.880656 (E_RNA) where: Base-Base interactions energy: -392.211 where: short stacking energy: -148.250 Base-Backbone interact. energy: -0.989 local terms energy: -150.680726 where: bonds (distance) C4'-P energy: -25.330 bonds (distance) P-C4' energy: -27.165 flat angles C4'-P-C4' energy: -27.999 flat angles P-C4'-P energy: -23.034 tors. eta vs tors. theta energy: -47.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -398.063437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.063437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.063437 (E_RNA) where: Base-Base interactions energy: -265.182 where: short stacking energy: -108.917 Base-Backbone interact. energy: -1.372 local terms energy: -131.508871 where: bonds (distance) C4'-P energy: -24.349 bonds (distance) P-C4' energy: -25.126 flat angles C4'-P-C4' energy: -28.851 flat angles P-C4'-P energy: -17.745 tors. eta vs tors. theta energy: -35.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -372.484760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.484760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.484760 (E_RNA) where: Base-Base interactions energy: -238.302 where: short stacking energy: -112.114 Base-Backbone interact. energy: -0.181 local terms energy: -134.001873 where: bonds (distance) C4'-P energy: -24.651 bonds (distance) P-C4' energy: -24.347 flat angles C4'-P-C4' energy: -31.007 flat angles P-C4'-P energy: -19.098 tors. eta vs tors. theta energy: -34.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -318.207419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.207419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.207419 (E_RNA) where: Base-Base interactions energy: -208.251 where: short stacking energy: -113.357 Base-Backbone interact. energy: -0.029 local terms energy: -109.927968 where: bonds (distance) C4'-P energy: -23.281 bonds (distance) P-C4' energy: -22.786 flat angles C4'-P-C4' energy: -25.029 flat angles P-C4'-P energy: -17.687 tors. eta vs tors. theta energy: -21.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -258.899348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.899348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.899348 (E_RNA) where: Base-Base interactions energy: -156.533 where: short stacking energy: -77.928 Base-Backbone interact. energy: -0.014 local terms energy: -102.352419 where: bonds (distance) C4'-P energy: -21.760 bonds (distance) P-C4' energy: -22.205 flat angles C4'-P-C4' energy: -24.418 flat angles P-C4'-P energy: -15.785 tors. eta vs tors. theta energy: -18.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -154.747365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.747365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.747365 (E_RNA) where: Base-Base interactions energy: -73.777 where: short stacking energy: -39.874 Base-Backbone interact. energy: -0.709 local terms energy: -80.261876 where: bonds (distance) C4'-P energy: -18.517 bonds (distance) P-C4' energy: -27.340 flat angles C4'-P-C4' energy: -16.836 flat angles P-C4'-P energy: -20.520 tors. eta vs tors. theta energy: 2.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -134.117502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.117502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.117502 (E_RNA) where: Base-Base interactions energy: -50.708 where: short stacking energy: -49.448 Base-Backbone interact. energy: 1.504 local terms energy: -84.912624 where: bonds (distance) C4'-P energy: -20.847 bonds (distance) P-C4' energy: -21.515 flat angles C4'-P-C4' energy: -19.673 flat angles P-C4'-P energy: -14.504 tors. eta vs tors. theta energy: -8.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -158.033085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.033085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.033085 (E_RNA) where: Base-Base interactions energy: -85.060 where: short stacking energy: -38.990 Base-Backbone interact. energy: 0.778 local terms energy: -73.750921 where: bonds (distance) C4'-P energy: -20.129 bonds (distance) P-C4' energy: -22.526 flat angles C4'-P-C4' energy: -16.469 flat angles P-C4'-P energy: -14.341 tors. eta vs tors. theta energy: -0.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -564.220598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.220598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.220598 (E_RNA) where: Base-Base interactions energy: -406.809 where: short stacking energy: -157.721 Base-Backbone interact. energy: -0.153 local terms energy: -157.259296 where: bonds (distance) C4'-P energy: -29.317 bonds (distance) P-C4' energy: -26.302 flat angles C4'-P-C4' energy: -29.183 flat angles P-C4'-P energy: -25.141 tors. eta vs tors. theta energy: -47.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -554.867380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.867380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.867380 (E_RNA) where: Base-Base interactions energy: -394.064 where: short stacking energy: -151.213 Base-Backbone interact. energy: 0.551 local terms energy: -161.353837 where: bonds (distance) C4'-P energy: -30.220 bonds (distance) P-C4' energy: -30.812 flat angles C4'-P-C4' energy: -28.706 flat angles P-C4'-P energy: -23.457 tors. eta vs tors. theta energy: -48.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -545.177176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.177176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.177176 (E_RNA) where: Base-Base interactions energy: -386.440 where: short stacking energy: -154.485 Base-Backbone interact. energy: -0.478 local terms energy: -158.258512 where: bonds (distance) C4'-P energy: -27.389 bonds (distance) P-C4' energy: -29.850 flat angles C4'-P-C4' energy: -33.599 flat angles P-C4'-P energy: -21.182 tors. eta vs tors. theta energy: -46.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -401.192484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.192484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.192484 (E_RNA) where: Base-Base interactions energy: -270.700 where: short stacking energy: -117.775 Base-Backbone interact. energy: -0.847 local terms energy: -129.644752 where: bonds (distance) C4'-P energy: -24.192 bonds (distance) P-C4' energy: -27.632 flat angles C4'-P-C4' energy: -26.917 flat angles P-C4'-P energy: -18.178 tors. eta vs tors. theta energy: -32.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -397.034806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.034806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.034806 (E_RNA) where: Base-Base interactions energy: -275.642 where: short stacking energy: -125.529 Base-Backbone interact. energy: -0.202 local terms energy: -121.191250 where: bonds (distance) C4'-P energy: -21.741 bonds (distance) P-C4' energy: -28.918 flat angles C4'-P-C4' energy: -21.250 flat angles P-C4'-P energy: -15.890 tors. eta vs tors. theta energy: -33.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -284.750634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.750634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.750634 (E_RNA) where: Base-Base interactions energy: -175.030 where: short stacking energy: -85.856 Base-Backbone interact. energy: -0.221 local terms energy: -109.499718 where: bonds (distance) C4'-P energy: -19.655 bonds (distance) P-C4' energy: -22.915 flat angles C4'-P-C4' energy: -31.468 flat angles P-C4'-P energy: -14.784 tors. eta vs tors. theta energy: -20.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -242.050248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.050248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.050248 (E_RNA) where: Base-Base interactions energy: -133.746 where: short stacking energy: -57.675 Base-Backbone interact. energy: 1.167 local terms energy: -109.471528 where: bonds (distance) C4'-P energy: -28.697 bonds (distance) P-C4' energy: -25.858 flat angles C4'-P-C4' energy: -28.109 flat angles P-C4'-P energy: -15.195 tors. eta vs tors. theta energy: -11.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -149.722892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.722892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.722892 (E_RNA) where: Base-Base interactions energy: -75.855 where: short stacking energy: -50.877 Base-Backbone interact. energy: -0.286 local terms energy: -73.581447 where: bonds (distance) C4'-P energy: -13.750 bonds (distance) P-C4' energy: -22.173 flat angles C4'-P-C4' energy: -12.808 flat angles P-C4'-P energy: -18.921 tors. eta vs tors. theta energy: -5.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -138.268468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.268468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.268468 (E_RNA) where: Base-Base interactions energy: -56.804 where: short stacking energy: -50.364 Base-Backbone interact. energy: 0.011 local terms energy: -81.475223 where: bonds (distance) C4'-P energy: -20.127 bonds (distance) P-C4' energy: -26.973 flat angles C4'-P-C4' energy: -24.265 flat angles P-C4'-P energy: -0.583 tors. eta vs tors. theta energy: -9.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -247.477493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.477493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.477493 (E_RNA) where: Base-Base interactions energy: -153.990 where: short stacking energy: -62.394 Base-Backbone interact. energy: -0.760 local terms energy: -92.727234 where: bonds (distance) C4'-P energy: -20.039 bonds (distance) P-C4' energy: -27.793 flat angles C4'-P-C4' energy: -20.050 flat angles P-C4'-P energy: -12.738 tors. eta vs tors. theta energy: -12.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -555.447688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.447688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.447688 (E_RNA) where: Base-Base interactions energy: -397.204 where: short stacking energy: -154.145 Base-Backbone interact. energy: -0.419 local terms energy: -157.824954 where: bonds (distance) C4'-P energy: -26.132 bonds (distance) P-C4' energy: -30.094 flat angles C4'-P-C4' energy: -27.391 flat angles P-C4'-P energy: -27.203 tors. eta vs tors. theta energy: -47.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -545.915213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.915213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.915213 (E_RNA) where: Base-Base interactions energy: -391.278 where: short stacking energy: -152.014 Base-Backbone interact. energy: -1.536 local terms energy: -153.101172 where: bonds (distance) C4'-P energy: -29.539 bonds (distance) P-C4' energy: -25.829 flat angles C4'-P-C4' energy: -29.279 flat angles P-C4'-P energy: -22.798 tors. eta vs tors. theta energy: -45.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -549.551862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.551862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.551862 (E_RNA) where: Base-Base interactions energy: -395.387 where: short stacking energy: -151.032 Base-Backbone interact. energy: -0.915 local terms energy: -153.249674 where: bonds (distance) C4'-P energy: -21.501 bonds (distance) P-C4' energy: -24.670 flat angles C4'-P-C4' energy: -31.870 flat angles P-C4'-P energy: -27.754 tors. eta vs tors. theta energy: -47.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -369.848555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.848555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.848555 (E_RNA) where: Base-Base interactions energy: -246.827 where: short stacking energy: -111.055 Base-Backbone interact. energy: -0.704 local terms energy: -122.317677 where: bonds (distance) C4'-P energy: -20.843 bonds (distance) P-C4' energy: -25.726 flat angles C4'-P-C4' energy: -23.606 flat angles P-C4'-P energy: -19.239 tors. eta vs tors. theta energy: -32.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -388.319604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.319604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.319604 (E_RNA) where: Base-Base interactions energy: -270.843 where: short stacking energy: -108.958 Base-Backbone interact. energy: 0.084 local terms energy: -117.560838 where: bonds (distance) C4'-P energy: -22.324 bonds (distance) P-C4' energy: -22.142 flat angles C4'-P-C4' energy: -23.779 flat angles P-C4'-P energy: -11.295 tors. eta vs tors. theta energy: -38.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -276.143033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.143033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.143033 (E_RNA) where: Base-Base interactions energy: -168.515 where: short stacking energy: -84.037 Base-Backbone interact. energy: -0.342 local terms energy: -107.285602 where: bonds (distance) C4'-P energy: -20.417 bonds (distance) P-C4' energy: -25.660 flat angles C4'-P-C4' energy: -28.565 flat angles P-C4'-P energy: -10.979 tors. eta vs tors. theta energy: -21.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -250.464873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.464873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.464873 (E_RNA) where: Base-Base interactions energy: -151.257 where: short stacking energy: -71.285 Base-Backbone interact. energy: -0.550 local terms energy: -98.657890 where: bonds (distance) C4'-P energy: -29.557 bonds (distance) P-C4' energy: -28.377 flat angles C4'-P-C4' energy: -23.688 flat angles P-C4'-P energy: -9.440 tors. eta vs tors. theta energy: -7.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -143.944416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.944416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.944416 (E_RNA) where: Base-Base interactions energy: -55.346 where: short stacking energy: -49.842 Base-Backbone interact. energy: -0.040 local terms energy: -88.558718 where: bonds (distance) C4'-P energy: -23.082 bonds (distance) P-C4' energy: -21.403 flat angles C4'-P-C4' energy: -28.030 flat angles P-C4'-P energy: -20.202 tors. eta vs tors. theta energy: 4.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -253.144765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.144765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.144765 (E_RNA) where: Base-Base interactions energy: -165.774 where: short stacking energy: -66.814 Base-Backbone interact. energy: 2.050 local terms energy: -89.419978 where: bonds (distance) C4'-P energy: -23.150 bonds (distance) P-C4' energy: -23.153 flat angles C4'-P-C4' energy: -23.701 flat angles P-C4'-P energy: -9.122 tors. eta vs tors. theta energy: -10.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -133.294832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.294832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.294832 (E_RNA) where: Base-Base interactions energy: -52.751 where: short stacking energy: -50.305 Base-Backbone interact. energy: -0.811 local terms energy: -79.732823 where: bonds (distance) C4'-P energy: -21.998 bonds (distance) P-C4' energy: -28.336 flat angles C4'-P-C4' energy: -17.917 flat angles P-C4'-P energy: -15.186 tors. eta vs tors. theta energy: 3.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -554.697870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.697870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.697870 (E_RNA) where: Base-Base interactions energy: -398.938 where: short stacking energy: -159.624 Base-Backbone interact. energy: -0.656 local terms energy: -155.103950 where: bonds (distance) C4'-P energy: -24.809 bonds (distance) P-C4' energy: -28.268 flat angles C4'-P-C4' energy: -32.981 flat angles P-C4'-P energy: -20.018 tors. eta vs tors. theta energy: -49.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -545.843358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.843358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.843358 (E_RNA) where: Base-Base interactions energy: -394.048 where: short stacking energy: -149.411 Base-Backbone interact. energy: -0.326 local terms energy: -151.469027 where: bonds (distance) C4'-P energy: -21.347 bonds (distance) P-C4' energy: -29.966 flat angles C4'-P-C4' energy: -32.069 flat angles P-C4'-P energy: -19.822 tors. eta vs tors. theta energy: -48.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -551.144800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.144800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.144800 (E_RNA) where: Base-Base interactions energy: -403.295 where: short stacking energy: -157.258 Base-Backbone interact. energy: -0.249 local terms energy: -147.601203 where: bonds (distance) C4'-P energy: -25.052 bonds (distance) P-C4' energy: -22.785 flat angles C4'-P-C4' energy: -28.347 flat angles P-C4'-P energy: -23.710 tors. eta vs tors. theta energy: -47.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -400.672653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.672653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.672653 (E_RNA) where: Base-Base interactions energy: -266.601 where: short stacking energy: -109.014 Base-Backbone interact. energy: -0.795 local terms energy: -133.276329 where: bonds (distance) C4'-P energy: -27.582 bonds (distance) P-C4' energy: -27.953 flat angles C4'-P-C4' energy: -25.415 flat angles P-C4'-P energy: -17.340 tors. eta vs tors. theta energy: -34.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -362.700175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.700175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.700175 (E_RNA) where: Base-Base interactions energy: -236.762 where: short stacking energy: -101.512 Base-Backbone interact. energy: -0.684 local terms energy: -125.254583 where: bonds (distance) C4'-P energy: -26.832 bonds (distance) P-C4' energy: -22.746 flat angles C4'-P-C4' energy: -27.033 flat angles P-C4'-P energy: -16.137 tors. eta vs tors. theta energy: -32.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -292.393361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.393361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.393361 (E_RNA) where: Base-Base interactions energy: -182.187 where: short stacking energy: -81.210 Base-Backbone interact. energy: -0.443 local terms energy: -109.763953 where: bonds (distance) C4'-P energy: -22.933 bonds (distance) P-C4' energy: -28.575 flat angles C4'-P-C4' energy: -26.190 flat angles P-C4'-P energy: -11.520 tors. eta vs tors. theta energy: -20.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -257.623451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.623451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.623451 (E_RNA) where: Base-Base interactions energy: -155.112 where: short stacking energy: -77.822 Base-Backbone interact. energy: -0.289 local terms energy: -102.222417 where: bonds (distance) C4'-P energy: -14.375 bonds (distance) P-C4' energy: -26.464 flat angles C4'-P-C4' energy: -23.914 flat angles P-C4'-P energy: -16.677 tors. eta vs tors. theta energy: -20.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -281.062238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.062238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.062238 (E_RNA) where: Base-Base interactions energy: -176.868 where: short stacking energy: -70.635 Base-Backbone interact. energy: -0.468 local terms energy: -103.725299 where: bonds (distance) C4'-P energy: -26.138 bonds (distance) P-C4' energy: -24.456 flat angles C4'-P-C4' energy: -23.768 flat angles P-C4'-P energy: -14.060 tors. eta vs tors. theta energy: -15.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -147.223661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.223661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.223661 (E_RNA) where: Base-Base interactions energy: -59.711 where: short stacking energy: -59.711 Base-Backbone interact. energy: -0.240 local terms energy: -87.272394 where: bonds (distance) C4'-P energy: -19.918 bonds (distance) P-C4' energy: -18.824 flat angles C4'-P-C4' energy: -15.856 flat angles P-C4'-P energy: -15.387 tors. eta vs tors. theta energy: -17.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -156.681705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.681705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.681705 (E_RNA) where: Base-Base interactions energy: -58.151 where: short stacking energy: -56.911 Base-Backbone interact. energy: -0.223 local terms energy: -98.306935 where: bonds (distance) C4'-P energy: -22.102 bonds (distance) P-C4' energy: -18.675 flat angles C4'-P-C4' energy: -23.258 flat angles P-C4'-P energy: -19.781 tors. eta vs tors. theta energy: -14.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -556.231046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.231046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.231046 (E_RNA) where: Base-Base interactions energy: -397.924 where: short stacking energy: -159.659 Base-Backbone interact. energy: -1.840 local terms energy: -156.467215 where: bonds (distance) C4'-P energy: -25.057 bonds (distance) P-C4' energy: -27.087 flat angles C4'-P-C4' energy: -32.061 flat angles P-C4'-P energy: -24.541 tors. eta vs tors. theta energy: -47.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -552.923687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.923687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.923687 (E_RNA) where: Base-Base interactions energy: -397.301 where: short stacking energy: -150.713 Base-Backbone interact. energy: -0.004 local terms energy: -155.618482 where: bonds (distance) C4'-P energy: -25.366 bonds (distance) P-C4' energy: -26.438 flat angles C4'-P-C4' energy: -32.292 flat angles P-C4'-P energy: -26.428 tors. eta vs tors. theta energy: -45.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -534.997921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.997921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.997921 (E_RNA) where: Base-Base interactions energy: -381.482 where: short stacking energy: -145.076 Base-Backbone interact. energy: -0.003 local terms energy: -153.512748 where: bonds (distance) C4'-P energy: -24.599 bonds (distance) P-C4' energy: -28.298 flat angles C4'-P-C4' energy: -33.774 flat angles P-C4'-P energy: -19.897 tors. eta vs tors. theta energy: -46.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -394.382819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.382819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.382819 (E_RNA) where: Base-Base interactions energy: -262.760 where: short stacking energy: -110.045 Base-Backbone interact. energy: -0.467 local terms energy: -131.156285 where: bonds (distance) C4'-P energy: -27.305 bonds (distance) P-C4' energy: -22.933 flat angles C4'-P-C4' energy: -26.408 flat angles P-C4'-P energy: -20.277 tors. eta vs tors. theta energy: -34.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -299.195338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.195338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.195338 (E_RNA) where: Base-Base interactions energy: -178.998 where: short stacking energy: -85.991 Base-Backbone interact. energy: -0.315 local terms energy: -119.881876 where: bonds (distance) C4'-P energy: -26.278 bonds (distance) P-C4' energy: -26.958 flat angles C4'-P-C4' energy: -26.396 flat angles P-C4'-P energy: -21.081 tors. eta vs tors. theta energy: -19.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -353.133961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.133961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.133961 (E_RNA) where: Base-Base interactions energy: -240.685 where: short stacking energy: -106.898 Base-Backbone interact. energy: 0.548 local terms energy: -112.996932 where: bonds (distance) C4'-P energy: -18.321 bonds (distance) P-C4' energy: -29.221 flat angles C4'-P-C4' energy: -24.862 flat angles P-C4'-P energy: -6.989 tors. eta vs tors. theta energy: -33.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -330.660226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.660226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.660226 (E_RNA) where: Base-Base interactions energy: -219.857 where: short stacking energy: -99.257 Base-Backbone interact. energy: -0.598 local terms energy: -110.205377 where: bonds (distance) C4'-P energy: -17.506 bonds (distance) P-C4' energy: -20.818 flat angles C4'-P-C4' energy: -27.868 flat angles P-C4'-P energy: -21.033 tors. eta vs tors. theta energy: -22.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -263.430144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.430144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.430144 (E_RNA) where: Base-Base interactions energy: -155.035 where: short stacking energy: -81.371 Base-Backbone interact. energy: -0.306 local terms energy: -108.089111 where: bonds (distance) C4'-P energy: -27.911 bonds (distance) P-C4' energy: -21.649 flat angles C4'-P-C4' energy: -26.018 flat angles P-C4'-P energy: -12.729 tors. eta vs tors. theta energy: -19.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -124.211085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.211085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.211085 (E_RNA) where: Base-Base interactions energy: -40.153 where: short stacking energy: -36.540 Base-Backbone interact. energy: -0.467 local terms energy: -83.590390 where: bonds (distance) C4'-P energy: -26.844 bonds (distance) P-C4' energy: -28.847 flat angles C4'-P-C4' energy: -22.673 flat angles P-C4'-P energy: -11.801 tors. eta vs tors. theta energy: 6.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -186.090349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.090349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.090349 (E_RNA) where: Base-Base interactions energy: -104.020 where: short stacking energy: -46.906 Base-Backbone interact. energy: 0.955 local terms energy: -83.025822 where: bonds (distance) C4'-P energy: -17.237 bonds (distance) P-C4' energy: -20.403 flat angles C4'-P-C4' energy: -24.062 flat angles P-C4'-P energy: -19.595 tors. eta vs tors. theta energy: -1.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -557.165230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.165230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.165230 (E_RNA) where: Base-Base interactions energy: -402.665 where: short stacking energy: -160.054 Base-Backbone interact. energy: -1.724 local terms energy: -152.776459 where: bonds (distance) C4'-P energy: -24.449 bonds (distance) P-C4' energy: -28.863 flat angles C4'-P-C4' energy: -29.622 flat angles P-C4'-P energy: -23.228 tors. eta vs tors. theta energy: -46.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -549.637720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.637720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.637720 (E_RNA) where: Base-Base interactions energy: -401.358 where: short stacking energy: -155.994 Base-Backbone interact. energy: -0.001 local terms energy: -148.278380 where: bonds (distance) C4'-P energy: -21.779 bonds (distance) P-C4' energy: -23.992 flat angles C4'-P-C4' energy: -30.923 flat angles P-C4'-P energy: -23.493 tors. eta vs tors. theta energy: -48.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -543.112116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.112116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.112116 (E_RNA) where: Base-Base interactions energy: -388.555 where: short stacking energy: -149.140 Base-Backbone interact. energy: -0.001 local terms energy: -154.555822 where: bonds (distance) C4'-P energy: -28.819 bonds (distance) P-C4' energy: -28.961 flat angles C4'-P-C4' energy: -33.176 flat angles P-C4'-P energy: -15.800 tors. eta vs tors. theta energy: -47.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -409.638099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.638099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.638099 (E_RNA) where: Base-Base interactions energy: -295.351 where: short stacking energy: -120.037 Base-Backbone interact. energy: -0.010 local terms energy: -114.277009 where: bonds (distance) C4'-P energy: -21.170 bonds (distance) P-C4' energy: -22.873 flat angles C4'-P-C4' energy: -28.402 flat angles P-C4'-P energy: -8.775 tors. eta vs tors. theta energy: -33.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -326.440812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.440812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.440812 (E_RNA) where: Base-Base interactions energy: -197.092 where: short stacking energy: -103.699 Base-Backbone interact. energy: -0.741 local terms energy: -128.607503 where: bonds (distance) C4'-P energy: -27.480 bonds (distance) P-C4' energy: -30.619 flat angles C4'-P-C4' energy: -24.342 flat angles P-C4'-P energy: -14.618 tors. eta vs tors. theta energy: -31.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -350.809537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.809537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.809537 (E_RNA) where: Base-Base interactions energy: -234.407 where: short stacking energy: -95.436 Base-Backbone interact. energy: -0.655 local terms energy: -115.747536 where: bonds (distance) C4'-P energy: -24.922 bonds (distance) P-C4' energy: -23.007 flat angles C4'-P-C4' energy: -25.583 flat angles P-C4'-P energy: -13.514 tors. eta vs tors. theta energy: -28.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -319.150335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.150335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.150335 (E_RNA) where: Base-Base interactions energy: -204.469 where: short stacking energy: -85.549 Base-Backbone interact. energy: 1.396 local terms energy: -116.078272 where: bonds (distance) C4'-P energy: -26.477 bonds (distance) P-C4' energy: -28.432 flat angles C4'-P-C4' energy: -24.879 flat angles P-C4'-P energy: -18.525 tors. eta vs tors. theta energy: -17.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -238.772093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.772093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.772093 (E_RNA) where: Base-Base interactions energy: -133.795 where: short stacking energy: -68.379 Base-Backbone interact. energy: -0.320 local terms energy: -104.656425 where: bonds (distance) C4'-P energy: -24.305 bonds (distance) P-C4' energy: -25.250 flat angles C4'-P-C4' energy: -23.179 flat angles P-C4'-P energy: -17.420 tors. eta vs tors. theta energy: -14.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -133.071789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.071789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.071789 (E_RNA) where: Base-Base interactions energy: -46.171 where: short stacking energy: -45.898 Base-Backbone interact. energy: -0.547 local terms energy: -86.353421 where: bonds (distance) C4'-P energy: -25.167 bonds (distance) P-C4' energy: -29.628 flat angles C4'-P-C4' energy: -20.985 flat angles P-C4'-P energy: -10.085 tors. eta vs tors. theta energy: -0.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -223.733131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.733131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.733131 (E_RNA) where: Base-Base interactions energy: -141.633 where: short stacking energy: -63.506 Base-Backbone interact. energy: 0.396 local terms energy: -82.496131 where: bonds (distance) C4'-P energy: -19.922 bonds (distance) P-C4' energy: -23.786 flat angles C4'-P-C4' energy: -19.735 flat angles P-C4'-P energy: -13.573 tors. eta vs tors. theta energy: -5.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -553.888448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.888448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.888448 (E_RNA) where: Base-Base interactions energy: -399.657 where: short stacking energy: -156.812 Base-Backbone interact. energy: -0.955 local terms energy: -153.276803 where: bonds (distance) C4'-P energy: -26.630 bonds (distance) P-C4' energy: -28.206 flat angles C4'-P-C4' energy: -30.612 flat angles P-C4'-P energy: -21.028 tors. eta vs tors. theta energy: -46.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -550.146385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.146385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.146385 (E_RNA) where: Base-Base interactions energy: -401.181 where: short stacking energy: -154.630 Base-Backbone interact. energy: -1.853 local terms energy: -147.111824 where: bonds (distance) C4'-P energy: -24.721 bonds (distance) P-C4' energy: -23.028 flat angles C4'-P-C4' energy: -28.477 flat angles P-C4'-P energy: -25.747 tors. eta vs tors. theta energy: -45.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -546.634603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.634603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.634603 (E_RNA) where: Base-Base interactions energy: -395.786 where: short stacking energy: -154.789 Base-Backbone interact. energy: -0.124 local terms energy: -150.724822 where: bonds (distance) C4'-P energy: -26.534 bonds (distance) P-C4' energy: -25.327 flat angles C4'-P-C4' energy: -28.422 flat angles P-C4'-P energy: -23.369 tors. eta vs tors. theta energy: -47.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -398.372912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.372912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.372912 (E_RNA) where: Base-Base interactions energy: -276.368 where: short stacking energy: -122.996 Base-Backbone interact. energy: -1.027 local terms energy: -120.977786 where: bonds (distance) C4'-P energy: -19.063 bonds (distance) P-C4' energy: -19.956 flat angles C4'-P-C4' energy: -29.396 flat angles P-C4'-P energy: -16.782 tors. eta vs tors. theta energy: -35.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -353.151223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.151223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.151223 (E_RNA) where: Base-Base interactions energy: -238.984 where: short stacking energy: -99.340 Base-Backbone interact. energy: -1.217 local terms energy: -112.949761 where: bonds (distance) C4'-P energy: -24.361 bonds (distance) P-C4' energy: -21.173 flat angles C4'-P-C4' energy: -21.959 flat angles P-C4'-P energy: -19.949 tors. eta vs tors. theta energy: -25.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -300.117996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.117996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.117996 (E_RNA) where: Base-Base interactions energy: -189.233 where: short stacking energy: -85.968 Base-Backbone interact. energy: -0.520 local terms energy: -110.364849 where: bonds (distance) C4'-P energy: -25.111 bonds (distance) P-C4' energy: -30.473 flat angles C4'-P-C4' energy: -19.819 flat angles P-C4'-P energy: -16.428 tors. eta vs tors. theta energy: -18.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -326.615163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.615163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.615163 (E_RNA) where: Base-Base interactions energy: -219.589 where: short stacking energy: -88.397 Base-Backbone interact. energy: -1.176 local terms energy: -105.849914 where: bonds (distance) C4'-P energy: -19.025 bonds (distance) P-C4' energy: -18.012 flat angles C4'-P-C4' energy: -31.098 flat angles P-C4'-P energy: -17.721 tors. eta vs tors. theta energy: -19.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -236.807158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.807158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.807158 (E_RNA) where: Base-Base interactions energy: -123.722 where: short stacking energy: -66.260 Base-Backbone interact. energy: -0.075 local terms energy: -113.010062 where: bonds (distance) C4'-P energy: -25.478 bonds (distance) P-C4' energy: -25.015 flat angles C4'-P-C4' energy: -20.365 flat angles P-C4'-P energy: -22.700 tors. eta vs tors. theta energy: -19.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -257.160671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.160671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.160671 (E_RNA) where: Base-Base interactions energy: -172.345 where: short stacking energy: -73.351 Base-Backbone interact. energy: 0.145 local terms energy: -84.959966 where: bonds (distance) C4'-P energy: -22.519 bonds (distance) P-C4' energy: -21.558 flat angles C4'-P-C4' energy: -20.670 flat angles P-C4'-P energy: -7.804 tors. eta vs tors. theta energy: -12.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -132.859033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.859033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.859033 (E_RNA) where: Base-Base interactions energy: -54.207 where: short stacking energy: -51.942 Base-Backbone interact. energy: 0.885 local terms energy: -79.537032 where: bonds (distance) C4'-P energy: -18.046 bonds (distance) P-C4' energy: -28.110 flat angles C4'-P-C4' energy: -19.692 flat angles P-C4'-P energy: -9.325 tors. eta vs tors. theta energy: -4.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -549.674388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.674388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.674388 (E_RNA) where: Base-Base interactions energy: -395.982 where: short stacking energy: -149.371 Base-Backbone interact. energy: -0.836 local terms energy: -152.856524 where: bonds (distance) C4'-P energy: -28.317 bonds (distance) P-C4' energy: -23.251 flat angles C4'-P-C4' energy: -32.511 flat angles P-C4'-P energy: -24.063 tors. eta vs tors. theta energy: -44.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -551.738718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.738718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.738718 (E_RNA) where: Base-Base interactions energy: -397.829 where: short stacking energy: -152.617 Base-Backbone interact. energy: -1.544 local terms energy: -152.366240 where: bonds (distance) C4'-P energy: -21.335 bonds (distance) P-C4' energy: -25.020 flat angles C4'-P-C4' energy: -30.841 flat angles P-C4'-P energy: -26.495 tors. eta vs tors. theta energy: -48.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -543.068528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.068528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.068528 (E_RNA) where: Base-Base interactions energy: -394.377 where: short stacking energy: -154.695 Base-Backbone interact. energy: -0.534 local terms energy: -148.157972 where: bonds (distance) C4'-P energy: -27.959 bonds (distance) P-C4' energy: -22.553 flat angles C4'-P-C4' energy: -33.021 flat angles P-C4'-P energy: -20.646 tors. eta vs tors. theta energy: -43.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -361.575695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.575695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.575695 (E_RNA) where: Base-Base interactions energy: -238.701 where: short stacking energy: -112.080 Base-Backbone interact. energy: -0.145 local terms energy: -122.729826 where: bonds (distance) C4'-P energy: -29.914 bonds (distance) P-C4' energy: -25.156 flat angles C4'-P-C4' energy: -23.994 flat angles P-C4'-P energy: -15.356 tors. eta vs tors. theta energy: -28.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -390.110672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.110672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.110672 (E_RNA) where: Base-Base interactions energy: -267.732 where: short stacking energy: -119.034 Base-Backbone interact. energy: 1.625 local terms energy: -124.003380 where: bonds (distance) C4'-P energy: -24.651 bonds (distance) P-C4' energy: -20.848 flat angles C4'-P-C4' energy: -23.161 flat angles P-C4'-P energy: -20.406 tors. eta vs tors. theta energy: -34.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -336.572927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.572927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.572927 (E_RNA) where: Base-Base interactions energy: -215.573 where: short stacking energy: -90.278 Base-Backbone interact. energy: -2.127 local terms energy: -118.872334 where: bonds (distance) C4'-P energy: -25.736 bonds (distance) P-C4' energy: -24.717 flat angles C4'-P-C4' energy: -27.208 flat angles P-C4'-P energy: -19.506 tors. eta vs tors. theta energy: -21.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -301.861296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.861296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.861296 (E_RNA) where: Base-Base interactions energy: -187.634 where: short stacking energy: -91.088 Base-Backbone interact. energy: 0.205 local terms energy: -114.432477 where: bonds (distance) C4'-P energy: -20.889 bonds (distance) P-C4' energy: -21.472 flat angles C4'-P-C4' energy: -30.005 flat angles P-C4'-P energy: -18.171 tors. eta vs tors. theta energy: -23.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -278.096917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.096917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.096917 (E_RNA) where: Base-Base interactions energy: -171.864 where: short stacking energy: -68.543 Base-Backbone interact. energy: -1.259 local terms energy: -104.974681 where: bonds (distance) C4'-P energy: -27.996 bonds (distance) P-C4' energy: -21.891 flat angles C4'-P-C4' energy: -25.571 flat angles P-C4'-P energy: -15.680 tors. eta vs tors. theta energy: -13.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -206.065607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.065607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.065607 (E_RNA) where: Base-Base interactions energy: -112.120 where: short stacking energy: -59.723 Base-Backbone interact. energy: -0.579 local terms energy: -93.367435 where: bonds (distance) C4'-P energy: -29.177 bonds (distance) P-C4' energy: -29.042 flat angles C4'-P-C4' energy: -18.060 flat angles P-C4'-P energy: -16.353 tors. eta vs tors. theta energy: -0.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -125.169162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.169162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.169162 (E_RNA) where: Base-Base interactions energy: -32.420 where: short stacking energy: -25.240 Base-Backbone interact. energy: -0.402 local terms energy: -92.346801 where: bonds (distance) C4'-P energy: -27.487 bonds (distance) P-C4' energy: -28.582 flat angles C4'-P-C4' energy: -22.991 flat angles P-C4'-P energy: -15.097 tors. eta vs tors. theta energy: 1.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -552.189266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.189266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.189266 (E_RNA) where: Base-Base interactions energy: -394.936 where: short stacking energy: -154.328 Base-Backbone interact. energy: -0.001 local terms energy: -157.252303 where: bonds (distance) C4'-P energy: -26.066 bonds (distance) P-C4' energy: -26.802 flat angles C4'-P-C4' energy: -32.530 flat angles P-C4'-P energy: -23.878 tors. eta vs tors. theta energy: -47.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -544.052037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.052037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.052037 (E_RNA) where: Base-Base interactions energy: -385.818 where: short stacking energy: -151.473 Base-Backbone interact. energy: -1.284 local terms energy: -156.950469 where: bonds (distance) C4'-P energy: -31.334 bonds (distance) P-C4' energy: -27.772 flat angles C4'-P-C4' energy: -31.025 flat angles P-C4'-P energy: -22.728 tors. eta vs tors. theta energy: -44.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -535.298233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.298233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.298233 (E_RNA) where: Base-Base interactions energy: -377.005 where: short stacking energy: -149.338 Base-Backbone interact. energy: -0.762 local terms energy: -157.530981 where: bonds (distance) C4'-P energy: -26.072 bonds (distance) P-C4' energy: -29.897 flat angles C4'-P-C4' energy: -30.266 flat angles P-C4'-P energy: -24.809 tors. eta vs tors. theta energy: -46.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -331.953031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.953031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.953031 (E_RNA) where: Base-Base interactions energy: -211.221 where: short stacking energy: -100.545 Base-Backbone interact. energy: 0.831 local terms energy: -121.562881 where: bonds (distance) C4'-P energy: -22.754 bonds (distance) P-C4' energy: -26.765 flat angles C4'-P-C4' energy: -27.703 flat angles P-C4'-P energy: -20.763 tors. eta vs tors. theta energy: -23.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -372.137733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.137733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.137733 (E_RNA) where: Base-Base interactions energy: -252.194 where: short stacking energy: -115.359 Base-Backbone interact. energy: -0.515 local terms energy: -119.428892 where: bonds (distance) C4'-P energy: -21.025 bonds (distance) P-C4' energy: -25.956 flat angles C4'-P-C4' energy: -24.710 flat angles P-C4'-P energy: -16.978 tors. eta vs tors. theta energy: -30.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -384.459268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.459268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.459268 (E_RNA) where: Base-Base interactions energy: -262.858 where: short stacking energy: -117.387 Base-Backbone interact. energy: 0.776 local terms energy: -122.376453 where: bonds (distance) C4'-P energy: -18.968 bonds (distance) P-C4' energy: -25.308 flat angles C4'-P-C4' energy: -27.194 flat angles P-C4'-P energy: -15.886 tors. eta vs tors. theta energy: -35.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -291.294919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.294919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.294919 (E_RNA) where: Base-Base interactions energy: -187.842 where: short stacking energy: -81.763 Base-Backbone interact. energy: -0.887 local terms energy: -102.566070 where: bonds (distance) C4'-P energy: -26.026 bonds (distance) P-C4' energy: -20.676 flat angles C4'-P-C4' energy: -21.629 flat angles P-C4'-P energy: -13.531 tors. eta vs tors. theta energy: -20.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -297.439538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.439538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.439538 (E_RNA) where: Base-Base interactions energy: -199.860 where: short stacking energy: -82.111 Base-Backbone interact. energy: -0.402 local terms energy: -97.177236 where: bonds (distance) C4'-P energy: -25.471 bonds (distance) P-C4' energy: -26.667 flat angles C4'-P-C4' energy: -20.158 flat angles P-C4'-P energy: -8.395 tors. eta vs tors. theta energy: -16.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -186.291394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.291394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.291394 (E_RNA) where: Base-Base interactions energy: -100.625 where: short stacking energy: -54.342 Base-Backbone interact. energy: 0.603 local terms energy: -86.268644 where: bonds (distance) C4'-P energy: -22.711 bonds (distance) P-C4' energy: -25.255 flat angles C4'-P-C4' energy: -18.301 flat angles P-C4'-P energy: -14.609 tors. eta vs tors. theta energy: -5.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -123.683825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.683825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.683825 (E_RNA) where: Base-Base interactions energy: -59.635 where: short stacking energy: -29.190 Base-Backbone interact. energy: 0.957 local terms energy: -65.006077 where: bonds (distance) C4'-P energy: -21.756 bonds (distance) P-C4' energy: -25.333 flat angles C4'-P-C4' energy: -18.666 flat angles P-C4'-P energy: -9.247 tors. eta vs tors. theta energy: 9.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -557.660631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.660631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.660631 (E_RNA) where: Base-Base interactions energy: -402.088 where: short stacking energy: -160.334 Base-Backbone interact. energy: -0.483 local terms energy: -155.089624 where: bonds (distance) C4'-P energy: -24.408 bonds (distance) P-C4' energy: -27.282 flat angles C4'-P-C4' energy: -32.723 flat angles P-C4'-P energy: -22.629 tors. eta vs tors. theta energy: -48.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -558.753263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.753263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.753263 (E_RNA) where: Base-Base interactions energy: -401.851 where: short stacking energy: -154.474 Base-Backbone interact. energy: -0.489 local terms energy: -156.413958 where: bonds (distance) C4'-P energy: -29.237 bonds (distance) P-C4' energy: -24.824 flat angles C4'-P-C4' energy: -29.155 flat angles P-C4'-P energy: -26.258 tors. eta vs tors. theta energy: -46.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -547.833620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.833620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.833620 (E_RNA) where: Base-Base interactions energy: -390.554 where: short stacking energy: -151.205 Base-Backbone interact. energy: -0.578 local terms energy: -156.700952 where: bonds (distance) C4'-P energy: -27.827 bonds (distance) P-C4' energy: -28.935 flat angles C4'-P-C4' energy: -30.220 flat angles P-C4'-P energy: -22.447 tors. eta vs tors. theta energy: -47.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -368.489752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.489752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.489752 (E_RNA) where: Base-Base interactions energy: -237.998 where: short stacking energy: -96.561 Base-Backbone interact. energy: -1.207 local terms energy: -129.284621 where: bonds (distance) C4'-P energy: -23.567 bonds (distance) P-C4' energy: -32.013 flat angles C4'-P-C4' energy: -29.976 flat angles P-C4'-P energy: -19.147 tors. eta vs tors. theta energy: -24.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -332.111102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.111102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.111102 (E_RNA) where: Base-Base interactions energy: -208.241 where: short stacking energy: -97.803 Base-Backbone interact. energy: -1.127 local terms energy: -122.742918 where: bonds (distance) C4'-P energy: -25.928 bonds (distance) P-C4' energy: -28.167 flat angles C4'-P-C4' energy: -20.750 flat angles P-C4'-P energy: -19.811 tors. eta vs tors. theta energy: -28.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -379.040180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.040180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.040180 (E_RNA) where: Base-Base interactions energy: -259.140 where: short stacking energy: -119.777 Base-Backbone interact. energy: -0.449 local terms energy: -119.451169 where: bonds (distance) C4'-P energy: -27.313 bonds (distance) P-C4' energy: -28.016 flat angles C4'-P-C4' energy: -25.821 flat angles P-C4'-P energy: -6.877 tors. eta vs tors. theta energy: -31.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -299.338674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.338674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.338674 (E_RNA) where: Base-Base interactions energy: -191.748 where: short stacking energy: -85.769 Base-Backbone interact. energy: 0.548 local terms energy: -108.139019 where: bonds (distance) C4'-P energy: -24.366 bonds (distance) P-C4' energy: -25.590 flat angles C4'-P-C4' energy: -23.765 flat angles P-C4'-P energy: -17.572 tors. eta vs tors. theta energy: -16.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -289.491610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.491610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.491610 (E_RNA) where: Base-Base interactions energy: -191.570 where: short stacking energy: -82.826 Base-Backbone interact. energy: 1.621 local terms energy: -99.542672 where: bonds (distance) C4'-P energy: -19.029 bonds (distance) P-C4' energy: -25.827 flat angles C4'-P-C4' energy: -24.725 flat angles P-C4'-P energy: -17.009 tors. eta vs tors. theta energy: -12.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -150.559941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.559941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.559941 (E_RNA) where: Base-Base interactions energy: -81.215 where: short stacking energy: -44.305 Base-Backbone interact. energy: -0.130 local terms energy: -69.214772 where: bonds (distance) C4'-P energy: -24.761 bonds (distance) P-C4' energy: -16.159 flat angles C4'-P-C4' energy: -12.743 flat angles P-C4'-P energy: -17.715 tors. eta vs tors. theta energy: 2.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -126.872337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.872337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.872337 (E_RNA) where: Base-Base interactions energy: -40.411 where: short stacking energy: -23.156 Base-Backbone interact. energy: 0.130 local terms energy: -86.590738 where: bonds (distance) C4'-P energy: -22.888 bonds (distance) P-C4' energy: -25.482 flat angles C4'-P-C4' energy: -23.100 flat angles P-C4'-P energy: -15.485 tors. eta vs tors. theta energy: 0.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -554.506937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.506937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.506937 (E_RNA) where: Base-Base interactions energy: -397.859 where: short stacking energy: -153.063 Base-Backbone interact. energy: -0.591 local terms energy: -156.057423 where: bonds (distance) C4'-P energy: -26.279 bonds (distance) P-C4' energy: -28.316 flat angles C4'-P-C4' energy: -30.482 flat angles P-C4'-P energy: -23.216 tors. eta vs tors. theta energy: -47.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -557.350858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.350858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.350858 (E_RNA) where: Base-Base interactions energy: -401.328 where: short stacking energy: -157.916 Base-Backbone interact. energy: -0.087 local terms energy: -155.935154 where: bonds (distance) C4'-P energy: -26.896 bonds (distance) P-C4' energy: -25.595 flat angles C4'-P-C4' energy: -32.385 flat angles P-C4'-P energy: -24.283 tors. eta vs tors. theta energy: -46.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -543.168479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.168479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.168479 (E_RNA) where: Base-Base interactions energy: -392.947 where: short stacking energy: -155.279 Base-Backbone interact. energy: 0.648 local terms energy: -150.869319 where: bonds (distance) C4'-P energy: -26.627 bonds (distance) P-C4' energy: -27.173 flat angles C4'-P-C4' energy: -30.006 flat angles P-C4'-P energy: -22.341 tors. eta vs tors. theta energy: -44.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -398.906030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.906030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.906030 (E_RNA) where: Base-Base interactions energy: -267.216 where: short stacking energy: -115.287 Base-Backbone interact. energy: -0.902 local terms energy: -130.787932 where: bonds (distance) C4'-P energy: -23.103 bonds (distance) P-C4' energy: -30.063 flat angles C4'-P-C4' energy: -25.920 flat angles P-C4'-P energy: -19.516 tors. eta vs tors. theta energy: -32.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -360.457535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.457535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.457535 (E_RNA) where: Base-Base interactions energy: -229.828 where: short stacking energy: -100.241 Base-Backbone interact. energy: -0.613 local terms energy: -130.016835 where: bonds (distance) C4'-P energy: -22.716 bonds (distance) P-C4' energy: -28.062 flat angles C4'-P-C4' energy: -29.761 flat angles P-C4'-P energy: -21.554 tors. eta vs tors. theta energy: -27.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -299.249948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.249948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.249948 (E_RNA) where: Base-Base interactions energy: -198.381 where: short stacking energy: -93.475 Base-Backbone interact. energy: -0.482 local terms energy: -100.387011 where: bonds (distance) C4'-P energy: -23.796 bonds (distance) P-C4' energy: -26.426 flat angles C4'-P-C4' energy: -21.058 flat angles P-C4'-P energy: -12.974 tors. eta vs tors. theta energy: -16.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -297.850483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.850483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.850483 (E_RNA) where: Base-Base interactions energy: -201.704 where: short stacking energy: -86.540 Base-Backbone interact. energy: -0.321 local terms energy: -95.825592 where: bonds (distance) C4'-P energy: -24.432 bonds (distance) P-C4' energy: -24.891 flat angles C4'-P-C4' energy: -26.093 flat angles P-C4'-P energy: -3.922 tors. eta vs tors. theta energy: -16.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -245.543262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.543262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.543262 (E_RNA) where: Base-Base interactions energy: -151.995 where: short stacking energy: -70.099 Base-Backbone interact. energy: -0.415 local terms energy: -93.133868 where: bonds (distance) C4'-P energy: -24.784 bonds (distance) P-C4' energy: -25.882 flat angles C4'-P-C4' energy: -26.577 flat angles P-C4'-P energy: -8.390 tors. eta vs tors. theta energy: -7.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -135.057227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.057227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.057227 (E_RNA) where: Base-Base interactions energy: -58.531 where: short stacking energy: -48.384 Base-Backbone interact. energy: -0.756 local terms energy: -75.770427 where: bonds (distance) C4'-P energy: -17.101 bonds (distance) P-C4' energy: -25.888 flat angles C4'-P-C4' energy: -20.768 flat angles P-C4'-P energy: -10.003 tors. eta vs tors. theta energy: -2.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -122.371754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.371754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.371754 (E_RNA) where: Base-Base interactions energy: -36.932 where: short stacking energy: -33.006 Base-Backbone interact. energy: -0.371 local terms energy: -85.068723 where: bonds (distance) C4'-P energy: -19.619 bonds (distance) P-C4' energy: -27.064 flat angles C4'-P-C4' energy: -25.087 flat angles P-C4'-P energy: -14.413 tors. eta vs tors. theta energy: 1.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -566.527786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.527786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.527786 (E_RNA) where: Base-Base interactions energy: -403.188 where: short stacking energy: -155.938 Base-Backbone interact. energy: -0.454 local terms energy: -162.885887 where: bonds (distance) C4'-P energy: -32.366 bonds (distance) P-C4' energy: -27.740 flat angles C4'-P-C4' energy: -29.770 flat angles P-C4'-P energy: -24.815 tors. eta vs tors. theta energy: -48.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -543.382294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.382294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.382294 (E_RNA) where: Base-Base interactions energy: -387.515 where: short stacking energy: -151.155 Base-Backbone interact. energy: -1.834 local terms energy: -154.033432 where: bonds (distance) C4'-P energy: -25.277 bonds (distance) P-C4' energy: -28.012 flat angles C4'-P-C4' energy: -26.867 flat angles P-C4'-P energy: -26.425 tors. eta vs tors. theta energy: -47.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -541.751404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.751404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.751404 (E_RNA) where: Base-Base interactions energy: -385.644 where: short stacking energy: -150.371 Base-Backbone interact. energy: -1.140 local terms energy: -154.967261 where: bonds (distance) C4'-P energy: -25.583 bonds (distance) P-C4' energy: -28.784 flat angles C4'-P-C4' energy: -30.560 flat angles P-C4'-P energy: -22.497 tors. eta vs tors. theta energy: -47.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -404.569645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.569645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.569645 (E_RNA) where: Base-Base interactions energy: -274.227 where: short stacking energy: -120.213 Base-Backbone interact. energy: 0.143 local terms energy: -130.485551 where: bonds (distance) C4'-P energy: -27.173 bonds (distance) P-C4' energy: -20.276 flat angles C4'-P-C4' energy: -27.400 flat angles P-C4'-P energy: -19.957 tors. eta vs tors. theta energy: -35.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -389.846230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.846230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.846230 (E_RNA) where: Base-Base interactions energy: -256.385 where: short stacking energy: -111.205 Base-Backbone interact. energy: 1.033 local terms energy: -134.494554 where: bonds (distance) C4'-P energy: -29.695 bonds (distance) P-C4' energy: -25.161 flat angles C4'-P-C4' energy: -28.663 flat angles P-C4'-P energy: -18.566 tors. eta vs tors. theta energy: -32.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -326.855786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.855786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.855786 (E_RNA) where: Base-Base interactions energy: -208.538 where: short stacking energy: -86.840 Base-Backbone interact. energy: 1.045 local terms energy: -119.363122 where: bonds (distance) C4'-P energy: -26.398 bonds (distance) P-C4' energy: -25.467 flat angles C4'-P-C4' energy: -30.368 flat angles P-C4'-P energy: -15.390 tors. eta vs tors. theta energy: -21.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -282.105598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.105598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.105598 (E_RNA) where: Base-Base interactions energy: -177.097 where: short stacking energy: -81.061 Base-Backbone interact. energy: -0.685 local terms energy: -104.323000 where: bonds (distance) C4'-P energy: -27.037 bonds (distance) P-C4' energy: -29.620 flat angles C4'-P-C4' energy: -24.999 flat angles P-C4'-P energy: -13.529 tors. eta vs tors. theta energy: -9.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -225.375150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.375150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.375150 (E_RNA) where: Base-Base interactions energy: -128.419 where: short stacking energy: -63.897 Base-Backbone interact. energy: -0.084 local terms energy: -96.871905 where: bonds (distance) C4'-P energy: -21.128 bonds (distance) P-C4' energy: -23.629 flat angles C4'-P-C4' energy: -24.105 flat angles P-C4'-P energy: -21.008 tors. eta vs tors. theta energy: -7.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -132.229753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.229753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.229753 (E_RNA) where: Base-Base interactions energy: -51.811 where: short stacking energy: -48.173 Base-Backbone interact. energy: 0.020 local terms energy: -80.438957 where: bonds (distance) C4'-P energy: -19.485 bonds (distance) P-C4' energy: -20.900 flat angles C4'-P-C4' energy: -20.539 flat angles P-C4'-P energy: -14.268 tors. eta vs tors. theta energy: -5.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -129.860469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.860469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.860469 (E_RNA) where: Base-Base interactions energy: -46.877 where: short stacking energy: -45.165 Base-Backbone interact. energy: -0.624 local terms energy: -82.359413 where: bonds (distance) C4'-P energy: -28.047 bonds (distance) P-C4' energy: -29.404 flat angles C4'-P-C4' energy: -8.340 flat angles P-C4'-P energy: -17.287 tors. eta vs tors. theta energy: 0.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -559.570881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.570881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.570881 (E_RNA) where: Base-Base interactions energy: -407.796 where: short stacking energy: -161.350 Base-Backbone interact. energy: -0.572 local terms energy: -151.202624 where: bonds (distance) C4'-P energy: -22.216 bonds (distance) P-C4' energy: -25.993 flat angles C4'-P-C4' energy: -30.130 flat angles P-C4'-P energy: -25.871 tors. eta vs tors. theta energy: -46.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -547.249214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.249214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.249214 (E_RNA) where: Base-Base interactions energy: -394.543 where: short stacking energy: -158.542 Base-Backbone interact. energy: -1.600 local terms energy: -151.106412 where: bonds (distance) C4'-P energy: -27.690 bonds (distance) P-C4' energy: -20.095 flat angles C4'-P-C4' energy: -31.622 flat angles P-C4'-P energy: -24.338 tors. eta vs tors. theta energy: -47.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -557.603952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.603952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.603952 (E_RNA) where: Base-Base interactions energy: -404.668 where: short stacking energy: -160.524 Base-Backbone interact. energy: -0.903 local terms energy: -152.032478 where: bonds (distance) C4'-P energy: -27.744 bonds (distance) P-C4' energy: -23.468 flat angles C4'-P-C4' energy: -31.343 flat angles P-C4'-P energy: -20.844 tors. eta vs tors. theta energy: -48.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -414.112130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.112130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.112130 (E_RNA) where: Base-Base interactions energy: -283.033 where: short stacking energy: -122.234 Base-Backbone interact. energy: -0.296 local terms energy: -130.782888 where: bonds (distance) C4'-P energy: -28.533 bonds (distance) P-C4' energy: -27.783 flat angles C4'-P-C4' energy: -27.297 flat angles P-C4'-P energy: -13.139 tors. eta vs tors. theta energy: -34.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -388.613394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.613394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.613394 (E_RNA) where: Base-Base interactions energy: -258.156 where: short stacking energy: -118.868 Base-Backbone interact. energy: 2.331 local terms energy: -132.787801 where: bonds (distance) C4'-P energy: -20.565 bonds (distance) P-C4' energy: -31.155 flat angles C4'-P-C4' energy: -27.750 flat angles P-C4'-P energy: -19.227 tors. eta vs tors. theta energy: -34.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -318.959866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.959866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.959866 (E_RNA) where: Base-Base interactions energy: -204.721 where: short stacking energy: -75.965 Base-Backbone interact. energy: -0.714 local terms energy: -113.524710 where: bonds (distance) C4'-P energy: -26.907 bonds (distance) P-C4' energy: -27.882 flat angles C4'-P-C4' energy: -24.543 flat angles P-C4'-P energy: -21.233 tors. eta vs tors. theta energy: -12.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -303.900258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.900258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.900258 (E_RNA) where: Base-Base interactions energy: -192.205 where: short stacking energy: -85.602 Base-Backbone interact. energy: 0.373 local terms energy: -112.068971 where: bonds (distance) C4'-P energy: -24.710 bonds (distance) P-C4' energy: -26.925 flat angles C4'-P-C4' energy: -23.793 flat angles P-C4'-P energy: -18.040 tors. eta vs tors. theta energy: -18.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -206.502626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.502626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.502626 (E_RNA) where: Base-Base interactions energy: -107.387 where: short stacking energy: -52.828 Base-Backbone interact. energy: 0.933 local terms energy: -100.049232 where: bonds (distance) C4'-P energy: -20.768 bonds (distance) P-C4' energy: -25.263 flat angles C4'-P-C4' energy: -26.588 flat angles P-C4'-P energy: -18.002 tors. eta vs tors. theta energy: -9.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -144.094821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.094821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.094821 (E_RNA) where: Base-Base interactions energy: -63.874 where: short stacking energy: -34.278 Base-Backbone interact. energy: -1.671 local terms energy: -78.549681 where: bonds (distance) C4'-P energy: -23.757 bonds (distance) P-C4' energy: -25.698 flat angles C4'-P-C4' energy: -22.408 flat angles P-C4'-P energy: -11.810 tors. eta vs tors. theta energy: 5.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -132.400674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.400674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.400674 (E_RNA) where: Base-Base interactions energy: -48.339 where: short stacking energy: -39.735 Base-Backbone interact. energy: 0.720 local terms energy: -84.781867 where: bonds (distance) C4'-P energy: -22.345 bonds (distance) P-C4' energy: -21.590 flat angles C4'-P-C4' energy: -26.344 flat angles P-C4'-P energy: -12.706 tors. eta vs tors. theta energy: -1.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -555.904635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.904635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.904635 (E_RNA) where: Base-Base interactions energy: -397.032 where: short stacking energy: -159.615 Base-Backbone interact. energy: -2.116 local terms energy: -156.757059 where: bonds (distance) C4'-P energy: -29.853 bonds (distance) P-C4' energy: -27.036 flat angles C4'-P-C4' energy: -29.798 flat angles P-C4'-P energy: -22.162 tors. eta vs tors. theta energy: -47.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -558.136453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.136453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.136453 (E_RNA) where: Base-Base interactions energy: -397.973 where: short stacking energy: -151.292 Base-Backbone interact. energy: -1.184 local terms energy: -158.979301 where: bonds (distance) C4'-P energy: -24.206 bonds (distance) P-C4' energy: -28.843 flat angles C4'-P-C4' energy: -32.639 flat angles P-C4'-P energy: -26.934 tors. eta vs tors. theta energy: -46.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -540.787343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.787343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.787343 (E_RNA) where: Base-Base interactions energy: -398.349 where: short stacking energy: -157.206 Base-Backbone interact. energy: -1.779 local terms energy: -140.659837 where: bonds (distance) C4'-P energy: -22.139 bonds (distance) P-C4' energy: -17.017 flat angles C4'-P-C4' energy: -26.849 flat angles P-C4'-P energy: -27.567 tors. eta vs tors. theta energy: -47.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -429.735703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.735703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.735703 (E_RNA) where: Base-Base interactions energy: -294.390 where: short stacking energy: -122.757 Base-Backbone interact. energy: -1.464 local terms energy: -133.882009 where: bonds (distance) C4'-P energy: -24.081 bonds (distance) P-C4' energy: -31.750 flat angles C4'-P-C4' energy: -26.518 flat angles P-C4'-P energy: -18.378 tors. eta vs tors. theta energy: -33.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -371.131409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.131409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.131409 (E_RNA) where: Base-Base interactions energy: -247.406 where: short stacking energy: -102.768 Base-Backbone interact. energy: -0.731 local terms energy: -122.994476 where: bonds (distance) C4'-P energy: -27.049 bonds (distance) P-C4' energy: -22.015 flat angles C4'-P-C4' energy: -27.770 flat angles P-C4'-P energy: -20.277 tors. eta vs tors. theta energy: -25.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -315.236569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.236569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.236569 (E_RNA) where: Base-Base interactions energy: -204.054 where: short stacking energy: -91.368 Base-Backbone interact. energy: -0.431 local terms energy: -110.752000 where: bonds (distance) C4'-P energy: -22.427 bonds (distance) P-C4' energy: -24.467 flat angles C4'-P-C4' energy: -29.158 flat angles P-C4'-P energy: -13.814 tors. eta vs tors. theta energy: -20.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -296.138201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.138201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.138201 (E_RNA) where: Base-Base interactions energy: -186.794 where: short stacking energy: -82.578 Base-Backbone interact. energy: 0.669 local terms energy: -110.013648 where: bonds (distance) C4'-P energy: -22.279 bonds (distance) P-C4' energy: -22.296 flat angles C4'-P-C4' energy: -25.413 flat angles P-C4'-P energy: -19.614 tors. eta vs tors. theta energy: -20.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -188.701408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.701408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.701408 (E_RNA) where: Base-Base interactions energy: -100.269 where: short stacking energy: -51.406 Base-Backbone interact. energy: -0.001 local terms energy: -88.430748 where: bonds (distance) C4'-P energy: -20.333 bonds (distance) P-C4' energy: -25.609 flat angles C4'-P-C4' energy: -23.833 flat angles P-C4'-P energy: -9.352 tors. eta vs tors. theta energy: -9.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -142.395360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.395360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.395360 (E_RNA) where: Base-Base interactions energy: -83.088 where: short stacking energy: -41.402 Base-Backbone interact. energy: 2.058 local terms energy: -61.365461 where: bonds (distance) C4'-P energy: -26.694 bonds (distance) P-C4' energy: -26.564 flat angles C4'-P-C4' energy: -14.701 flat angles P-C4'-P energy: 1.833 tors. eta vs tors. theta energy: 4.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -121.031602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.031602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.031602 (E_RNA) where: Base-Base interactions energy: -46.858 where: short stacking energy: -46.055 Base-Backbone interact. energy: -0.371 local terms energy: -73.802788 where: bonds (distance) C4'-P energy: -17.757 bonds (distance) P-C4' energy: -22.195 flat angles C4'-P-C4' energy: -19.047 flat angles P-C4'-P energy: -16.149 tors. eta vs tors. theta energy: 1.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -557.506069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.506069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.506069 (E_RNA) where: Base-Base interactions energy: -399.239 where: short stacking energy: -156.845 Base-Backbone interact. energy: -0.461 local terms energy: -157.805813 where: bonds (distance) C4'-P energy: -24.034 bonds (distance) P-C4' energy: -28.916 flat angles C4'-P-C4' energy: -34.078 flat angles P-C4'-P energy: -22.849 tors. eta vs tors. theta energy: -47.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -551.034134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.034134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.034134 (E_RNA) where: Base-Base interactions energy: -393.559 where: short stacking energy: -154.888 Base-Backbone interact. energy: -0.782 local terms energy: -156.693190 where: bonds (distance) C4'-P energy: -23.284 bonds (distance) P-C4' energy: -27.971 flat angles C4'-P-C4' energy: -33.339 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -48.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -541.325155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.325155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.325155 (E_RNA) where: Base-Base interactions energy: -387.264 where: short stacking energy: -147.442 Base-Backbone interact. energy: -0.979 local terms energy: -153.081469 where: bonds (distance) C4'-P energy: -30.406 bonds (distance) P-C4' energy: -28.185 flat angles C4'-P-C4' energy: -29.095 flat angles P-C4'-P energy: -20.730 tors. eta vs tors. theta energy: -44.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -418.849341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.849341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.849341 (E_RNA) where: Base-Base interactions energy: -288.865 where: short stacking energy: -120.599 Base-Backbone interact. energy: -0.531 local terms energy: -129.452658 where: bonds (distance) C4'-P energy: -25.190 bonds (distance) P-C4' energy: -23.871 flat angles C4'-P-C4' energy: -25.285 flat angles P-C4'-P energy: -20.399 tors. eta vs tors. theta energy: -34.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -365.572692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.572692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.572692 (E_RNA) where: Base-Base interactions energy: -248.910 where: short stacking energy: -107.138 Base-Backbone interact. energy: 0.209 local terms energy: -116.872423 where: bonds (distance) C4'-P energy: -19.807 bonds (distance) P-C4' energy: -23.524 flat angles C4'-P-C4' energy: -26.336 flat angles P-C4'-P energy: -19.936 tors. eta vs tors. theta energy: -27.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -308.378169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.378169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.378169 (E_RNA) where: Base-Base interactions energy: -194.642 where: short stacking energy: -97.627 Base-Backbone interact. energy: -0.110 local terms energy: -113.625700 where: bonds (distance) C4'-P energy: -16.032 bonds (distance) P-C4' energy: -23.591 flat angles C4'-P-C4' energy: -25.993 flat angles P-C4'-P energy: -22.101 tors. eta vs tors. theta energy: -25.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -260.375433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.375433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.375433 (E_RNA) where: Base-Base interactions energy: -155.404 where: short stacking energy: -66.556 Base-Backbone interact. energy: -0.348 local terms energy: -104.623108 where: bonds (distance) C4'-P energy: -28.356 bonds (distance) P-C4' energy: -23.338 flat angles C4'-P-C4' energy: -21.827 flat angles P-C4'-P energy: -18.974 tors. eta vs tors. theta energy: -12.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -170.087120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.087120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.087120 (E_RNA) where: Base-Base interactions energy: -81.218 where: short stacking energy: -55.326 Base-Backbone interact. energy: -1.338 local terms energy: -87.531004 where: bonds (distance) C4'-P energy: -27.528 bonds (distance) P-C4' energy: -23.175 flat angles C4'-P-C4' energy: -22.187 flat angles P-C4'-P energy: -14.517 tors. eta vs tors. theta energy: -0.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -145.697384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.697384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.697384 (E_RNA) where: Base-Base interactions energy: -52.913 where: short stacking energy: -44.423 Base-Backbone interact. energy: -0.344 local terms energy: -92.440602 where: bonds (distance) C4'-P energy: -21.926 bonds (distance) P-C4' energy: -25.821 flat angles C4'-P-C4' energy: -18.999 flat angles P-C4'-P energy: -14.831 tors. eta vs tors. theta energy: -10.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -115.261809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.261809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.261809 (E_RNA) where: Base-Base interactions energy: -42.526 where: short stacking energy: -40.609 Base-Backbone interact. energy: -0.461 local terms energy: -72.274913 where: bonds (distance) C4'-P energy: -22.912 bonds (distance) P-C4' energy: -23.863 flat angles C4'-P-C4' energy: -17.777 flat angles P-C4'-P energy: -13.981 tors. eta vs tors. theta energy: 6.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -553.918274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.918274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.918274 (E_RNA) where: Base-Base interactions energy: -388.865 where: short stacking energy: -149.960 Base-Backbone interact. energy: -0.033 local terms energy: -165.019814 where: bonds (distance) C4'-P energy: -30.273 bonds (distance) P-C4' energy: -30.456 flat angles C4'-P-C4' energy: -31.843 flat angles P-C4'-P energy: -24.356 tors. eta vs tors. theta energy: -48.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -552.347490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.347490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.347490 (E_RNA) where: Base-Base interactions energy: -403.292 where: short stacking energy: -158.857 Base-Backbone interact. energy: -0.599 local terms energy: -148.456291 where: bonds (distance) C4'-P energy: -27.143 bonds (distance) P-C4' energy: -21.677 flat angles C4'-P-C4' energy: -33.301 flat angles P-C4'-P energy: -20.134 tors. eta vs tors. theta energy: -46.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -536.478316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.478316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.478316 (E_RNA) where: Base-Base interactions energy: -391.697 where: short stacking energy: -151.815 Base-Backbone interact. energy: -0.917 local terms energy: -143.864123 where: bonds (distance) C4'-P energy: -23.533 bonds (distance) P-C4' energy: -24.096 flat angles C4'-P-C4' energy: -30.339 flat angles P-C4'-P energy: -20.600 tors. eta vs tors. theta energy: -45.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -435.853877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.853877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.853877 (E_RNA) where: Base-Base interactions energy: -312.639 where: short stacking energy: -126.720 Base-Backbone interact. energy: -0.078 local terms energy: -123.137465 where: bonds (distance) C4'-P energy: -24.593 bonds (distance) P-C4' energy: -26.608 flat angles C4'-P-C4' energy: -23.280 flat angles P-C4'-P energy: -20.424 tors. eta vs tors. theta energy: -28.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -363.795794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.795794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.795794 (E_RNA) where: Base-Base interactions energy: -242.268 where: short stacking energy: -108.667 Base-Backbone interact. energy: -0.423 local terms energy: -121.104794 where: bonds (distance) C4'-P energy: -20.454 bonds (distance) P-C4' energy: -23.542 flat angles C4'-P-C4' energy: -21.685 flat angles P-C4'-P energy: -22.847 tors. eta vs tors. theta energy: -32.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -308.543560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.543560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.543560 (E_RNA) where: Base-Base interactions energy: -186.459 where: short stacking energy: -90.320 Base-Backbone interact. energy: 0.714 local terms energy: -122.798451 where: bonds (distance) C4'-P energy: -25.466 bonds (distance) P-C4' energy: -27.783 flat angles C4'-P-C4' energy: -29.893 flat angles P-C4'-P energy: -17.160 tors. eta vs tors. theta energy: -22.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -209.185530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.185530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.185530 (E_RNA) where: Base-Base interactions energy: -103.359 where: short stacking energy: -69.559 Base-Backbone interact. energy: -0.440 local terms energy: -105.386241 where: bonds (distance) C4'-P energy: -24.640 bonds (distance) P-C4' energy: -26.340 flat angles C4'-P-C4' energy: -19.419 flat angles P-C4'-P energy: -17.288 tors. eta vs tors. theta energy: -17.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -160.634687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.634687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.634687 (E_RNA) where: Base-Base interactions energy: -63.995 where: short stacking energy: -63.163 Base-Backbone interact. energy: -0.105 local terms energy: -96.534401 where: bonds (distance) C4'-P energy: -28.145 bonds (distance) P-C4' energy: -30.124 flat angles C4'-P-C4' energy: -18.908 flat angles P-C4'-P energy: -10.763 tors. eta vs tors. theta energy: -8.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -178.769914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.769914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.769914 (E_RNA) where: Base-Base interactions energy: -84.918 where: short stacking energy: -47.514 Base-Backbone interact. energy: 0.339 local terms energy: -94.191155 where: bonds (distance) C4'-P energy: -29.047 bonds (distance) P-C4' energy: -26.335 flat angles C4'-P-C4' energy: -18.321 flat angles P-C4'-P energy: -13.809 tors. eta vs tors. theta energy: -6.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -121.694848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.694848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.694848 (E_RNA) where: Base-Base interactions energy: -43.061 where: short stacking energy: -43.061 Base-Backbone interact. energy: 0.613 local terms energy: -79.247048 where: bonds (distance) C4'-P energy: -24.757 bonds (distance) P-C4' energy: -22.581 flat angles C4'-P-C4' energy: -17.195 flat angles P-C4'-P energy: -10.383 tors. eta vs tors. theta energy: -4.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -553.329385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.329385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.329385 (E_RNA) where: Base-Base interactions energy: -387.944 where: short stacking energy: -146.652 Base-Backbone interact. energy: -2.114 local terms energy: -163.271606 where: bonds (distance) C4'-P energy: -30.404 bonds (distance) P-C4' energy: -29.130 flat angles C4'-P-C4' energy: -30.101 flat angles P-C4'-P energy: -28.917 tors. eta vs tors. theta energy: -44.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -547.439904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.439904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.439904 (E_RNA) where: Base-Base interactions energy: -391.177 where: short stacking energy: -152.508 Base-Backbone interact. energy: -0.153 local terms energy: -156.109749 where: bonds (distance) C4'-P energy: -26.614 bonds (distance) P-C4' energy: -28.825 flat angles C4'-P-C4' energy: -28.239 flat angles P-C4'-P energy: -23.501 tors. eta vs tors. theta energy: -48.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -539.211010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.211010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.211010 (E_RNA) where: Base-Base interactions energy: -391.868 where: short stacking energy: -151.350 Base-Backbone interact. energy: 1.237 local terms energy: -148.579411 where: bonds (distance) C4'-P energy: -27.796 bonds (distance) P-C4' energy: -22.607 flat angles C4'-P-C4' energy: -31.294 flat angles P-C4'-P energy: -19.646 tors. eta vs tors. theta energy: -47.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -455.909030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.909030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.909030 (E_RNA) where: Base-Base interactions energy: -309.803 where: short stacking energy: -128.086 Base-Backbone interact. energy: -0.696 local terms energy: -145.409753 where: bonds (distance) C4'-P energy: -27.239 bonds (distance) P-C4' energy: -25.644 flat angles C4'-P-C4' energy: -27.824 flat angles P-C4'-P energy: -25.542 tors. eta vs tors. theta energy: -39.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -373.250377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.250377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.250377 (E_RNA) where: Base-Base interactions energy: -260.751 where: short stacking energy: -119.915 Base-Backbone interact. energy: -0.344 local terms energy: -112.154760 where: bonds (distance) C4'-P energy: -21.684 bonds (distance) P-C4' energy: -19.279 flat angles C4'-P-C4' energy: -19.327 flat angles P-C4'-P energy: -21.343 tors. eta vs tors. theta energy: -30.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -344.401885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.401885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.401885 (E_RNA) where: Base-Base interactions energy: -213.513 where: short stacking energy: -98.033 Base-Backbone interact. energy: -0.960 local terms energy: -129.928305 where: bonds (distance) C4'-P energy: -29.154 bonds (distance) P-C4' energy: -28.760 flat angles C4'-P-C4' energy: -28.812 flat angles P-C4'-P energy: -21.507 tors. eta vs tors. theta energy: -21.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -170.187290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.187290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.187290 (E_RNA) where: Base-Base interactions energy: -64.078 where: short stacking energy: -64.078 Base-Backbone interact. energy: -0.156 local terms energy: -105.952959 where: bonds (distance) C4'-P energy: -26.098 bonds (distance) P-C4' energy: -22.466 flat angles C4'-P-C4' energy: -28.107 flat angles P-C4'-P energy: -17.392 tors. eta vs tors. theta energy: -11.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -194.972050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.972050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.972050 (E_RNA) where: Base-Base interactions energy: -103.018 where: short stacking energy: -48.574 Base-Backbone interact. energy: -0.126 local terms energy: -91.827586 where: bonds (distance) C4'-P energy: -21.113 bonds (distance) P-C4' energy: -24.287 flat angles C4'-P-C4' energy: -24.733 flat angles P-C4'-P energy: -11.787 tors. eta vs tors. theta energy: -9.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -130.190706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.190706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.190706 (E_RNA) where: Base-Base interactions energy: -47.783 where: short stacking energy: -42.425 Base-Backbone interact. energy: 3.202 local terms energy: -85.609519 where: bonds (distance) C4'-P energy: -19.402 bonds (distance) P-C4' energy: -30.258 flat angles C4'-P-C4' energy: -17.490 flat angles P-C4'-P energy: -14.473 tors. eta vs tors. theta energy: -3.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -132.661010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.661010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.661010 (E_RNA) where: Base-Base interactions energy: -58.273 where: short stacking energy: -45.447 Base-Backbone interact. energy: -2.037 local terms energy: -72.351665 where: bonds (distance) C4'-P energy: -17.018 bonds (distance) P-C4' energy: -30.525 flat angles C4'-P-C4' energy: -15.270 flat angles P-C4'-P energy: -9.459 tors. eta vs tors. theta energy: -0.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -555.120526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.120526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.120526 (E_RNA) where: Base-Base interactions energy: -399.150 where: short stacking energy: -154.573 Base-Backbone interact. energy: -1.151 local terms energy: -154.820028 where: bonds (distance) C4'-P energy: -28.985 bonds (distance) P-C4' energy: -28.507 flat angles C4'-P-C4' energy: -30.850 flat angles P-C4'-P energy: -20.108 tors. eta vs tors. theta energy: -46.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -548.101480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.101480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.101480 (E_RNA) where: Base-Base interactions energy: -397.412 where: short stacking energy: -154.008 Base-Backbone interact. energy: 2.966 local terms energy: -153.654980 where: bonds (distance) C4'-P energy: -23.812 bonds (distance) P-C4' energy: -29.110 flat angles C4'-P-C4' energy: -31.063 flat angles P-C4'-P energy: -21.503 tors. eta vs tors. theta energy: -48.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -552.260349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.260349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.260349 (E_RNA) where: Base-Base interactions energy: -397.434 where: short stacking energy: -151.465 Base-Backbone interact. energy: -1.249 local terms energy: -153.577581 where: bonds (distance) C4'-P energy: -29.558 bonds (distance) P-C4' energy: -26.437 flat angles C4'-P-C4' energy: -27.132 flat angles P-C4'-P energy: -24.892 tors. eta vs tors. theta energy: -45.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -502.985346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.985346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.985346 (E_RNA) where: Base-Base interactions energy: -366.625 where: short stacking energy: -139.909 Base-Backbone interact. energy: -0.337 local terms energy: -136.023113 where: bonds (distance) C4'-P energy: -20.142 bonds (distance) P-C4' energy: -21.992 flat angles C4'-P-C4' energy: -33.383 flat angles P-C4'-P energy: -19.466 tors. eta vs tors. theta energy: -41.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -381.451325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.451325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.451325 (E_RNA) where: Base-Base interactions energy: -255.573 where: short stacking energy: -95.154 Base-Backbone interact. energy: 0.839 local terms energy: -126.717301 where: bonds (distance) C4'-P energy: -26.973 bonds (distance) P-C4' energy: -27.439 flat angles C4'-P-C4' energy: -26.597 flat angles P-C4'-P energy: -16.557 tors. eta vs tors. theta energy: -29.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -339.927928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.927928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.927928 (E_RNA) where: Base-Base interactions energy: -225.416 where: short stacking energy: -104.773 Base-Backbone interact. energy: -0.097 local terms energy: -114.415561 where: bonds (distance) C4'-P energy: -25.412 bonds (distance) P-C4' energy: -24.178 flat angles C4'-P-C4' energy: -17.122 flat angles P-C4'-P energy: -20.916 tors. eta vs tors. theta energy: -26.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -148.697535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.697535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.697535 (E_RNA) where: Base-Base interactions energy: -62.141 where: short stacking energy: -46.324 Base-Backbone interact. energy: -0.185 local terms energy: -86.371649 where: bonds (distance) C4'-P energy: -26.458 bonds (distance) P-C4' energy: -20.303 flat angles C4'-P-C4' energy: -18.060 flat angles P-C4'-P energy: -13.108 tors. eta vs tors. theta energy: -8.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -173.826218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.826218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.826218 (E_RNA) where: Base-Base interactions energy: -70.795 where: short stacking energy: -67.023 Base-Backbone interact. energy: -0.708 local terms energy: -102.323283 where: bonds (distance) C4'-P energy: -23.055 bonds (distance) P-C4' energy: -28.874 flat angles C4'-P-C4' energy: -25.531 flat angles P-C4'-P energy: -15.104 tors. eta vs tors. theta energy: -9.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -157.042512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.042512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.042512 (E_RNA) where: Base-Base interactions energy: -58.431 where: short stacking energy: -56.341 Base-Backbone interact. energy: -0.555 local terms energy: -98.056951 where: bonds (distance) C4'-P energy: -27.607 bonds (distance) P-C4' energy: -25.287 flat angles C4'-P-C4' energy: -26.750 flat angles P-C4'-P energy: -14.061 tors. eta vs tors. theta energy: -4.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -131.862733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.862733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.862733 (E_RNA) where: Base-Base interactions energy: -56.459 where: short stacking energy: -52.146 Base-Backbone interact. energy: -0.590 local terms energy: -74.813849 where: bonds (distance) C4'-P energy: -18.819 bonds (distance) P-C4' energy: -15.831 flat angles C4'-P-C4' energy: -17.809 flat angles P-C4'-P energy: -18.389 tors. eta vs tors. theta energy: -3.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -554.585668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.585668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.585668 (E_RNA) where: Base-Base interactions energy: -402.232 where: short stacking energy: -159.167 Base-Backbone interact. energy: -0.000 local terms energy: -152.352886 where: bonds (distance) C4'-P energy: -21.344 bonds (distance) P-C4' energy: -27.993 flat angles C4'-P-C4' energy: -31.739 flat angles P-C4'-P energy: -23.715 tors. eta vs tors. theta energy: -47.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -547.550109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.550109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.550109 (E_RNA) where: Base-Base interactions energy: -386.559 where: short stacking energy: -149.716 Base-Backbone interact. energy: -0.539 local terms energy: -160.451795 where: bonds (distance) C4'-P energy: -28.759 bonds (distance) P-C4' energy: -26.887 flat angles C4'-P-C4' energy: -33.352 flat angles P-C4'-P energy: -24.086 tors. eta vs tors. theta energy: -47.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -540.720958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.720958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.720958 (E_RNA) where: Base-Base interactions energy: -386.257 where: short stacking energy: -155.017 Base-Backbone interact. energy: -0.008 local terms energy: -154.456102 where: bonds (distance) C4'-P energy: -28.535 bonds (distance) P-C4' energy: -26.409 flat angles C4'-P-C4' energy: -34.050 flat angles P-C4'-P energy: -21.223 tors. eta vs tors. theta energy: -44.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -531.643113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.643113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.643113 (E_RNA) where: Base-Base interactions energy: -384.653 where: short stacking energy: -150.524 Base-Backbone interact. energy: -0.468 local terms energy: -146.522300 where: bonds (distance) C4'-P energy: -22.618 bonds (distance) P-C4' energy: -22.105 flat angles C4'-P-C4' energy: -34.246 flat angles P-C4'-P energy: -23.767 tors. eta vs tors. theta energy: -43.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -393.218959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.218959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.218959 (E_RNA) where: Base-Base interactions energy: -267.069 where: short stacking energy: -110.636 Base-Backbone interact. energy: -0.313 local terms energy: -125.836903 where: bonds (distance) C4'-P energy: -28.896 bonds (distance) P-C4' energy: -25.055 flat angles C4'-P-C4' energy: -28.566 flat angles P-C4'-P energy: -10.371 tors. eta vs tors. theta energy: -32.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -361.245141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.245141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.245141 (E_RNA) where: Base-Base interactions energy: -234.973 where: short stacking energy: -98.597 Base-Backbone interact. energy: -2.191 local terms energy: -124.080915 where: bonds (distance) C4'-P energy: -25.137 bonds (distance) P-C4' energy: -26.357 flat angles C4'-P-C4' energy: -26.904 flat angles P-C4'-P energy: -20.064 tors. eta vs tors. theta energy: -25.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -193.850556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.850556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.850556 (E_RNA) where: Base-Base interactions energy: -92.022 where: short stacking energy: -56.679 Base-Backbone interact. energy: 0.805 local terms energy: -102.633689 where: bonds (distance) C4'-P energy: -29.794 bonds (distance) P-C4' energy: -28.230 flat angles C4'-P-C4' energy: -21.504 flat angles P-C4'-P energy: -13.239 tors. eta vs tors. theta energy: -9.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -134.043635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.043635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.043635 (E_RNA) where: Base-Base interactions energy: -41.789 where: short stacking energy: -39.867 Base-Backbone interact. energy: -0.508 local terms energy: -91.746447 where: bonds (distance) C4'-P energy: -30.861 bonds (distance) P-C4' energy: -29.462 flat angles C4'-P-C4' energy: -19.151 flat angles P-C4'-P energy: -14.238 tors. eta vs tors. theta energy: 1.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -138.358236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.358236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.358236 (E_RNA) where: Base-Base interactions energy: -39.115 where: short stacking energy: -37.826 Base-Backbone interact. energy: -1.108 local terms energy: -98.134751 where: bonds (distance) C4'-P energy: -21.142 bonds (distance) P-C4' energy: -24.956 flat angles C4'-P-C4' energy: -24.954 flat angles P-C4'-P energy: -20.097 tors. eta vs tors. theta energy: -6.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -137.371319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.371319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.371319 (E_RNA) where: Base-Base interactions energy: -41.549 where: short stacking energy: -40.658 Base-Backbone interact. energy: 0.180 local terms energy: -96.002194 where: bonds (distance) C4'-P energy: -21.340 bonds (distance) P-C4' energy: -30.385 flat angles C4'-P-C4' energy: -24.137 flat angles P-C4'-P energy: -15.447 tors. eta vs tors. theta energy: -4.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -559.549581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.549581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.549581 (E_RNA) where: Base-Base interactions energy: -404.238 where: short stacking energy: -159.366 Base-Backbone interact. energy: -0.240 local terms energy: -155.071402 where: bonds (distance) C4'-P energy: -28.859 bonds (distance) P-C4' energy: -28.489 flat angles C4'-P-C4' energy: -25.799 flat angles P-C4'-P energy: -23.011 tors. eta vs tors. theta energy: -48.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -546.134244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.134244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.134244 (E_RNA) where: Base-Base interactions energy: -389.105 where: short stacking energy: -145.534 Base-Backbone interact. energy: -0.544 local terms energy: -156.484952 where: bonds (distance) C4'-P energy: -24.523 bonds (distance) P-C4' energy: -30.960 flat angles C4'-P-C4' energy: -31.927 flat angles P-C4'-P energy: -24.213 tors. eta vs tors. theta energy: -44.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -539.123261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.123261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.123261 (E_RNA) where: Base-Base interactions energy: -388.400 where: short stacking energy: -148.017 Base-Backbone interact. energy: -0.621 local terms energy: -150.102012 where: bonds (distance) C4'-P energy: -21.074 bonds (distance) P-C4' energy: -28.800 flat angles C4'-P-C4' energy: -31.082 flat angles P-C4'-P energy: -22.985 tors. eta vs tors. theta energy: -46.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -531.662867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.662867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.662867 (E_RNA) where: Base-Base interactions energy: -384.995 where: short stacking energy: -146.644 Base-Backbone interact. energy: -0.002 local terms energy: -146.666471 where: bonds (distance) C4'-P energy: -27.305 bonds (distance) P-C4' energy: -19.968 flat angles C4'-P-C4' energy: -29.829 flat angles P-C4'-P energy: -22.561 tors. eta vs tors. theta energy: -47.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -396.710916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.710916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.710916 (E_RNA) where: Base-Base interactions energy: -266.333 where: short stacking energy: -124.096 Base-Backbone interact. energy: 0.180 local terms energy: -130.557949 where: bonds (distance) C4'-P energy: -23.186 bonds (distance) P-C4' energy: -28.854 flat angles C4'-P-C4' energy: -28.432 flat angles P-C4'-P energy: -15.638 tors. eta vs tors. theta energy: -34.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -372.601694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.601694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.601694 (E_RNA) where: Base-Base interactions energy: -249.917 where: short stacking energy: -105.993 Base-Backbone interact. energy: -1.239 local terms energy: -121.445578 where: bonds (distance) C4'-P energy: -27.025 bonds (distance) P-C4' energy: -23.694 flat angles C4'-P-C4' energy: -23.895 flat angles P-C4'-P energy: -19.621 tors. eta vs tors. theta energy: -27.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -147.818945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.818945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.818945 (E_RNA) where: Base-Base interactions energy: -64.385 where: short stacking energy: -49.902 Base-Backbone interact. energy: 0.029 local terms energy: -83.463187 where: bonds (distance) C4'-P energy: -25.446 bonds (distance) P-C4' energy: -26.075 flat angles C4'-P-C4' energy: -22.343 flat angles P-C4'-P energy: -12.764 tors. eta vs tors. theta energy: 3.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -148.419620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.419620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.419620 (E_RNA) where: Base-Base interactions energy: -63.564 where: short stacking energy: -50.433 Base-Backbone interact. energy: -1.165 local terms energy: -83.690117 where: bonds (distance) C4'-P energy: -21.998 bonds (distance) P-C4' energy: -23.416 flat angles C4'-P-C4' energy: -19.687 flat angles P-C4'-P energy: -13.639 tors. eta vs tors. theta energy: -4.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -136.652188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.652188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.652188 (E_RNA) where: Base-Base interactions energy: -56.363 where: short stacking energy: -33.952 Base-Backbone interact. energy: -1.244 local terms energy: -79.045829 where: bonds (distance) C4'-P energy: -22.108 bonds (distance) P-C4' energy: -27.257 flat angles C4'-P-C4' energy: -18.239 flat angles P-C4'-P energy: -15.291 tors. eta vs tors. theta energy: 3.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -117.535705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.535705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.535705 (E_RNA) where: Base-Base interactions energy: -46.435 where: short stacking energy: -46.142 Base-Backbone interact. energy: 0.882 local terms energy: -71.982278 where: bonds (distance) C4'-P energy: -12.344 bonds (distance) P-C4' energy: -25.025 flat angles C4'-P-C4' energy: -16.492 flat angles P-C4'-P energy: -11.582 tors. eta vs tors. theta energy: -6.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -557.397505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.397505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.397505 (E_RNA) where: Base-Base interactions energy: -399.051 where: short stacking energy: -157.242 Base-Backbone interact. energy: -1.387 local terms energy: -156.958936 where: bonds (distance) C4'-P energy: -30.701 bonds (distance) P-C4' energy: -26.232 flat angles C4'-P-C4' energy: -31.734 flat angles P-C4'-P energy: -22.100 tors. eta vs tors. theta energy: -46.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -547.767873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.767873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.767873 (E_RNA) where: Base-Base interactions energy: -395.049 where: short stacking energy: -152.598 Base-Backbone interact. energy: -0.193 local terms energy: -152.525236 where: bonds (distance) C4'-P energy: -24.315 bonds (distance) P-C4' energy: -28.438 flat angles C4'-P-C4' energy: -27.872 flat angles P-C4'-P energy: -25.648 tors. eta vs tors. theta energy: -46.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -535.910070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.910070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.910070 (E_RNA) where: Base-Base interactions energy: -393.566 where: short stacking energy: -157.261 Base-Backbone interact. energy: -1.278 local terms energy: -141.066749 where: bonds (distance) C4'-P energy: -20.995 bonds (distance) P-C4' energy: -21.735 flat angles C4'-P-C4' energy: -29.166 flat angles P-C4'-P energy: -23.613 tors. eta vs tors. theta energy: -45.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -538.141748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.141748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.141748 (E_RNA) where: Base-Base interactions energy: -393.969 where: short stacking energy: -150.625 Base-Backbone interact. energy: -1.309 local terms energy: -142.863872 where: bonds (distance) C4'-P energy: -21.670 bonds (distance) P-C4' energy: -21.269 flat angles C4'-P-C4' energy: -30.453 flat angles P-C4'-P energy: -22.809 tors. eta vs tors. theta energy: -46.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -385.780295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.780295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.780295 (E_RNA) where: Base-Base interactions energy: -259.340 where: short stacking energy: -107.187 Base-Backbone interact. energy: -0.224 local terms energy: -126.216515 where: bonds (distance) C4'-P energy: -22.934 bonds (distance) P-C4' energy: -24.664 flat angles C4'-P-C4' energy: -24.517 flat angles P-C4'-P energy: -21.234 tors. eta vs tors. theta energy: -32.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -373.902068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.902068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.902068 (E_RNA) where: Base-Base interactions energy: -252.334 where: short stacking energy: -112.887 Base-Backbone interact. energy: -0.029 local terms energy: -121.539627 where: bonds (distance) C4'-P energy: -25.697 bonds (distance) P-C4' energy: -25.339 flat angles C4'-P-C4' energy: -27.596 flat angles P-C4'-P energy: -13.519 tors. eta vs tors. theta energy: -29.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -186.637331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.637331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.637331 (E_RNA) where: Base-Base interactions energy: -83.595 where: short stacking energy: -47.328 Base-Backbone interact. energy: -1.644 local terms energy: -101.398596 where: bonds (distance) C4'-P energy: -24.127 bonds (distance) P-C4' energy: -32.962 flat angles C4'-P-C4' energy: -24.390 flat angles P-C4'-P energy: -14.575 tors. eta vs tors. theta energy: -5.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -142.103689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.103689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.103689 (E_RNA) where: Base-Base interactions energy: -50.172 where: short stacking energy: -44.690 Base-Backbone interact. energy: -0.180 local terms energy: -91.751830 where: bonds (distance) C4'-P energy: -22.947 bonds (distance) P-C4' energy: -27.359 flat angles C4'-P-C4' energy: -23.048 flat angles P-C4'-P energy: -17.010 tors. eta vs tors. theta energy: -1.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -149.165755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.165755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.165755 (E_RNA) where: Base-Base interactions energy: -55.864 where: short stacking energy: -53.771 Base-Backbone interact. energy: -0.532 local terms energy: -92.769450 where: bonds (distance) C4'-P energy: -20.202 bonds (distance) P-C4' energy: -25.829 flat angles C4'-P-C4' energy: -22.826 flat angles P-C4'-P energy: -19.925 tors. eta vs tors. theta energy: -3.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -126.049567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.049567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.049567 (E_RNA) where: Base-Base interactions energy: -48.418 where: short stacking energy: -43.523 Base-Backbone interact. energy: -0.315 local terms energy: -77.316225 where: bonds (distance) C4'-P energy: -21.690 bonds (distance) P-C4' energy: -22.447 flat angles C4'-P-C4' energy: -9.499 flat angles P-C4'-P energy: -21.587 tors. eta vs tors. theta energy: -2.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -563.465418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.465418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.465418 (E_RNA) where: Base-Base interactions energy: -401.638 where: short stacking energy: -156.055 Base-Backbone interact. energy: -0.842 local terms energy: -160.985545 where: bonds (distance) C4'-P energy: -27.521 bonds (distance) P-C4' energy: -30.180 flat angles C4'-P-C4' energy: -32.273 flat angles P-C4'-P energy: -25.600 tors. eta vs tors. theta energy: -45.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -539.437111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.437111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.437111 (E_RNA) where: Base-Base interactions energy: -392.352 where: short stacking energy: -152.148 Base-Backbone interact. energy: -0.163 local terms energy: -146.921839 where: bonds (distance) C4'-P energy: -21.486 bonds (distance) P-C4' energy: -27.115 flat angles C4'-P-C4' energy: -33.417 flat angles P-C4'-P energy: -19.037 tors. eta vs tors. theta energy: -45.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -546.955086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.955086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.955086 (E_RNA) where: Base-Base interactions energy: -396.314 where: short stacking energy: -156.040 Base-Backbone interact. energy: -0.682 local terms energy: -149.959208 where: bonds (distance) C4'-P energy: -27.694 bonds (distance) P-C4' energy: -23.589 flat angles C4'-P-C4' energy: -30.383 flat angles P-C4'-P energy: -20.979 tors. eta vs tors. theta energy: -47.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -531.505118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.505118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.505118 (E_RNA) where: Base-Base interactions energy: -376.676 where: short stacking energy: -138.869 Base-Backbone interact. energy: -0.246 local terms energy: -154.582369 where: bonds (distance) C4'-P energy: -26.811 bonds (distance) P-C4' energy: -26.425 flat angles C4'-P-C4' energy: -30.118 flat angles P-C4'-P energy: -26.897 tors. eta vs tors. theta energy: -44.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -384.427863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.427863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.427863 (E_RNA) where: Base-Base interactions energy: -254.233 where: short stacking energy: -106.516 Base-Backbone interact. energy: -0.480 local terms energy: -129.714663 where: bonds (distance) C4'-P energy: -24.295 bonds (distance) P-C4' energy: -25.854 flat angles C4'-P-C4' energy: -27.059 flat angles P-C4'-P energy: -21.708 tors. eta vs tors. theta energy: -30.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -398.437352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.437352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.437352 (E_RNA) where: Base-Base interactions energy: -270.187 where: short stacking energy: -113.992 Base-Backbone interact. energy: -0.661 local terms energy: -127.589792 where: bonds (distance) C4'-P energy: -20.884 bonds (distance) P-C4' energy: -30.392 flat angles C4'-P-C4' energy: -26.896 flat angles P-C4'-P energy: -14.839 tors. eta vs tors. theta energy: -34.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -210.345264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.345264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.345264 (E_RNA) where: Base-Base interactions energy: -108.700 where: short stacking energy: -66.467 Base-Backbone interact. energy: -0.581 local terms energy: -101.064777 where: bonds (distance) C4'-P energy: -23.596 bonds (distance) P-C4' energy: -27.045 flat angles C4'-P-C4' energy: -22.061 flat angles P-C4'-P energy: -17.852 tors. eta vs tors. theta energy: -10.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -159.440510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.440510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.440510 (E_RNA) where: Base-Base interactions energy: -73.076 where: short stacking energy: -42.144 Base-Backbone interact. energy: -0.316 local terms energy: -86.047995 where: bonds (distance) C4'-P energy: -20.970 bonds (distance) P-C4' energy: -26.864 flat angles C4'-P-C4' energy: -23.005 flat angles P-C4'-P energy: -14.798 tors. eta vs tors. theta energy: -0.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -143.457791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.457791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.457791 (E_RNA) where: Base-Base interactions energy: -61.811 where: short stacking energy: -43.802 Base-Backbone interact. energy: -0.352 local terms energy: -81.294500 where: bonds (distance) C4'-P energy: -25.008 bonds (distance) P-C4' energy: -23.473 flat angles C4'-P-C4' energy: -18.411 flat angles P-C4'-P energy: -7.972 tors. eta vs tors. theta energy: -6.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -124.840242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.840242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.840242 (E_RNA) where: Base-Base interactions energy: -52.489 where: short stacking energy: -48.800 Base-Backbone interact. energy: 0.800 local terms energy: -73.151504 where: bonds (distance) C4'-P energy: -22.962 bonds (distance) P-C4' energy: -21.313 flat angles C4'-P-C4' energy: -22.131 flat angles P-C4'-P energy: -10.926 tors. eta vs tors. theta energy: 4.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -555.014481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.014481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.014481 (E_RNA) where: Base-Base interactions energy: -397.262 where: short stacking energy: -155.260 Base-Backbone interact. energy: -0.273 local terms energy: -157.478612 where: bonds (distance) C4'-P energy: -30.183 bonds (distance) P-C4' energy: -26.138 flat angles C4'-P-C4' energy: -32.727 flat angles P-C4'-P energy: -24.279 tors. eta vs tors. theta energy: -44.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -539.480608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.480608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.480608 (E_RNA) where: Base-Base interactions energy: -393.218 where: short stacking energy: -155.153 Base-Backbone interact. energy: -2.684 local terms energy: -143.578202 where: bonds (distance) C4'-P energy: -22.214 bonds (distance) P-C4' energy: -27.473 flat angles C4'-P-C4' energy: -27.644 flat angles P-C4'-P energy: -20.429 tors. eta vs tors. theta energy: -45.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -541.294526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.294526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.294526 (E_RNA) where: Base-Base interactions energy: -393.609 where: short stacking energy: -145.787 Base-Backbone interact. energy: -0.067 local terms energy: -147.618376 where: bonds (distance) C4'-P energy: -22.655 bonds (distance) P-C4' energy: -29.188 flat angles C4'-P-C4' energy: -28.422 flat angles P-C4'-P energy: -22.059 tors. eta vs tors. theta energy: -45.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -532.716478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.716478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.716478 (E_RNA) where: Base-Base interactions energy: -388.049 where: short stacking energy: -154.216 Base-Backbone interact. energy: -0.002 local terms energy: -144.666218 where: bonds (distance) C4'-P energy: -26.512 bonds (distance) P-C4' energy: -26.649 flat angles C4'-P-C4' energy: -28.125 flat angles P-C4'-P energy: -18.445 tors. eta vs tors. theta energy: -44.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -390.638341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.638341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.638341 (E_RNA) where: Base-Base interactions energy: -266.277 where: short stacking energy: -111.540 Base-Backbone interact. energy: -0.280 local terms energy: -124.082247 where: bonds (distance) C4'-P energy: -14.039 bonds (distance) P-C4' energy: -32.544 flat angles C4'-P-C4' energy: -30.756 flat angles P-C4'-P energy: -15.084 tors. eta vs tors. theta energy: -31.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -395.117947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.117947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.117947 (E_RNA) where: Base-Base interactions energy: -277.177 where: short stacking energy: -120.891 Base-Backbone interact. energy: -1.478 local terms energy: -116.463016 where: bonds (distance) C4'-P energy: -27.350 bonds (distance) P-C4' energy: -24.823 flat angles C4'-P-C4' energy: -21.599 flat angles P-C4'-P energy: -14.598 tors. eta vs tors. theta energy: -28.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -196.371942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.371942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.371942 (E_RNA) where: Base-Base interactions energy: -89.621 where: short stacking energy: -48.650 Base-Backbone interact. energy: -0.185 local terms energy: -106.565968 where: bonds (distance) C4'-P energy: -23.761 bonds (distance) P-C4' energy: -24.238 flat angles C4'-P-C4' energy: -28.153 flat angles P-C4'-P energy: -19.756 tors. eta vs tors. theta energy: -10.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -167.577084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.577084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.577084 (E_RNA) where: Base-Base interactions energy: -76.305 where: short stacking energy: -44.533 Base-Backbone interact. energy: -1.873 local terms energy: -89.399085 where: bonds (distance) C4'-P energy: -29.652 bonds (distance) P-C4' energy: -25.380 flat angles C4'-P-C4' energy: -19.715 flat angles P-C4'-P energy: -12.334 tors. eta vs tors. theta energy: -2.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -130.914700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.914700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.914700 (E_RNA) where: Base-Base interactions energy: -60.250 where: short stacking energy: -40.525 Base-Backbone interact. energy: -0.241 local terms energy: -70.423373 where: bonds (distance) C4'-P energy: -19.853 bonds (distance) P-C4' energy: -19.990 flat angles C4'-P-C4' energy: -19.894 flat angles P-C4'-P energy: -9.974 tors. eta vs tors. theta energy: -0.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -128.107099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.107099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.107099 (E_RNA) where: Base-Base interactions energy: -43.788 where: short stacking energy: -40.193 Base-Backbone interact. energy: -0.288 local terms energy: -84.030382 where: bonds (distance) C4'-P energy: -26.465 bonds (distance) P-C4' energy: -25.874 flat angles C4'-P-C4' energy: -18.537 flat angles P-C4'-P energy: -8.712 tors. eta vs tors. theta energy: -4.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -553.858191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.858191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.858191 (E_RNA) where: Base-Base interactions energy: -396.926 where: short stacking energy: -153.516 Base-Backbone interact. energy: -1.768 local terms energy: -155.164316 where: bonds (distance) C4'-P energy: -29.384 bonds (distance) P-C4' energy: -25.590 flat angles C4'-P-C4' energy: -31.447 flat angles P-C4'-P energy: -20.841 tors. eta vs tors. theta energy: -47.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -541.846149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.846149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.846149 (E_RNA) where: Base-Base interactions energy: -397.656 where: short stacking energy: -157.505 Base-Backbone interact. energy: -0.380 local terms energy: -143.809923 where: bonds (distance) C4'-P energy: -23.389 bonds (distance) P-C4' energy: -27.856 flat angles C4'-P-C4' energy: -31.159 flat angles P-C4'-P energy: -14.927 tors. eta vs tors. theta energy: -46.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -534.669282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.669282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.669282 (E_RNA) where: Base-Base interactions energy: -387.385 where: short stacking energy: -151.433 Base-Backbone interact. energy: -0.299 local terms energy: -146.984907 where: bonds (distance) C4'-P energy: -28.061 bonds (distance) P-C4' energy: -21.950 flat angles C4'-P-C4' energy: -32.787 flat angles P-C4'-P energy: -21.986 tors. eta vs tors. theta energy: -42.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -528.638072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.638072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.638072 (E_RNA) where: Base-Base interactions energy: -381.799 where: short stacking energy: -158.922 Base-Backbone interact. energy: -0.008 local terms energy: -146.830930 where: bonds (distance) C4'-P energy: -24.131 bonds (distance) P-C4' energy: -24.631 flat angles C4'-P-C4' energy: -32.005 flat angles P-C4'-P energy: -18.338 tors. eta vs tors. theta energy: -47.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -412.910531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.910531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.910531 (E_RNA) where: Base-Base interactions energy: -272.955 where: short stacking energy: -115.928 Base-Backbone interact. energy: 0.945 local terms energy: -140.899735 where: bonds (distance) C4'-P energy: -31.555 bonds (distance) P-C4' energy: -26.757 flat angles C4'-P-C4' energy: -30.079 flat angles P-C4'-P energy: -20.118 tors. eta vs tors. theta energy: -32.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -402.764029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.764029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.764029 (E_RNA) where: Base-Base interactions energy: -284.307 where: short stacking energy: -120.681 Base-Backbone interact. energy: -0.373 local terms energy: -118.084060 where: bonds (distance) C4'-P energy: -22.839 bonds (distance) P-C4' energy: -17.121 flat angles C4'-P-C4' energy: -26.656 flat angles P-C4'-P energy: -18.596 tors. eta vs tors. theta energy: -32.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -146.850839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.850839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.850839 (E_RNA) where: Base-Base interactions energy: -57.981 where: short stacking energy: -40.606 Base-Backbone interact. energy: -0.427 local terms energy: -88.443031 where: bonds (distance) C4'-P energy: -26.191 bonds (distance) P-C4' energy: -28.281 flat angles C4'-P-C4' energy: -22.814 flat angles P-C4'-P energy: -17.876 tors. eta vs tors. theta energy: 6.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -147.630057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.630057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.630057 (E_RNA) where: Base-Base interactions energy: -53.260 where: short stacking energy: -48.492 Base-Backbone interact. energy: 1.769 local terms energy: -96.139214 where: bonds (distance) C4'-P energy: -24.936 bonds (distance) P-C4' energy: -24.928 flat angles C4'-P-C4' energy: -25.019 flat angles P-C4'-P energy: -16.238 tors. eta vs tors. theta energy: -5.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -142.183836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.183836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.183836 (E_RNA) where: Base-Base interactions energy: -46.306 where: short stacking energy: -43.135 Base-Backbone interact. energy: -0.646 local terms energy: -95.231918 where: bonds (distance) C4'-P energy: -23.505 bonds (distance) P-C4' energy: -23.490 flat angles C4'-P-C4' energy: -22.535 flat angles P-C4'-P energy: -20.643 tors. eta vs tors. theta energy: -5.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -128.416166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.416166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.416166 (E_RNA) where: Base-Base interactions energy: -48.368 where: short stacking energy: -45.280 Base-Backbone interact. energy: 0.100 local terms energy: -80.148678 where: bonds (distance) C4'-P energy: -22.880 bonds (distance) P-C4' energy: -24.617 flat angles C4'-P-C4' energy: -20.080 flat angles P-C4'-P energy: -11.249 tors. eta vs tors. theta energy: -1.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -561.449922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.449922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.449922 (E_RNA) where: Base-Base interactions energy: -402.088 where: short stacking energy: -157.645 Base-Backbone interact. energy: -0.031 local terms energy: -159.331326 where: bonds (distance) C4'-P energy: -27.483 bonds (distance) P-C4' energy: -31.457 flat angles C4'-P-C4' energy: -31.415 flat angles P-C4'-P energy: -21.751 tors. eta vs tors. theta energy: -47.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -553.434894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.434894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.434894 (E_RNA) where: Base-Base interactions energy: -393.926 where: short stacking energy: -160.723 Base-Backbone interact. energy: -0.001 local terms energy: -159.508060 where: bonds (distance) C4'-P energy: -30.348 bonds (distance) P-C4' energy: -27.834 flat angles C4'-P-C4' energy: -32.522 flat angles P-C4'-P energy: -23.565 tors. eta vs tors. theta energy: -45.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -541.946776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.946776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.946776 (E_RNA) where: Base-Base interactions energy: -387.008 where: short stacking energy: -148.333 Base-Backbone interact. energy: -0.299 local terms energy: -154.640166 where: bonds (distance) C4'-P energy: -26.474 bonds (distance) P-C4' energy: -28.411 flat angles C4'-P-C4' energy: -29.554 flat angles P-C4'-P energy: -21.636 tors. eta vs tors. theta energy: -48.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -525.867989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.867989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.867989 (E_RNA) where: Base-Base interactions energy: -379.968 where: short stacking energy: -146.675 Base-Backbone interact. energy: -0.882 local terms energy: -145.017725 where: bonds (distance) C4'-P energy: -22.486 bonds (distance) P-C4' energy: -24.998 flat angles C4'-P-C4' energy: -29.466 flat angles P-C4'-P energy: -22.785 tors. eta vs tors. theta energy: -45.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -451.497732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.497732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.497732 (E_RNA) where: Base-Base interactions energy: -316.714 where: short stacking energy: -124.506 Base-Backbone interact. energy: -0.804 local terms energy: -133.980253 where: bonds (distance) C4'-P energy: -25.570 bonds (distance) P-C4' energy: -22.542 flat angles C4'-P-C4' energy: -27.913 flat angles P-C4'-P energy: -20.838 tors. eta vs tors. theta energy: -37.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -401.242489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.242489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.242489 (E_RNA) where: Base-Base interactions energy: -273.404 where: short stacking energy: -109.968 Base-Backbone interact. energy: -0.636 local terms energy: -127.202136 where: bonds (distance) C4'-P energy: -20.339 bonds (distance) P-C4' energy: -26.305 flat angles C4'-P-C4' energy: -23.845 flat angles P-C4'-P energy: -21.976 tors. eta vs tors. theta energy: -34.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -190.810096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.810096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.810096 (E_RNA) where: Base-Base interactions energy: -93.196 where: short stacking energy: -53.780 Base-Backbone interact. energy: -0.522 local terms energy: -97.092793 where: bonds (distance) C4'-P energy: -26.568 bonds (distance) P-C4' energy: -26.429 flat angles C4'-P-C4' energy: -27.773 flat angles P-C4'-P energy: -3.704 tors. eta vs tors. theta energy: -12.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -161.824010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.824010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.824010 (E_RNA) where: Base-Base interactions energy: -72.108 where: short stacking energy: -42.253 Base-Backbone interact. energy: 0.335 local terms energy: -90.051499 where: bonds (distance) C4'-P energy: -25.243 bonds (distance) P-C4' energy: -25.472 flat angles C4'-P-C4' energy: -23.028 flat angles P-C4'-P energy: -15.640 tors. eta vs tors. theta energy: -0.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -128.077621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.077621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.077621 (E_RNA) where: Base-Base interactions energy: -59.748 where: short stacking energy: -50.497 Base-Backbone interact. energy: 0.559 local terms energy: -68.888791 where: bonds (distance) C4'-P energy: -21.661 bonds (distance) P-C4' energy: -24.552 flat angles C4'-P-C4' energy: -14.063 flat angles P-C4'-P energy: -7.783 tors. eta vs tors. theta energy: -0.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -122.169006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.169006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.169006 (E_RNA) where: Base-Base interactions energy: -41.465 where: short stacking energy: -40.771 Base-Backbone interact. energy: 1.900 local terms energy: -82.603867 where: bonds (distance) C4'-P energy: -24.132 bonds (distance) P-C4' energy: -25.862 flat angles C4'-P-C4' energy: -23.388 flat angles P-C4'-P energy: -11.452 tors. eta vs tors. theta energy: 2.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -555.402642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.402642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.402642 (E_RNA) where: Base-Base interactions energy: -400.089 where: short stacking energy: -156.866 Base-Backbone interact. energy: -1.720 local terms energy: -153.593466 where: bonds (distance) C4'-P energy: -21.261 bonds (distance) P-C4' energy: -30.617 flat angles C4'-P-C4' energy: -30.352 flat angles P-C4'-P energy: -22.459 tors. eta vs tors. theta energy: -48.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -549.667514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.667514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.667514 (E_RNA) where: Base-Base interactions energy: -389.833 where: short stacking energy: -154.854 Base-Backbone interact. energy: -2.207 local terms energy: -157.626879 where: bonds (distance) C4'-P energy: -26.941 bonds (distance) P-C4' energy: -26.225 flat angles C4'-P-C4' energy: -32.369 flat angles P-C4'-P energy: -22.320 tors. eta vs tors. theta energy: -49.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -550.851268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.851268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.851268 (E_RNA) where: Base-Base interactions energy: -394.306 where: short stacking energy: -157.257 Base-Backbone interact. energy: -1.967 local terms energy: -154.577432 where: bonds (distance) C4'-P energy: -25.335 bonds (distance) P-C4' energy: -24.121 flat angles C4'-P-C4' energy: -32.149 flat angles P-C4'-P energy: -25.134 tors. eta vs tors. theta energy: -47.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -527.650477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.650477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.650477 (E_RNA) where: Base-Base interactions energy: -377.653 where: short stacking energy: -149.422 Base-Backbone interact. energy: -0.631 local terms energy: -149.365832 where: bonds (distance) C4'-P energy: -26.453 bonds (distance) P-C4' energy: -26.732 flat angles C4'-P-C4' energy: -31.007 flat angles P-C4'-P energy: -19.893 tors. eta vs tors. theta energy: -45.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -500.907225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.907225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.907225 (E_RNA) where: Base-Base interactions energy: -366.845 where: short stacking energy: -135.798 Base-Backbone interact. energy: -0.341 local terms energy: -133.721966 where: bonds (distance) C4'-P energy: -24.949 bonds (distance) P-C4' energy: -27.818 flat angles C4'-P-C4' energy: -28.122 flat angles P-C4'-P energy: -15.187 tors. eta vs tors. theta energy: -37.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -382.014468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.014468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.014468 (E_RNA) where: Base-Base interactions energy: -262.267 where: short stacking energy: -113.064 Base-Backbone interact. energy: -0.369 local terms energy: -119.377940 where: bonds (distance) C4'-P energy: -23.187 bonds (distance) P-C4' energy: -26.312 flat angles C4'-P-C4' energy: -29.331 flat angles P-C4'-P energy: -8.341 tors. eta vs tors. theta energy: -32.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -254.257685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.257685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.257685 (E_RNA) where: Base-Base interactions energy: -149.769 where: short stacking energy: -78.079 Base-Backbone interact. energy: -1.308 local terms energy: -103.179920 where: bonds (distance) C4'-P energy: -25.169 bonds (distance) P-C4' energy: -26.649 flat angles C4'-P-C4' energy: -21.893 flat angles P-C4'-P energy: -10.653 tors. eta vs tors. theta energy: -18.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -136.758587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.758587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.758587 (E_RNA) where: Base-Base interactions energy: -38.337 where: short stacking energy: -35.370 Base-Backbone interact. energy: 0.913 local terms energy: -99.334900 where: bonds (distance) C4'-P energy: -27.811 bonds (distance) P-C4' energy: -27.080 flat angles C4'-P-C4' energy: -20.969 flat angles P-C4'-P energy: -18.483 tors. eta vs tors. theta energy: -4.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -139.783203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.783203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.783203 (E_RNA) where: Base-Base interactions energy: -60.196 where: short stacking energy: -53.716 Base-Backbone interact. energy: -0.362 local terms energy: -79.226099 where: bonds (distance) C4'-P energy: -20.608 bonds (distance) P-C4' energy: -22.116 flat angles C4'-P-C4' energy: -16.798 flat angles P-C4'-P energy: -15.211 tors. eta vs tors. theta energy: -4.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -126.351653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.351653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.351653 (E_RNA) where: Base-Base interactions energy: -53.203 where: short stacking energy: -49.014 Base-Backbone interact. energy: -0.204 local terms energy: -72.944043 where: bonds (distance) C4'-P energy: -19.042 bonds (distance) P-C4' energy: -24.449 flat angles C4'-P-C4' energy: -21.316 flat angles P-C4'-P energy: -8.432 tors. eta vs tors. theta energy: 0.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -559.365052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.365052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.365052 (E_RNA) where: Base-Base interactions energy: -396.249 where: short stacking energy: -152.048 Base-Backbone interact. energy: -0.000 local terms energy: -163.115821 where: bonds (distance) C4'-P energy: -30.493 bonds (distance) P-C4' energy: -30.187 flat angles C4'-P-C4' energy: -31.378 flat angles P-C4'-P energy: -22.905 tors. eta vs tors. theta energy: -48.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -554.949618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.949618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.949618 (E_RNA) where: Base-Base interactions energy: -402.235 where: short stacking energy: -157.983 Base-Backbone interact. energy: -2.111 local terms energy: -150.602868 where: bonds (distance) C4'-P energy: -24.971 bonds (distance) P-C4' energy: -24.055 flat angles C4'-P-C4' energy: -31.282 flat angles P-C4'-P energy: -22.170 tors. eta vs tors. theta energy: -48.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -538.373383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.373383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.373383 (E_RNA) where: Base-Base interactions energy: -391.330 where: short stacking energy: -148.695 Base-Backbone interact. energy: -0.041 local terms energy: -147.002617 where: bonds (distance) C4'-P energy: -21.877 bonds (distance) P-C4' energy: -23.224 flat angles C4'-P-C4' energy: -32.291 flat angles P-C4'-P energy: -21.968 tors. eta vs tors. theta energy: -47.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -538.876477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.876477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.876477 (E_RNA) where: Base-Base interactions energy: -386.047 where: short stacking energy: -147.512 Base-Backbone interact. energy: -0.001 local terms energy: -152.828462 where: bonds (distance) C4'-P energy: -27.375 bonds (distance) P-C4' energy: -28.482 flat angles C4'-P-C4' energy: -28.004 flat angles P-C4'-P energy: -22.087 tors. eta vs tors. theta energy: -46.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -501.351649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.351649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.351649 (E_RNA) where: Base-Base interactions energy: -363.315 where: short stacking energy: -138.539 Base-Backbone interact. energy: -0.257 local terms energy: -137.779127 where: bonds (distance) C4'-P energy: -24.209 bonds (distance) P-C4' energy: -26.220 flat angles C4'-P-C4' energy: -27.496 flat angles P-C4'-P energy: -19.961 tors. eta vs tors. theta energy: -39.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -379.811783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.811783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.811783 (E_RNA) where: Base-Base interactions energy: -264.954 where: short stacking energy: -110.253 Base-Backbone interact. energy: 1.098 local terms energy: -115.955129 where: bonds (distance) C4'-P energy: -24.243 bonds (distance) P-C4' energy: -18.011 flat angles C4'-P-C4' energy: -26.826 flat angles P-C4'-P energy: -17.173 tors. eta vs tors. theta energy: -29.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -272.058009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.058009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.058009 (E_RNA) where: Base-Base interactions energy: -158.814 where: short stacking energy: -75.104 Base-Backbone interact. energy: -0.922 local terms energy: -112.322558 where: bonds (distance) C4'-P energy: -29.135 bonds (distance) P-C4' energy: -29.425 flat angles C4'-P-C4' energy: -20.807 flat angles P-C4'-P energy: -14.542 tors. eta vs tors. theta energy: -18.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -140.824700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.824700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.824700 (E_RNA) where: Base-Base interactions energy: -60.453 where: short stacking energy: -38.212 Base-Backbone interact. energy: -0.025 local terms energy: -80.347093 where: bonds (distance) C4'-P energy: -20.162 bonds (distance) P-C4' energy: -29.711 flat angles C4'-P-C4' energy: -21.227 flat angles P-C4'-P energy: -8.817 tors. eta vs tors. theta energy: -0.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -135.639869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.639869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.639869 (E_RNA) where: Base-Base interactions energy: -51.551 where: short stacking energy: -42.131 Base-Backbone interact. energy: -0.478 local terms energy: -83.610957 where: bonds (distance) C4'-P energy: -25.848 bonds (distance) P-C4' energy: -20.700 flat angles C4'-P-C4' energy: -25.135 flat angles P-C4'-P energy: -7.124 tors. eta vs tors. theta energy: -4.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -123.297627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.297627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.297627 (E_RNA) where: Base-Base interactions energy: -45.506 where: short stacking energy: -38.598 Base-Backbone interact. energy: -1.042 local terms energy: -76.749448 where: bonds (distance) C4'-P energy: -23.838 bonds (distance) P-C4' energy: -30.348 flat angles C4'-P-C4' energy: -14.978 flat angles P-C4'-P energy: -13.181 tors. eta vs tors. theta energy: 5.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -563.294319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.294319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.294319 (E_RNA) where: Base-Base interactions energy: -396.865 where: short stacking energy: -156.683 Base-Backbone interact. energy: -0.325 local terms energy: -166.104045 where: bonds (distance) C4'-P energy: -31.748 bonds (distance) P-C4' energy: -31.349 flat angles C4'-P-C4' energy: -33.729 flat angles P-C4'-P energy: -23.384 tors. eta vs tors. theta energy: -45.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -546.753073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.753073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.753073 (E_RNA) where: Base-Base interactions energy: -389.952 where: short stacking energy: -151.380 Base-Backbone interact. energy: -0.954 local terms energy: -155.847588 where: bonds (distance) C4'-P energy: -28.084 bonds (distance) P-C4' energy: -27.856 flat angles C4'-P-C4' energy: -33.161 flat angles P-C4'-P energy: -20.519 tors. eta vs tors. theta energy: -46.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -548.780157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.780157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.780157 (E_RNA) where: Base-Base interactions energy: -392.150 where: short stacking energy: -147.416 Base-Backbone interact. energy: -1.176 local terms energy: -155.454655 where: bonds (distance) C4'-P energy: -24.514 bonds (distance) P-C4' energy: -29.316 flat angles C4'-P-C4' energy: -30.713 flat angles P-C4'-P energy: -22.640 tors. eta vs tors. theta energy: -48.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -520.689885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.689885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.689885 (E_RNA) where: Base-Base interactions energy: -377.918 where: short stacking energy: -151.457 Base-Backbone interact. energy: -0.953 local terms energy: -141.819424 where: bonds (distance) C4'-P energy: -23.462 bonds (distance) P-C4' energy: -23.343 flat angles C4'-P-C4' energy: -30.098 flat angles P-C4'-P energy: -22.399 tors. eta vs tors. theta energy: -42.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -539.819629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.819629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.819629 (E_RNA) where: Base-Base interactions energy: -389.158 where: short stacking energy: -145.109 Base-Backbone interact. energy: -0.627 local terms energy: -150.034807 where: bonds (distance) C4'-P energy: -25.769 bonds (distance) P-C4' energy: -22.876 flat angles C4'-P-C4' energy: -32.090 flat angles P-C4'-P energy: -24.934 tors. eta vs tors. theta energy: -44.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -380.839757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.839757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.839757 (E_RNA) where: Base-Base interactions energy: -261.325 where: short stacking energy: -110.606 Base-Backbone interact. energy: -0.176 local terms energy: -119.339363 where: bonds (distance) C4'-P energy: -25.549 bonds (distance) P-C4' energy: -23.921 flat angles C4'-P-C4' energy: -22.371 flat angles P-C4'-P energy: -15.152 tors. eta vs tors. theta energy: -32.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -235.760727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.760727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.760727 (E_RNA) where: Base-Base interactions energy: -133.527 where: short stacking energy: -77.313 Base-Backbone interact. energy: -0.112 local terms energy: -102.122448 where: bonds (distance) C4'-P energy: -20.963 bonds (distance) P-C4' energy: -23.122 flat angles C4'-P-C4' energy: -27.483 flat angles P-C4'-P energy: -12.631 tors. eta vs tors. theta energy: -17.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -148.305831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.305831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.305831 (E_RNA) where: Base-Base interactions energy: -55.385 where: short stacking energy: -53.502 Base-Backbone interact. energy: -0.379 local terms energy: -92.541885 where: bonds (distance) C4'-P energy: -26.431 bonds (distance) P-C4' energy: -26.151 flat angles C4'-P-C4' energy: -21.538 flat angles P-C4'-P energy: -14.189 tors. eta vs tors. theta energy: -4.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -135.952549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.952549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.952549 (E_RNA) where: Base-Base interactions energy: -58.201 where: short stacking energy: -56.635 Base-Backbone interact. energy: -0.062 local terms energy: -77.689637 where: bonds (distance) C4'-P energy: -23.511 bonds (distance) P-C4' energy: -25.588 flat angles C4'-P-C4' energy: -14.172 flat angles P-C4'-P energy: -9.115 tors. eta vs tors. theta energy: -5.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -119.538623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.538623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.538623 (E_RNA) where: Base-Base interactions energy: -40.211 where: short stacking energy: -35.600 Base-Backbone interact. energy: -0.217 local terms energy: -79.110819 where: bonds (distance) C4'-P energy: -16.566 bonds (distance) P-C4' energy: -30.194 flat angles C4'-P-C4' energy: -24.064 flat angles P-C4'-P energy: -15.557 tors. eta vs tors. theta energy: 7.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -562.710324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.710324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.710324 (E_RNA) where: Base-Base interactions energy: -399.780 where: short stacking energy: -159.270 Base-Backbone interact. energy: -1.243 local terms energy: -161.687763 where: bonds (distance) C4'-P energy: -29.258 bonds (distance) P-C4' energy: -28.350 flat angles C4'-P-C4' energy: -32.163 flat angles P-C4'-P energy: -27.102 tors. eta vs tors. theta energy: -44.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -545.569351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.569351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.569351 (E_RNA) where: Base-Base interactions energy: -395.623 where: short stacking energy: -151.648 Base-Backbone interact. energy: -0.778 local terms energy: -149.168380 where: bonds (distance) C4'-P energy: -23.808 bonds (distance) P-C4' energy: -22.122 flat angles C4'-P-C4' energy: -31.643 flat angles P-C4'-P energy: -26.075 tors. eta vs tors. theta energy: -45.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -539.455568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.455568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.455568 (E_RNA) where: Base-Base interactions energy: -382.552 where: short stacking energy: -149.440 Base-Backbone interact. energy: -0.004 local terms energy: -156.900074 where: bonds (distance) C4'-P energy: -27.047 bonds (distance) P-C4' energy: -26.845 flat angles C4'-P-C4' energy: -30.349 flat angles P-C4'-P energy: -26.324 tors. eta vs tors. theta energy: -46.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -532.441358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.441358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.441358 (E_RNA) where: Base-Base interactions energy: -383.394 where: short stacking energy: -150.938 Base-Backbone interact. energy: -0.520 local terms energy: -148.527805 where: bonds (distance) C4'-P energy: -26.409 bonds (distance) P-C4' energy: -25.258 flat angles C4'-P-C4' energy: -28.671 flat angles P-C4'-P energy: -20.744 tors. eta vs tors. theta energy: -47.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -534.963496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.963496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.963496 (E_RNA) where: Base-Base interactions energy: -382.832 where: short stacking energy: -149.042 Base-Backbone interact. energy: 1.750 local terms energy: -153.881183 where: bonds (distance) C4'-P energy: -28.928 bonds (distance) P-C4' energy: -23.986 flat angles C4'-P-C4' energy: -29.608 flat angles P-C4'-P energy: -24.160 tors. eta vs tors. theta energy: -47.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -387.173728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.173728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.173728 (E_RNA) where: Base-Base interactions energy: -257.443 where: short stacking energy: -116.282 Base-Backbone interact. energy: -0.889 local terms energy: -128.842095 where: bonds (distance) C4'-P energy: -25.207 bonds (distance) P-C4' energy: -23.100 flat angles C4'-P-C4' energy: -25.319 flat angles P-C4'-P energy: -17.251 tors. eta vs tors. theta energy: -37.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -253.590469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.590469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.590469 (E_RNA) where: Base-Base interactions energy: -145.847 where: short stacking energy: -71.574 Base-Backbone interact. energy: -0.775 local terms energy: -106.968748 where: bonds (distance) C4'-P energy: -24.709 bonds (distance) P-C4' energy: -27.899 flat angles C4'-P-C4' energy: -24.537 flat angles P-C4'-P energy: -18.050 tors. eta vs tors. theta energy: -11.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -207.229409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.229409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.229409 (E_RNA) where: Base-Base interactions energy: -123.414 where: short stacking energy: -62.871 Base-Backbone interact. energy: -0.669 local terms energy: -83.146418 where: bonds (distance) C4'-P energy: -24.428 bonds (distance) P-C4' energy: -15.267 flat angles C4'-P-C4' energy: -16.759 flat angles P-C4'-P energy: -9.427 tors. eta vs tors. theta energy: -17.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -133.859698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.859698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.859698 (E_RNA) where: Base-Base interactions energy: -53.131 where: short stacking energy: -42.628 Base-Backbone interact. energy: -0.313 local terms energy: -80.415570 where: bonds (distance) C4'-P energy: -24.463 bonds (distance) P-C4' energy: -24.714 flat angles C4'-P-C4' energy: -20.281 flat angles P-C4'-P energy: -11.164 tors. eta vs tors. theta energy: 0.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -129.539245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.539245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.539245 (E_RNA) where: Base-Base interactions energy: -44.951 where: short stacking energy: -43.052 Base-Backbone interact. energy: 0.236 local terms energy: -84.823770 where: bonds (distance) C4'-P energy: -23.964 bonds (distance) P-C4' energy: -31.038 flat angles C4'-P-C4' energy: -19.536 flat angles P-C4'-P energy: -15.265 tors. eta vs tors. theta energy: 4.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -556.915651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.915651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.915651 (E_RNA) where: Base-Base interactions energy: -397.802 where: short stacking energy: -154.031 Base-Backbone interact. energy: -1.263 local terms energy: -157.850419 where: bonds (distance) C4'-P energy: -29.028 bonds (distance) P-C4' energy: -22.691 flat angles C4'-P-C4' energy: -33.236 flat angles P-C4'-P energy: -23.464 tors. eta vs tors. theta energy: -49.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -549.742300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.742300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.742300 (E_RNA) where: Base-Base interactions energy: -398.715 where: short stacking energy: -154.243 Base-Backbone interact. energy: -0.359 local terms energy: -150.668142 where: bonds (distance) C4'-P energy: -29.377 bonds (distance) P-C4' energy: -26.186 flat angles C4'-P-C4' energy: -31.730 flat angles P-C4'-P energy: -17.464 tors. eta vs tors. theta energy: -45.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -550.035060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.035060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.035060 (E_RNA) where: Base-Base interactions energy: -393.210 where: short stacking energy: -154.240 Base-Backbone interact. energy: -0.004 local terms energy: -156.820911 where: bonds (distance) C4'-P energy: -24.958 bonds (distance) P-C4' energy: -27.536 flat angles C4'-P-C4' energy: -32.125 flat angles P-C4'-P energy: -23.314 tors. eta vs tors. theta energy: -48.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -538.178214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.178214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.178214 (E_RNA) where: Base-Base interactions energy: -385.149 where: short stacking energy: -152.655 Base-Backbone interact. energy: -1.335 local terms energy: -151.693691 where: bonds (distance) C4'-P energy: -22.682 bonds (distance) P-C4' energy: -30.932 flat angles C4'-P-C4' energy: -32.043 flat angles P-C4'-P energy: -20.067 tors. eta vs tors. theta energy: -45.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -539.347859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.347859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.347859 (E_RNA) where: Base-Base interactions energy: -390.422 where: short stacking energy: -147.355 Base-Backbone interact. energy: -0.305 local terms energy: -148.621252 where: bonds (distance) C4'-P energy: -27.443 bonds (distance) P-C4' energy: -25.035 flat angles C4'-P-C4' energy: -31.233 flat angles P-C4'-P energy: -18.335 tors. eta vs tors. theta energy: -46.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -386.490211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.490211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.490211 (E_RNA) where: Base-Base interactions energy: -256.343 where: short stacking energy: -116.474 Base-Backbone interact. energy: -0.323 local terms energy: -129.824393 where: bonds (distance) C4'-P energy: -23.602 bonds (distance) P-C4' energy: -28.540 flat angles C4'-P-C4' energy: -24.254 flat angles P-C4'-P energy: -15.608 tors. eta vs tors. theta energy: -37.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -285.890820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.890820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.890820 (E_RNA) where: Base-Base interactions energy: -181.835 where: short stacking energy: -88.401 Base-Backbone interact. energy: -0.422 local terms energy: -103.634293 where: bonds (distance) C4'-P energy: -18.839 bonds (distance) P-C4' energy: -28.145 flat angles C4'-P-C4' energy: -24.350 flat angles P-C4'-P energy: -15.538 tors. eta vs tors. theta energy: -16.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -288.617751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.617751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.617751 (E_RNA) where: Base-Base interactions energy: -192.689 where: short stacking energy: -91.296 Base-Backbone interact. energy: -0.665 local terms energy: -95.263875 where: bonds (distance) C4'-P energy: -22.273 bonds (distance) P-C4' energy: -16.291 flat angles C4'-P-C4' energy: -24.567 flat angles P-C4'-P energy: -13.913 tors. eta vs tors. theta energy: -18.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -138.309572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.309572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.309572 (E_RNA) where: Base-Base interactions energy: -54.384 where: short stacking energy: -31.999 Base-Backbone interact. energy: -0.704 local terms energy: -83.221438 where: bonds (distance) C4'-P energy: -26.792 bonds (distance) P-C4' energy: -24.204 flat angles C4'-P-C4' energy: -21.218 flat angles P-C4'-P energy: -14.713 tors. eta vs tors. theta energy: 3.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -119.040220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.040220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.040220 (E_RNA) where: Base-Base interactions energy: -40.632 where: short stacking energy: -34.105 Base-Backbone interact. energy: 2.999 local terms energy: -81.407169 where: bonds (distance) C4'-P energy: -22.535 bonds (distance) P-C4' energy: -27.062 flat angles C4'-P-C4' energy: -18.197 flat angles P-C4'-P energy: -14.268 tors. eta vs tors. theta energy: 0.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -549.384732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.384732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.384732 (E_RNA) where: Base-Base interactions energy: -405.603 where: short stacking energy: -158.862 Base-Backbone interact. energy: -0.071 local terms energy: -143.711445 where: bonds (distance) C4'-P energy: -24.917 bonds (distance) P-C4' energy: -23.600 flat angles C4'-P-C4' energy: -28.118 flat angles P-C4'-P energy: -20.315 tors. eta vs tors. theta energy: -46.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -547.704084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.704084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.704084 (E_RNA) where: Base-Base interactions energy: -394.618 where: short stacking energy: -158.995 Base-Backbone interact. energy: -0.948 local terms energy: -152.138158 where: bonds (distance) C4'-P energy: -20.001 bonds (distance) P-C4' energy: -28.989 flat angles C4'-P-C4' energy: -29.489 flat angles P-C4'-P energy: -25.747 tors. eta vs tors. theta energy: -47.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -546.390734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.390734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.390734 (E_RNA) where: Base-Base interactions energy: -394.421 where: short stacking energy: -150.913 Base-Backbone interact. energy: -0.780 local terms energy: -151.190348 where: bonds (distance) C4'-P energy: -24.459 bonds (distance) P-C4' energy: -24.808 flat angles C4'-P-C4' energy: -29.361 flat angles P-C4'-P energy: -24.523 tors. eta vs tors. theta energy: -48.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -541.544298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.544298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.544298 (E_RNA) where: Base-Base interactions energy: -389.233 where: short stacking energy: -152.205 Base-Backbone interact. energy: -1.621 local terms energy: -150.689362 where: bonds (distance) C4'-P energy: -27.839 bonds (distance) P-C4' energy: -30.023 flat angles C4'-P-C4' energy: -28.713 flat angles P-C4'-P energy: -20.689 tors. eta vs tors. theta energy: -43.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -528.228842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.228842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.228842 (E_RNA) where: Base-Base interactions energy: -383.463 where: short stacking energy: -149.411 Base-Backbone interact. energy: -0.745 local terms energy: -144.020541 where: bonds (distance) C4'-P energy: -22.211 bonds (distance) P-C4' energy: -27.303 flat angles C4'-P-C4' energy: -28.219 flat angles P-C4'-P energy: -20.903 tors. eta vs tors. theta energy: -45.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -362.814243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.814243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.814243 (E_RNA) where: Base-Base interactions energy: -246.665 where: short stacking energy: -89.660 Base-Backbone interact. energy: -0.484 local terms energy: -115.665039 where: bonds (distance) C4'-P energy: -20.002 bonds (distance) P-C4' energy: -26.493 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -16.413 tors. eta vs tors. theta energy: -29.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -309.827390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.827390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.827390 (E_RNA) where: Base-Base interactions energy: -206.386 where: short stacking energy: -99.126 Base-Backbone interact. energy: 0.408 local terms energy: -103.848522 where: bonds (distance) C4'-P energy: -22.663 bonds (distance) P-C4' energy: -24.739 flat angles C4'-P-C4' energy: -19.716 flat angles P-C4'-P energy: -14.193 tors. eta vs tors. theta energy: -22.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -279.087704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.087704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.087704 (E_RNA) where: Base-Base interactions energy: -181.952 where: short stacking energy: -82.381 Base-Backbone interact. energy: -0.477 local terms energy: -96.658402 where: bonds (distance) C4'-P energy: -24.142 bonds (distance) P-C4' energy: -22.413 flat angles C4'-P-C4' energy: -18.456 flat angles P-C4'-P energy: -13.220 tors. eta vs tors. theta energy: -18.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -139.431105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.431105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.431105 (E_RNA) where: Base-Base interactions energy: -56.297 where: short stacking energy: -50.024 Base-Backbone interact. energy: -0.550 local terms energy: -82.583780 where: bonds (distance) C4'-P energy: -21.584 bonds (distance) P-C4' energy: -21.171 flat angles C4'-P-C4' energy: -13.750 flat angles P-C4'-P energy: -15.194 tors. eta vs tors. theta energy: -10.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -136.381205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.381205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.381205 (E_RNA) where: Base-Base interactions energy: -44.657 where: short stacking energy: -42.918 Base-Backbone interact. energy: -0.914 local terms energy: -90.810520 where: bonds (distance) C4'-P energy: -23.001 bonds (distance) P-C4' energy: -28.131 flat angles C4'-P-C4' energy: -21.085 flat angles P-C4'-P energy: -16.167 tors. eta vs tors. theta energy: -2.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -561.690948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.690948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.690948 (E_RNA) where: Base-Base interactions energy: -407.897 where: short stacking energy: -159.403 Base-Backbone interact. energy: -1.354 local terms energy: -152.439371 where: bonds (distance) C4'-P energy: -25.074 bonds (distance) P-C4' energy: -24.468 flat angles C4'-P-C4' energy: -31.011 flat angles P-C4'-P energy: -25.021 tors. eta vs tors. theta energy: -46.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -548.026276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.026276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.026276 (E_RNA) where: Base-Base interactions energy: -393.070 where: short stacking energy: -149.544 Base-Backbone interact. energy: -0.056 local terms energy: -154.900583 where: bonds (distance) C4'-P energy: -26.589 bonds (distance) P-C4' energy: -29.240 flat angles C4'-P-C4' energy: -33.686 flat angles P-C4'-P energy: -21.830 tors. eta vs tors. theta energy: -43.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -548.593162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.593162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.593162 (E_RNA) where: Base-Base interactions energy: -386.799 where: short stacking energy: -156.042 Base-Backbone interact. energy: -0.931 local terms energy: -160.862760 where: bonds (distance) C4'-P energy: -24.971 bonds (distance) P-C4' energy: -32.172 flat angles C4'-P-C4' energy: -29.842 flat angles P-C4'-P energy: -26.557 tors. eta vs tors. theta energy: -47.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -532.570397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.570397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.570397 (E_RNA) where: Base-Base interactions energy: -386.339 where: short stacking energy: -147.367 Base-Backbone interact. energy: -0.673 local terms energy: -145.558483 where: bonds (distance) C4'-P energy: -21.346 bonds (distance) P-C4' energy: -23.404 flat angles C4'-P-C4' energy: -30.418 flat angles P-C4'-P energy: -23.444 tors. eta vs tors. theta energy: -46.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -531.522503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.522503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.522503 (E_RNA) where: Base-Base interactions energy: -384.856 where: short stacking energy: -151.083 Base-Backbone interact. energy: -0.340 local terms energy: -146.326879 where: bonds (distance) C4'-P energy: -22.648 bonds (distance) P-C4' energy: -28.054 flat angles C4'-P-C4' energy: -27.187 flat angles P-C4'-P energy: -21.264 tors. eta vs tors. theta energy: -47.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -385.921558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.921558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.921558 (E_RNA) where: Base-Base interactions energy: -263.039 where: short stacking energy: -107.029 Base-Backbone interact. energy: -0.872 local terms energy: -122.011048 where: bonds (distance) C4'-P energy: -25.902 bonds (distance) P-C4' energy: -25.952 flat angles C4'-P-C4' energy: -27.352 flat angles P-C4'-P energy: -12.134 tors. eta vs tors. theta energy: -30.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -372.142433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.142433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.142433 (E_RNA) where: Base-Base interactions energy: -248.247 where: short stacking energy: -111.124 Base-Backbone interact. energy: -0.702 local terms energy: -123.193267 where: bonds (distance) C4'-P energy: -22.445 bonds (distance) P-C4' energy: -30.194 flat angles C4'-P-C4' energy: -25.685 flat angles P-C4'-P energy: -18.725 tors. eta vs tors. theta energy: -26.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -300.592383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.592383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.592383 (E_RNA) where: Base-Base interactions energy: -189.773 where: short stacking energy: -84.511 Base-Backbone interact. energy: 3.391 local terms energy: -114.211114 where: bonds (distance) C4'-P energy: -21.691 bonds (distance) P-C4' energy: -30.443 flat angles C4'-P-C4' energy: -22.636 flat angles P-C4'-P energy: -18.381 tors. eta vs tors. theta energy: -21.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -135.049739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.049739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.049739 (E_RNA) where: Base-Base interactions energy: -51.120 where: short stacking energy: -47.738 Base-Backbone interact. energy: -0.800 local terms energy: -83.129945 where: bonds (distance) C4'-P energy: -22.821 bonds (distance) P-C4' energy: -19.954 flat angles C4'-P-C4' energy: -17.646 flat angles P-C4'-P energy: -21.009 tors. eta vs tors. theta energy: -1.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -127.272182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.272182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.272182 (E_RNA) where: Base-Base interactions energy: -46.639 where: short stacking energy: -45.401 Base-Backbone interact. energy: -1.537 local terms energy: -79.096049 where: bonds (distance) C4'-P energy: -19.490 bonds (distance) P-C4' energy: -22.950 flat angles C4'-P-C4' energy: -22.945 flat angles P-C4'-P energy: -11.269 tors. eta vs tors. theta energy: -2.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -557.761466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.761466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.761466 (E_RNA) where: Base-Base interactions energy: -401.811 where: short stacking energy: -161.195 Base-Backbone interact. energy: -2.360 local terms energy: -153.589985 where: bonds (distance) C4'-P energy: -22.791 bonds (distance) P-C4' energy: -27.111 flat angles C4'-P-C4' energy: -30.960 flat angles P-C4'-P energy: -24.655 tors. eta vs tors. theta energy: -48.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -539.802978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.802978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.802978 (E_RNA) where: Base-Base interactions energy: -379.279 where: short stacking energy: -148.247 Base-Backbone interact. energy: 0.009 local terms energy: -160.533123 where: bonds (distance) C4'-P energy: -30.999 bonds (distance) P-C4' energy: -28.952 flat angles C4'-P-C4' energy: -33.859 flat angles P-C4'-P energy: -24.881 tors. eta vs tors. theta energy: -41.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -541.173610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.173610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.173610 (E_RNA) where: Base-Base interactions energy: -397.452 where: short stacking energy: -158.280 Base-Backbone interact. energy: -2.283 local terms energy: -141.439200 where: bonds (distance) C4'-P energy: -23.154 bonds (distance) P-C4' energy: -17.930 flat angles C4'-P-C4' energy: -30.975 flat angles P-C4'-P energy: -22.075 tors. eta vs tors. theta energy: -47.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -537.082650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.082650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.082650 (E_RNA) where: Base-Base interactions energy: -390.978 where: short stacking energy: -151.389 Base-Backbone interact. energy: -1.043 local terms energy: -145.061805 where: bonds (distance) C4'-P energy: -29.016 bonds (distance) P-C4' energy: -26.489 flat angles C4'-P-C4' energy: -22.984 flat angles P-C4'-P energy: -20.560 tors. eta vs tors. theta energy: -46.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -531.878727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.878727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.878727 (E_RNA) where: Base-Base interactions energy: -382.526 where: short stacking energy: -144.947 Base-Backbone interact. energy: -1.660 local terms energy: -147.693116 where: bonds (distance) C4'-P energy: -24.501 bonds (distance) P-C4' energy: -25.832 flat angles C4'-P-C4' energy: -31.081 flat angles P-C4'-P energy: -19.519 tors. eta vs tors. theta energy: -46.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -389.777267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.777267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.777267 (E_RNA) where: Base-Base interactions energy: -265.053 where: short stacking energy: -115.211 Base-Backbone interact. energy: -0.240 local terms energy: -124.484386 where: bonds (distance) C4'-P energy: -19.225 bonds (distance) P-C4' energy: -19.635 flat angles C4'-P-C4' energy: -26.498 flat angles P-C4'-P energy: -21.226 tors. eta vs tors. theta energy: -37.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -383.263722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.263722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.263722 (E_RNA) where: Base-Base interactions energy: -247.547 where: short stacking energy: -98.495 Base-Backbone interact. energy: -1.314 local terms energy: -134.402984 where: bonds (distance) C4'-P energy: -30.643 bonds (distance) P-C4' energy: -31.483 flat angles C4'-P-C4' energy: -23.567 flat angles P-C4'-P energy: -17.601 tors. eta vs tors. theta energy: -31.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -315.513423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.513423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.513423 (E_RNA) where: Base-Base interactions energy: -208.070 where: short stacking energy: -87.540 Base-Backbone interact. energy: -0.283 local terms energy: -107.160781 where: bonds (distance) C4'-P energy: -21.505 bonds (distance) P-C4' energy: -23.080 flat angles C4'-P-C4' energy: -25.019 flat angles P-C4'-P energy: -16.408 tors. eta vs tors. theta energy: -21.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -153.942609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.942609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.942609 (E_RNA) where: Base-Base interactions energy: -75.547 where: short stacking energy: -61.806 Base-Backbone interact. energy: -0.382 local terms energy: -78.013668 where: bonds (distance) C4'-P energy: -20.113 bonds (distance) P-C4' energy: -20.639 flat angles C4'-P-C4' energy: -25.268 flat angles P-C4'-P energy: -6.817 tors. eta vs tors. theta energy: -5.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -131.259713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.259713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.259713 (E_RNA) where: Base-Base interactions energy: -48.027 where: short stacking energy: -45.515 Base-Backbone interact. energy: -0.098 local terms energy: -83.134689 where: bonds (distance) C4'-P energy: -27.831 bonds (distance) P-C4' energy: -26.875 flat angles C4'-P-C4' energy: -14.526 flat angles P-C4'-P energy: -17.026 tors. eta vs tors. theta energy: 3.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -557.071358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.071358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.071358 (E_RNA) where: Base-Base interactions energy: -392.432 where: short stacking energy: -155.392 Base-Backbone interact. energy: -1.756 local terms energy: -162.883127 where: bonds (distance) C4'-P energy: -29.218 bonds (distance) P-C4' energy: -28.548 flat angles C4'-P-C4' energy: -33.650 flat angles P-C4'-P energy: -27.228 tors. eta vs tors. theta energy: -44.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -544.630701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.630701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.630701 (E_RNA) where: Base-Base interactions energy: -398.188 where: short stacking energy: -158.213 Base-Backbone interact. energy: -0.884 local terms energy: -145.559480 where: bonds (distance) C4'-P energy: -24.593 bonds (distance) P-C4' energy: -25.989 flat angles C4'-P-C4' energy: -27.226 flat angles P-C4'-P energy: -20.339 tors. eta vs tors. theta energy: -47.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -533.019022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.019022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.019022 (E_RNA) where: Base-Base interactions energy: -381.305 where: short stacking energy: -149.402 Base-Backbone interact. energy: -1.323 local terms energy: -150.390807 where: bonds (distance) C4'-P energy: -18.434 bonds (distance) P-C4' energy: -29.083 flat angles C4'-P-C4' energy: -32.124 flat angles P-C4'-P energy: -23.059 tors. eta vs tors. theta energy: -47.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -530.568599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.568599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.568599 (E_RNA) where: Base-Base interactions energy: -384.537 where: short stacking energy: -151.219 Base-Backbone interact. energy: 0.486 local terms energy: -146.517745 where: bonds (distance) C4'-P energy: -21.525 bonds (distance) P-C4' energy: -25.057 flat angles C4'-P-C4' energy: -30.457 flat angles P-C4'-P energy: -22.598 tors. eta vs tors. theta energy: -46.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -535.421728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.421728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.421728 (E_RNA) where: Base-Base interactions energy: -387.857 where: short stacking energy: -148.466 Base-Backbone interact. energy: -1.319 local terms energy: -146.245462 where: bonds (distance) C4'-P energy: -27.520 bonds (distance) P-C4' energy: -24.446 flat angles C4'-P-C4' energy: -31.003 flat angles P-C4'-P energy: -17.138 tors. eta vs tors. theta energy: -46.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -397.474395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.474395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.474395 (E_RNA) where: Base-Base interactions energy: -270.898 where: short stacking energy: -116.444 Base-Backbone interact. energy: -0.349 local terms energy: -126.227970 where: bonds (distance) C4'-P energy: -30.322 bonds (distance) P-C4' energy: -23.066 flat angles C4'-P-C4' energy: -25.218 flat angles P-C4'-P energy: -16.716 tors. eta vs tors. theta energy: -30.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -372.117627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.117627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.117627 (E_RNA) where: Base-Base interactions energy: -252.397 where: short stacking energy: -110.631 Base-Backbone interact. energy: -0.934 local terms energy: -118.786718 where: bonds (distance) C4'-P energy: -20.312 bonds (distance) P-C4' energy: -26.665 flat angles C4'-P-C4' energy: -24.823 flat angles P-C4'-P energy: -14.362 tors. eta vs tors. theta energy: -32.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -323.904466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.904466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.904466 (E_RNA) where: Base-Base interactions energy: -212.518 where: short stacking energy: -98.337 Base-Backbone interact. energy: -0.488 local terms energy: -110.898610 where: bonds (distance) C4'-P energy: -15.899 bonds (distance) P-C4' energy: -21.061 flat angles C4'-P-C4' energy: -27.361 flat angles P-C4'-P energy: -16.403 tors. eta vs tors. theta energy: -30.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -139.569634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.569634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.569634 (E_RNA) where: Base-Base interactions energy: -47.704 where: short stacking energy: -46.458 Base-Backbone interact. energy: -0.890 local terms energy: -90.975741 where: bonds (distance) C4'-P energy: -25.256 bonds (distance) P-C4' energy: -26.702 flat angles C4'-P-C4' energy: -20.092 flat angles P-C4'-P energy: -13.638 tors. eta vs tors. theta energy: -5.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -127.560292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.560292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.560292 (E_RNA) where: Base-Base interactions energy: -41.939 where: short stacking energy: -38.329 Base-Backbone interact. energy: -0.925 local terms energy: -84.696036 where: bonds (distance) C4'-P energy: -15.339 bonds (distance) P-C4' energy: -26.056 flat angles C4'-P-C4' energy: -19.083 flat angles P-C4'-P energy: -17.894 tors. eta vs tors. theta energy: -6.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -549.426096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.426096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.426096 (E_RNA) where: Base-Base interactions energy: -399.236 where: short stacking energy: -159.158 Base-Backbone interact. energy: -1.391 local terms energy: -148.799941 where: bonds (distance) C4'-P energy: -22.805 bonds (distance) P-C4' energy: -26.673 flat angles C4'-P-C4' energy: -27.613 flat angles P-C4'-P energy: -25.073 tors. eta vs tors. theta energy: -46.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -547.376462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.376462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.376462 (E_RNA) where: Base-Base interactions energy: -393.191 where: short stacking energy: -149.438 Base-Backbone interact. energy: -0.604 local terms energy: -153.580878 where: bonds (distance) C4'-P energy: -26.805 bonds (distance) P-C4' energy: -28.338 flat angles C4'-P-C4' energy: -30.170 flat angles P-C4'-P energy: -23.959 tors. eta vs tors. theta energy: -44.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -538.237472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.237472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.237472 (E_RNA) where: Base-Base interactions energy: -378.975 where: short stacking energy: -147.172 Base-Backbone interact. energy: -0.565 local terms energy: -158.696987 where: bonds (distance) C4'-P energy: -25.206 bonds (distance) P-C4' energy: -29.006 flat angles C4'-P-C4' energy: -34.649 flat angles P-C4'-P energy: -23.471 tors. eta vs tors. theta energy: -46.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -536.229844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.229844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.229844 (E_RNA) where: Base-Base interactions energy: -396.000 where: short stacking energy: -153.527 Base-Backbone interact. energy: -1.097 local terms energy: -139.133206 where: bonds (distance) C4'-P energy: -17.079 bonds (distance) P-C4' energy: -26.321 flat angles C4'-P-C4' energy: -30.050 flat angles P-C4'-P energy: -20.364 tors. eta vs tors. theta energy: -45.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -525.938309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.938309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.938309 (E_RNA) where: Base-Base interactions energy: -376.723 where: short stacking energy: -147.100 Base-Backbone interact. energy: -0.890 local terms energy: -148.324771 where: bonds (distance) C4'-P energy: -26.245 bonds (distance) P-C4' energy: -22.855 flat angles C4'-P-C4' energy: -31.025 flat angles P-C4'-P energy: -21.948 tors. eta vs tors. theta energy: -46.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -443.005210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.005210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.005210 (E_RNA) where: Base-Base interactions energy: -314.715 where: short stacking energy: -129.044 Base-Backbone interact. energy: -0.036 local terms energy: -128.254246 where: bonds (distance) C4'-P energy: -25.840 bonds (distance) P-C4' energy: -23.629 flat angles C4'-P-C4' energy: -25.298 flat angles P-C4'-P energy: -20.085 tors. eta vs tors. theta energy: -33.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -371.147435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.147435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.147435 (E_RNA) where: Base-Base interactions energy: -258.642 where: short stacking energy: -103.987 Base-Backbone interact. energy: -0.290 local terms energy: -112.215942 where: bonds (distance) C4'-P energy: -18.021 bonds (distance) P-C4' energy: -25.075 flat angles C4'-P-C4' energy: -30.726 flat angles P-C4'-P energy: -8.913 tors. eta vs tors. theta energy: -29.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -354.918630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.918630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.918630 (E_RNA) where: Base-Base interactions energy: -236.700 where: short stacking energy: -105.623 Base-Backbone interact. energy: 1.666 local terms energy: -119.884762 where: bonds (distance) C4'-P energy: -22.312 bonds (distance) P-C4' energy: -27.078 flat angles C4'-P-C4' energy: -24.223 flat angles P-C4'-P energy: -16.401 tors. eta vs tors. theta energy: -29.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -148.956501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.956501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.956501 (E_RNA) where: Base-Base interactions energy: -50.535 where: short stacking energy: -38.117 Base-Backbone interact. energy: -0.112 local terms energy: -98.308967 where: bonds (distance) C4'-P energy: -25.860 bonds (distance) P-C4' energy: -28.391 flat angles C4'-P-C4' energy: -21.654 flat angles P-C4'-P energy: -20.444 tors. eta vs tors. theta energy: -1.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -129.143171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.143171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.143171 (E_RNA) where: Base-Base interactions energy: -41.744 where: short stacking energy: -35.889 Base-Backbone interact. energy: -0.394 local terms energy: -87.004870 where: bonds (distance) C4'-P energy: -30.497 bonds (distance) P-C4' energy: -26.102 flat angles C4'-P-C4' energy: -21.217 flat angles P-C4'-P energy: -10.368 tors. eta vs tors. theta energy: 1.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -554.573928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.573928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.573928 (E_RNA) where: Base-Base interactions energy: -399.992 where: short stacking energy: -152.707 Base-Backbone interact. energy: -0.140 local terms energy: -154.442661 where: bonds (distance) C4'-P energy: -25.707 bonds (distance) P-C4' energy: -28.295 flat angles C4'-P-C4' energy: -31.672 flat angles P-C4'-P energy: -20.566 tors. eta vs tors. theta energy: -48.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -548.281967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.281967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.281967 (E_RNA) where: Base-Base interactions energy: -400.337 where: short stacking energy: -152.515 Base-Backbone interact. energy: -1.158 local terms energy: -146.786983 where: bonds (distance) C4'-P energy: -19.627 bonds (distance) P-C4' energy: -27.832 flat angles C4'-P-C4' energy: -26.706 flat angles P-C4'-P energy: -24.983 tors. eta vs tors. theta energy: -47.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -542.968324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.968324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.968324 (E_RNA) where: Base-Base interactions energy: -392.641 where: short stacking energy: -151.401 Base-Backbone interact. energy: -0.068 local terms energy: -150.259545 where: bonds (distance) C4'-P energy: -29.378 bonds (distance) P-C4' energy: -26.101 flat angles C4'-P-C4' energy: -29.853 flat angles P-C4'-P energy: -18.710 tors. eta vs tors. theta energy: -46.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -536.358783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.358783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.358783 (E_RNA) where: Base-Base interactions energy: -397.142 where: short stacking energy: -152.007 Base-Backbone interact. energy: -0.674 local terms energy: -138.543285 where: bonds (distance) C4'-P energy: -23.372 bonds (distance) P-C4' energy: -20.969 flat angles C4'-P-C4' energy: -26.949 flat angles P-C4'-P energy: -22.259 tors. eta vs tors. theta energy: -44.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -532.174309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.174309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.174309 (E_RNA) where: Base-Base interactions energy: -379.042 where: short stacking energy: -149.508 Base-Backbone interact. energy: -0.760 local terms energy: -152.371801 where: bonds (distance) C4'-P energy: -25.716 bonds (distance) P-C4' energy: -29.813 flat angles C4'-P-C4' energy: -32.095 flat angles P-C4'-P energy: -19.295 tors. eta vs tors. theta energy: -45.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -457.854964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.854964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.854964 (E_RNA) where: Base-Base interactions energy: -315.855 where: short stacking energy: -128.294 Base-Backbone interact. energy: -2.409 local terms energy: -139.590758 where: bonds (distance) C4'-P energy: -24.846 bonds (distance) P-C4' energy: -24.783 flat angles C4'-P-C4' energy: -29.159 flat angles P-C4'-P energy: -22.527 tors. eta vs tors. theta energy: -38.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -377.193923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.193923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.193923 (E_RNA) where: Base-Base interactions energy: -256.665 where: short stacking energy: -108.416 Base-Backbone interact. energy: -0.074 local terms energy: -120.454545 where: bonds (distance) C4'-P energy: -25.740 bonds (distance) P-C4' energy: -20.285 flat angles C4'-P-C4' energy: -24.562 flat angles P-C4'-P energy: -14.995 tors. eta vs tors. theta energy: -34.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -371.459507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.459507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.459507 (E_RNA) where: Base-Base interactions energy: -249.753 where: short stacking energy: -111.149 Base-Backbone interact. energy: -1.121 local terms energy: -120.585290 where: bonds (distance) C4'-P energy: -20.054 bonds (distance) P-C4' energy: -28.823 flat angles C4'-P-C4' energy: -28.100 flat angles P-C4'-P energy: -15.385 tors. eta vs tors. theta energy: -28.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -146.781976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.781976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.781976 (E_RNA) where: Base-Base interactions energy: -52.759 where: short stacking energy: -45.992 Base-Backbone interact. energy: 0.009 local terms energy: -94.032155 where: bonds (distance) C4'-P energy: -20.896 bonds (distance) P-C4' energy: -27.857 flat angles C4'-P-C4' energy: -20.229 flat angles P-C4'-P energy: -13.522 tors. eta vs tors. theta energy: -11.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -139.086641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.086641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.086641 (E_RNA) where: Base-Base interactions energy: -59.944 where: short stacking energy: -50.602 Base-Backbone interact. energy: 0.027 local terms energy: -79.169918 where: bonds (distance) C4'-P energy: -19.936 bonds (distance) P-C4' energy: -14.219 flat angles C4'-P-C4' energy: -24.561 flat angles P-C4'-P energy: -13.805 tors. eta vs tors. theta energy: -6.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -561.987551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.987551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.987551 (E_RNA) where: Base-Base interactions energy: -411.177 where: short stacking energy: -161.802 Base-Backbone interact. energy: -0.210 local terms energy: -150.600133 where: bonds (distance) C4'-P energy: -26.152 bonds (distance) P-C4' energy: -19.280 flat angles C4'-P-C4' energy: -33.598 flat angles P-C4'-P energy: -23.708 tors. eta vs tors. theta energy: -47.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -551.750313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.750313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.750313 (E_RNA) where: Base-Base interactions energy: -397.918 where: short stacking energy: -154.640 Base-Backbone interact. energy: -1.220 local terms energy: -152.612468 where: bonds (distance) C4'-P energy: -25.524 bonds (distance) P-C4' energy: -22.737 flat angles C4'-P-C4' energy: -30.719 flat angles P-C4'-P energy: -24.926 tors. eta vs tors. theta energy: -48.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -555.883340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.883340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.883340 (E_RNA) where: Base-Base interactions energy: -392.472 where: short stacking energy: -154.708 Base-Backbone interact. energy: -2.857 local terms energy: -160.554656 where: bonds (distance) C4'-P energy: -26.275 bonds (distance) P-C4' energy: -31.615 flat angles C4'-P-C4' energy: -31.556 flat angles P-C4'-P energy: -24.469 tors. eta vs tors. theta energy: -46.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -541.031022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.031022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.031022 (E_RNA) where: Base-Base interactions energy: -395.005 where: short stacking energy: -153.690 Base-Backbone interact. energy: -0.209 local terms energy: -145.816744 where: bonds (distance) C4'-P energy: -24.586 bonds (distance) P-C4' energy: -26.389 flat angles C4'-P-C4' energy: -29.596 flat angles P-C4'-P energy: -19.852 tors. eta vs tors. theta energy: -45.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -546.415002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.415002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.415002 (E_RNA) where: Base-Base interactions energy: -387.727 where: short stacking energy: -151.717 Base-Backbone interact. energy: -1.692 local terms energy: -156.995760 where: bonds (distance) C4'-P energy: -23.707 bonds (distance) P-C4' energy: -30.336 flat angles C4'-P-C4' energy: -30.167 flat angles P-C4'-P energy: -23.843 tors. eta vs tors. theta energy: -48.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -506.918719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.918719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.918719 (E_RNA) where: Base-Base interactions energy: -363.146 where: short stacking energy: -143.840 Base-Backbone interact. energy: -0.567 local terms energy: -143.205536 where: bonds (distance) C4'-P energy: -25.882 bonds (distance) P-C4' energy: -22.739 flat angles C4'-P-C4' energy: -31.456 flat angles P-C4'-P energy: -20.888 tors. eta vs tors. theta energy: -42.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -382.267684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.267684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.267684 (E_RNA) where: Base-Base interactions energy: -251.073 where: short stacking energy: -103.050 Base-Backbone interact. energy: -0.766 local terms energy: -130.429389 where: bonds (distance) C4'-P energy: -27.880 bonds (distance) P-C4' energy: -25.546 flat angles C4'-P-C4' energy: -27.109 flat angles P-C4'-P energy: -18.010 tors. eta vs tors. theta energy: -31.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -324.251678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.251678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.251678 (E_RNA) where: Base-Base interactions energy: -213.368 where: short stacking energy: -91.683 Base-Backbone interact. energy: 0.303 local terms energy: -111.187414 where: bonds (distance) C4'-P energy: -20.688 bonds (distance) P-C4' energy: -28.730 flat angles C4'-P-C4' energy: -24.675 flat angles P-C4'-P energy: -10.282 tors. eta vs tors. theta energy: -26.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -150.248919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.248919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.248919 (E_RNA) where: Base-Base interactions energy: -62.005 where: short stacking energy: -59.145 Base-Backbone interact. energy: 0.177 local terms energy: -88.420247 where: bonds (distance) C4'-P energy: -18.649 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -20.890 flat angles P-C4'-P energy: -13.290 tors. eta vs tors. theta energy: -12.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -131.950337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.950337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.950337 (E_RNA) where: Base-Base interactions energy: -49.695 where: short stacking energy: -48.920 Base-Backbone interact. energy: 2.360 local terms energy: -84.615404 where: bonds (distance) C4'-P energy: -17.418 bonds (distance) P-C4' energy: -24.170 flat angles C4'-P-C4' energy: -17.348 flat angles P-C4'-P energy: -14.938 tors. eta vs tors. theta energy: -10.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -552.664424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.664424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.664424 (E_RNA) where: Base-Base interactions energy: -396.098 where: short stacking energy: -151.876 Base-Backbone interact. energy: -1.680 local terms energy: -154.886763 where: bonds (distance) C4'-P energy: -24.284 bonds (distance) P-C4' energy: -24.585 flat angles C4'-P-C4' energy: -33.093 flat angles P-C4'-P energy: -25.227 tors. eta vs tors. theta energy: -47.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -557.564560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.564560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.564560 (E_RNA) where: Base-Base interactions energy: -398.787 where: short stacking energy: -152.030 Base-Backbone interact. energy: -1.134 local terms energy: -157.643338 where: bonds (distance) C4'-P energy: -29.181 bonds (distance) P-C4' energy: -28.540 flat angles C4'-P-C4' energy: -29.599 flat angles P-C4'-P energy: -23.318 tors. eta vs tors. theta energy: -47.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -550.010869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.010869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.010869 (E_RNA) where: Base-Base interactions energy: -394.032 where: short stacking energy: -148.503 Base-Backbone interact. energy: -0.050 local terms energy: -155.928792 where: bonds (distance) C4'-P energy: -27.272 bonds (distance) P-C4' energy: -28.804 flat angles C4'-P-C4' energy: -33.461 flat angles P-C4'-P energy: -19.383 tors. eta vs tors. theta energy: -47.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -532.567440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.567440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.567440 (E_RNA) where: Base-Base interactions energy: -383.407 where: short stacking energy: -155.928 Base-Backbone interact. energy: -0.715 local terms energy: -148.445070 where: bonds (distance) C4'-P energy: -26.295 bonds (distance) P-C4' energy: -26.038 flat angles C4'-P-C4' energy: -30.643 flat angles P-C4'-P energy: -22.883 tors. eta vs tors. theta energy: -42.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -538.860961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.860961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.860961 (E_RNA) where: Base-Base interactions energy: -387.075 where: short stacking energy: -149.229 Base-Backbone interact. energy: -0.128 local terms energy: -151.657585 where: bonds (distance) C4'-P energy: -24.716 bonds (distance) P-C4' energy: -30.556 flat angles C4'-P-C4' energy: -28.790 flat angles P-C4'-P energy: -20.938 tors. eta vs tors. theta energy: -46.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -519.693720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.693720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.693720 (E_RNA) where: Base-Base interactions energy: -382.552 where: short stacking energy: -152.752 Base-Backbone interact. energy: -0.586 local terms energy: -136.555607 where: bonds (distance) C4'-P energy: -21.795 bonds (distance) P-C4' energy: -23.171 flat angles C4'-P-C4' energy: -28.724 flat angles P-C4'-P energy: -19.097 tors. eta vs tors. theta energy: -43.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -384.898079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.898079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.898079 (E_RNA) where: Base-Base interactions energy: -263.884 where: short stacking energy: -104.447 Base-Backbone interact. energy: -0.085 local terms energy: -120.928427 where: bonds (distance) C4'-P energy: -27.771 bonds (distance) P-C4' energy: -21.005 flat angles C4'-P-C4' energy: -30.498 flat angles P-C4'-P energy: -16.189 tors. eta vs tors. theta energy: -25.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -345.071071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.071071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.071071 (E_RNA) where: Base-Base interactions energy: -237.511 where: short stacking energy: -101.588 Base-Backbone interact. energy: -0.767 local terms energy: -106.793797 where: bonds (distance) C4'-P energy: -12.114 bonds (distance) P-C4' energy: -26.404 flat angles C4'-P-C4' energy: -28.353 flat angles P-C4'-P energy: -14.784 tors. eta vs tors. theta energy: -25.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -141.197964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.197964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.197964 (E_RNA) where: Base-Base interactions energy: -48.152 where: short stacking energy: -47.182 Base-Backbone interact. energy: 0.385 local terms energy: -93.431410 where: bonds (distance) C4'-P energy: -21.960 bonds (distance) P-C4' energy: -25.555 flat angles C4'-P-C4' energy: -27.525 flat angles P-C4'-P energy: -12.107 tors. eta vs tors. theta energy: -6.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -122.450183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.450183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.450183 (E_RNA) where: Base-Base interactions energy: -48.604 where: short stacking energy: -41.410 Base-Backbone interact. energy: -0.297 local terms energy: -73.548634 where: bonds (distance) C4'-P energy: -26.698 bonds (distance) P-C4' energy: -23.953 flat angles C4'-P-C4' energy: -14.886 flat angles P-C4'-P energy: -7.962 tors. eta vs tors. theta energy: -0.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -551.650403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.650403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.650403 (E_RNA) where: Base-Base interactions energy: -409.090 where: short stacking energy: -162.761 Base-Backbone interact. energy: -0.639 local terms energy: -141.921641 where: bonds (distance) C4'-P energy: -26.508 bonds (distance) P-C4' energy: -17.761 flat angles C4'-P-C4' energy: -28.626 flat angles P-C4'-P energy: -21.785 tors. eta vs tors. theta energy: -47.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -549.504961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.504961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.504961 (E_RNA) where: Base-Base interactions energy: -395.609 where: short stacking energy: -152.527 Base-Backbone interact. energy: -0.039 local terms energy: -153.856639 where: bonds (distance) C4'-P energy: -22.065 bonds (distance) P-C4' energy: -30.146 flat angles C4'-P-C4' energy: -29.527 flat angles P-C4'-P energy: -25.015 tors. eta vs tors. theta energy: -47.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -539.760858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.760858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.760858 (E_RNA) where: Base-Base interactions energy: -389.080 where: short stacking energy: -147.839 Base-Backbone interact. energy: -0.972 local terms energy: -149.709118 where: bonds (distance) C4'-P energy: -24.006 bonds (distance) P-C4' energy: -28.243 flat angles C4'-P-C4' energy: -29.436 flat angles P-C4'-P energy: -20.736 tors. eta vs tors. theta energy: -47.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -541.599390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.599390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.599390 (E_RNA) where: Base-Base interactions energy: -387.077 where: short stacking energy: -154.942 Base-Backbone interact. energy: -1.974 local terms energy: -152.547747 where: bonds (distance) C4'-P energy: -26.607 bonds (distance) P-C4' energy: -24.216 flat angles C4'-P-C4' energy: -29.229 flat angles P-C4'-P energy: -25.791 tors. eta vs tors. theta energy: -46.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -522.822141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.822141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.822141 (E_RNA) where: Base-Base interactions energy: -371.129 where: short stacking energy: -143.822 Base-Backbone interact. energy: -1.165 local terms energy: -150.528118 where: bonds (distance) C4'-P energy: -26.638 bonds (distance) P-C4' energy: -30.657 flat angles C4'-P-C4' energy: -31.305 flat angles P-C4'-P energy: -20.040 tors. eta vs tors. theta energy: -41.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -513.395315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.395315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.395315 (E_RNA) where: Base-Base interactions energy: -374.221 where: short stacking energy: -145.573 Base-Backbone interact. energy: 0.488 local terms energy: -139.661680 where: bonds (distance) C4'-P energy: -18.424 bonds (distance) P-C4' energy: -26.622 flat angles C4'-P-C4' energy: -29.808 flat angles P-C4'-P energy: -20.189 tors. eta vs tors. theta energy: -44.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -386.411397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.411397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.411397 (E_RNA) where: Base-Base interactions energy: -269.448 where: short stacking energy: -103.996 Base-Backbone interact. energy: -0.472 local terms energy: -116.490957 where: bonds (distance) C4'-P energy: -29.667 bonds (distance) P-C4' energy: -22.984 flat angles C4'-P-C4' energy: -20.280 flat angles P-C4'-P energy: -13.850 tors. eta vs tors. theta energy: -29.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -310.658714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.658714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.658714 (E_RNA) where: Base-Base interactions energy: -193.958 where: short stacking energy: -77.015 Base-Backbone interact. energy: -0.461 local terms energy: -116.240020 where: bonds (distance) C4'-P energy: -26.655 bonds (distance) P-C4' energy: -29.665 flat angles C4'-P-C4' energy: -21.856 flat angles P-C4'-P energy: -18.211 tors. eta vs tors. theta energy: -19.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -125.457445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.457445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.457445 (E_RNA) where: Base-Base interactions energy: -40.418 where: short stacking energy: -39.732 Base-Backbone interact. energy: 0.038 local terms energy: -85.077681 where: bonds (distance) C4'-P energy: -18.300 bonds (distance) P-C4' energy: -24.995 flat angles C4'-P-C4' energy: -22.458 flat angles P-C4'-P energy: -14.538 tors. eta vs tors. theta energy: -4.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -142.911447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.911447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.911447 (E_RNA) where: Base-Base interactions energy: -49.782 where: short stacking energy: -40.860 Base-Backbone interact. energy: -0.846 local terms energy: -92.283082 where: bonds (distance) C4'-P energy: -27.711 bonds (distance) P-C4' energy: -27.996 flat angles C4'-P-C4' energy: -19.134 flat angles P-C4'-P energy: -17.930 tors. eta vs tors. theta energy: 0.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -563.923560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.923560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.923560 (E_RNA) where: Base-Base interactions energy: -403.590 where: short stacking energy: -157.594 Base-Backbone interact. energy: -0.001 local terms energy: -160.332153 where: bonds (distance) C4'-P energy: -29.744 bonds (distance) P-C4' energy: -25.706 flat angles C4'-P-C4' energy: -32.094 flat angles P-C4'-P energy: -25.707 tors. eta vs tors. theta energy: -47.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -552.340161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.340161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.340161 (E_RNA) where: Base-Base interactions energy: -395.891 where: short stacking energy: -152.480 Base-Backbone interact. energy: -0.575 local terms energy: -155.873600 where: bonds (distance) C4'-P energy: -27.393 bonds (distance) P-C4' energy: -28.772 flat angles C4'-P-C4' energy: -32.467 flat angles P-C4'-P energy: -20.772 tors. eta vs tors. theta energy: -46.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -542.452031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.452031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.452031 (E_RNA) where: Base-Base interactions energy: -392.129 where: short stacking energy: -156.958 Base-Backbone interact. energy: -1.878 local terms energy: -148.444929 where: bonds (distance) C4'-P energy: -20.412 bonds (distance) P-C4' energy: -27.652 flat angles C4'-P-C4' energy: -32.031 flat angles P-C4'-P energy: -23.954 tors. eta vs tors. theta energy: -44.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -536.292192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.292192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.292192 (E_RNA) where: Base-Base interactions energy: -387.877 where: short stacking energy: -148.617 Base-Backbone interact. energy: -0.240 local terms energy: -148.175426 where: bonds (distance) C4'-P energy: -29.794 bonds (distance) P-C4' energy: -26.005 flat angles C4'-P-C4' energy: -19.244 flat angles P-C4'-P energy: -25.316 tors. eta vs tors. theta energy: -47.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -519.755484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.755484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.755484 (E_RNA) where: Base-Base interactions energy: -372.832 where: short stacking energy: -142.688 Base-Backbone interact. energy: -1.012 local terms energy: -145.911585 where: bonds (distance) C4'-P energy: -26.794 bonds (distance) P-C4' energy: -26.110 flat angles C4'-P-C4' energy: -26.870 flat angles P-C4'-P energy: -22.655 tors. eta vs tors. theta energy: -43.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -529.823106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.823106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.823106 (E_RNA) where: Base-Base interactions energy: -371.803 where: short stacking energy: -143.765 Base-Backbone interact. energy: -0.006 local terms energy: -158.013888 where: bonds (distance) C4'-P energy: -27.674 bonds (distance) P-C4' energy: -29.385 flat angles C4'-P-C4' energy: -32.140 flat angles P-C4'-P energy: -21.806 tors. eta vs tors. theta energy: -47.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -385.134963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.134963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.134963 (E_RNA) where: Base-Base interactions energy: -268.953 where: short stacking energy: -108.489 Base-Backbone interact. energy: 0.186 local terms energy: -116.368003 where: bonds (distance) C4'-P energy: -19.833 bonds (distance) P-C4' energy: -20.207 flat angles C4'-P-C4' energy: -28.334 flat angles P-C4'-P energy: -21.847 tors. eta vs tors. theta energy: -26.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -313.752116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.752116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.752116 (E_RNA) where: Base-Base interactions energy: -210.294 where: short stacking energy: -91.591 Base-Backbone interact. energy: 2.552 local terms energy: -106.010418 where: bonds (distance) C4'-P energy: -21.998 bonds (distance) P-C4' energy: -24.512 flat angles C4'-P-C4' energy: -23.927 flat angles P-C4'-P energy: -12.329 tors. eta vs tors. theta energy: -23.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -140.073756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.073756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.073756 (E_RNA) where: Base-Base interactions energy: -41.965 where: short stacking energy: -41.817 Base-Backbone interact. energy: -0.150 local terms energy: -97.958695 where: bonds (distance) C4'-P energy: -24.858 bonds (distance) P-C4' energy: -27.453 flat angles C4'-P-C4' energy: -23.019 flat angles P-C4'-P energy: -14.162 tors. eta vs tors. theta energy: -8.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -137.453413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.453413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.453413 (E_RNA) where: Base-Base interactions energy: -55.036 where: short stacking energy: -51.423 Base-Backbone interact. energy: -1.171 local terms energy: -81.246655 where: bonds (distance) C4'-P energy: -25.114 bonds (distance) P-C4' energy: -23.937 flat angles C4'-P-C4' energy: -16.043 flat angles P-C4'-P energy: -11.389 tors. eta vs tors. theta energy: -4.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -565.767668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.767668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.767668 (E_RNA) where: Base-Base interactions energy: -410.039 where: short stacking energy: -158.392 Base-Backbone interact. energy: -0.627 local terms energy: -155.101896 where: bonds (distance) C4'-P energy: -26.142 bonds (distance) P-C4' energy: -27.014 flat angles C4'-P-C4' energy: -28.836 flat angles P-C4'-P energy: -23.482 tors. eta vs tors. theta energy: -49.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -538.795365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.795365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.795365 (E_RNA) where: Base-Base interactions energy: -390.872 where: short stacking energy: -153.272 Base-Backbone interact. energy: -0.070 local terms energy: -147.853224 where: bonds (distance) C4'-P energy: -26.837 bonds (distance) P-C4' energy: -26.540 flat angles C4'-P-C4' energy: -31.025 flat angles P-C4'-P energy: -20.158 tors. eta vs tors. theta energy: -43.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -543.869810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.869810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.869810 (E_RNA) where: Base-Base interactions energy: -391.658 where: short stacking energy: -149.582 Base-Backbone interact. energy: -0.954 local terms energy: -151.258006 where: bonds (distance) C4'-P energy: -21.546 bonds (distance) P-C4' energy: -29.335 flat angles C4'-P-C4' energy: -29.739 flat angles P-C4'-P energy: -25.558 tors. eta vs tors. theta energy: -45.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -537.125139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.125139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.125139 (E_RNA) where: Base-Base interactions energy: -389.056 where: short stacking energy: -149.950 Base-Backbone interact. energy: -0.653 local terms energy: -147.416087 where: bonds (distance) C4'-P energy: -28.901 bonds (distance) P-C4' energy: -25.554 flat angles C4'-P-C4' energy: -30.488 flat angles P-C4'-P energy: -20.119 tors. eta vs tors. theta energy: -42.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -536.631084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.631084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.631084 (E_RNA) where: Base-Base interactions energy: -385.646 where: short stacking energy: -150.954 Base-Backbone interact. energy: -0.958 local terms energy: -150.027488 where: bonds (distance) C4'-P energy: -23.926 bonds (distance) P-C4' energy: -26.432 flat angles C4'-P-C4' energy: -32.829 flat angles P-C4'-P energy: -19.698 tors. eta vs tors. theta energy: -47.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -514.974494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.974494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.974494 (E_RNA) where: Base-Base interactions energy: -375.579 where: short stacking energy: -147.486 Base-Backbone interact. energy: 0.473 local terms energy: -139.869088 where: bonds (distance) C4'-P energy: -25.405 bonds (distance) P-C4' energy: -24.635 flat angles C4'-P-C4' energy: -26.396 flat angles P-C4'-P energy: -22.229 tors. eta vs tors. theta energy: -41.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -374.108285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.108285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.108285 (E_RNA) where: Base-Base interactions energy: -252.138 where: short stacking energy: -104.263 Base-Backbone interact. energy: -0.953 local terms energy: -121.016782 where: bonds (distance) C4'-P energy: -28.911 bonds (distance) P-C4' energy: -20.905 flat angles C4'-P-C4' energy: -26.679 flat angles P-C4'-P energy: -16.719 tors. eta vs tors. theta energy: -27.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -317.964697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.964697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.964697 (E_RNA) where: Base-Base interactions energy: -210.103 where: short stacking energy: -86.973 Base-Backbone interact. energy: -0.238 local terms energy: -107.623915 where: bonds (distance) C4'-P energy: -27.300 bonds (distance) P-C4' energy: -21.521 flat angles C4'-P-C4' energy: -19.583 flat angles P-C4'-P energy: -14.241 tors. eta vs tors. theta energy: -24.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -139.852331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.852331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.852331 (E_RNA) where: Base-Base interactions energy: -51.316 where: short stacking energy: -51.316 Base-Backbone interact. energy: -0.061 local terms energy: -88.475853 where: bonds (distance) C4'-P energy: -17.369 bonds (distance) P-C4' energy: -19.200 flat angles C4'-P-C4' energy: -27.851 flat angles P-C4'-P energy: -17.319 tors. eta vs tors. theta energy: -6.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -137.701231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.701231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.701231 (E_RNA) where: Base-Base interactions energy: -64.772 where: short stacking energy: -29.067 Base-Backbone interact. energy: 1.805 local terms energy: -74.734967 where: bonds (distance) C4'-P energy: -24.853 bonds (distance) P-C4' energy: -21.204 flat angles C4'-P-C4' energy: -22.376 flat angles P-C4'-P energy: -4.607 tors. eta vs tors. theta energy: -1.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -555.927591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.927591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.927591 (E_RNA) where: Base-Base interactions energy: -400.419 where: short stacking energy: -157.261 Base-Backbone interact. energy: -0.124 local terms energy: -155.384502 where: bonds (distance) C4'-P energy: -26.085 bonds (distance) P-C4' energy: -27.006 flat angles C4'-P-C4' energy: -30.535 flat angles P-C4'-P energy: -23.189 tors. eta vs tors. theta energy: -48.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -551.737438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.737438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.737438 (E_RNA) where: Base-Base interactions energy: -397.096 where: short stacking energy: -155.469 Base-Backbone interact. energy: -0.190 local terms energy: -154.451448 where: bonds (distance) C4'-P energy: -25.104 bonds (distance) P-C4' energy: -26.154 flat angles C4'-P-C4' energy: -29.565 flat angles P-C4'-P energy: -26.063 tors. eta vs tors. theta energy: -47.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -542.213145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.213145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.213145 (E_RNA) where: Base-Base interactions energy: -394.093 where: short stacking energy: -153.053 Base-Backbone interact. energy: -1.189 local terms energy: -146.930904 where: bonds (distance) C4'-P energy: -28.308 bonds (distance) P-C4' energy: -25.527 flat angles C4'-P-C4' energy: -26.155 flat angles P-C4'-P energy: -21.489 tors. eta vs tors. theta energy: -45.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -531.253771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.253771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.253771 (E_RNA) where: Base-Base interactions energy: -386.304 where: short stacking energy: -145.248 Base-Backbone interact. energy: -0.115 local terms energy: -144.833941 where: bonds (distance) C4'-P energy: -27.917 bonds (distance) P-C4' energy: -25.079 flat angles C4'-P-C4' energy: -30.381 flat angles P-C4'-P energy: -17.283 tors. eta vs tors. theta energy: -44.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -523.187019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.187019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.187019 (E_RNA) where: Base-Base interactions energy: -383.490 where: short stacking energy: -143.011 Base-Backbone interact. energy: -1.995 local terms energy: -137.701227 where: bonds (distance) C4'-P energy: -24.684 bonds (distance) P-C4' energy: -18.496 flat angles C4'-P-C4' energy: -28.058 flat angles P-C4'-P energy: -21.153 tors. eta vs tors. theta energy: -45.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -514.487775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.487775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.487775 (E_RNA) where: Base-Base interactions energy: -376.819 where: short stacking energy: -143.609 Base-Backbone interact. energy: -0.055 local terms energy: -137.613822 where: bonds (distance) C4'-P energy: -21.151 bonds (distance) P-C4' energy: -22.337 flat angles C4'-P-C4' energy: -31.693 flat angles P-C4'-P energy: -19.393 tors. eta vs tors. theta energy: -43.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -383.452553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.452553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.452553 (E_RNA) where: Base-Base interactions energy: -261.038 where: short stacking energy: -103.472 Base-Backbone interact. energy: -0.867 local terms energy: -121.547101 where: bonds (distance) C4'-P energy: -25.174 bonds (distance) P-C4' energy: -25.495 flat angles C4'-P-C4' energy: -26.340 flat angles P-C4'-P energy: -18.868 tors. eta vs tors. theta energy: -25.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -284.794183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.794183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.794183 (E_RNA) where: Base-Base interactions energy: -175.704 where: short stacking energy: -71.209 Base-Backbone interact. energy: -0.527 local terms energy: -108.562476 where: bonds (distance) C4'-P energy: -21.716 bonds (distance) P-C4' energy: -29.567 flat angles C4'-P-C4' energy: -26.170 flat angles P-C4'-P energy: -11.986 tors. eta vs tors. theta energy: -19.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -130.472157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.472157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.472157 (E_RNA) where: Base-Base interactions energy: -42.826 where: short stacking energy: -38.037 Base-Backbone interact. energy: 1.238 local terms energy: -88.883857 where: bonds (distance) C4'-P energy: -21.863 bonds (distance) P-C4' energy: -29.156 flat angles C4'-P-C4' energy: -23.221 flat angles P-C4'-P energy: -10.717 tors. eta vs tors. theta energy: -3.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -131.257820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.257820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.257820 (E_RNA) where: Base-Base interactions energy: -42.730 where: short stacking energy: -41.250 Base-Backbone interact. energy: -0.987 local terms energy: -87.540392 where: bonds (distance) C4'-P energy: -24.811 bonds (distance) P-C4' energy: -22.323 flat angles C4'-P-C4' energy: -23.306 flat angles P-C4'-P energy: -10.465 tors. eta vs tors. theta energy: -6.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -553.391629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.391629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.391629 (E_RNA) where: Base-Base interactions energy: -399.057 where: short stacking energy: -155.722 Base-Backbone interact. energy: -1.361 local terms energy: -152.973610 where: bonds (distance) C4'-P energy: -27.942 bonds (distance) P-C4' energy: -22.407 flat angles C4'-P-C4' energy: -34.096 flat angles P-C4'-P energy: -22.490 tors. eta vs tors. theta energy: -46.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -546.345800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.345800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.345800 (E_RNA) where: Base-Base interactions energy: -391.469 where: short stacking energy: -155.313 Base-Backbone interact. energy: -0.579 local terms energy: -154.297157 where: bonds (distance) C4'-P energy: -26.708 bonds (distance) P-C4' energy: -28.056 flat angles C4'-P-C4' energy: -30.319 flat angles P-C4'-P energy: -22.139 tors. eta vs tors. theta energy: -47.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -551.014282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.014282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.014282 (E_RNA) where: Base-Base interactions energy: -393.582 where: short stacking energy: -155.833 Base-Backbone interact. energy: -0.292 local terms energy: -157.141073 where: bonds (distance) C4'-P energy: -24.579 bonds (distance) P-C4' energy: -26.768 flat angles C4'-P-C4' energy: -31.602 flat angles P-C4'-P energy: -25.910 tors. eta vs tors. theta energy: -48.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -541.780973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.780973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.780973 (E_RNA) where: Base-Base interactions energy: -394.163 where: short stacking energy: -152.196 Base-Backbone interact. energy: -0.151 local terms energy: -147.467041 where: bonds (distance) C4'-P energy: -20.648 bonds (distance) P-C4' energy: -26.781 flat angles C4'-P-C4' energy: -28.641 flat angles P-C4'-P energy: -24.708 tors. eta vs tors. theta energy: -46.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -513.638532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.638532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.638532 (E_RNA) where: Base-Base interactions energy: -380.221 where: short stacking energy: -148.058 Base-Backbone interact. energy: -0.337 local terms energy: -133.080796 where: bonds (distance) C4'-P energy: -23.125 bonds (distance) P-C4' energy: -19.125 flat angles C4'-P-C4' energy: -32.429 flat angles P-C4'-P energy: -18.084 tors. eta vs tors. theta energy: -40.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -530.634050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.634050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.634050 (E_RNA) where: Base-Base interactions energy: -386.125 where: short stacking energy: -151.032 Base-Backbone interact. energy: 1.012 local terms energy: -145.521389 where: bonds (distance) C4'-P energy: -26.471 bonds (distance) P-C4' energy: -23.258 flat angles C4'-P-C4' energy: -30.053 flat angles P-C4'-P energy: -23.191 tors. eta vs tors. theta energy: -42.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -388.706792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.706792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.706792 (E_RNA) where: Base-Base interactions energy: -268.327 where: short stacking energy: -116.468 Base-Backbone interact. energy: -0.499 local terms energy: -119.880269 where: bonds (distance) C4'-P energy: -20.839 bonds (distance) P-C4' energy: -25.491 flat angles C4'-P-C4' energy: -27.797 flat angles P-C4'-P energy: -16.252 tors. eta vs tors. theta energy: -29.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -268.056339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.056339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.056339 (E_RNA) where: Base-Base interactions energy: -171.354 where: short stacking energy: -68.620 Base-Backbone interact. energy: -0.432 local terms energy: -96.270890 where: bonds (distance) C4'-P energy: -18.784 bonds (distance) P-C4' energy: -25.258 flat angles C4'-P-C4' energy: -21.137 flat angles P-C4'-P energy: -15.430 tors. eta vs tors. theta energy: -15.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -127.541926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.541926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.541926 (E_RNA) where: Base-Base interactions energy: -51.892 where: short stacking energy: -46.000 Base-Backbone interact. energy: 1.606 local terms energy: -77.256257 where: bonds (distance) C4'-P energy: -19.922 bonds (distance) P-C4' energy: -25.479 flat angles C4'-P-C4' energy: -15.383 flat angles P-C4'-P energy: -18.103 tors. eta vs tors. theta energy: 1.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -122.485625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.485625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.485625 (E_RNA) where: Base-Base interactions energy: -32.183 where: short stacking energy: -32.183 Base-Backbone interact. energy: 1.655 local terms energy: -91.957536 where: bonds (distance) C4'-P energy: -21.940 bonds (distance) P-C4' energy: -24.754 flat angles C4'-P-C4' energy: -25.016 flat angles P-C4'-P energy: -16.917 tors. eta vs tors. theta energy: -3.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -558.246602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.246602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.246602 (E_RNA) where: Base-Base interactions energy: -396.656 where: short stacking energy: -157.359 Base-Backbone interact. energy: -0.211 local terms energy: -161.378944 where: bonds (distance) C4'-P energy: -26.678 bonds (distance) P-C4' energy: -31.991 flat angles C4'-P-C4' energy: -32.112 flat angles P-C4'-P energy: -21.807 tors. eta vs tors. theta energy: -48.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -550.849462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.849462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.849462 (E_RNA) where: Base-Base interactions energy: -394.170 where: short stacking energy: -150.958 Base-Backbone interact. energy: -1.762 local terms energy: -154.917064 where: bonds (distance) C4'-P energy: -28.779 bonds (distance) P-C4' energy: -25.437 flat angles C4'-P-C4' energy: -31.343 flat angles P-C4'-P energy: -23.346 tors. eta vs tors. theta energy: -46.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -547.459936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.459936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.459936 (E_RNA) where: Base-Base interactions energy: -388.982 where: short stacking energy: -155.749 Base-Backbone interact. energy: -0.773 local terms energy: -157.704181 where: bonds (distance) C4'-P energy: -30.294 bonds (distance) P-C4' energy: -28.376 flat angles C4'-P-C4' energy: -29.572 flat angles P-C4'-P energy: -23.967 tors. eta vs tors. theta energy: -45.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -539.622173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.622173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.622173 (E_RNA) where: Base-Base interactions energy: -386.963 where: short stacking energy: -149.992 Base-Backbone interact. energy: -0.792 local terms energy: -151.866879 where: bonds (distance) C4'-P energy: -28.680 bonds (distance) P-C4' energy: -25.142 flat angles C4'-P-C4' energy: -33.046 flat angles P-C4'-P energy: -21.266 tors. eta vs tors. theta energy: -43.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -531.441936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.441936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.441936 (E_RNA) where: Base-Base interactions energy: -386.387 where: short stacking energy: -152.004 Base-Backbone interact. energy: -0.730 local terms energy: -144.324949 where: bonds (distance) C4'-P energy: -25.979 bonds (distance) P-C4' energy: -28.178 flat angles C4'-P-C4' energy: -26.168 flat angles P-C4'-P energy: -18.153 tors. eta vs tors. theta energy: -45.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -517.441859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.441859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.441859 (E_RNA) where: Base-Base interactions energy: -386.728 where: short stacking energy: -144.533 Base-Backbone interact. energy: -1.009 local terms energy: -129.704572 where: bonds (distance) C4'-P energy: -14.945 bonds (distance) P-C4' energy: -26.282 flat angles C4'-P-C4' energy: -25.302 flat angles P-C4'-P energy: -17.511 tors. eta vs tors. theta energy: -45.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -405.598747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.598747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.598747 (E_RNA) where: Base-Base interactions energy: -278.947 where: short stacking energy: -112.543 Base-Backbone interact. energy: -0.735 local terms energy: -125.916927 where: bonds (distance) C4'-P energy: -22.911 bonds (distance) P-C4' energy: -26.163 flat angles C4'-P-C4' energy: -26.532 flat angles P-C4'-P energy: -19.139 tors. eta vs tors. theta energy: -31.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -302.772401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.772401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.772401 (E_RNA) where: Base-Base interactions energy: -201.315 where: short stacking energy: -81.103 Base-Backbone interact. energy: -0.173 local terms energy: -101.284568 where: bonds (distance) C4'-P energy: -16.194 bonds (distance) P-C4' energy: -24.729 flat angles C4'-P-C4' energy: -20.257 flat angles P-C4'-P energy: -15.598 tors. eta vs tors. theta energy: -24.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -160.344875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.344875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.344875 (E_RNA) where: Base-Base interactions energy: -73.153 where: short stacking energy: -59.973 Base-Backbone interact. energy: -0.381 local terms energy: -86.810589 where: bonds (distance) C4'-P energy: -18.351 bonds (distance) P-C4' energy: -27.033 flat angles C4'-P-C4' energy: -19.620 flat angles P-C4'-P energy: -14.336 tors. eta vs tors. theta energy: -7.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -123.396908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.396908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.396908 (E_RNA) where: Base-Base interactions energy: -49.749 where: short stacking energy: -40.670 Base-Backbone interact. energy: 0.032 local terms energy: -73.680041 where: bonds (distance) C4'-P energy: -13.091 bonds (distance) P-C4' energy: -21.449 flat angles C4'-P-C4' energy: -21.749 flat angles P-C4'-P energy: -18.551 tors. eta vs tors. theta energy: 1.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -551.261803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.261803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.261803 (E_RNA) where: Base-Base interactions energy: -392.558 where: short stacking energy: -153.166 Base-Backbone interact. energy: -1.571 local terms energy: -157.132205 where: bonds (distance) C4'-P energy: -29.491 bonds (distance) P-C4' energy: -29.048 flat angles C4'-P-C4' energy: -26.588 flat angles P-C4'-P energy: -23.955 tors. eta vs tors. theta energy: -48.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -546.424020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.424020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.424020 (E_RNA) where: Base-Base interactions energy: -395.571 where: short stacking energy: -149.319 Base-Backbone interact. energy: -0.005 local terms energy: -150.848203 where: bonds (distance) C4'-P energy: -26.165 bonds (distance) P-C4' energy: -27.838 flat angles C4'-P-C4' energy: -31.506 flat angles P-C4'-P energy: -17.999 tors. eta vs tors. theta energy: -47.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -545.265066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.265066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.265066 (E_RNA) where: Base-Base interactions energy: -394.923 where: short stacking energy: -153.138 Base-Backbone interact. energy: -0.184 local terms energy: -150.157552 where: bonds (distance) C4'-P energy: -21.379 bonds (distance) P-C4' energy: -29.659 flat angles C4'-P-C4' energy: -30.450 flat angles P-C4'-P energy: -23.376 tors. eta vs tors. theta energy: -45.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -528.795788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.795788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.795788 (E_RNA) where: Base-Base interactions energy: -385.951 where: short stacking energy: -148.513 Base-Backbone interact. energy: -2.114 local terms energy: -140.730747 where: bonds (distance) C4'-P energy: -23.170 bonds (distance) P-C4' energy: -24.402 flat angles C4'-P-C4' energy: -28.456 flat angles P-C4'-P energy: -21.893 tors. eta vs tors. theta energy: -42.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -523.542652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.542652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.542652 (E_RNA) where: Base-Base interactions energy: -370.000 where: short stacking energy: -140.030 Base-Backbone interact. energy: -1.238 local terms energy: -152.304964 where: bonds (distance) C4'-P energy: -27.480 bonds (distance) P-C4' energy: -27.298 flat angles C4'-P-C4' energy: -30.054 flat angles P-C4'-P energy: -22.376 tors. eta vs tors. theta energy: -45.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -519.254139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.254139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.254139 (E_RNA) where: Base-Base interactions energy: -377.999 where: short stacking energy: -148.749 Base-Backbone interact. energy: -0.292 local terms energy: -140.962587 where: bonds (distance) C4'-P energy: -20.665 bonds (distance) P-C4' energy: -26.515 flat angles C4'-P-C4' energy: -29.577 flat angles P-C4'-P energy: -18.582 tors. eta vs tors. theta energy: -45.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -428.030210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.030210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.030210 (E_RNA) where: Base-Base interactions energy: -299.661 where: short stacking energy: -129.080 Base-Backbone interact. energy: -0.101 local terms energy: -128.268117 where: bonds (distance) C4'-P energy: -26.704 bonds (distance) P-C4' energy: -24.388 flat angles C4'-P-C4' energy: -21.375 flat angles P-C4'-P energy: -16.945 tors. eta vs tors. theta energy: -38.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -312.077287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.077287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.077287 (E_RNA) where: Base-Base interactions energy: -202.789 where: short stacking energy: -94.480 Base-Backbone interact. energy: -0.224 local terms energy: -109.064582 where: bonds (distance) C4'-P energy: -24.531 bonds (distance) P-C4' energy: -19.307 flat angles C4'-P-C4' energy: -23.518 flat angles P-C4'-P energy: -15.061 tors. eta vs tors. theta energy: -26.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -147.561177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.561177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.561177 (E_RNA) where: Base-Base interactions energy: -60.705 where: short stacking energy: -56.148 Base-Backbone interact. energy: -0.305 local terms energy: -86.551333 where: bonds (distance) C4'-P energy: -22.432 bonds (distance) P-C4' energy: -29.233 flat angles C4'-P-C4' energy: -16.180 flat angles P-C4'-P energy: -9.324 tors. eta vs tors. theta energy: -9.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -120.612893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.612893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.612893 (E_RNA) where: Base-Base interactions energy: -42.112 where: short stacking energy: -33.151 Base-Backbone interact. energy: -0.051 local terms energy: -78.449548 where: bonds (distance) C4'-P energy: -23.161 bonds (distance) P-C4' energy: -30.759 flat angles C4'-P-C4' energy: -16.628 flat angles P-C4'-P energy: -15.237 tors. eta vs tors. theta energy: 7.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -556.692825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.692825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.692825 (E_RNA) where: Base-Base interactions energy: -400.359 where: short stacking energy: -159.499 Base-Backbone interact. energy: -1.023 local terms energy: -155.311033 where: bonds (distance) C4'-P energy: -27.369 bonds (distance) P-C4' energy: -29.729 flat angles C4'-P-C4' energy: -30.686 flat angles P-C4'-P energy: -20.890 tors. eta vs tors. theta energy: -46.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -551.328968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.328968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.328968 (E_RNA) where: Base-Base interactions energy: -395.573 where: short stacking energy: -152.089 Base-Backbone interact. energy: -1.143 local terms energy: -154.613418 where: bonds (distance) C4'-P energy: -23.935 bonds (distance) P-C4' energy: -27.708 flat angles C4'-P-C4' energy: -31.945 flat angles P-C4'-P energy: -24.478 tors. eta vs tors. theta energy: -46.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -543.186488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.186488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.186488 (E_RNA) where: Base-Base interactions energy: -406.771 where: short stacking energy: -161.766 Base-Backbone interact. energy: -1.361 local terms energy: -135.054361 where: bonds (distance) C4'-P energy: -25.958 bonds (distance) P-C4' energy: -13.579 flat angles C4'-P-C4' energy: -28.223 flat angles P-C4'-P energy: -18.564 tors. eta vs tors. theta energy: -48.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -529.424216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.424216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.424216 (E_RNA) where: Base-Base interactions energy: -385.062 where: short stacking energy: -150.000 Base-Backbone interact. energy: -1.071 local terms energy: -143.290431 where: bonds (distance) C4'-P energy: -24.567 bonds (distance) P-C4' energy: -22.094 flat angles C4'-P-C4' energy: -31.473 flat angles P-C4'-P energy: -20.215 tors. eta vs tors. theta energy: -44.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -528.010131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.010131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.010131 (E_RNA) where: Base-Base interactions energy: -389.950 where: short stacking energy: -150.947 Base-Backbone interact. energy: -0.412 local terms energy: -137.648980 where: bonds (distance) C4'-P energy: -25.376 bonds (distance) P-C4' energy: -22.610 flat angles C4'-P-C4' energy: -29.398 flat angles P-C4'-P energy: -18.341 tors. eta vs tors. theta energy: -41.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -525.364443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.364443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.364443 (E_RNA) where: Base-Base interactions energy: -386.021 where: short stacking energy: -152.198 Base-Backbone interact. energy: -0.344 local terms energy: -138.999369 where: bonds (distance) C4'-P energy: -17.502 bonds (distance) P-C4' energy: -28.719 flat angles C4'-P-C4' energy: -29.233 flat angles P-C4'-P energy: -19.836 tors. eta vs tors. theta energy: -43.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -450.569022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.569022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.569022 (E_RNA) where: Base-Base interactions energy: -325.018 where: short stacking energy: -125.985 Base-Backbone interact. energy: -0.009 local terms energy: -125.541900 where: bonds (distance) C4'-P energy: -19.011 bonds (distance) P-C4' energy: -28.876 flat angles C4'-P-C4' energy: -26.177 flat angles P-C4'-P energy: -14.564 tors. eta vs tors. theta energy: -36.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -306.468902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.468902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.468902 (E_RNA) where: Base-Base interactions energy: -209.544 where: short stacking energy: -94.321 Base-Backbone interact. energy: -1.200 local terms energy: -95.725424 where: bonds (distance) C4'-P energy: -16.616 bonds (distance) P-C4' energy: -20.653 flat angles C4'-P-C4' energy: -28.651 flat angles P-C4'-P energy: -14.553 tors. eta vs tors. theta energy: -15.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -144.220440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.220440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.220440 (E_RNA) where: Base-Base interactions energy: -52.326 where: short stacking energy: -50.758 Base-Backbone interact. energy: -1.306 local terms energy: -90.588358 where: bonds (distance) C4'-P energy: -19.229 bonds (distance) P-C4' energy: -24.510 flat angles C4'-P-C4' energy: -22.028 flat angles P-C4'-P energy: -14.992 tors. eta vs tors. theta energy: -9.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -140.197903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.197903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.197903 (E_RNA) where: Base-Base interactions energy: -63.258 where: short stacking energy: -43.261 Base-Backbone interact. energy: 0.455 local terms energy: -77.395598 where: bonds (distance) C4'-P energy: -11.261 bonds (distance) P-C4' energy: -26.201 flat angles C4'-P-C4' energy: -21.588 flat angles P-C4'-P energy: -16.538 tors. eta vs tors. theta energy: -1.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -557.186229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.186229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.186229 (E_RNA) where: Base-Base interactions energy: -404.513 where: short stacking energy: -160.724 Base-Backbone interact. energy: -0.253 local terms energy: -152.419808 where: bonds (distance) C4'-P energy: -24.534 bonds (distance) P-C4' energy: -29.047 flat angles C4'-P-C4' energy: -30.713 flat angles P-C4'-P energy: -20.261 tors. eta vs tors. theta energy: -47.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -549.709730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.709730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.709730 (E_RNA) where: Base-Base interactions energy: -401.537 where: short stacking energy: -158.315 Base-Backbone interact. energy: -0.332 local terms energy: -147.841099 where: bonds (distance) C4'-P energy: -21.622 bonds (distance) P-C4' energy: -29.533 flat angles C4'-P-C4' energy: -28.175 flat angles P-C4'-P energy: -23.148 tors. eta vs tors. theta energy: -45.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -544.569696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.569696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.569696 (E_RNA) where: Base-Base interactions energy: -392.717 where: short stacking energy: -156.612 Base-Backbone interact. energy: -0.551 local terms energy: -151.302093 where: bonds (distance) C4'-P energy: -23.803 bonds (distance) P-C4' energy: -27.493 flat angles C4'-P-C4' energy: -28.307 flat angles P-C4'-P energy: -24.363 tors. eta vs tors. theta energy: -47.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -532.979068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.979068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.979068 (E_RNA) where: Base-Base interactions energy: -378.924 where: short stacking energy: -146.966 Base-Backbone interact. energy: -0.421 local terms energy: -153.633841 where: bonds (distance) C4'-P energy: -24.100 bonds (distance) P-C4' energy: -30.270 flat angles C4'-P-C4' energy: -31.173 flat angles P-C4'-P energy: -22.814 tors. eta vs tors. theta energy: -45.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -523.580699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.580699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.580699 (E_RNA) where: Base-Base interactions energy: -380.631 where: short stacking energy: -149.254 Base-Backbone interact. energy: -0.178 local terms energy: -142.770954 where: bonds (distance) C4'-P energy: -22.290 bonds (distance) P-C4' energy: -30.535 flat angles C4'-P-C4' energy: -26.743 flat angles P-C4'-P energy: -20.295 tors. eta vs tors. theta energy: -42.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -521.801025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.801025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.801025 (E_RNA) where: Base-Base interactions energy: -366.851 where: short stacking energy: -143.924 Base-Backbone interact. energy: -0.043 local terms energy: -154.906532 where: bonds (distance) C4'-P energy: -27.828 bonds (distance) P-C4' energy: -29.204 flat angles C4'-P-C4' energy: -32.392 flat angles P-C4'-P energy: -21.964 tors. eta vs tors. theta energy: -43.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -486.844088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.844088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.844088 (E_RNA) where: Base-Base interactions energy: -334.694 where: short stacking energy: -129.968 Base-Backbone interact. energy: -0.460 local terms energy: -151.689716 where: bonds (distance) C4'-P energy: -29.356 bonds (distance) P-C4' energy: -30.571 flat angles C4'-P-C4' energy: -24.978 flat angles P-C4'-P energy: -25.195 tors. eta vs tors. theta energy: -41.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -308.858713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.858713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.858713 (E_RNA) where: Base-Base interactions energy: -203.169 where: short stacking energy: -85.379 Base-Backbone interact. energy: -0.116 local terms energy: -105.574393 where: bonds (distance) C4'-P energy: -28.647 bonds (distance) P-C4' energy: -15.675 flat angles C4'-P-C4' energy: -22.873 flat angles P-C4'-P energy: -13.300 tors. eta vs tors. theta energy: -25.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -139.246144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.246144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.246144 (E_RNA) where: Base-Base interactions energy: -47.656 where: short stacking energy: -44.730 Base-Backbone interact. energy: -1.011 local terms energy: -90.578855 where: bonds (distance) C4'-P energy: -24.148 bonds (distance) P-C4' energy: -29.833 flat angles C4'-P-C4' energy: -17.419 flat angles P-C4'-P energy: -16.832 tors. eta vs tors. theta energy: -2.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -134.241431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.241431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.241431 (E_RNA) where: Base-Base interactions energy: -55.117 where: short stacking energy: -47.257 Base-Backbone interact. energy: 0.905 local terms energy: -80.029587 where: bonds (distance) C4'-P energy: -19.437 bonds (distance) P-C4' energy: -18.461 flat angles C4'-P-C4' energy: -24.182 flat angles P-C4'-P energy: -11.004 tors. eta vs tors. theta energy: -6.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -552.184147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.184147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.184147 (E_RNA) where: Base-Base interactions energy: -387.643 where: short stacking energy: -155.834 Base-Backbone interact. energy: -0.024 local terms energy: -164.516612 where: bonds (distance) C4'-P energy: -26.325 bonds (distance) P-C4' energy: -30.717 flat angles C4'-P-C4' energy: -34.494 flat angles P-C4'-P energy: -23.345 tors. eta vs tors. theta energy: -49.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -550.848417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.848417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.848417 (E_RNA) where: Base-Base interactions energy: -398.723 where: short stacking energy: -156.546 Base-Backbone interact. energy: -1.189 local terms energy: -150.936781 where: bonds (distance) C4'-P energy: -22.713 bonds (distance) P-C4' energy: -24.233 flat angles C4'-P-C4' energy: -28.171 flat angles P-C4'-P energy: -28.012 tors. eta vs tors. theta energy: -47.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -538.251437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.251437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.251437 (E_RNA) where: Base-Base interactions energy: -379.804 where: short stacking energy: -145.132 Base-Backbone interact. energy: -0.004 local terms energy: -158.442958 where: bonds (distance) C4'-P energy: -25.500 bonds (distance) P-C4' energy: -31.362 flat angles C4'-P-C4' energy: -33.387 flat angles P-C4'-P energy: -22.007 tors. eta vs tors. theta energy: -46.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -531.689549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.689549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.689549 (E_RNA) where: Base-Base interactions energy: -382.806 where: short stacking energy: -150.287 Base-Backbone interact. energy: -0.570 local terms energy: -148.313438 where: bonds (distance) C4'-P energy: -16.906 bonds (distance) P-C4' energy: -31.238 flat angles C4'-P-C4' energy: -30.777 flat angles P-C4'-P energy: -23.085 tors. eta vs tors. theta energy: -46.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -532.038293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.038293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.038293 (E_RNA) where: Base-Base interactions energy: -388.490 where: short stacking energy: -154.713 Base-Backbone interact. energy: -1.710 local terms energy: -141.838695 where: bonds (distance) C4'-P energy: -19.696 bonds (distance) P-C4' energy: -22.706 flat angles C4'-P-C4' energy: -31.141 flat angles P-C4'-P energy: -23.228 tors. eta vs tors. theta energy: -45.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -530.033307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.033307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.033307 (E_RNA) where: Base-Base interactions energy: -386.947 where: short stacking energy: -147.542 Base-Backbone interact. energy: -0.885 local terms energy: -142.201414 where: bonds (distance) C4'-P energy: -22.570 bonds (distance) P-C4' energy: -27.341 flat angles C4'-P-C4' energy: -26.850 flat angles P-C4'-P energy: -19.588 tors. eta vs tors. theta energy: -45.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -500.914682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.914682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.914682 (E_RNA) where: Base-Base interactions energy: -360.560 where: short stacking energy: -137.601 Base-Backbone interact. energy: -0.004 local terms energy: -140.350218 where: bonds (distance) C4'-P energy: -22.754 bonds (distance) P-C4' energy: -25.100 flat angles C4'-P-C4' energy: -30.116 flat angles P-C4'-P energy: -20.691 tors. eta vs tors. theta energy: -41.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -334.012103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.012103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.012103 (E_RNA) where: Base-Base interactions energy: -221.031 where: short stacking energy: -99.345 Base-Backbone interact. energy: -1.516 local terms energy: -111.464940 where: bonds (distance) C4'-P energy: -25.464 bonds (distance) P-C4' energy: -27.563 flat angles C4'-P-C4' energy: -21.062 flat angles P-C4'-P energy: -11.488 tors. eta vs tors. theta energy: -25.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -137.188207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.188207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.188207 (E_RNA) where: Base-Base interactions energy: -47.721 where: short stacking energy: -41.901 Base-Backbone interact. energy: 0.475 local terms energy: -89.941323 where: bonds (distance) C4'-P energy: -23.922 bonds (distance) P-C4' energy: -24.166 flat angles C4'-P-C4' energy: -25.094 flat angles P-C4'-P energy: -12.634 tors. eta vs tors. theta energy: -4.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -124.988905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.988905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.988905 (E_RNA) where: Base-Base interactions energy: -44.140 where: short stacking energy: -44.140 Base-Backbone interact. energy: -0.684 local terms energy: -80.164583 where: bonds (distance) C4'-P energy: -26.151 bonds (distance) P-C4' energy: -16.682 flat angles C4'-P-C4' energy: -18.848 flat angles P-C4'-P energy: -12.885 tors. eta vs tors. theta energy: -5.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -551.385639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.385639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.385639 (E_RNA) where: Base-Base interactions energy: -393.800 where: short stacking energy: -153.788 Base-Backbone interact. energy: -1.255 local terms energy: -156.330724 where: bonds (distance) C4'-P energy: -29.604 bonds (distance) P-C4' energy: -28.180 flat angles C4'-P-C4' energy: -31.207 flat angles P-C4'-P energy: -19.973 tors. eta vs tors. theta energy: -47.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -548.328118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.328118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.328118 (E_RNA) where: Base-Base interactions energy: -385.350 where: short stacking energy: -149.640 Base-Backbone interact. energy: -0.610 local terms energy: -162.368389 where: bonds (distance) C4'-P energy: -25.717 bonds (distance) P-C4' energy: -31.820 flat angles C4'-P-C4' energy: -33.397 flat angles P-C4'-P energy: -24.670 tors. eta vs tors. theta energy: -46.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -541.199884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.199884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.199884 (E_RNA) where: Base-Base interactions energy: -396.571 where: short stacking energy: -156.275 Base-Backbone interact. energy: -0.416 local terms energy: -144.213163 where: bonds (distance) C4'-P energy: -26.862 bonds (distance) P-C4' energy: -21.808 flat angles C4'-P-C4' energy: -26.093 flat angles P-C4'-P energy: -21.443 tors. eta vs tors. theta energy: -48.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -532.561538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.561538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.561538 (E_RNA) where: Base-Base interactions energy: -380.029 where: short stacking energy: -144.136 Base-Backbone interact. energy: -0.261 local terms energy: -152.271991 where: bonds (distance) C4'-P energy: -27.367 bonds (distance) P-C4' energy: -25.528 flat angles C4'-P-C4' energy: -33.240 flat angles P-C4'-P energy: -19.689 tors. eta vs tors. theta energy: -46.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -537.795456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.795456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.795456 (E_RNA) where: Base-Base interactions energy: -387.143 where: short stacking energy: -152.482 Base-Backbone interact. energy: -1.495 local terms energy: -149.157162 where: bonds (distance) C4'-P energy: -24.823 bonds (distance) P-C4' energy: -27.538 flat angles C4'-P-C4' energy: -28.268 flat angles P-C4'-P energy: -23.583 tors. eta vs tors. theta energy: -44.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -521.073385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.073385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.073385 (E_RNA) where: Base-Base interactions energy: -381.453 where: short stacking energy: -144.694 Base-Backbone interact. energy: -0.078 local terms energy: -139.542156 where: bonds (distance) C4'-P energy: -24.335 bonds (distance) P-C4' energy: -19.315 flat angles C4'-P-C4' energy: -31.704 flat angles P-C4'-P energy: -20.545 tors. eta vs tors. theta energy: -43.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -516.148388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.148388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.148388 (E_RNA) where: Base-Base interactions energy: -375.173 where: short stacking energy: -146.647 Base-Backbone interact. energy: -0.980 local terms energy: -139.994927 where: bonds (distance) C4'-P energy: -27.053 bonds (distance) P-C4' energy: -21.299 flat angles C4'-P-C4' energy: -26.435 flat angles P-C4'-P energy: -20.531 tors. eta vs tors. theta energy: -44.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -349.080632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.080632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.080632 (E_RNA) where: Base-Base interactions energy: -242.546 where: short stacking energy: -101.315 Base-Backbone interact. energy: -0.169 local terms energy: -106.365522 where: bonds (distance) C4'-P energy: -22.110 bonds (distance) P-C4' energy: -15.795 flat angles C4'-P-C4' energy: -24.566 flat angles P-C4'-P energy: -18.424 tors. eta vs tors. theta energy: -25.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -140.276701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.276701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.276701 (E_RNA) where: Base-Base interactions energy: -52.485 where: short stacking energy: -47.712 Base-Backbone interact. energy: -0.667 local terms energy: -87.125094 where: bonds (distance) C4'-P energy: -29.781 bonds (distance) P-C4' energy: -17.714 flat angles C4'-P-C4' energy: -21.868 flat angles P-C4'-P energy: -15.659 tors. eta vs tors. theta energy: -2.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -131.167751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.167751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.167751 (E_RNA) where: Base-Base interactions energy: -44.607 where: short stacking energy: -39.511 Base-Backbone interact. energy: -1.957 local terms energy: -84.603105 where: bonds (distance) C4'-P energy: -16.947 bonds (distance) P-C4' energy: -28.672 flat angles C4'-P-C4' energy: -18.750 flat angles P-C4'-P energy: -14.666 tors. eta vs tors. theta energy: -5.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -553.120004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.120004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.120004 (E_RNA) where: Base-Base interactions energy: -394.224 where: short stacking energy: -156.857 Base-Backbone interact. energy: -1.397 local terms energy: -157.499365 where: bonds (distance) C4'-P energy: -28.291 bonds (distance) P-C4' energy: -28.776 flat angles C4'-P-C4' energy: -30.180 flat angles P-C4'-P energy: -23.310 tors. eta vs tors. theta energy: -46.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -548.422494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.422494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.422494 (E_RNA) where: Base-Base interactions energy: -397.528 where: short stacking energy: -159.909 Base-Backbone interact. energy: -1.612 local terms energy: -149.282986 where: bonds (distance) C4'-P energy: -21.927 bonds (distance) P-C4' energy: -23.426 flat angles C4'-P-C4' energy: -32.700 flat angles P-C4'-P energy: -22.379 tors. eta vs tors. theta energy: -48.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -548.650754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.650754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.650754 (E_RNA) where: Base-Base interactions energy: -388.326 where: short stacking energy: -147.818 Base-Backbone interact. energy: -1.740 local terms energy: -158.584401 where: bonds (distance) C4'-P energy: -29.516 bonds (distance) P-C4' energy: -29.620 flat angles C4'-P-C4' energy: -27.809 flat angles P-C4'-P energy: -25.052 tors. eta vs tors. theta energy: -46.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -537.106696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.106696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.106696 (E_RNA) where: Base-Base interactions energy: -387.011 where: short stacking energy: -149.835 Base-Backbone interact. energy: -1.901 local terms energy: -148.194861 where: bonds (distance) C4'-P energy: -26.175 bonds (distance) P-C4' energy: -22.797 flat angles C4'-P-C4' energy: -29.429 flat angles P-C4'-P energy: -22.728 tors. eta vs tors. theta energy: -47.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -532.980674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.980674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.980674 (E_RNA) where: Base-Base interactions energy: -386.988 where: short stacking energy: -152.780 Base-Backbone interact. energy: -0.182 local terms energy: -145.810419 where: bonds (distance) C4'-P energy: -24.772 bonds (distance) P-C4' energy: -22.653 flat angles C4'-P-C4' energy: -30.885 flat angles P-C4'-P energy: -22.070 tors. eta vs tors. theta energy: -45.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -516.191423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.191423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.191423 (E_RNA) where: Base-Base interactions energy: -363.876 where: short stacking energy: -143.173 Base-Backbone interact. energy: -1.941 local terms energy: -150.374528 where: bonds (distance) C4'-P energy: -26.425 bonds (distance) P-C4' energy: -25.133 flat angles C4'-P-C4' energy: -31.408 flat angles P-C4'-P energy: -20.412 tors. eta vs tors. theta energy: -46.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -512.412682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.412682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.412682 (E_RNA) where: Base-Base interactions energy: -368.585 where: short stacking energy: -137.317 Base-Backbone interact. energy: -0.186 local terms energy: -143.641186 where: bonds (distance) C4'-P energy: -26.373 bonds (distance) P-C4' energy: -25.280 flat angles C4'-P-C4' energy: -29.590 flat angles P-C4'-P energy: -20.031 tors. eta vs tors. theta energy: -42.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -314.642297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.642297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.642297 (E_RNA) where: Base-Base interactions energy: -211.381 where: short stacking energy: -87.458 Base-Backbone interact. energy: -0.437 local terms energy: -102.823756 where: bonds (distance) C4'-P energy: -27.726 bonds (distance) P-C4' energy: -21.258 flat angles C4'-P-C4' energy: -23.655 flat angles P-C4'-P energy: -7.283 tors. eta vs tors. theta energy: -22.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -133.563226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.563226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.563226 (E_RNA) where: Base-Base interactions energy: -63.232 where: short stacking energy: -49.551 Base-Backbone interact. energy: 1.338 local terms energy: -71.669323 where: bonds (distance) C4'-P energy: -18.602 bonds (distance) P-C4' energy: -28.406 flat angles C4'-P-C4' energy: -20.558 flat angles P-C4'-P energy: -0.645 tors. eta vs tors. theta energy: -3.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -134.346115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.346115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.346115 (E_RNA) where: Base-Base interactions energy: -43.302 where: short stacking energy: -33.853 Base-Backbone interact. energy: -0.543 local terms energy: -90.501401 where: bonds (distance) C4'-P energy: -25.370 bonds (distance) P-C4' energy: -28.134 flat angles C4'-P-C4' energy: -15.639 flat angles P-C4'-P energy: -17.715 tors. eta vs tors. theta energy: -3.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -555.677545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.677545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.677545 (E_RNA) where: Base-Base interactions energy: -397.035 where: short stacking energy: -155.515 Base-Backbone interact. energy: -1.042 local terms energy: -157.600672 where: bonds (distance) C4'-P energy: -30.363 bonds (distance) P-C4' energy: -28.819 flat angles C4'-P-C4' energy: -29.447 flat angles P-C4'-P energy: -24.600 tors. eta vs tors. theta energy: -44.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -543.867131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.867131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.867131 (E_RNA) where: Base-Base interactions energy: -391.043 where: short stacking energy: -154.178 Base-Backbone interact. energy: 0.176 local terms energy: -153.000140 where: bonds (distance) C4'-P energy: -25.658 bonds (distance) P-C4' energy: -27.067 flat angles C4'-P-C4' energy: -27.310 flat angles P-C4'-P energy: -23.891 tors. eta vs tors. theta energy: -49.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -550.372717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.372717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.372717 (E_RNA) where: Base-Base interactions energy: -391.502 where: short stacking energy: -155.185 Base-Backbone interact. energy: -1.280 local terms energy: -157.590820 where: bonds (distance) C4'-P energy: -27.083 bonds (distance) P-C4' energy: -25.845 flat angles C4'-P-C4' energy: -31.127 flat angles P-C4'-P energy: -26.384 tors. eta vs tors. theta energy: -47.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -530.420646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.420646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.420646 (E_RNA) where: Base-Base interactions energy: -384.430 where: short stacking energy: -155.268 Base-Backbone interact. energy: -0.236 local terms energy: -145.754948 where: bonds (distance) C4'-P energy: -25.677 bonds (distance) P-C4' energy: -28.850 flat angles C4'-P-C4' energy: -30.010 flat angles P-C4'-P energy: -16.516 tors. eta vs tors. theta energy: -44.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -526.955352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.955352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.955352 (E_RNA) where: Base-Base interactions energy: -376.385 where: short stacking energy: -145.671 Base-Backbone interact. energy: -0.230 local terms energy: -150.340237 where: bonds (distance) C4'-P energy: -31.802 bonds (distance) P-C4' energy: -26.111 flat angles C4'-P-C4' energy: -27.388 flat angles P-C4'-P energy: -21.949 tors. eta vs tors. theta energy: -43.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -517.755533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.755533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.755533 (E_RNA) where: Base-Base interactions energy: -376.050 where: short stacking energy: -147.443 Base-Backbone interact. energy: -0.055 local terms energy: -141.649970 where: bonds (distance) C4'-P energy: -28.248 bonds (distance) P-C4' energy: -24.625 flat angles C4'-P-C4' energy: -28.413 flat angles P-C4'-P energy: -17.108 tors. eta vs tors. theta energy: -43.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -511.308090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.308090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.308090 (E_RNA) where: Base-Base interactions energy: -366.348 where: short stacking energy: -137.482 Base-Backbone interact. energy: -0.726 local terms energy: -144.233894 where: bonds (distance) C4'-P energy: -25.398 bonds (distance) P-C4' energy: -29.839 flat angles C4'-P-C4' energy: -25.479 flat angles P-C4'-P energy: -21.907 tors. eta vs tors. theta energy: -41.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -294.222165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.222165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.222165 (E_RNA) where: Base-Base interactions energy: -186.827 where: short stacking energy: -83.119 Base-Backbone interact. energy: -0.571 local terms energy: -106.825054 where: bonds (distance) C4'-P energy: -28.895 bonds (distance) P-C4' energy: -17.017 flat angles C4'-P-C4' energy: -24.235 flat angles P-C4'-P energy: -18.660 tors. eta vs tors. theta energy: -18.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -124.433547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.433547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.433547 (E_RNA) where: Base-Base interactions energy: -47.360 where: short stacking energy: -42.624 Base-Backbone interact. energy: -0.616 local terms energy: -76.457844 where: bonds (distance) C4'-P energy: -24.238 bonds (distance) P-C4' energy: -23.948 flat angles C4'-P-C4' energy: -10.836 flat angles P-C4'-P energy: -15.309 tors. eta vs tors. theta energy: -2.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -120.348670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.348670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.348670 (E_RNA) where: Base-Base interactions energy: -45.696 where: short stacking energy: -34.999 Base-Backbone interact. energy: -0.517 local terms energy: -74.136007 where: bonds (distance) C4'-P energy: -21.593 bonds (distance) P-C4' energy: -25.868 flat angles C4'-P-C4' energy: -21.236 flat angles P-C4'-P energy: -12.573 tors. eta vs tors. theta energy: 7.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -559.171981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.171981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.171981 (E_RNA) where: Base-Base interactions energy: -401.232 where: short stacking energy: -160.508 Base-Backbone interact. energy: -0.001 local terms energy: -157.939034 where: bonds (distance) C4'-P energy: -29.801 bonds (distance) P-C4' energy: -23.736 flat angles C4'-P-C4' energy: -34.708 flat angles P-C4'-P energy: -22.037 tors. eta vs tors. theta energy: -47.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -541.710977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.710977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.710977 (E_RNA) where: Base-Base interactions energy: -386.021 where: short stacking energy: -149.065 Base-Backbone interact. energy: -2.042 local terms energy: -153.647575 where: bonds (distance) C4'-P energy: -29.270 bonds (distance) P-C4' energy: -25.771 flat angles C4'-P-C4' energy: -28.636 flat angles P-C4'-P energy: -23.633 tors. eta vs tors. theta energy: -46.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -541.458778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.458778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.458778 (E_RNA) where: Base-Base interactions energy: -391.259 where: short stacking energy: -151.137 Base-Backbone interact. energy: -1.819 local terms energy: -148.381350 where: bonds (distance) C4'-P energy: -20.634 bonds (distance) P-C4' energy: -22.735 flat angles C4'-P-C4' energy: -28.802 flat angles P-C4'-P energy: -28.202 tors. eta vs tors. theta energy: -48.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -547.459781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.459781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.459781 (E_RNA) where: Base-Base interactions energy: -396.913 where: short stacking energy: -155.787 Base-Backbone interact. energy: -1.107 local terms energy: -149.440086 where: bonds (distance) C4'-P energy: -23.774 bonds (distance) P-C4' energy: -22.895 flat angles C4'-P-C4' energy: -31.124 flat angles P-C4'-P energy: -24.150 tors. eta vs tors. theta energy: -47.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -535.535915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.535915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.535915 (E_RNA) where: Base-Base interactions energy: -378.555 where: short stacking energy: -150.261 Base-Backbone interact. energy: -0.503 local terms energy: -156.477314 where: bonds (distance) C4'-P energy: -28.140 bonds (distance) P-C4' energy: -26.362 flat angles C4'-P-C4' energy: -30.343 flat angles P-C4'-P energy: -25.823 tors. eta vs tors. theta energy: -45.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -524.490740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.490740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.490740 (E_RNA) where: Base-Base interactions energy: -381.362 where: short stacking energy: -149.408 Base-Backbone interact. energy: -0.216 local terms energy: -142.913059 where: bonds (distance) C4'-P energy: -20.507 bonds (distance) P-C4' energy: -26.466 flat angles C4'-P-C4' energy: -30.768 flat angles P-C4'-P energy: -19.291 tors. eta vs tors. theta energy: -45.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -527.158650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.158650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.158650 (E_RNA) where: Base-Base interactions energy: -384.445 where: short stacking energy: -146.154 Base-Backbone interact. energy: -0.366 local terms energy: -142.347476 where: bonds (distance) C4'-P energy: -23.163 bonds (distance) P-C4' energy: -24.219 flat angles C4'-P-C4' energy: -25.664 flat angles P-C4'-P energy: -24.057 tors. eta vs tors. theta energy: -45.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -287.897016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.897016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.897016 (E_RNA) where: Base-Base interactions energy: -175.507 where: short stacking energy: -82.612 Base-Backbone interact. energy: -0.314 local terms energy: -112.075930 where: bonds (distance) C4'-P energy: -19.232 bonds (distance) P-C4' energy: -28.206 flat angles C4'-P-C4' energy: -26.452 flat angles P-C4'-P energy: -19.157 tors. eta vs tors. theta energy: -19.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -141.037811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.037811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.037811 (E_RNA) where: Base-Base interactions energy: -44.213 where: short stacking energy: -43.464 Base-Backbone interact. energy: 0.877 local terms energy: -97.701989 where: bonds (distance) C4'-P energy: -19.005 bonds (distance) P-C4' energy: -26.263 flat angles C4'-P-C4' energy: -32.180 flat angles P-C4'-P energy: -14.224 tors. eta vs tors. theta energy: -6.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -135.730351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.730351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.730351 (E_RNA) where: Base-Base interactions energy: -56.675 where: short stacking energy: -36.741 Base-Backbone interact. energy: 0.093 local terms energy: -79.148134 where: bonds (distance) C4'-P energy: -23.617 bonds (distance) P-C4' energy: -23.079 flat angles C4'-P-C4' energy: -17.139 flat angles P-C4'-P energy: -11.723 tors. eta vs tors. theta energy: -3.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 10 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 3675041 moves confirmed later: 4035542 all moves confirmed: 7710583 percent of confirmed moves: 4.819114 current total energy: -531.451242 recalc. total energy: -531.451242 replica 5 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 6231445 moves confirmed later: 7317086 all moves confirmed: 13548531 percent of confirmed moves: 8.467832 current total energy: -502.325205 recalc. total energy: -502.325205 replica 9 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 3354870 moves confirmed later: 3618912 all moves confirmed: 6973782 percent of confirmed moves: 4.358614 current total energy: -518.851403 recalc. total energy: -518.851403 replica 6 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 3279609 moves confirmed later: 3519531 all moves confirmed: 6799140 percent of confirmed moves: 4.249462 current total energy: -464.898466 recalc. total energy: -464.898466 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 6253531 moves confirmed later: 7332228 all moves confirmed: 13585759 percent of confirmed moves: 8.491099 current total energy: -508.850785 recalc. total energy: -508.850785 replica 2 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 6665760 moves confirmed later: 7897080 all moves confirmed: 14562840 percent of confirmed moves: 9.101775 current total energy: -480.088600 recalc. total energy: -480.088600 replica 7 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 7049422 moves confirmed later: 8402742 all moves confirmed: 15452164 percent of confirmed moves: 9.657602 current total energy: -460.364338 recalc. total energy: -460.364338 replica 1 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 4795168 moves confirmed later: 5462769 all moves confirmed: 10257937 percent of confirmed moves: 6.411211 current total energy: -184.358801 recalc. total energy: -184.358801 replica 4 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 6987651 moves confirmed later: 8277967 all moves confirmed: 15265618 percent of confirmed moves: 9.541011 current total energy: -85.361035 recalc. total energy: -85.361035 replica 8 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 9821047 moves confirmed later: 12023618 all moves confirmed: 21844665 percent of confirmed moves: 13.652916 current total energy: -67.668593 recalc. total energy: -67.668593 out arg RESULTS//1/Tetraloop_10_steps-ab157b55_01 Time of doing 1600000 iterations: 849.845 seconds