SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-99840a20/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1226.228874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.228874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.228874 (E_RNA) where: Base-Base interactions energy: -546.201 where: short stacking energy: -539.831 Base-Backbone interact. energy: -0.188 local terms energy: -679.839180 where: bonds (distance) C4'-P energy: -157.515 bonds (distance) P-C4' energy: -151.241 flat angles C4'-P-C4' energy: -153.264 flat angles P-C4'-P energy: -100.906 tors. eta vs tors. theta energy: -116.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1204.728334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.728334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.728334 (E_RNA) where: Base-Base interactions energy: -533.394 where: short stacking energy: -527.815 Base-Backbone interact. energy: 0.148 local terms energy: -671.482284 where: bonds (distance) C4'-P energy: -150.636 bonds (distance) P-C4' energy: -168.779 flat angles C4'-P-C4' energy: -147.762 flat angles P-C4'-P energy: -92.923 tors. eta vs tors. theta energy: -111.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1204.931621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.931621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.931621 (E_RNA) where: Base-Base interactions energy: -534.774 where: short stacking energy: -529.042 Base-Backbone interact. energy: -0.151 local terms energy: -670.006260 where: bonds (distance) C4'-P energy: -143.300 bonds (distance) P-C4' energy: -153.306 flat angles C4'-P-C4' energy: -161.559 flat angles P-C4'-P energy: -88.157 tors. eta vs tors. theta energy: -123.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1076.315346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.315346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.315346 (E_RNA) where: Base-Base interactions energy: -438.962 where: short stacking energy: -433.812 Base-Backbone interact. energy: -0.974 local terms energy: -636.379168 where: bonds (distance) C4'-P energy: -152.931 bonds (distance) P-C4' energy: -158.498 flat angles C4'-P-C4' energy: -134.631 flat angles P-C4'-P energy: -99.966 tors. eta vs tors. theta energy: -90.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1021.243209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.243209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.243209 (E_RNA) where: Base-Base interactions energy: -72.459 where: short stacking energy: -72.459 Base-Backbone interact. energy: -0.000 local terms energy: -948.783815 where: bonds (distance) C4'-P energy: -234.279 bonds (distance) P-C4' energy: -217.358 flat angles C4'-P-C4' energy: -178.842 flat angles P-C4'-P energy: -205.764 tors. eta vs tors. theta energy: -112.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1020.623213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.623213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.623213 (E_RNA) where: Base-Base interactions energy: -59.685 where: short stacking energy: -59.685 Base-Backbone interact. energy: -0.000 local terms energy: -960.938356 where: bonds (distance) C4'-P energy: -239.864 bonds (distance) P-C4' energy: -221.867 flat angles C4'-P-C4' energy: -181.057 flat angles P-C4'-P energy: -207.375 tors. eta vs tors. theta energy: -110.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1022.057025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.057025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.057025 (E_RNA) where: Base-Base interactions energy: -69.250 where: short stacking energy: -69.250 Base-Backbone interact. energy: -0.000 local terms energy: -952.807151 where: bonds (distance) C4'-P energy: -236.938 bonds (distance) P-C4' energy: -218.143 flat angles C4'-P-C4' energy: -179.371 flat angles P-C4'-P energy: -205.944 tors. eta vs tors. theta energy: -112.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1020.988999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.988999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.988999 (E_RNA) where: Base-Base interactions energy: -62.800 where: short stacking energy: -62.800 Base-Backbone interact. energy: -0.000 local terms energy: -958.188680 where: bonds (distance) C4'-P energy: -238.527 bonds (distance) P-C4' energy: -220.663 flat angles C4'-P-C4' energy: -180.491 flat angles P-C4'-P energy: -206.792 tors. eta vs tors. theta energy: -111.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1020.372302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.372302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.372302 (E_RNA) where: Base-Base interactions energy: -59.685 where: short stacking energy: -59.685 Base-Backbone interact. energy: -0.000 local terms energy: -960.687445 where: bonds (distance) C4'-P energy: -239.864 bonds (distance) P-C4' energy: -221.867 flat angles C4'-P-C4' energy: -180.769 flat angles P-C4'-P energy: -207.412 tors. eta vs tors. theta energy: -110.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1023.412403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.412403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.412403 (E_RNA) where: Base-Base interactions energy: -65.743 where: short stacking energy: -65.743 Base-Backbone interact. energy: -0.000 local terms energy: -957.669166 where: bonds (distance) C4'-P energy: -238.535 bonds (distance) P-C4' energy: -219.077 flat angles C4'-P-C4' energy: -181.818 flat angles P-C4'-P energy: -206.899 tors. eta vs tors. theta energy: -111.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1317.861217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.861217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.861217 (E_RNA) where: Base-Base interactions energy: -594.012 where: short stacking energy: -588.181 Base-Backbone interact. energy: -0.449 local terms energy: -723.400252 where: bonds (distance) C4'-P energy: -149.377 bonds (distance) P-C4' energy: -159.119 flat angles C4'-P-C4' energy: -173.329 flat angles P-C4'-P energy: -105.803 tors. eta vs tors. theta energy: -135.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1269.414810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.414810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.414810 (E_RNA) where: Base-Base interactions energy: -557.610 where: short stacking energy: -553.591 Base-Backbone interact. energy: 0.126 local terms energy: -711.930960 where: bonds (distance) C4'-P energy: -150.318 bonds (distance) P-C4' energy: -154.933 flat angles C4'-P-C4' energy: -157.901 flat angles P-C4'-P energy: -107.661 tors. eta vs tors. theta energy: -141.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1210.794592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.794592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.794592 (E_RNA) where: Base-Base interactions energy: -557.637 where: short stacking energy: -546.252 Base-Backbone interact. energy: 0.465 local terms energy: -653.622562 where: bonds (distance) C4'-P energy: -129.166 bonds (distance) P-C4' energy: -141.666 flat angles C4'-P-C4' energy: -155.160 flat angles P-C4'-P energy: -91.323 tors. eta vs tors. theta energy: -136.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1037.447419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.447419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.447419 (E_RNA) where: Base-Base interactions energy: -458.049 where: short stacking energy: -418.133 Base-Backbone interact. energy: -2.037 local terms energy: -577.361594 where: bonds (distance) C4'-P energy: -135.794 bonds (distance) P-C4' energy: -142.861 flat angles C4'-P-C4' energy: -137.952 flat angles P-C4'-P energy: -83.439 tors. eta vs tors. theta energy: -77.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -966.609887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.609887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.609887 (E_RNA) where: Base-Base interactions energy: -410.788 where: short stacking energy: -404.191 Base-Backbone interact. energy: -0.803 local terms energy: -555.018304 where: bonds (distance) C4'-P energy: -131.821 bonds (distance) P-C4' energy: -144.259 flat angles C4'-P-C4' energy: -137.473 flat angles P-C4'-P energy: -75.720 tors. eta vs tors. theta energy: -65.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -922.768382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.768382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.768382 (E_RNA) where: Base-Base interactions energy: -372.719 where: short stacking energy: -371.784 Base-Backbone interact. energy: 0.204 local terms energy: -550.253580 where: bonds (distance) C4'-P energy: -135.650 bonds (distance) P-C4' energy: -145.331 flat angles C4'-P-C4' energy: -143.733 flat angles P-C4'-P energy: -53.239 tors. eta vs tors. theta energy: -72.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -818.382816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.382816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.382816 (E_RNA) where: Base-Base interactions energy: -323.896 where: short stacking energy: -310.046 Base-Backbone interact. energy: 5.917 local terms energy: -500.404058 where: bonds (distance) C4'-P energy: -123.334 bonds (distance) P-C4' energy: -134.948 flat angles C4'-P-C4' energy: -125.831 flat angles P-C4'-P energy: -64.437 tors. eta vs tors. theta energy: -51.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -749.382111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.382111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.382111 (E_RNA) where: Base-Base interactions energy: -301.883 where: short stacking energy: -277.060 Base-Backbone interact. energy: 9.243 local terms energy: -456.741940 where: bonds (distance) C4'-P energy: -126.197 bonds (distance) P-C4' energy: -125.184 flat angles C4'-P-C4' energy: -113.909 flat angles P-C4'-P energy: -69.621 tors. eta vs tors. theta energy: -21.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -702.275994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.275994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.275994 (E_RNA) where: Base-Base interactions energy: -253.645 where: short stacking energy: -222.594 Base-Backbone interact. energy: -0.688 local terms energy: -447.942293 where: bonds (distance) C4'-P energy: -116.802 bonds (distance) P-C4' energy: -121.054 flat angles C4'-P-C4' energy: -124.306 flat angles P-C4'-P energy: -70.381 tors. eta vs tors. theta energy: -15.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -727.566573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.566573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.566573 (E_RNA) where: Base-Base interactions energy: -303.184 where: short stacking energy: -238.271 Base-Backbone interact. energy: 0.631 local terms energy: -425.013776 where: bonds (distance) C4'-P energy: -131.151 bonds (distance) P-C4' energy: -117.805 flat angles C4'-P-C4' energy: -110.627 flat angles P-C4'-P energy: -55.187 tors. eta vs tors. theta energy: -10.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1382.643159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.643159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.643159 (E_RNA) where: Base-Base interactions energy: -670.296 where: short stacking energy: -639.155 Base-Backbone interact. energy: 0.054 local terms energy: -712.401513 where: bonds (distance) C4'-P energy: -153.763 bonds (distance) P-C4' energy: -146.067 flat angles C4'-P-C4' energy: -150.389 flat angles P-C4'-P energy: -109.051 tors. eta vs tors. theta energy: -153.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1303.593943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.593943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.593943 (E_RNA) where: Base-Base interactions energy: -574.907 where: short stacking energy: -570.206 Base-Backbone interact. energy: -0.399 local terms energy: -728.287572 where: bonds (distance) C4'-P energy: -153.750 bonds (distance) P-C4' energy: -152.368 flat angles C4'-P-C4' energy: -165.101 flat angles P-C4'-P energy: -109.936 tors. eta vs tors. theta energy: -147.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1153.744832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.744832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.744832 (E_RNA) where: Base-Base interactions energy: -488.942 where: short stacking energy: -474.453 Base-Backbone interact. energy: -1.246 local terms energy: -663.556793 where: bonds (distance) C4'-P energy: -149.271 bonds (distance) P-C4' energy: -160.749 flat angles C4'-P-C4' energy: -154.121 flat angles P-C4'-P energy: -86.103 tors. eta vs tors. theta energy: -113.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1094.379822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.379822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.379822 (E_RNA) where: Base-Base interactions energy: -519.033 where: short stacking energy: -405.234 Base-Backbone interact. energy: 1.097 local terms energy: -576.443408 where: bonds (distance) C4'-P energy: -133.307 bonds (distance) P-C4' energy: -141.816 flat angles C4'-P-C4' energy: -146.280 flat angles P-C4'-P energy: -86.661 tors. eta vs tors. theta energy: -68.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -966.175099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.175099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.175099 (E_RNA) where: Base-Base interactions energy: -432.916 where: short stacking energy: -386.784 Base-Backbone interact. energy: -1.853 local terms energy: -531.406110 where: bonds (distance) C4'-P energy: -115.226 bonds (distance) P-C4' energy: -144.582 flat angles C4'-P-C4' energy: -130.008 flat angles P-C4'-P energy: -84.488 tors. eta vs tors. theta energy: -57.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -986.222385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.222385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.222385 (E_RNA) where: Base-Base interactions energy: -441.869 where: short stacking energy: -370.805 Base-Backbone interact. energy: -0.813 local terms energy: -543.540531 where: bonds (distance) C4'-P energy: -131.889 bonds (distance) P-C4' energy: -149.514 flat angles C4'-P-C4' energy: -114.417 flat angles P-C4'-P energy: -81.187 tors. eta vs tors. theta energy: -66.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -815.179252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.179252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.179252 (E_RNA) where: Base-Base interactions energy: -316.077 where: short stacking energy: -289.786 Base-Backbone interact. energy: -3.050 local terms energy: -496.052462 where: bonds (distance) C4'-P energy: -124.887 bonds (distance) P-C4' energy: -137.375 flat angles C4'-P-C4' energy: -114.600 flat angles P-C4'-P energy: -88.985 tors. eta vs tors. theta energy: -30.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -734.170151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.170151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.170151 (E_RNA) where: Base-Base interactions energy: -293.308 where: short stacking energy: -272.992 Base-Backbone interact. energy: 2.272 local terms energy: -443.135093 where: bonds (distance) C4'-P energy: -133.121 bonds (distance) P-C4' energy: -144.269 flat angles C4'-P-C4' energy: -101.010 flat angles P-C4'-P energy: -58.739 tors. eta vs tors. theta energy: -5.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -789.593853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.593853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.593853 (E_RNA) where: Base-Base interactions energy: -352.957 where: short stacking energy: -279.773 Base-Backbone interact. energy: 0.856 local terms energy: -437.492503 where: bonds (distance) C4'-P energy: -103.392 bonds (distance) P-C4' energy: -117.636 flat angles C4'-P-C4' energy: -138.754 flat angles P-C4'-P energy: -66.127 tors. eta vs tors. theta energy: -11.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -689.742142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.742142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.742142 (E_RNA) where: Base-Base interactions energy: -329.678 where: short stacking energy: -216.052 Base-Backbone interact. energy: -0.466 local terms energy: -359.598227 where: bonds (distance) C4'-P energy: -125.596 bonds (distance) P-C4' energy: -119.213 flat angles C4'-P-C4' energy: -105.084 flat angles P-C4'-P energy: -40.649 tors. eta vs tors. theta energy: 30.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1376.015162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.015162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.015162 (E_RNA) where: Base-Base interactions energy: -645.382 where: short stacking energy: -622.771 Base-Backbone interact. energy: -0.699 local terms energy: -729.934592 where: bonds (distance) C4'-P energy: -150.526 bonds (distance) P-C4' energy: -159.580 flat angles C4'-P-C4' energy: -162.947 flat angles P-C4'-P energy: -105.269 tors. eta vs tors. theta energy: -151.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1322.134097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.134097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.134097 (E_RNA) where: Base-Base interactions energy: -602.144 where: short stacking energy: -584.091 Base-Backbone interact. energy: -1.437 local terms energy: -718.553806 where: bonds (distance) C4'-P energy: -143.445 bonds (distance) P-C4' energy: -165.190 flat angles C4'-P-C4' energy: -154.702 flat angles P-C4'-P energy: -99.063 tors. eta vs tors. theta energy: -156.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1152.209832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.209832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.209832 (E_RNA) where: Base-Base interactions energy: -496.060 where: short stacking energy: -470.500 Base-Backbone interact. energy: -1.353 local terms energy: -654.797384 where: bonds (distance) C4'-P energy: -145.988 bonds (distance) P-C4' energy: -153.023 flat angles C4'-P-C4' energy: -159.814 flat angles P-C4'-P energy: -89.381 tors. eta vs tors. theta energy: -106.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1249.801647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.801647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.801647 (E_RNA) where: Base-Base interactions energy: -659.194 where: short stacking energy: -406.817 Base-Backbone interact. energy: 0.406 local terms energy: -591.013156 where: bonds (distance) C4'-P energy: -129.408 bonds (distance) P-C4' energy: -137.891 flat angles C4'-P-C4' energy: -153.194 flat angles P-C4'-P energy: -93.235 tors. eta vs tors. theta energy: -77.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -989.108254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.108254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.108254 (E_RNA) where: Base-Base interactions energy: -416.905 where: short stacking energy: -415.036 Base-Backbone interact. energy: 1.322 local terms energy: -573.524571 where: bonds (distance) C4'-P energy: -144.617 bonds (distance) P-C4' energy: -142.666 flat angles C4'-P-C4' energy: -126.585 flat angles P-C4'-P energy: -88.293 tors. eta vs tors. theta energy: -71.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -943.693850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.693850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.693850 (E_RNA) where: Base-Base interactions energy: -412.572 where: short stacking energy: -324.445 Base-Backbone interact. energy: -2.137 local terms energy: -528.984399 where: bonds (distance) C4'-P energy: -130.574 bonds (distance) P-C4' energy: -154.921 flat angles C4'-P-C4' energy: -129.638 flat angles P-C4'-P energy: -79.181 tors. eta vs tors. theta energy: -34.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -837.617993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.617993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.617993 (E_RNA) where: Base-Base interactions energy: -371.400 where: short stacking energy: -324.991 Base-Backbone interact. energy: -1.598 local terms energy: -464.620730 where: bonds (distance) C4'-P energy: -140.953 bonds (distance) P-C4' energy: -131.374 flat angles C4'-P-C4' energy: -126.312 flat angles P-C4'-P energy: -48.754 tors. eta vs tors. theta energy: -17.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -826.951608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.951608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.951608 (E_RNA) where: Base-Base interactions energy: -395.809 where: short stacking energy: -285.705 Base-Backbone interact. energy: 2.053 local terms energy: -433.196351 where: bonds (distance) C4'-P energy: -101.162 bonds (distance) P-C4' energy: -134.964 flat angles C4'-P-C4' energy: -110.080 flat angles P-C4'-P energy: -83.930 tors. eta vs tors. theta energy: -3.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -791.684847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.684847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.684847 (E_RNA) where: Base-Base interactions energy: -345.117 where: short stacking energy: -267.729 Base-Backbone interact. energy: 0.274 local terms energy: -446.841827 where: bonds (distance) C4'-P energy: -119.484 bonds (distance) P-C4' energy: -123.554 flat angles C4'-P-C4' energy: -105.096 flat angles P-C4'-P energy: -73.725 tors. eta vs tors. theta energy: -24.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -774.982296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.982296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.982296 (E_RNA) where: Base-Base interactions energy: -374.985 where: short stacking energy: -249.520 Base-Backbone interact. energy: 1.097 local terms energy: -401.093660 where: bonds (distance) C4'-P energy: -111.226 bonds (distance) P-C4' energy: -115.562 flat angles C4'-P-C4' energy: -106.653 flat angles P-C4'-P energy: -71.993 tors. eta vs tors. theta energy: 4.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1501.801507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.801507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.801507 (E_RNA) where: Base-Base interactions energy: -731.484 where: short stacking energy: -634.395 Base-Backbone interact. energy: -2.015 local terms energy: -768.302323 where: bonds (distance) C4'-P energy: -160.453 bonds (distance) P-C4' energy: -159.260 flat angles C4'-P-C4' energy: -163.773 flat angles P-C4'-P energy: -122.474 tors. eta vs tors. theta energy: -162.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1305.503741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.503741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.503741 (E_RNA) where: Base-Base interactions energy: -635.233 where: short stacking energy: -570.598 Base-Backbone interact. energy: -1.257 local terms energy: -669.014139 where: bonds (distance) C4'-P energy: -150.189 bonds (distance) P-C4' energy: -151.793 flat angles C4'-P-C4' energy: -161.031 flat angles P-C4'-P energy: -85.650 tors. eta vs tors. theta energy: -120.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1517.929538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.929538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.929538 (E_RNA) where: Base-Base interactions energy: -850.879 where: short stacking energy: -537.981 Base-Backbone interact. energy: -4.326 local terms energy: -662.724520 where: bonds (distance) C4'-P energy: -154.716 bonds (distance) P-C4' energy: -137.626 flat angles C4'-P-C4' energy: -154.096 flat angles P-C4'-P energy: -88.102 tors. eta vs tors. theta energy: -128.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1165.445894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.445894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.445894 (E_RNA) where: Base-Base interactions energy: -525.595 where: short stacking energy: -488.841 Base-Backbone interact. energy: 1.051 local terms energy: -640.902396 where: bonds (distance) C4'-P energy: -148.608 bonds (distance) P-C4' energy: -137.768 flat angles C4'-P-C4' energy: -154.585 flat angles P-C4'-P energy: -86.395 tors. eta vs tors. theta energy: -113.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1044.234275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.234275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.234275 (E_RNA) where: Base-Base interactions energy: -519.222 where: short stacking energy: -396.903 Base-Backbone interact. energy: 2.851 local terms energy: -527.863773 where: bonds (distance) C4'-P energy: -133.768 bonds (distance) P-C4' energy: -122.519 flat angles C4'-P-C4' energy: -123.945 flat angles P-C4'-P energy: -83.792 tors. eta vs tors. theta energy: -63.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -985.730421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.730421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.730421 (E_RNA) where: Base-Base interactions energy: -481.779 where: short stacking energy: -310.772 Base-Backbone interact. energy: -0.655 local terms energy: -503.296110 where: bonds (distance) C4'-P energy: -111.115 bonds (distance) P-C4' energy: -144.121 flat angles C4'-P-C4' energy: -123.749 flat angles P-C4'-P energy: -86.259 tors. eta vs tors. theta energy: -38.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -909.075514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.075514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.075514 (E_RNA) where: Base-Base interactions energy: -421.886 where: short stacking energy: -355.035 Base-Backbone interact. energy: -2.684 local terms energy: -484.505065 where: bonds (distance) C4'-P energy: -123.986 bonds (distance) P-C4' energy: -133.214 flat angles C4'-P-C4' energy: -110.620 flat angles P-C4'-P energy: -75.606 tors. eta vs tors. theta energy: -41.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -765.307577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.307577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.307577 (E_RNA) where: Base-Base interactions energy: -341.042 where: short stacking energy: -285.471 Base-Backbone interact. energy: 6.893 local terms energy: -431.157680 where: bonds (distance) C4'-P energy: -103.748 bonds (distance) P-C4' energy: -135.929 flat angles C4'-P-C4' energy: -111.006 flat angles P-C4'-P energy: -61.546 tors. eta vs tors. theta energy: -18.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -837.211359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.211359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.211359 (E_RNA) where: Base-Base interactions energy: -407.401 where: short stacking energy: -288.279 Base-Backbone interact. energy: 0.729 local terms energy: -430.539405 where: bonds (distance) C4'-P energy: -120.149 bonds (distance) P-C4' energy: -116.053 flat angles C4'-P-C4' energy: -110.672 flat angles P-C4'-P energy: -72.793 tors. eta vs tors. theta energy: -10.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -763.309764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.309764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.309764 (E_RNA) where: Base-Base interactions energy: -366.241 where: short stacking energy: -231.514 Base-Backbone interact. energy: -0.276 local terms energy: -396.792076 where: bonds (distance) C4'-P energy: -104.360 bonds (distance) P-C4' energy: -122.637 flat angles C4'-P-C4' energy: -116.214 flat angles P-C4'-P energy: -56.199 tors. eta vs tors. theta energy: 2.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1451.439358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.439358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.439358 (E_RNA) where: Base-Base interactions energy: -715.221 where: short stacking energy: -606.594 Base-Backbone interact. energy: -1.159 local terms energy: -735.059085 where: bonds (distance) C4'-P energy: -154.740 bonds (distance) P-C4' energy: -155.358 flat angles C4'-P-C4' energy: -162.638 flat angles P-C4'-P energy: -112.580 tors. eta vs tors. theta energy: -149.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1673.942059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.942059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.942059 (E_RNA) where: Base-Base interactions energy: -978.335 where: short stacking energy: -608.213 Base-Backbone interact. energy: -2.722 local terms energy: -692.885358 where: bonds (distance) C4'-P energy: -133.263 bonds (distance) P-C4' energy: -151.797 flat angles C4'-P-C4' energy: -165.911 flat angles P-C4'-P energy: -92.361 tors. eta vs tors. theta energy: -149.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1264.856203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.856203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.856203 (E_RNA) where: Base-Base interactions energy: -616.644 where: short stacking energy: -554.676 Base-Backbone interact. energy: 0.960 local terms energy: -649.171493 where: bonds (distance) C4'-P energy: -145.144 bonds (distance) P-C4' energy: -139.653 flat angles C4'-P-C4' energy: -161.816 flat angles P-C4'-P energy: -87.060 tors. eta vs tors. theta energy: -115.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1140.991253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.991253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.991253 (E_RNA) where: Base-Base interactions energy: -540.591 where: short stacking energy: -461.224 Base-Backbone interact. energy: -2.467 local terms energy: -597.933196 where: bonds (distance) C4'-P energy: -149.180 bonds (distance) P-C4' energy: -146.087 flat angles C4'-P-C4' energy: -139.969 flat angles P-C4'-P energy: -81.175 tors. eta vs tors. theta energy: -81.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1086.990188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.990188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.990188 (E_RNA) where: Base-Base interactions energy: -547.070 where: short stacking energy: -382.097 Base-Backbone interact. energy: -1.095 local terms energy: -538.825564 where: bonds (distance) C4'-P energy: -139.359 bonds (distance) P-C4' energy: -147.312 flat angles C4'-P-C4' energy: -139.055 flat angles P-C4'-P energy: -69.846 tors. eta vs tors. theta energy: -43.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -966.891768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.891768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.891768 (E_RNA) where: Base-Base interactions energy: -452.992 where: short stacking energy: -363.391 Base-Backbone interact. energy: -3.215 local terms energy: -510.684703 where: bonds (distance) C4'-P energy: -128.917 bonds (distance) P-C4' energy: -129.446 flat angles C4'-P-C4' energy: -133.567 flat angles P-C4'-P energy: -77.118 tors. eta vs tors. theta energy: -41.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -943.896556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.896556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.896556 (E_RNA) where: Base-Base interactions energy: -465.199 where: short stacking energy: -316.356 Base-Backbone interact. energy: -3.433 local terms energy: -475.264544 where: bonds (distance) C4'-P energy: -118.398 bonds (distance) P-C4' energy: -112.112 flat angles C4'-P-C4' energy: -123.693 flat angles P-C4'-P energy: -91.710 tors. eta vs tors. theta energy: -29.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -953.823241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.823241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.823241 (E_RNA) where: Base-Base interactions energy: -502.104 where: short stacking energy: -355.993 Base-Backbone interact. energy: -3.969 local terms energy: -447.750604 where: bonds (distance) C4'-P energy: -125.350 bonds (distance) P-C4' energy: -120.759 flat angles C4'-P-C4' energy: -99.919 flat angles P-C4'-P energy: -71.477 tors. eta vs tors. theta energy: -30.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -689.292649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.292649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.292649 (E_RNA) where: Base-Base interactions energy: -258.577 where: short stacking energy: -228.527 Base-Backbone interact. energy: -0.459 local terms energy: -430.257141 where: bonds (distance) C4'-P energy: -130.856 bonds (distance) P-C4' energy: -146.182 flat angles C4'-P-C4' energy: -85.585 flat angles P-C4'-P energy: -69.527 tors. eta vs tors. theta energy: 1.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -787.052461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.052461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.052461 (E_RNA) where: Base-Base interactions energy: -389.055 where: short stacking energy: -256.646 Base-Backbone interact. energy: 5.637 local terms energy: -403.634821 where: bonds (distance) C4'-P energy: -134.788 bonds (distance) P-C4' energy: -140.437 flat angles C4'-P-C4' energy: -90.633 flat angles P-C4'-P energy: -35.981 tors. eta vs tors. theta energy: -1.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1806.658590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.658590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.658590 (E_RNA) where: Base-Base interactions energy: -1073.814 where: short stacking energy: -669.381 Base-Backbone interact. energy: -4.854 local terms energy: -727.990597 where: bonds (distance) C4'-P energy: -163.505 bonds (distance) P-C4' energy: -147.642 flat angles C4'-P-C4' energy: -161.158 flat angles P-C4'-P energy: -93.879 tors. eta vs tors. theta energy: -161.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1390.885114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.885114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.885114 (E_RNA) where: Base-Base interactions energy: -699.740 where: short stacking energy: -576.794 Base-Backbone interact. energy: -0.197 local terms energy: -690.948098 where: bonds (distance) C4'-P energy: -149.514 bonds (distance) P-C4' energy: -150.204 flat angles C4'-P-C4' energy: -148.557 flat angles P-C4'-P energy: -104.587 tors. eta vs tors. theta energy: -138.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1239.451855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.451855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.451855 (E_RNA) where: Base-Base interactions energy: -575.180 where: short stacking energy: -475.515 Base-Backbone interact. energy: -0.691 local terms energy: -663.581143 where: bonds (distance) C4'-P energy: -149.771 bonds (distance) P-C4' energy: -159.507 flat angles C4'-P-C4' energy: -138.675 flat angles P-C4'-P energy: -93.927 tors. eta vs tors. theta energy: -121.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1280.166666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.166666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.166666 (E_RNA) where: Base-Base interactions energy: -657.557 where: short stacking energy: -446.327 Base-Backbone interact. energy: -1.484 local terms energy: -621.125967 where: bonds (distance) C4'-P energy: -123.537 bonds (distance) P-C4' energy: -146.174 flat angles C4'-P-C4' energy: -151.133 flat angles P-C4'-P energy: -100.780 tors. eta vs tors. theta energy: -99.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1214.685453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.685453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.685453 (E_RNA) where: Base-Base interactions energy: -657.307 where: short stacking energy: -486.857 Base-Backbone interact. energy: 7.312 local terms energy: -564.690264 where: bonds (distance) C4'-P energy: -111.305 bonds (distance) P-C4' energy: -154.704 flat angles C4'-P-C4' energy: -132.449 flat angles P-C4'-P energy: -75.147 tors. eta vs tors. theta energy: -91.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1001.661710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.661710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.661710 (E_RNA) where: Base-Base interactions energy: -479.518 where: short stacking energy: -346.990 Base-Backbone interact. energy: 0.611 local terms energy: -522.754011 where: bonds (distance) C4'-P energy: -127.150 bonds (distance) P-C4' energy: -139.504 flat angles C4'-P-C4' energy: -128.768 flat angles P-C4'-P energy: -77.864 tors. eta vs tors. theta energy: -49.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1057.368582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.368582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.368582 (E_RNA) where: Base-Base interactions energy: -569.139 where: short stacking energy: -344.360 Base-Backbone interact. energy: 1.277 local terms energy: -489.506572 where: bonds (distance) C4'-P energy: -127.870 bonds (distance) P-C4' energy: -121.046 flat angles C4'-P-C4' energy: -118.487 flat angles P-C4'-P energy: -82.424 tors. eta vs tors. theta energy: -39.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -943.605469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.605469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.605469 (E_RNA) where: Base-Base interactions energy: -460.554 where: short stacking energy: -314.417 Base-Backbone interact. energy: 0.132 local terms energy: -483.183203 where: bonds (distance) C4'-P energy: -100.274 bonds (distance) P-C4' energy: -127.193 flat angles C4'-P-C4' energy: -141.030 flat angles P-C4'-P energy: -73.777 tors. eta vs tors. theta energy: -40.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -843.189144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.189144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.189144 (E_RNA) where: Base-Base interactions energy: -371.595 where: short stacking energy: -275.589 Base-Backbone interact. energy: -4.168 local terms energy: -467.426155 where: bonds (distance) C4'-P energy: -100.004 bonds (distance) P-C4' energy: -137.981 flat angles C4'-P-C4' energy: -113.099 flat angles P-C4'-P energy: -75.762 tors. eta vs tors. theta energy: -40.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -745.048414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.048414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.048414 (E_RNA) where: Base-Base interactions energy: -360.129 where: short stacking energy: -261.232 Base-Backbone interact. energy: 2.352 local terms energy: -387.272117 where: bonds (distance) C4'-P energy: -124.468 bonds (distance) P-C4' energy: -112.084 flat angles C4'-P-C4' energy: -106.559 flat angles P-C4'-P energy: -53.008 tors. eta vs tors. theta energy: 8.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1806.525101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.525101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.525101 (E_RNA) where: Base-Base interactions energy: -1066.712 where: short stacking energy: -658.229 Base-Backbone interact. energy: -4.209 local terms energy: -735.604535 where: bonds (distance) C4'-P energy: -149.629 bonds (distance) P-C4' energy: -159.213 flat angles C4'-P-C4' energy: -159.973 flat angles P-C4'-P energy: -104.953 tors. eta vs tors. theta energy: -161.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1457.836914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.836914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.836914 (E_RNA) where: Base-Base interactions energy: -751.020 where: short stacking energy: -606.704 Base-Backbone interact. energy: -1.289 local terms energy: -705.528401 where: bonds (distance) C4'-P energy: -157.571 bonds (distance) P-C4' energy: -141.681 flat angles C4'-P-C4' energy: -155.931 flat angles P-C4'-P energy: -108.067 tors. eta vs tors. theta energy: -142.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1300.035229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.035229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.035229 (E_RNA) where: Base-Base interactions energy: -668.995 where: short stacking energy: -478.780 Base-Backbone interact. energy: -0.539 local terms energy: -630.501381 where: bonds (distance) C4'-P energy: -144.778 bonds (distance) P-C4' energy: -162.588 flat angles C4'-P-C4' energy: -128.375 flat angles P-C4'-P energy: -98.179 tors. eta vs tors. theta energy: -96.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1330.935694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.935694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.935694 (E_RNA) where: Base-Base interactions energy: -721.208 where: short stacking energy: -451.546 Base-Backbone interact. energy: 1.154 local terms energy: -610.882063 where: bonds (distance) C4'-P energy: -117.382 bonds (distance) P-C4' energy: -155.295 flat angles C4'-P-C4' energy: -153.954 flat angles P-C4'-P energy: -93.143 tors. eta vs tors. theta energy: -91.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1228.713061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.713061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.713061 (E_RNA) where: Base-Base interactions energy: -677.652 where: short stacking energy: -423.162 Base-Backbone interact. energy: -1.879 local terms energy: -549.182414 where: bonds (distance) C4'-P energy: -121.550 bonds (distance) P-C4' energy: -130.519 flat angles C4'-P-C4' energy: -132.616 flat angles P-C4'-P energy: -88.782 tors. eta vs tors. theta energy: -75.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1211.119054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.119054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.119054 (E_RNA) where: Base-Base interactions energy: -691.974 where: short stacking energy: -423.058 Base-Backbone interact. energy: 1.497 local terms energy: -520.641105 where: bonds (distance) C4'-P energy: -134.355 bonds (distance) P-C4' energy: -121.335 flat angles C4'-P-C4' energy: -129.264 flat angles P-C4'-P energy: -61.398 tors. eta vs tors. theta energy: -74.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -988.653539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.653539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.653539 (E_RNA) where: Base-Base interactions energy: -452.980 where: short stacking energy: -322.469 Base-Backbone interact. energy: -1.984 local terms energy: -533.689917 where: bonds (distance) C4'-P energy: -141.706 bonds (distance) P-C4' energy: -136.445 flat angles C4'-P-C4' energy: -144.227 flat angles P-C4'-P energy: -73.121 tors. eta vs tors. theta energy: -38.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -979.827369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.827369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.827369 (E_RNA) where: Base-Base interactions energy: -499.120 where: short stacking energy: -304.170 Base-Backbone interact. energy: -1.100 local terms energy: -479.608006 where: bonds (distance) C4'-P energy: -128.398 bonds (distance) P-C4' energy: -141.999 flat angles C4'-P-C4' energy: -127.186 flat angles P-C4'-P energy: -70.590 tors. eta vs tors. theta energy: -11.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -978.759016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.759016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.759016 (E_RNA) where: Base-Base interactions energy: -511.860 where: short stacking energy: -292.408 Base-Backbone interact. energy: -3.213 local terms energy: -463.686347 where: bonds (distance) C4'-P energy: -126.943 bonds (distance) P-C4' energy: -133.122 flat angles C4'-P-C4' energy: -120.395 flat angles P-C4'-P energy: -60.496 tors. eta vs tors. theta energy: -22.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -735.587391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.587391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.587391 (E_RNA) where: Base-Base interactions energy: -341.994 where: short stacking energy: -213.940 Base-Backbone interact. energy: 8.581 local terms energy: -402.173968 where: bonds (distance) C4'-P energy: -129.121 bonds (distance) P-C4' energy: -115.701 flat angles C4'-P-C4' energy: -104.839 flat angles P-C4'-P energy: -59.800 tors. eta vs tors. theta energy: 7.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1856.769401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1856.769401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1856.769401 (E_RNA) where: Base-Base interactions energy: -1133.643 where: short stacking energy: -685.778 Base-Backbone interact. energy: -1.772 local terms energy: -721.354099 where: bonds (distance) C4'-P energy: -153.382 bonds (distance) P-C4' energy: -150.754 flat angles C4'-P-C4' energy: -150.241 flat angles P-C4'-P energy: -94.669 tors. eta vs tors. theta energy: -172.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1473.436799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.436799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.436799 (E_RNA) where: Base-Base interactions energy: -780.065 where: short stacking energy: -602.891 Base-Backbone interact. energy: -1.412 local terms energy: -691.959491 where: bonds (distance) C4'-P energy: -155.316 bonds (distance) P-C4' energy: -145.337 flat angles C4'-P-C4' energy: -153.271 flat angles P-C4'-P energy: -94.922 tors. eta vs tors. theta energy: -143.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1458.347935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.347935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.347935 (E_RNA) where: Base-Base interactions energy: -818.368 where: short stacking energy: -493.350 Base-Backbone interact. energy: -1.662 local terms energy: -638.317850 where: bonds (distance) C4'-P energy: -136.597 bonds (distance) P-C4' energy: -156.435 flat angles C4'-P-C4' energy: -146.098 flat angles P-C4'-P energy: -97.317 tors. eta vs tors. theta energy: -101.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1187.209384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.209384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.209384 (E_RNA) where: Base-Base interactions energy: -592.581 where: short stacking energy: -462.733 Base-Backbone interact. energy: 1.744 local terms energy: -596.372611 where: bonds (distance) C4'-P energy: -140.343 bonds (distance) P-C4' energy: -155.716 flat angles C4'-P-C4' energy: -124.465 flat angles P-C4'-P energy: -92.660 tors. eta vs tors. theta energy: -83.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1324.829508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.829508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.829508 (E_RNA) where: Base-Base interactions energy: -734.860 where: short stacking energy: -454.382 Base-Backbone interact. energy: -1.880 local terms energy: -588.089652 where: bonds (distance) C4'-P energy: -145.293 bonds (distance) P-C4' energy: -158.345 flat angles C4'-P-C4' energy: -134.753 flat angles P-C4'-P energy: -78.705 tors. eta vs tors. theta energy: -70.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1202.535342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.535342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1202.535342 (E_RNA) where: Base-Base interactions energy: -681.672 where: short stacking energy: -424.022 Base-Backbone interact. energy: -3.147 local terms energy: -517.716406 where: bonds (distance) C4'-P energy: -115.916 bonds (distance) P-C4' energy: -131.842 flat angles C4'-P-C4' energy: -129.274 flat angles P-C4'-P energy: -86.536 tors. eta vs tors. theta energy: -54.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -978.577819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.577819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.577819 (E_RNA) where: Base-Base interactions energy: -485.156 where: short stacking energy: -313.894 Base-Backbone interact. energy: 5.169 local terms energy: -498.590196 where: bonds (distance) C4'-P energy: -107.935 bonds (distance) P-C4' energy: -141.271 flat angles C4'-P-C4' energy: -128.097 flat angles P-C4'-P energy: -84.145 tors. eta vs tors. theta energy: -37.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -954.871165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.871165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.871165 (E_RNA) where: Base-Base interactions energy: -498.396 where: short stacking energy: -290.846 Base-Backbone interact. energy: 3.871 local terms energy: -460.346784 where: bonds (distance) C4'-P energy: -134.159 bonds (distance) P-C4' energy: -120.713 flat angles C4'-P-C4' energy: -128.846 flat angles P-C4'-P energy: -65.238 tors. eta vs tors. theta energy: -11.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1014.223129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.223129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.223129 (E_RNA) where: Base-Base interactions energy: -571.624 where: short stacking energy: -329.393 Base-Backbone interact. energy: 1.808 local terms energy: -444.406895 where: bonds (distance) C4'-P energy: -107.162 bonds (distance) P-C4' energy: -113.854 flat angles C4'-P-C4' energy: -119.812 flat angles P-C4'-P energy: -79.561 tors. eta vs tors. theta energy: -24.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -750.503210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.503210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.503210 (E_RNA) where: Base-Base interactions energy: -369.434 where: short stacking energy: -249.310 Base-Backbone interact. energy: 1.998 local terms energy: -383.067338 where: bonds (distance) C4'-P energy: -110.893 bonds (distance) P-C4' energy: -112.305 flat angles C4'-P-C4' energy: -102.009 flat angles P-C4'-P energy: -43.152 tors. eta vs tors. theta energy: -14.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1957.954860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1957.954860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.954860 (E_RNA) where: Base-Base interactions energy: -1202.473 where: short stacking energy: -690.834 Base-Backbone interact. energy: -6.313 local terms energy: -749.169581 where: bonds (distance) C4'-P energy: -148.941 bonds (distance) P-C4' energy: -156.295 flat angles C4'-P-C4' energy: -162.412 flat angles P-C4'-P energy: -105.819 tors. eta vs tors. theta energy: -175.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1630.986598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.986598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.986598 (E_RNA) where: Base-Base interactions energy: -948.681 where: short stacking energy: -552.478 Base-Backbone interact. energy: -0.772 local terms energy: -681.534151 where: bonds (distance) C4'-P energy: -146.145 bonds (distance) P-C4' energy: -164.215 flat angles C4'-P-C4' energy: -144.342 flat angles P-C4'-P energy: -113.907 tors. eta vs tors. theta energy: -112.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1442.914480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.914480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.914480 (E_RNA) where: Base-Base interactions energy: -798.512 where: short stacking energy: -568.020 Base-Backbone interact. energy: -1.045 local terms energy: -643.357095 where: bonds (distance) C4'-P energy: -131.985 bonds (distance) P-C4' energy: -159.364 flat angles C4'-P-C4' energy: -137.159 flat angles P-C4'-P energy: -96.260 tors. eta vs tors. theta energy: -118.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1447.417364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.417364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.417364 (E_RNA) where: Base-Base interactions energy: -827.154 where: short stacking energy: -459.354 Base-Backbone interact. energy: 0.386 local terms energy: -620.648828 where: bonds (distance) C4'-P energy: -135.614 bonds (distance) P-C4' energy: -150.944 flat angles C4'-P-C4' energy: -145.976 flat angles P-C4'-P energy: -92.654 tors. eta vs tors. theta energy: -95.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1170.064699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.064699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.064699 (E_RNA) where: Base-Base interactions energy: -602.566 where: short stacking energy: -429.227 Base-Backbone interact. energy: -2.690 local terms energy: -564.808369 where: bonds (distance) C4'-P energy: -131.376 bonds (distance) P-C4' energy: -137.859 flat angles C4'-P-C4' energy: -134.049 flat angles P-C4'-P energy: -90.081 tors. eta vs tors. theta energy: -71.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1308.197210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.197210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.197210 (E_RNA) where: Base-Base interactions energy: -759.263 where: short stacking energy: -434.124 Base-Backbone interact. energy: 1.319 local terms energy: -550.253079 where: bonds (distance) C4'-P energy: -122.262 bonds (distance) P-C4' energy: -125.723 flat angles C4'-P-C4' energy: -126.248 flat angles P-C4'-P energy: -105.646 tors. eta vs tors. theta energy: -70.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -980.601562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.601562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.601562 (E_RNA) where: Base-Base interactions energy: -507.427 where: short stacking energy: -347.423 Base-Backbone interact. energy: 1.775 local terms energy: -474.949262 where: bonds (distance) C4'-P energy: -126.535 bonds (distance) P-C4' energy: -123.619 flat angles C4'-P-C4' energy: -130.317 flat angles P-C4'-P energy: -44.835 tors. eta vs tors. theta energy: -49.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1104.038491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.038491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.038491 (E_RNA) where: Base-Base interactions energy: -593.086 where: short stacking energy: -365.438 Base-Backbone interact. energy: -3.579 local terms energy: -507.373495 where: bonds (distance) C4'-P energy: -128.706 bonds (distance) P-C4' energy: -144.474 flat angles C4'-P-C4' energy: -122.112 flat angles P-C4'-P energy: -77.056 tors. eta vs tors. theta energy: -35.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -890.202962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.202962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.202962 (E_RNA) where: Base-Base interactions energy: -452.647 where: short stacking energy: -264.785 Base-Backbone interact. energy: 0.901 local terms energy: -438.456569 where: bonds (distance) C4'-P energy: -120.247 bonds (distance) P-C4' energy: -140.528 flat angles C4'-P-C4' energy: -105.211 flat angles P-C4'-P energy: -76.279 tors. eta vs tors. theta energy: 3.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -809.701373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.701373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.701373 (E_RNA) where: Base-Base interactions energy: -410.622 where: short stacking energy: -246.332 Base-Backbone interact. energy: -4.577 local terms energy: -394.501602 where: bonds (distance) C4'-P energy: -116.079 bonds (distance) P-C4' energy: -117.523 flat angles C4'-P-C4' energy: -110.910 flat angles P-C4'-P energy: -63.515 tors. eta vs tors. theta energy: 13.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -2010.129597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2010.129597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2010.129597 (E_RNA) where: Base-Base interactions energy: -1236.430 where: short stacking energy: -712.923 Base-Backbone interact. energy: 0.880 local terms energy: -774.579507 where: bonds (distance) C4'-P energy: -150.743 bonds (distance) P-C4' energy: -170.033 flat angles C4'-P-C4' energy: -159.145 flat angles P-C4'-P energy: -113.812 tors. eta vs tors. theta energy: -180.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1751.476459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.476459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.476459 (E_RNA) where: Base-Base interactions energy: -1055.564 where: short stacking energy: -595.354 Base-Backbone interact. energy: 0.126 local terms energy: -696.038657 where: bonds (distance) C4'-P energy: -141.989 bonds (distance) P-C4' energy: -153.428 flat angles C4'-P-C4' energy: -166.386 flat angles P-C4'-P energy: -94.721 tors. eta vs tors. theta energy: -139.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1680.167000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.167000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.167000 (E_RNA) where: Base-Base interactions energy: -1002.295 where: short stacking energy: -590.508 Base-Backbone interact. energy: 5.658 local terms energy: -683.530385 where: bonds (distance) C4'-P energy: -144.773 bonds (distance) P-C4' energy: -151.484 flat angles C4'-P-C4' energy: -152.530 flat angles P-C4'-P energy: -105.678 tors. eta vs tors. theta energy: -129.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1338.471127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.471127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.471127 (E_RNA) where: Base-Base interactions energy: -755.926 where: short stacking energy: -501.563 Base-Backbone interact. energy: 1.794 local terms energy: -584.338622 where: bonds (distance) C4'-P energy: -139.965 bonds (distance) P-C4' energy: -127.522 flat angles C4'-P-C4' energy: -144.835 flat angles P-C4'-P energy: -78.666 tors. eta vs tors. theta energy: -93.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1463.499710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.499710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.499710 (E_RNA) where: Base-Base interactions energy: -882.127 where: short stacking energy: -506.600 Base-Backbone interact. energy: -2.210 local terms energy: -579.162876 where: bonds (distance) C4'-P energy: -120.749 bonds (distance) P-C4' energy: -138.981 flat angles C4'-P-C4' energy: -147.872 flat angles P-C4'-P energy: -89.202 tors. eta vs tors. theta energy: -82.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1046.091624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.091624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.091624 (E_RNA) where: Base-Base interactions energy: -555.360 where: short stacking energy: -373.343 Base-Backbone interact. energy: 1.510 local terms energy: -492.241266 where: bonds (distance) C4'-P energy: -120.362 bonds (distance) P-C4' energy: -133.215 flat angles C4'-P-C4' energy: -115.775 flat angles P-C4'-P energy: -70.691 tors. eta vs tors. theta energy: -52.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1239.123808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.123808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.123808 (E_RNA) where: Base-Base interactions energy: -738.815 where: short stacking energy: -380.881 Base-Backbone interact. energy: 1.434 local terms energy: -501.742838 where: bonds (distance) C4'-P energy: -138.052 bonds (distance) P-C4' energy: -128.617 flat angles C4'-P-C4' energy: -129.515 flat angles P-C4'-P energy: -72.988 tors. eta vs tors. theta energy: -32.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1097.703682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.703682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.703682 (E_RNA) where: Base-Base interactions energy: -593.214 where: short stacking energy: -345.172 Base-Backbone interact. energy: 0.278 local terms energy: -504.767813 where: bonds (distance) C4'-P energy: -129.719 bonds (distance) P-C4' energy: -132.277 flat angles C4'-P-C4' energy: -130.015 flat angles P-C4'-P energy: -71.718 tors. eta vs tors. theta energy: -41.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -786.661397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.661397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.661397 (E_RNA) where: Base-Base interactions energy: -358.996 where: short stacking energy: -265.078 Base-Backbone interact. energy: 8.791 local terms energy: -436.456303 where: bonds (distance) C4'-P energy: -125.548 bonds (distance) P-C4' energy: -116.379 flat angles C4'-P-C4' energy: -111.284 flat angles P-C4'-P energy: -76.729 tors. eta vs tors. theta energy: -6.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -931.379059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.379059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.379059 (E_RNA) where: Base-Base interactions energy: -501.596 where: short stacking energy: -291.666 Base-Backbone interact. energy: 2.427 local terms energy: -432.210043 where: bonds (distance) C4'-P energy: -101.712 bonds (distance) P-C4' energy: -122.386 flat angles C4'-P-C4' energy: -98.305 flat angles P-C4'-P energy: -77.124 tors. eta vs tors. theta energy: -32.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -2041.773934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.773934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2041.773934 (E_RNA) where: Base-Base interactions energy: -1275.792 where: short stacking energy: -701.392 Base-Backbone interact. energy: -3.072 local terms energy: -762.909972 where: bonds (distance) C4'-P energy: -137.846 bonds (distance) P-C4' energy: -163.637 flat angles C4'-P-C4' energy: -166.789 flat angles P-C4'-P energy: -107.731 tors. eta vs tors. theta energy: -186.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1829.926178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1829.926178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1829.926178 (E_RNA) where: Base-Base interactions energy: -1139.208 where: short stacking energy: -616.041 Base-Backbone interact. energy: -2.016 local terms energy: -688.702256 where: bonds (distance) C4'-P energy: -146.337 bonds (distance) P-C4' energy: -154.316 flat angles C4'-P-C4' energy: -152.105 flat angles P-C4'-P energy: -96.585 tors. eta vs tors. theta energy: -139.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1695.167282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.167282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.167282 (E_RNA) where: Base-Base interactions energy: -1044.109 where: short stacking energy: -583.947 Base-Backbone interact. energy: -2.897 local terms energy: -648.161825 where: bonds (distance) C4'-P energy: -160.634 bonds (distance) P-C4' energy: -134.863 flat angles C4'-P-C4' energy: -140.662 flat angles P-C4'-P energy: -93.961 tors. eta vs tors. theta energy: -118.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1544.362157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.362157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.362157 (E_RNA) where: Base-Base interactions energy: -932.266 where: short stacking energy: -554.671 Base-Backbone interact. energy: -1.543 local terms energy: -610.553117 where: bonds (distance) C4'-P energy: -142.736 bonds (distance) P-C4' energy: -128.505 flat angles C4'-P-C4' energy: -134.234 flat angles P-C4'-P energy: -90.937 tors. eta vs tors. theta energy: -114.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1262.314444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.314444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.314444 (E_RNA) where: Base-Base interactions energy: -666.572 where: short stacking energy: -447.937 Base-Backbone interact. energy: -0.056 local terms energy: -595.686984 where: bonds (distance) C4'-P energy: -150.111 bonds (distance) P-C4' energy: -127.290 flat angles C4'-P-C4' energy: -148.705 flat angles P-C4'-P energy: -80.310 tors. eta vs tors. theta energy: -89.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1420.696066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.696066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.696066 (E_RNA) where: Base-Base interactions energy: -843.127 where: short stacking energy: -448.108 Base-Backbone interact. energy: -2.187 local terms energy: -575.381524 where: bonds (distance) C4'-P energy: -120.782 bonds (distance) P-C4' energy: -146.944 flat angles C4'-P-C4' energy: -137.042 flat angles P-C4'-P energy: -96.435 tors. eta vs tors. theta energy: -74.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -963.451956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.451956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.451956 (E_RNA) where: Base-Base interactions energy: -482.227 where: short stacking energy: -302.113 Base-Backbone interact. energy: 8.642 local terms energy: -489.867165 where: bonds (distance) C4'-P energy: -136.725 bonds (distance) P-C4' energy: -139.789 flat angles C4'-P-C4' energy: -114.854 flat angles P-C4'-P energy: -74.003 tors. eta vs tors. theta energy: -24.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1038.898749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.898749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.898749 (E_RNA) where: Base-Base interactions energy: -575.891 where: short stacking energy: -322.353 Base-Backbone interact. energy: -0.180 local terms energy: -462.827616 where: bonds (distance) C4'-P energy: -125.395 bonds (distance) P-C4' energy: -127.316 flat angles C4'-P-C4' energy: -111.341 flat angles P-C4'-P energy: -58.137 tors. eta vs tors. theta energy: -40.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -794.219088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.219088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.219088 (E_RNA) where: Base-Base interactions energy: -367.307 where: short stacking energy: -255.865 Base-Backbone interact. energy: 1.750 local terms energy: -428.662124 where: bonds (distance) C4'-P energy: -104.805 bonds (distance) P-C4' energy: -130.297 flat angles C4'-P-C4' energy: -106.859 flat angles P-C4'-P energy: -78.996 tors. eta vs tors. theta energy: -7.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -845.880015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.880015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.880015 (E_RNA) where: Base-Base interactions energy: -435.096 where: short stacking energy: -251.564 Base-Backbone interact. energy: 0.216 local terms energy: -411.000720 where: bonds (distance) C4'-P energy: -106.546 bonds (distance) P-C4' energy: -126.465 flat angles C4'-P-C4' energy: -116.449 flat angles P-C4'-P energy: -65.405 tors. eta vs tors. theta energy: 3.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -2043.203801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2043.203801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2043.203801 (E_RNA) where: Base-Base interactions energy: -1254.868 where: short stacking energy: -708.732 Base-Backbone interact. energy: -4.198 local terms energy: -784.137931 where: bonds (distance) C4'-P energy: -156.834 bonds (distance) P-C4' energy: -171.068 flat angles C4'-P-C4' energy: -172.313 flat angles P-C4'-P energy: -106.192 tors. eta vs tors. theta energy: -177.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1847.785928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1847.785928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1847.785928 (E_RNA) where: Base-Base interactions energy: -1137.578 where: short stacking energy: -651.986 Base-Backbone interact. energy: -4.054 local terms energy: -706.153575 where: bonds (distance) C4'-P energy: -164.462 bonds (distance) P-C4' energy: -155.051 flat angles C4'-P-C4' energy: -144.306 flat angles P-C4'-P energy: -91.152 tors. eta vs tors. theta energy: -151.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1758.850057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1758.850057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.850057 (E_RNA) where: Base-Base interactions energy: -1086.057 where: short stacking energy: -593.232 Base-Backbone interact. energy: 2.009 local terms energy: -674.801702 where: bonds (distance) C4'-P energy: -150.570 bonds (distance) P-C4' energy: -152.481 flat angles C4'-P-C4' energy: -151.667 flat angles P-C4'-P energy: -89.709 tors. eta vs tors. theta energy: -130.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1550.748358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.748358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.748358 (E_RNA) where: Base-Base interactions energy: -902.616 where: short stacking energy: -534.374 Base-Backbone interact. energy: -1.790 local terms energy: -646.342810 where: bonds (distance) C4'-P energy: -122.095 bonds (distance) P-C4' energy: -149.937 flat angles C4'-P-C4' energy: -145.474 flat angles P-C4'-P energy: -114.589 tors. eta vs tors. theta energy: -114.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1515.130513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.130513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.130513 (E_RNA) where: Base-Base interactions energy: -885.689 where: short stacking energy: -486.307 Base-Backbone interact. energy: -1.909 local terms energy: -627.532475 where: bonds (distance) C4'-P energy: -144.061 bonds (distance) P-C4' energy: -158.360 flat angles C4'-P-C4' energy: -138.596 flat angles P-C4'-P energy: -93.905 tors. eta vs tors. theta energy: -92.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1160.048254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.048254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.048254 (E_RNA) where: Base-Base interactions energy: -627.420 where: short stacking energy: -387.633 Base-Backbone interact. energy: -3.334 local terms energy: -529.293971 where: bonds (distance) C4'-P energy: -128.258 bonds (distance) P-C4' energy: -147.671 flat angles C4'-P-C4' energy: -123.821 flat angles P-C4'-P energy: -80.551 tors. eta vs tors. theta energy: -48.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1241.552828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.552828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.552828 (E_RNA) where: Base-Base interactions energy: -698.851 where: short stacking energy: -384.561 Base-Backbone interact. energy: -3.614 local terms energy: -539.087615 where: bonds (distance) C4'-P energy: -120.057 bonds (distance) P-C4' energy: -131.693 flat angles C4'-P-C4' energy: -144.313 flat angles P-C4'-P energy: -78.245 tors. eta vs tors. theta energy: -64.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -910.422071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.422071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.422071 (E_RNA) where: Base-Base interactions energy: -439.619 where: short stacking energy: -317.351 Base-Backbone interact. energy: 4.542 local terms energy: -475.344449 where: bonds (distance) C4'-P energy: -121.288 bonds (distance) P-C4' energy: -127.482 flat angles C4'-P-C4' energy: -123.494 flat angles P-C4'-P energy: -72.551 tors. eta vs tors. theta energy: -30.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -828.500956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.500956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.500956 (E_RNA) where: Base-Base interactions energy: -389.338 where: short stacking energy: -250.197 Base-Backbone interact. energy: 4.757 local terms energy: -443.920190 where: bonds (distance) C4'-P energy: -136.038 bonds (distance) P-C4' energy: -125.449 flat angles C4'-P-C4' energy: -126.728 flat angles P-C4'-P energy: -64.648 tors. eta vs tors. theta energy: 8.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -802.679869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.679869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.679869 (E_RNA) where: Base-Base interactions energy: -421.973 where: short stacking energy: -257.378 Base-Backbone interact. energy: -0.056 local terms energy: -380.650868 where: bonds (distance) C4'-P energy: -122.413 bonds (distance) P-C4' energy: -129.752 flat angles C4'-P-C4' energy: -88.859 flat angles P-C4'-P energy: -48.606 tors. eta vs tors. theta energy: 8.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2029.608596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.608596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.608596 (E_RNA) where: Base-Base interactions energy: -1253.446 where: short stacking energy: -711.035 Base-Backbone interact. energy: -3.154 local terms energy: -773.009240 where: bonds (distance) C4'-P energy: -150.145 bonds (distance) P-C4' energy: -162.777 flat angles C4'-P-C4' energy: -165.299 flat angles P-C4'-P energy: -108.073 tors. eta vs tors. theta energy: -186.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1825.757336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1825.757336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1825.757336 (E_RNA) where: Base-Base interactions energy: -1143.844 where: short stacking energy: -635.563 Base-Backbone interact. energy: 4.749 local terms energy: -686.662894 where: bonds (distance) C4'-P energy: -138.068 bonds (distance) P-C4' energy: -149.236 flat angles C4'-P-C4' energy: -169.755 flat angles P-C4'-P energy: -94.684 tors. eta vs tors. theta energy: -134.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1777.187199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1777.187199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.187199 (E_RNA) where: Base-Base interactions energy: -1102.131 where: short stacking energy: -590.997 Base-Backbone interact. energy: -1.121 local terms energy: -673.935476 where: bonds (distance) C4'-P energy: -152.413 bonds (distance) P-C4' energy: -148.379 flat angles C4'-P-C4' energy: -157.428 flat angles P-C4'-P energy: -96.022 tors. eta vs tors. theta energy: -119.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1635.337322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.337322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.337322 (E_RNA) where: Base-Base interactions energy: -1010.862 where: short stacking energy: -548.885 Base-Backbone interact. energy: -0.491 local terms energy: -623.984573 where: bonds (distance) C4'-P energy: -125.406 bonds (distance) P-C4' energy: -137.923 flat angles C4'-P-C4' energy: -153.957 flat angles P-C4'-P energy: -90.961 tors. eta vs tors. theta energy: -115.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1522.267987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.267987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.267987 (E_RNA) where: Base-Base interactions energy: -889.701 where: short stacking energy: -517.044 Base-Backbone interact. energy: 1.956 local terms energy: -634.523276 where: bonds (distance) C4'-P energy: -133.932 bonds (distance) P-C4' energy: -145.973 flat angles C4'-P-C4' energy: -138.475 flat angles P-C4'-P energy: -91.757 tors. eta vs tors. theta energy: -124.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1379.901794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.901794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.901794 (E_RNA) where: Base-Base interactions energy: -835.611 where: short stacking energy: -469.999 Base-Backbone interact. energy: -1.343 local terms energy: -542.948355 where: bonds (distance) C4'-P energy: -97.575 bonds (distance) P-C4' energy: -141.221 flat angles C4'-P-C4' energy: -150.323 flat angles P-C4'-P energy: -71.188 tors. eta vs tors. theta energy: -82.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1063.097871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.097871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.097871 (E_RNA) where: Base-Base interactions energy: -546.524 where: short stacking energy: -345.617 Base-Backbone interact. energy: 0.486 local terms energy: -517.059844 where: bonds (distance) C4'-P energy: -133.315 bonds (distance) P-C4' energy: -126.851 flat angles C4'-P-C4' energy: -114.096 flat angles P-C4'-P energy: -83.916 tors. eta vs tors. theta energy: -58.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1016.045460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.045460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.045460 (E_RNA) where: Base-Base interactions energy: -547.171 where: short stacking energy: -316.614 Base-Backbone interact. energy: 1.005 local terms energy: -469.879469 where: bonds (distance) C4'-P energy: -128.919 bonds (distance) P-C4' energy: -131.253 flat angles C4'-P-C4' energy: -117.877 flat angles P-C4'-P energy: -73.112 tors. eta vs tors. theta energy: -18.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -863.900921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.900921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.900921 (E_RNA) where: Base-Base interactions energy: -429.288 where: short stacking energy: -265.406 Base-Backbone interact. energy: -1.245 local terms energy: -433.367952 where: bonds (distance) C4'-P energy: -113.591 bonds (distance) P-C4' energy: -130.742 flat angles C4'-P-C4' energy: -127.935 flat angles P-C4'-P energy: -55.700 tors. eta vs tors. theta energy: -5.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -821.284667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.284667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.284667 (E_RNA) where: Base-Base interactions energy: -421.711 where: short stacking energy: -281.779 Base-Backbone interact. energy: 2.721 local terms energy: -402.295301 where: bonds (distance) C4'-P energy: -99.054 bonds (distance) P-C4' energy: -126.748 flat angles C4'-P-C4' energy: -104.127 flat angles P-C4'-P energy: -54.489 tors. eta vs tors. theta energy: -17.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2074.507686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2074.507686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.507686 (E_RNA) where: Base-Base interactions energy: -1310.866 where: short stacking energy: -734.135 Base-Backbone interact. energy: -5.982 local terms energy: -757.659786 where: bonds (distance) C4'-P energy: -154.062 bonds (distance) P-C4' energy: -155.288 flat angles C4'-P-C4' energy: -163.934 flat angles P-C4'-P energy: -100.478 tors. eta vs tors. theta energy: -183.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1831.913169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1831.913169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1831.913169 (E_RNA) where: Base-Base interactions energy: -1106.194 where: short stacking energy: -593.153 Base-Backbone interact. energy: 1.016 local terms energy: -726.735573 where: bonds (distance) C4'-P energy: -153.526 bonds (distance) P-C4' energy: -159.595 flat angles C4'-P-C4' energy: -159.031 flat angles P-C4'-P energy: -114.224 tors. eta vs tors. theta energy: -140.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1746.726896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.726896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.726896 (E_RNA) where: Base-Base interactions energy: -1066.654 where: short stacking energy: -603.150 Base-Backbone interact. energy: -3.786 local terms energy: -676.287403 where: bonds (distance) C4'-P energy: -138.129 bonds (distance) P-C4' energy: -145.175 flat angles C4'-P-C4' energy: -152.465 flat angles P-C4'-P energy: -96.809 tors. eta vs tors. theta energy: -143.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1720.934340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.934340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.934340 (E_RNA) where: Base-Base interactions energy: -1053.067 where: short stacking energy: -552.517 Base-Backbone interact. energy: -2.586 local terms energy: -665.281356 where: bonds (distance) C4'-P energy: -134.055 bonds (distance) P-C4' energy: -154.927 flat angles C4'-P-C4' energy: -160.516 flat angles P-C4'-P energy: -97.535 tors. eta vs tors. theta energy: -118.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1431.735255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.735255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.735255 (E_RNA) where: Base-Base interactions energy: -831.229 where: short stacking energy: -469.635 Base-Backbone interact. energy: -4.424 local terms energy: -596.082515 where: bonds (distance) C4'-P energy: -133.366 bonds (distance) P-C4' energy: -133.123 flat angles C4'-P-C4' energy: -148.576 flat angles P-C4'-P energy: -88.253 tors. eta vs tors. theta energy: -92.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1393.418006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.418006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.418006 (E_RNA) where: Base-Base interactions energy: -853.493 where: short stacking energy: -461.314 Base-Backbone interact. energy: -1.988 local terms energy: -537.937615 where: bonds (distance) C4'-P energy: -133.516 bonds (distance) P-C4' energy: -134.556 flat angles C4'-P-C4' energy: -126.095 flat angles P-C4'-P energy: -84.271 tors. eta vs tors. theta energy: -59.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1264.970430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.970430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.970430 (E_RNA) where: Base-Base interactions energy: -761.439 where: short stacking energy: -408.021 Base-Backbone interact. energy: -0.569 local terms energy: -502.962289 where: bonds (distance) C4'-P energy: -140.635 bonds (distance) P-C4' energy: -115.661 flat angles C4'-P-C4' energy: -129.129 flat angles P-C4'-P energy: -70.041 tors. eta vs tors. theta energy: -47.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -907.849297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.849297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.849297 (E_RNA) where: Base-Base interactions energy: -465.977 where: short stacking energy: -320.620 Base-Backbone interact. energy: 9.350 local terms energy: -451.221647 where: bonds (distance) C4'-P energy: -120.713 bonds (distance) P-C4' energy: -115.766 flat angles C4'-P-C4' energy: -102.730 flat angles P-C4'-P energy: -79.650 tors. eta vs tors. theta energy: -32.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -850.833314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.833314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.833314 (E_RNA) where: Base-Base interactions energy: -418.197 where: short stacking energy: -245.063 Base-Backbone interact. energy: 0.279 local terms energy: -432.915477 where: bonds (distance) C4'-P energy: -125.777 bonds (distance) P-C4' energy: -114.639 flat angles C4'-P-C4' energy: -136.698 flat angles P-C4'-P energy: -64.000 tors. eta vs tors. theta energy: 8.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -784.830766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.830766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.830766 (E_RNA) where: Base-Base interactions energy: -348.034 where: short stacking energy: -237.618 Base-Backbone interact. energy: -2.550 local terms energy: -434.246703 where: bonds (distance) C4'-P energy: -115.555 bonds (distance) P-C4' energy: -128.836 flat angles C4'-P-C4' energy: -131.243 flat angles P-C4'-P energy: -66.143 tors. eta vs tors. theta energy: 7.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2128.757831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.757831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.757831 (E_RNA) where: Base-Base interactions energy: -1379.487 where: short stacking energy: -731.231 Base-Backbone interact. energy: -3.034 local terms energy: -746.236293 where: bonds (distance) C4'-P energy: -150.550 bonds (distance) P-C4' energy: -154.388 flat angles C4'-P-C4' energy: -161.694 flat angles P-C4'-P energy: -90.619 tors. eta vs tors. theta energy: -188.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1870.655395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1870.655395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1870.655395 (E_RNA) where: Base-Base interactions energy: -1176.518 where: short stacking energy: -634.313 Base-Backbone interact. energy: 1.200 local terms energy: -695.337073 where: bonds (distance) C4'-P energy: -158.974 bonds (distance) P-C4' energy: -141.697 flat angles C4'-P-C4' energy: -155.681 flat angles P-C4'-P energy: -98.003 tors. eta vs tors. theta energy: -140.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1749.262227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.262227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1749.262227 (E_RNA) where: Base-Base interactions energy: -1073.660 where: short stacking energy: -601.796 Base-Backbone interact. energy: -2.954 local terms energy: -672.648314 where: bonds (distance) C4'-P energy: -150.722 bonds (distance) P-C4' energy: -135.425 flat angles C4'-P-C4' energy: -153.838 flat angles P-C4'-P energy: -104.099 tors. eta vs tors. theta energy: -128.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1707.366990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.366990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.366990 (E_RNA) where: Base-Base interactions energy: -1039.631 where: short stacking energy: -559.646 Base-Backbone interact. energy: -3.751 local terms energy: -663.984751 where: bonds (distance) C4'-P energy: -142.336 bonds (distance) P-C4' energy: -147.355 flat angles C4'-P-C4' energy: -161.672 flat angles P-C4'-P energy: -92.737 tors. eta vs tors. theta energy: -119.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1538.312904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.312904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1538.312904 (E_RNA) where: Base-Base interactions energy: -903.128 where: short stacking energy: -542.178 Base-Backbone interact. energy: -0.919 local terms energy: -634.265563 where: bonds (distance) C4'-P energy: -118.874 bonds (distance) P-C4' energy: -142.644 flat angles C4'-P-C4' energy: -151.536 flat angles P-C4'-P energy: -91.174 tors. eta vs tors. theta energy: -130.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1378.171847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.171847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.171847 (E_RNA) where: Base-Base interactions energy: -852.358 where: short stacking energy: -489.640 Base-Backbone interact. energy: -1.190 local terms energy: -524.623574 where: bonds (distance) C4'-P energy: -122.703 bonds (distance) P-C4' energy: -127.061 flat angles C4'-P-C4' energy: -119.188 flat angles P-C4'-P energy: -76.437 tors. eta vs tors. theta energy: -79.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1326.987613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.987613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.987613 (E_RNA) where: Base-Base interactions energy: -757.917 where: short stacking energy: -410.937 Base-Backbone interact. energy: 2.382 local terms energy: -571.452837 where: bonds (distance) C4'-P energy: -127.800 bonds (distance) P-C4' energy: -145.852 flat angles C4'-P-C4' energy: -137.536 flat angles P-C4'-P energy: -74.722 tors. eta vs tors. theta energy: -85.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -976.816785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.816785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.816785 (E_RNA) where: Base-Base interactions energy: -524.002 where: short stacking energy: -322.700 Base-Backbone interact. energy: -2.032 local terms energy: -450.782056 where: bonds (distance) C4'-P energy: -133.055 bonds (distance) P-C4' energy: -125.131 flat angles C4'-P-C4' energy: -115.712 flat angles P-C4'-P energy: -52.917 tors. eta vs tors. theta energy: -23.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -927.738166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.738166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.738166 (E_RNA) where: Base-Base interactions energy: -489.469 where: short stacking energy: -247.515 Base-Backbone interact. energy: -1.019 local terms energy: -437.250307 where: bonds (distance) C4'-P energy: -120.237 bonds (distance) P-C4' energy: -129.682 flat angles C4'-P-C4' energy: -101.841 flat angles P-C4'-P energy: -88.104 tors. eta vs tors. theta energy: 2.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -793.130255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.130255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.130255 (E_RNA) where: Base-Base interactions energy: -371.905 where: short stacking energy: -251.996 Base-Backbone interact. energy: 3.799 local terms energy: -425.024495 where: bonds (distance) C4'-P energy: -115.402 bonds (distance) P-C4' energy: -131.596 flat angles C4'-P-C4' energy: -94.436 flat angles P-C4'-P energy: -67.327 tors. eta vs tors. theta energy: -16.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2134.626619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2134.626619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2134.626619 (E_RNA) where: Base-Base interactions energy: -1355.757 where: short stacking energy: -751.423 Base-Backbone interact. energy: -3.902 local terms energy: -774.967692 where: bonds (distance) C4'-P energy: -148.160 bonds (distance) P-C4' energy: -154.475 flat angles C4'-P-C4' energy: -163.708 flat angles P-C4'-P energy: -107.799 tors. eta vs tors. theta energy: -200.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1914.773225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.773225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.773225 (E_RNA) where: Base-Base interactions energy: -1197.105 where: short stacking energy: -631.797 Base-Backbone interact. energy: -4.094 local terms energy: -713.573750 where: bonds (distance) C4'-P energy: -144.680 bonds (distance) P-C4' energy: -150.523 flat angles C4'-P-C4' energy: -156.063 flat angles P-C4'-P energy: -112.089 tors. eta vs tors. theta energy: -150.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1827.473240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.473240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.473240 (E_RNA) where: Base-Base interactions energy: -1155.001 where: short stacking energy: -617.581 Base-Backbone interact. energy: -2.676 local terms energy: -669.795683 where: bonds (distance) C4'-P energy: -137.270 bonds (distance) P-C4' energy: -153.613 flat angles C4'-P-C4' energy: -143.039 flat angles P-C4'-P energy: -103.644 tors. eta vs tors. theta energy: -132.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1717.317323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.317323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.317323 (E_RNA) where: Base-Base interactions energy: -1076.853 where: short stacking energy: -550.497 Base-Backbone interact. energy: -2.240 local terms energy: -638.224654 where: bonds (distance) C4'-P energy: -137.180 bonds (distance) P-C4' energy: -144.231 flat angles C4'-P-C4' energy: -154.197 flat angles P-C4'-P energy: -83.426 tors. eta vs tors. theta energy: -119.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1493.757626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.757626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.757626 (E_RNA) where: Base-Base interactions energy: -909.837 where: short stacking energy: -482.548 Base-Backbone interact. energy: 2.503 local terms energy: -586.423561 where: bonds (distance) C4'-P energy: -134.494 bonds (distance) P-C4' energy: -154.546 flat angles C4'-P-C4' energy: -137.002 flat angles P-C4'-P energy: -75.319 tors. eta vs tors. theta energy: -85.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1466.264575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.264575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.264575 (E_RNA) where: Base-Base interactions energy: -851.290 where: short stacking energy: -489.260 Base-Backbone interact. energy: 1.238 local terms energy: -616.212130 where: bonds (distance) C4'-P energy: -134.827 bonds (distance) P-C4' energy: -138.588 flat angles C4'-P-C4' energy: -140.659 flat angles P-C4'-P energy: -104.675 tors. eta vs tors. theta energy: -97.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1342.694887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.694887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.694887 (E_RNA) where: Base-Base interactions energy: -806.745 where: short stacking energy: -410.881 Base-Backbone interact. energy: 1.559 local terms energy: -537.508274 where: bonds (distance) C4'-P energy: -124.323 bonds (distance) P-C4' energy: -133.174 flat angles C4'-P-C4' energy: -122.561 flat angles P-C4'-P energy: -82.587 tors. eta vs tors. theta energy: -74.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1037.045245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.045245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.045245 (E_RNA) where: Base-Base interactions energy: -569.751 where: short stacking energy: -291.468 Base-Backbone interact. energy: -7.097 local terms energy: -460.197071 where: bonds (distance) C4'-P energy: -112.290 bonds (distance) P-C4' energy: -139.023 flat angles C4'-P-C4' energy: -117.848 flat angles P-C4'-P energy: -70.340 tors. eta vs tors. theta energy: -20.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -978.649791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.649791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.649791 (E_RNA) where: Base-Base interactions energy: -515.741 where: short stacking energy: -300.434 Base-Backbone interact. energy: 8.779 local terms energy: -471.687712 where: bonds (distance) C4'-P energy: -108.214 bonds (distance) P-C4' energy: -139.499 flat angles C4'-P-C4' energy: -100.117 flat angles P-C4'-P energy: -94.246 tors. eta vs tors. theta energy: -29.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -791.153016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.153016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.153016 (E_RNA) where: Base-Base interactions energy: -368.135 where: short stacking energy: -238.002 Base-Backbone interact. energy: -0.832 local terms energy: -422.185673 where: bonds (distance) C4'-P energy: -112.076 bonds (distance) P-C4' energy: -134.791 flat angles C4'-P-C4' energy: -97.382 flat angles P-C4'-P energy: -70.855 tors. eta vs tors. theta energy: -7.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2143.867317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2143.867317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2143.867317 (E_RNA) where: Base-Base interactions energy: -1378.812 where: short stacking energy: -734.782 Base-Backbone interact. energy: -3.256 local terms energy: -761.799614 where: bonds (distance) C4'-P energy: -162.848 bonds (distance) P-C4' energy: -137.541 flat angles C4'-P-C4' energy: -171.215 flat angles P-C4'-P energy: -107.883 tors. eta vs tors. theta energy: -182.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1931.923184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.923184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.923184 (E_RNA) where: Base-Base interactions energy: -1234.775 where: short stacking energy: -617.069 Base-Backbone interact. energy: -1.541 local terms energy: -695.607161 where: bonds (distance) C4'-P energy: -166.088 bonds (distance) P-C4' energy: -156.056 flat angles C4'-P-C4' energy: -147.883 flat angles P-C4'-P energy: -88.670 tors. eta vs tors. theta energy: -136.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1933.197048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1933.197048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1933.197048 (E_RNA) where: Base-Base interactions energy: -1251.536 where: short stacking energy: -633.404 Base-Backbone interact. energy: 1.846 local terms energy: -683.507285 where: bonds (distance) C4'-P energy: -140.409 bonds (distance) P-C4' energy: -148.053 flat angles C4'-P-C4' energy: -160.628 flat angles P-C4'-P energy: -94.636 tors. eta vs tors. theta energy: -139.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1726.477767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.477767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.477767 (E_RNA) where: Base-Base interactions energy: -1055.803 where: short stacking energy: -562.646 Base-Backbone interact. energy: 0.218 local terms energy: -670.893078 where: bonds (distance) C4'-P energy: -148.079 bonds (distance) P-C4' energy: -147.637 flat angles C4'-P-C4' energy: -168.373 flat angles P-C4'-P energy: -83.225 tors. eta vs tors. theta energy: -123.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1528.997415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.997415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.997415 (E_RNA) where: Base-Base interactions energy: -907.012 where: short stacking energy: -479.847 Base-Backbone interact. energy: -1.509 local terms energy: -620.477258 where: bonds (distance) C4'-P energy: -139.345 bonds (distance) P-C4' energy: -144.907 flat angles C4'-P-C4' energy: -144.607 flat angles P-C4'-P energy: -100.802 tors. eta vs tors. theta energy: -90.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1496.683269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.683269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.683269 (E_RNA) where: Base-Base interactions energy: -902.336 where: short stacking energy: -533.082 Base-Backbone interact. energy: 0.331 local terms energy: -594.678719 where: bonds (distance) C4'-P energy: -117.756 bonds (distance) P-C4' energy: -138.571 flat angles C4'-P-C4' energy: -125.864 flat angles P-C4'-P energy: -96.047 tors. eta vs tors. theta energy: -116.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1346.684584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.684584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.684584 (E_RNA) where: Base-Base interactions energy: -819.456 where: short stacking energy: -420.058 Base-Backbone interact. energy: -1.933 local terms energy: -525.294980 where: bonds (distance) C4'-P energy: -145.689 bonds (distance) P-C4' energy: -130.888 flat angles C4'-P-C4' energy: -125.657 flat angles P-C4'-P energy: -55.283 tors. eta vs tors. theta energy: -67.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1134.892662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.892662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.892662 (E_RNA) where: Base-Base interactions energy: -661.585 where: short stacking energy: -349.323 Base-Backbone interact. energy: 0.513 local terms energy: -473.819963 where: bonds (distance) C4'-P energy: -118.354 bonds (distance) P-C4' energy: -141.865 flat angles C4'-P-C4' energy: -114.839 flat angles P-C4'-P energy: -77.539 tors. eta vs tors. theta energy: -21.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1004.900735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.900735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.900735 (E_RNA) where: Base-Base interactions energy: -547.544 where: short stacking energy: -332.632 Base-Backbone interact. energy: -1.421 local terms energy: -455.936121 where: bonds (distance) C4'-P energy: -120.610 bonds (distance) P-C4' energy: -121.482 flat angles C4'-P-C4' energy: -115.442 flat angles P-C4'-P energy: -68.545 tors. eta vs tors. theta energy: -29.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -824.433262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.433262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.433262 (E_RNA) where: Base-Base interactions energy: -417.690 where: short stacking energy: -261.768 Base-Backbone interact. energy: 0.186 local terms energy: -406.929668 where: bonds (distance) C4'-P energy: -114.240 bonds (distance) P-C4' energy: -135.066 flat angles C4'-P-C4' energy: -95.999 flat angles P-C4'-P energy: -73.689 tors. eta vs tors. theta energy: 12.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2133.816184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.816184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.816184 (E_RNA) where: Base-Base interactions energy: -1371.964 where: short stacking energy: -714.447 Base-Backbone interact. energy: -1.828 local terms energy: -760.024131 where: bonds (distance) C4'-P energy: -137.907 bonds (distance) P-C4' energy: -153.911 flat angles C4'-P-C4' energy: -173.049 flat angles P-C4'-P energy: -99.995 tors. eta vs tors. theta energy: -195.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1943.949921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.949921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.949921 (E_RNA) where: Base-Base interactions energy: -1222.089 where: short stacking energy: -655.885 Base-Backbone interact. energy: -2.121 local terms energy: -719.740187 where: bonds (distance) C4'-P energy: -135.434 bonds (distance) P-C4' energy: -160.243 flat angles C4'-P-C4' energy: -154.627 flat angles P-C4'-P energy: -108.710 tors. eta vs tors. theta energy: -160.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1936.253835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.253835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.253835 (E_RNA) where: Base-Base interactions energy: -1237.675 where: short stacking energy: -580.517 Base-Backbone interact. energy: 0.478 local terms energy: -699.055995 where: bonds (distance) C4'-P energy: -158.264 bonds (distance) P-C4' energy: -134.468 flat angles C4'-P-C4' energy: -155.520 flat angles P-C4'-P energy: -113.506 tors. eta vs tors. theta energy: -137.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1699.712793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1699.712793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.712793 (E_RNA) where: Base-Base interactions energy: -1053.484 where: short stacking energy: -543.418 Base-Backbone interact. energy: -1.388 local terms energy: -644.841022 where: bonds (distance) C4'-P energy: -157.197 bonds (distance) P-C4' energy: -148.764 flat angles C4'-P-C4' energy: -156.959 flat angles P-C4'-P energy: -55.413 tors. eta vs tors. theta energy: -126.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1652.958044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.958044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.958044 (E_RNA) where: Base-Base interactions energy: -1030.636 where: short stacking energy: -516.749 Base-Backbone interact. energy: 3.355 local terms energy: -625.677393 where: bonds (distance) C4'-P energy: -146.066 bonds (distance) P-C4' energy: -130.065 flat angles C4'-P-C4' energy: -132.093 flat angles P-C4'-P energy: -102.643 tors. eta vs tors. theta energy: -114.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1430.083676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.083676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.083676 (E_RNA) where: Base-Base interactions energy: -898.112 where: short stacking energy: -501.815 Base-Backbone interact. energy: -0.593 local terms energy: -531.378863 where: bonds (distance) C4'-P energy: -140.682 bonds (distance) P-C4' energy: -120.230 flat angles C4'-P-C4' energy: -109.099 flat angles P-C4'-P energy: -72.724 tors. eta vs tors. theta energy: -88.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1330.148107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.148107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.148107 (E_RNA) where: Base-Base interactions energy: -814.660 where: short stacking energy: -421.367 Base-Backbone interact. energy: 2.106 local terms energy: -517.593482 where: bonds (distance) C4'-P energy: -137.527 bonds (distance) P-C4' energy: -148.839 flat angles C4'-P-C4' energy: -118.593 flat angles P-C4'-P energy: -64.474 tors. eta vs tors. theta energy: -48.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1100.292386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.292386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.292386 (E_RNA) where: Base-Base interactions energy: -640.666 where: short stacking energy: -361.850 Base-Backbone interact. energy: 1.598 local terms energy: -461.223685 where: bonds (distance) C4'-P energy: -125.462 bonds (distance) P-C4' energy: -126.247 flat angles C4'-P-C4' energy: -122.353 flat angles P-C4'-P energy: -58.457 tors. eta vs tors. theta energy: -28.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1055.117618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.117618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.117618 (E_RNA) where: Base-Base interactions energy: -584.858 where: short stacking energy: -302.347 Base-Backbone interact. energy: -0.535 local terms energy: -469.723996 where: bonds (distance) C4'-P energy: -129.666 bonds (distance) P-C4' energy: -127.618 flat angles C4'-P-C4' energy: -139.418 flat angles P-C4'-P energy: -46.376 tors. eta vs tors. theta energy: -26.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -811.017590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.017590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.017590 (E_RNA) where: Base-Base interactions energy: -398.621 where: short stacking energy: -217.945 Base-Backbone interact. energy: -4.243 local terms energy: -408.153309 where: bonds (distance) C4'-P energy: -100.419 bonds (distance) P-C4' energy: -140.286 flat angles C4'-P-C4' energy: -101.581 flat angles P-C4'-P energy: -67.389 tors. eta vs tors. theta energy: 1.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2124.226310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.226310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.226310 (E_RNA) where: Base-Base interactions energy: -1369.566 where: short stacking energy: -744.257 Base-Backbone interact. energy: -0.539 local terms energy: -754.121584 where: bonds (distance) C4'-P energy: -141.037 bonds (distance) P-C4' energy: -142.344 flat angles C4'-P-C4' energy: -164.706 flat angles P-C4'-P energy: -101.535 tors. eta vs tors. theta energy: -204.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1983.063843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.063843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1983.063843 (E_RNA) where: Base-Base interactions energy: -1274.691 where: short stacking energy: -687.981 Base-Backbone interact. energy: 1.258 local terms energy: -709.630709 where: bonds (distance) C4'-P energy: -154.568 bonds (distance) P-C4' energy: -149.143 flat angles C4'-P-C4' energy: -156.288 flat angles P-C4'-P energy: -95.013 tors. eta vs tors. theta energy: -154.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1897.035330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1897.035330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1897.035330 (E_RNA) where: Base-Base interactions energy: -1228.317 where: short stacking energy: -601.747 Base-Backbone interact. energy: -0.290 local terms energy: -668.428370 where: bonds (distance) C4'-P energy: -125.729 bonds (distance) P-C4' energy: -154.103 flat angles C4'-P-C4' energy: -162.876 flat angles P-C4'-P energy: -100.838 tors. eta vs tors. theta energy: -124.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1800.955698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.955698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.955698 (E_RNA) where: Base-Base interactions energy: -1137.673 where: short stacking energy: -566.788 Base-Backbone interact. energy: 0.253 local terms energy: -663.535313 where: bonds (distance) C4'-P energy: -157.442 bonds (distance) P-C4' energy: -140.028 flat angles C4'-P-C4' energy: -148.896 flat angles P-C4'-P energy: -92.143 tors. eta vs tors. theta energy: -125.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1603.699623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.699623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.699623 (E_RNA) where: Base-Base interactions energy: -993.354 where: short stacking energy: -531.167 Base-Backbone interact. energy: -1.593 local terms energy: -608.752450 where: bonds (distance) C4'-P energy: -139.399 bonds (distance) P-C4' energy: -135.467 flat angles C4'-P-C4' energy: -131.226 flat angles P-C4'-P energy: -90.720 tors. eta vs tors. theta energy: -111.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1465.353810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.353810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.353810 (E_RNA) where: Base-Base interactions energy: -924.040 where: short stacking energy: -507.018 Base-Backbone interact. energy: -0.829 local terms energy: -540.485309 where: bonds (distance) C4'-P energy: -113.831 bonds (distance) P-C4' energy: -117.788 flat angles C4'-P-C4' energy: -150.324 flat angles P-C4'-P energy: -70.802 tors. eta vs tors. theta energy: -87.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1334.526303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.526303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.526303 (E_RNA) where: Base-Base interactions energy: -810.009 where: short stacking energy: -400.115 Base-Backbone interact. energy: -2.250 local terms energy: -522.266887 where: bonds (distance) C4'-P energy: -129.031 bonds (distance) P-C4' energy: -128.709 flat angles C4'-P-C4' energy: -133.703 flat angles P-C4'-P energy: -70.117 tors. eta vs tors. theta energy: -60.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1067.203889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.203889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.203889 (E_RNA) where: Base-Base interactions energy: -571.311 where: short stacking energy: -328.627 Base-Backbone interact. energy: 3.021 local terms energy: -498.914528 where: bonds (distance) C4'-P energy: -142.684 bonds (distance) P-C4' energy: -119.338 flat angles C4'-P-C4' energy: -122.173 flat angles P-C4'-P energy: -73.865 tors. eta vs tors. theta energy: -40.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1027.461463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.461463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.461463 (E_RNA) where: Base-Base interactions energy: -577.936 where: short stacking energy: -325.355 Base-Backbone interact. energy: 1.789 local terms energy: -451.314944 where: bonds (distance) C4'-P energy: -124.743 bonds (distance) P-C4' energy: -134.169 flat angles C4'-P-C4' energy: -125.931 flat angles P-C4'-P energy: -48.539 tors. eta vs tors. theta energy: -17.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -813.947633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.947633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.947633 (E_RNA) where: Base-Base interactions energy: -391.016 where: short stacking energy: -248.854 Base-Backbone interact. energy: -1.984 local terms energy: -420.947842 where: bonds (distance) C4'-P energy: -137.275 bonds (distance) P-C4' energy: -113.744 flat angles C4'-P-C4' energy: -105.750 flat angles P-C4'-P energy: -63.563 tors. eta vs tors. theta energy: -0.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2175.091809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2175.091809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.091809 (E_RNA) where: Base-Base interactions energy: -1426.540 where: short stacking energy: -730.304 Base-Backbone interact. energy: 0.180 local terms energy: -748.731554 where: bonds (distance) C4'-P energy: -150.178 bonds (distance) P-C4' energy: -149.660 flat angles C4'-P-C4' energy: -174.753 flat angles P-C4'-P energy: -91.607 tors. eta vs tors. theta energy: -182.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1950.524797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1950.524797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1950.524797 (E_RNA) where: Base-Base interactions energy: -1260.067 where: short stacking energy: -628.020 Base-Backbone interact. energy: -2.704 local terms energy: -687.753112 where: bonds (distance) C4'-P energy: -136.949 bonds (distance) P-C4' energy: -153.949 flat angles C4'-P-C4' energy: -145.970 flat angles P-C4'-P energy: -102.580 tors. eta vs tors. theta energy: -148.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1928.638826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.638826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.638826 (E_RNA) where: Base-Base interactions energy: -1245.910 where: short stacking energy: -641.321 Base-Backbone interact. energy: -6.275 local terms energy: -676.453477 where: bonds (distance) C4'-P energy: -133.236 bonds (distance) P-C4' energy: -148.656 flat angles C4'-P-C4' energy: -154.364 flat angles P-C4'-P energy: -104.492 tors. eta vs tors. theta energy: -135.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1799.004907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.004907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.004907 (E_RNA) where: Base-Base interactions energy: -1111.911 where: short stacking energy: -579.207 Base-Backbone interact. energy: 2.129 local terms energy: -689.222722 where: bonds (distance) C4'-P energy: -132.215 bonds (distance) P-C4' energy: -151.066 flat angles C4'-P-C4' energy: -153.244 flat angles P-C4'-P energy: -112.185 tors. eta vs tors. theta energy: -140.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1571.270953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.270953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.270953 (E_RNA) where: Base-Base interactions energy: -967.170 where: short stacking energy: -517.184 Base-Backbone interact. energy: 1.197 local terms energy: -605.297980 where: bonds (distance) C4'-P energy: -120.767 bonds (distance) P-C4' energy: -142.547 flat angles C4'-P-C4' energy: -154.309 flat angles P-C4'-P energy: -95.585 tors. eta vs tors. theta energy: -92.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1438.218211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.218211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.218211 (E_RNA) where: Base-Base interactions energy: -848.165 where: short stacking energy: -459.884 Base-Backbone interact. energy: 4.693 local terms energy: -594.746173 where: bonds (distance) C4'-P energy: -131.415 bonds (distance) P-C4' energy: -145.028 flat angles C4'-P-C4' energy: -151.004 flat angles P-C4'-P energy: -76.854 tors. eta vs tors. theta energy: -90.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1384.061608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.061608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.061608 (E_RNA) where: Base-Base interactions energy: -801.285 where: short stacking energy: -423.179 Base-Backbone interact. energy: 2.510 local terms energy: -585.286127 where: bonds (distance) C4'-P energy: -139.168 bonds (distance) P-C4' energy: -141.895 flat angles C4'-P-C4' energy: -138.596 flat angles P-C4'-P energy: -93.867 tors. eta vs tors. theta energy: -71.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1093.422299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.422299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.422299 (E_RNA) where: Base-Base interactions energy: -593.821 where: short stacking energy: -341.248 Base-Backbone interact. energy: -1.067 local terms energy: -498.534508 where: bonds (distance) C4'-P energy: -124.139 bonds (distance) P-C4' energy: -126.438 flat angles C4'-P-C4' energy: -121.816 flat angles P-C4'-P energy: -76.365 tors. eta vs tors. theta energy: -49.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1011.584816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.584816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.584816 (E_RNA) where: Base-Base interactions energy: -557.582 where: short stacking energy: -318.649 Base-Backbone interact. energy: -1.105 local terms energy: -452.897951 where: bonds (distance) C4'-P energy: -119.163 bonds (distance) P-C4' energy: -137.270 flat angles C4'-P-C4' energy: -114.345 flat angles P-C4'-P energy: -62.313 tors. eta vs tors. theta energy: -19.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -826.204845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.204845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.204845 (E_RNA) where: Base-Base interactions energy: -396.192 where: short stacking energy: -235.980 Base-Backbone interact. energy: -1.852 local terms energy: -428.160270 where: bonds (distance) C4'-P energy: -131.276 bonds (distance) P-C4' energy: -123.955 flat angles C4'-P-C4' energy: -104.364 flat angles P-C4'-P energy: -64.941 tors. eta vs tors. theta energy: -3.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2194.567104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.567104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.567104 (E_RNA) where: Base-Base interactions energy: -1427.904 where: short stacking energy: -749.744 Base-Backbone interact. energy: -5.047 local terms energy: -761.616019 where: bonds (distance) C4'-P energy: -132.122 bonds (distance) P-C4' energy: -153.036 flat angles C4'-P-C4' energy: -166.675 flat angles P-C4'-P energy: -110.487 tors. eta vs tors. theta energy: -199.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1969.855706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1969.855706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1969.855706 (E_RNA) where: Base-Base interactions energy: -1252.064 where: short stacking energy: -638.683 Base-Backbone interact. energy: -2.027 local terms energy: -715.765086 where: bonds (distance) C4'-P energy: -146.940 bonds (distance) P-C4' energy: -144.734 flat angles C4'-P-C4' energy: -156.145 flat angles P-C4'-P energy: -111.495 tors. eta vs tors. theta energy: -156.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1950.253621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1950.253621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1950.253621 (E_RNA) where: Base-Base interactions energy: -1229.602 where: short stacking energy: -658.682 Base-Backbone interact. energy: -2.596 local terms energy: -718.055663 where: bonds (distance) C4'-P energy: -149.933 bonds (distance) P-C4' energy: -141.284 flat angles C4'-P-C4' energy: -162.537 flat angles P-C4'-P energy: -107.810 tors. eta vs tors. theta energy: -156.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1805.533528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1805.533528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1805.533528 (E_RNA) where: Base-Base interactions energy: -1149.624 where: short stacking energy: -598.865 Base-Backbone interact. energy: -3.512 local terms energy: -652.397588 where: bonds (distance) C4'-P energy: -127.469 bonds (distance) P-C4' energy: -129.936 flat angles C4'-P-C4' energy: -166.504 flat angles P-C4'-P energy: -86.339 tors. eta vs tors. theta energy: -142.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1574.864588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1574.864588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.864588 (E_RNA) where: Base-Base interactions energy: -984.163 where: short stacking energy: -497.752 Base-Backbone interact. energy: 6.974 local terms energy: -597.675421 where: bonds (distance) C4'-P energy: -125.177 bonds (distance) P-C4' energy: -145.213 flat angles C4'-P-C4' energy: -156.673 flat angles P-C4'-P energy: -75.251 tors. eta vs tors. theta energy: -95.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1447.431274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.431274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.431274 (E_RNA) where: Base-Base interactions energy: -880.614 where: short stacking energy: -459.250 Base-Backbone interact. energy: -0.811 local terms energy: -566.007153 where: bonds (distance) C4'-P energy: -132.440 bonds (distance) P-C4' energy: -127.232 flat angles C4'-P-C4' energy: -136.346 flat angles P-C4'-P energy: -85.729 tors. eta vs tors. theta energy: -84.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1421.911157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.911157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.911157 (E_RNA) where: Base-Base interactions energy: -871.243 where: short stacking energy: -445.500 Base-Backbone interact. energy: -0.685 local terms energy: -549.983601 where: bonds (distance) C4'-P energy: -128.658 bonds (distance) P-C4' energy: -139.265 flat angles C4'-P-C4' energy: -127.628 flat angles P-C4'-P energy: -82.665 tors. eta vs tors. theta energy: -71.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1052.310240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.310240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.310240 (E_RNA) where: Base-Base interactions energy: -582.438 where: short stacking energy: -334.360 Base-Backbone interact. energy: 10.823 local terms energy: -480.695518 where: bonds (distance) C4'-P energy: -131.470 bonds (distance) P-C4' energy: -130.650 flat angles C4'-P-C4' energy: -117.001 flat angles P-C4'-P energy: -74.185 tors. eta vs tors. theta energy: -27.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1053.241824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.241824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.241824 (E_RNA) where: Base-Base interactions energy: -598.906 where: short stacking energy: -335.271 Base-Backbone interact. energy: -1.561 local terms energy: -452.775361 where: bonds (distance) C4'-P energy: -111.586 bonds (distance) P-C4' energy: -118.256 flat angles C4'-P-C4' energy: -120.821 flat angles P-C4'-P energy: -78.784 tors. eta vs tors. theta energy: -23.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -889.317527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.317527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.317527 (E_RNA) where: Base-Base interactions energy: -471.973 where: short stacking energy: -293.790 Base-Backbone interact. energy: -0.369 local terms energy: -416.976037 where: bonds (distance) C4'-P energy: -120.075 bonds (distance) P-C4' energy: -131.118 flat angles C4'-P-C4' energy: -102.132 flat angles P-C4'-P energy: -52.871 tors. eta vs tors. theta energy: -10.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2261.731689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2261.731689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.731689 (E_RNA) where: Base-Base interactions energy: -1453.374 where: short stacking energy: -784.158 Base-Backbone interact. energy: -2.108 local terms energy: -806.249097 where: bonds (distance) C4'-P energy: -153.853 bonds (distance) P-C4' energy: -165.269 flat angles C4'-P-C4' energy: -162.720 flat angles P-C4'-P energy: -103.892 tors. eta vs tors. theta energy: -220.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1979.959842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.959842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.959842 (E_RNA) where: Base-Base interactions energy: -1282.203 where: short stacking energy: -684.533 Base-Backbone interact. energy: -0.704 local terms energy: -697.053399 where: bonds (distance) C4'-P energy: -132.768 bonds (distance) P-C4' energy: -144.302 flat angles C4'-P-C4' energy: -163.992 flat angles P-C4'-P energy: -92.266 tors. eta vs tors. theta energy: -163.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -2008.248911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2008.248911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2008.248911 (E_RNA) where: Base-Base interactions energy: -1313.692 where: short stacking energy: -684.335 Base-Backbone interact. energy: -2.218 local terms energy: -692.339153 where: bonds (distance) C4'-P energy: -129.462 bonds (distance) P-C4' energy: -159.121 flat angles C4'-P-C4' energy: -141.701 flat angles P-C4'-P energy: -95.946 tors. eta vs tors. theta energy: -166.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1868.742963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.742963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1868.742963 (E_RNA) where: Base-Base interactions energy: -1220.465 where: short stacking energy: -605.969 Base-Backbone interact. energy: -2.108 local terms energy: -646.170181 where: bonds (distance) C4'-P energy: -126.005 bonds (distance) P-C4' energy: -140.599 flat angles C4'-P-C4' energy: -156.763 flat angles P-C4'-P energy: -82.279 tors. eta vs tors. theta energy: -140.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1689.958453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.958453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.958453 (E_RNA) where: Base-Base interactions energy: -1063.139 where: short stacking energy: -539.734 Base-Backbone interact. energy: -1.137 local terms energy: -625.682698 where: bonds (distance) C4'-P energy: -131.930 bonds (distance) P-C4' energy: -136.093 flat angles C4'-P-C4' energy: -154.555 flat angles P-C4'-P energy: -95.620 tors. eta vs tors. theta energy: -107.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1489.962497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.962497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.962497 (E_RNA) where: Base-Base interactions energy: -959.030 where: short stacking energy: -474.756 Base-Backbone interact. energy: -1.208 local terms energy: -529.724622 where: bonds (distance) C4'-P energy: -125.286 bonds (distance) P-C4' energy: -113.613 flat angles C4'-P-C4' energy: -136.124 flat angles P-C4'-P energy: -84.553 tors. eta vs tors. theta energy: -70.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1489.656952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.656952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.656952 (E_RNA) where: Base-Base interactions energy: -947.329 where: short stacking energy: -435.010 Base-Backbone interact. energy: -2.536 local terms energy: -539.791398 where: bonds (distance) C4'-P energy: -109.598 bonds (distance) P-C4' energy: -149.048 flat angles C4'-P-C4' energy: -128.852 flat angles P-C4'-P energy: -81.677 tors. eta vs tors. theta energy: -70.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1032.325897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.325897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.325897 (E_RNA) where: Base-Base interactions energy: -545.908 where: short stacking energy: -303.280 Base-Backbone interact. energy: -3.822 local terms energy: -482.596103 where: bonds (distance) C4'-P energy: -142.319 bonds (distance) P-C4' energy: -126.058 flat angles C4'-P-C4' energy: -117.230 flat angles P-C4'-P energy: -84.793 tors. eta vs tors. theta energy: -12.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1152.052994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.052994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.052994 (E_RNA) where: Base-Base interactions energy: -660.586 where: short stacking energy: -347.817 Base-Backbone interact. energy: 1.647 local terms energy: -493.114591 where: bonds (distance) C4'-P energy: -126.001 bonds (distance) P-C4' energy: -127.840 flat angles C4'-P-C4' energy: -132.048 flat angles P-C4'-P energy: -74.349 tors. eta vs tors. theta energy: -32.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -891.902288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.902288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.902288 (E_RNA) where: Base-Base interactions energy: -440.720 where: short stacking energy: -260.604 Base-Backbone interact. energy: 0.725 local terms energy: -451.907005 where: bonds (distance) C4'-P energy: -121.231 bonds (distance) P-C4' energy: -138.489 flat angles C4'-P-C4' energy: -114.797 flat angles P-C4'-P energy: -67.032 tors. eta vs tors. theta energy: -10.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2193.706372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.706372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.706372 (E_RNA) where: Base-Base interactions energy: -1396.813 where: short stacking energy: -765.900 Base-Backbone interact. energy: -3.079 local terms energy: -793.814615 where: bonds (distance) C4'-P energy: -148.507 bonds (distance) P-C4' energy: -156.568 flat angles C4'-P-C4' energy: -168.913 flat angles P-C4'-P energy: -105.674 tors. eta vs tors. theta energy: -214.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1971.553487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.553487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.553487 (E_RNA) where: Base-Base interactions energy: -1241.630 where: short stacking energy: -655.211 Base-Backbone interact. energy: -0.424 local terms energy: -729.499440 where: bonds (distance) C4'-P energy: -142.201 bonds (distance) P-C4' energy: -151.396 flat angles C4'-P-C4' energy: -166.869 flat angles P-C4'-P energy: -103.277 tors. eta vs tors. theta energy: -165.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1922.517883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1922.517883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1922.517883 (E_RNA) where: Base-Base interactions energy: -1230.028 where: short stacking energy: -629.127 Base-Backbone interact. energy: -1.804 local terms energy: -690.685649 where: bonds (distance) C4'-P energy: -140.794 bonds (distance) P-C4' energy: -152.978 flat angles C4'-P-C4' energy: -151.312 flat angles P-C4'-P energy: -85.624 tors. eta vs tors. theta energy: -159.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1867.725244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1867.725244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1867.725244 (E_RNA) where: Base-Base interactions energy: -1173.579 where: short stacking energy: -567.566 Base-Backbone interact. energy: 5.867 local terms energy: -700.013931 where: bonds (distance) C4'-P energy: -142.455 bonds (distance) P-C4' energy: -160.203 flat angles C4'-P-C4' energy: -171.713 flat angles P-C4'-P energy: -96.832 tors. eta vs tors. theta energy: -128.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1739.791892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.791892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.791892 (E_RNA) where: Base-Base interactions energy: -1105.913 where: short stacking energy: -537.658 Base-Backbone interact. energy: -1.892 local terms energy: -631.986099 where: bonds (distance) C4'-P energy: -137.479 bonds (distance) P-C4' energy: -136.301 flat angles C4'-P-C4' energy: -143.905 flat angles P-C4'-P energy: -100.383 tors. eta vs tors. theta energy: -113.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1536.677792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.677792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.677792 (E_RNA) where: Base-Base interactions energy: -982.069 where: short stacking energy: -473.669 Base-Backbone interact. energy: -6.107 local terms energy: -548.502105 where: bonds (distance) C4'-P energy: -117.985 bonds (distance) P-C4' energy: -138.911 flat angles C4'-P-C4' energy: -121.395 flat angles P-C4'-P energy: -82.285 tors. eta vs tors. theta energy: -87.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1480.959306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.959306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.959306 (E_RNA) where: Base-Base interactions energy: -898.846 where: short stacking energy: -459.378 Base-Backbone interact. energy: -1.615 local terms energy: -580.497984 where: bonds (distance) C4'-P energy: -137.299 bonds (distance) P-C4' energy: -123.646 flat angles C4'-P-C4' energy: -135.320 flat angles P-C4'-P energy: -85.594 tors. eta vs tors. theta energy: -98.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1225.505111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.505111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.505111 (E_RNA) where: Base-Base interactions energy: -715.272 where: short stacking energy: -368.055 Base-Backbone interact. energy: 0.948 local terms energy: -511.180792 where: bonds (distance) C4'-P energy: -121.125 bonds (distance) P-C4' energy: -131.782 flat angles C4'-P-C4' energy: -135.034 flat angles P-C4'-P energy: -84.415 tors. eta vs tors. theta energy: -38.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -963.121142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.121142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.121142 (E_RNA) where: Base-Base interactions energy: -517.042 where: short stacking energy: -284.030 Base-Backbone interact. energy: 4.540 local terms energy: -450.618577 where: bonds (distance) C4'-P energy: -124.940 bonds (distance) P-C4' energy: -121.603 flat angles C4'-P-C4' energy: -106.380 flat angles P-C4'-P energy: -72.687 tors. eta vs tors. theta energy: -25.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -902.325069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.325069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.325069 (E_RNA) where: Base-Base interactions energy: -485.252 where: short stacking energy: -293.195 Base-Backbone interact. energy: -1.750 local terms energy: -415.323080 where: bonds (distance) C4'-P energy: -107.676 bonds (distance) P-C4' energy: -123.606 flat angles C4'-P-C4' energy: -101.391 flat angles P-C4'-P energy: -70.348 tors. eta vs tors. theta energy: -12.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2215.868383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2215.868383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.868383 (E_RNA) where: Base-Base interactions energy: -1446.327 where: short stacking energy: -742.008 Base-Backbone interact. energy: -4.089 local terms energy: -765.452089 where: bonds (distance) C4'-P energy: -146.387 bonds (distance) P-C4' energy: -158.862 flat angles C4'-P-C4' energy: -168.232 flat angles P-C4'-P energy: -106.115 tors. eta vs tors. theta energy: -185.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2030.605467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2030.605467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2030.605467 (E_RNA) where: Base-Base interactions energy: -1289.646 where: short stacking energy: -668.676 Base-Backbone interact. energy: 3.493 local terms energy: -744.452498 where: bonds (distance) C4'-P energy: -156.069 bonds (distance) P-C4' energy: -160.108 flat angles C4'-P-C4' energy: -165.971 flat angles P-C4'-P energy: -103.843 tors. eta vs tors. theta energy: -158.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -2052.866985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2052.866985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2052.866985 (E_RNA) where: Base-Base interactions energy: -1330.348 where: short stacking energy: -654.625 Base-Backbone interact. energy: -1.167 local terms energy: -721.351838 where: bonds (distance) C4'-P energy: -136.063 bonds (distance) P-C4' energy: -138.911 flat angles C4'-P-C4' energy: -167.951 flat angles P-C4'-P energy: -116.028 tors. eta vs tors. theta energy: -162.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1924.094533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1924.094533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1924.094533 (E_RNA) where: Base-Base interactions energy: -1262.060 where: short stacking energy: -588.302 Base-Backbone interact. energy: -3.309 local terms energy: -658.725904 where: bonds (distance) C4'-P energy: -146.758 bonds (distance) P-C4' energy: -152.344 flat angles C4'-P-C4' energy: -156.863 flat angles P-C4'-P energy: -90.923 tors. eta vs tors. theta energy: -111.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1762.511382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1762.511382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.511382 (E_RNA) where: Base-Base interactions energy: -1134.286 where: short stacking energy: -572.145 Base-Backbone interact. energy: -1.130 local terms energy: -627.095866 where: bonds (distance) C4'-P energy: -132.951 bonds (distance) P-C4' energy: -140.692 flat angles C4'-P-C4' energy: -146.625 flat angles P-C4'-P energy: -94.712 tors. eta vs tors. theta energy: -112.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1546.103242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.103242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.103242 (E_RNA) where: Base-Base interactions energy: -998.478 where: short stacking energy: -493.708 Base-Backbone interact. energy: 1.683 local terms energy: -549.307889 where: bonds (distance) C4'-P energy: -109.468 bonds (distance) P-C4' energy: -140.905 flat angles C4'-P-C4' energy: -131.899 flat angles P-C4'-P energy: -75.693 tors. eta vs tors. theta energy: -91.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1478.875061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.875061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.875061 (E_RNA) where: Base-Base interactions energy: -900.830 where: short stacking energy: -445.919 Base-Backbone interact. energy: 0.140 local terms energy: -578.185456 where: bonds (distance) C4'-P energy: -124.847 bonds (distance) P-C4' energy: -134.015 flat angles C4'-P-C4' energy: -154.240 flat angles P-C4'-P energy: -81.341 tors. eta vs tors. theta energy: -83.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1260.361595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.361595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.361595 (E_RNA) where: Base-Base interactions energy: -765.373 where: short stacking energy: -380.122 Base-Backbone interact. energy: -3.903 local terms energy: -491.085358 where: bonds (distance) C4'-P energy: -122.659 bonds (distance) P-C4' energy: -129.122 flat angles C4'-P-C4' energy: -107.934 flat angles P-C4'-P energy: -80.106 tors. eta vs tors. theta energy: -51.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -973.106456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.106456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.106456 (E_RNA) where: Base-Base interactions energy: -520.388 where: short stacking energy: -291.732 Base-Backbone interact. energy: -3.572 local terms energy: -449.146006 where: bonds (distance) C4'-P energy: -120.645 bonds (distance) P-C4' energy: -126.442 flat angles C4'-P-C4' energy: -110.826 flat angles P-C4'-P energy: -75.901 tors. eta vs tors. theta energy: -15.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -931.102075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.102075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.102075 (E_RNA) where: Base-Base interactions energy: -537.262 where: short stacking energy: -292.121 Base-Backbone interact. energy: 3.407 local terms energy: -397.246641 where: bonds (distance) C4'-P energy: -119.924 bonds (distance) P-C4' energy: -115.389 flat angles C4'-P-C4' energy: -101.180 flat angles P-C4'-P energy: -51.270 tors. eta vs tors. theta energy: -9.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2163.205177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2163.205177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2163.205177 (E_RNA) where: Base-Base interactions energy: -1420.147 where: short stacking energy: -751.208 Base-Backbone interact. energy: -5.784 local terms energy: -737.274191 where: bonds (distance) C4'-P energy: -155.315 bonds (distance) P-C4' energy: -143.213 flat angles C4'-P-C4' energy: -149.536 flat angles P-C4'-P energy: -93.570 tors. eta vs tors. theta energy: -195.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2156.769312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.769312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.769312 (E_RNA) where: Base-Base interactions energy: -1440.754 where: short stacking energy: -662.782 Base-Backbone interact. energy: -4.314 local terms energy: -711.701503 where: bonds (distance) C4'-P energy: -143.073 bonds (distance) P-C4' energy: -151.823 flat angles C4'-P-C4' energy: -167.680 flat angles P-C4'-P energy: -102.687 tors. eta vs tors. theta energy: -146.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1902.751863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1902.751863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1902.751863 (E_RNA) where: Base-Base interactions energy: -1210.476 where: short stacking energy: -626.552 Base-Backbone interact. energy: -3.478 local terms energy: -688.798304 where: bonds (distance) C4'-P energy: -144.796 bonds (distance) P-C4' energy: -147.840 flat angles C4'-P-C4' energy: -148.352 flat angles P-C4'-P energy: -90.970 tors. eta vs tors. theta energy: -156.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1993.917309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.917309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.917309 (E_RNA) where: Base-Base interactions energy: -1278.216 where: short stacking energy: -624.800 Base-Backbone interact. energy: -1.041 local terms energy: -714.660714 where: bonds (distance) C4'-P energy: -157.398 bonds (distance) P-C4' energy: -149.225 flat angles C4'-P-C4' energy: -151.579 flat angles P-C4'-P energy: -110.149 tors. eta vs tors. theta energy: -146.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1694.674842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.674842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.674842 (E_RNA) where: Base-Base interactions energy: -1093.974 where: short stacking energy: -536.537 Base-Backbone interact. energy: -1.093 local terms energy: -599.607713 where: bonds (distance) C4'-P energy: -128.179 bonds (distance) P-C4' energy: -149.883 flat angles C4'-P-C4' energy: -128.073 flat angles P-C4'-P energy: -82.965 tors. eta vs tors. theta energy: -110.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1597.680448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.680448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.680448 (E_RNA) where: Base-Base interactions energy: -997.781 where: short stacking energy: -551.614 Base-Backbone interact. energy: -1.175 local terms energy: -598.723887 where: bonds (distance) C4'-P energy: -128.120 bonds (distance) P-C4' energy: -133.311 flat angles C4'-P-C4' energy: -134.947 flat angles P-C4'-P energy: -81.888 tors. eta vs tors. theta energy: -120.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1494.329435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.329435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.329435 (E_RNA) where: Base-Base interactions energy: -958.239 where: short stacking energy: -464.631 Base-Backbone interact. energy: -4.426 local terms energy: -531.664939 where: bonds (distance) C4'-P energy: -121.530 bonds (distance) P-C4' energy: -140.916 flat angles C4'-P-C4' energy: -121.118 flat angles P-C4'-P energy: -82.866 tors. eta vs tors. theta energy: -65.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1299.022644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.022644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.022644 (E_RNA) where: Base-Base interactions energy: -800.479 where: short stacking energy: -416.916 Base-Backbone interact. energy: 6.159 local terms energy: -504.703251 where: bonds (distance) C4'-P energy: -122.395 bonds (distance) P-C4' energy: -142.195 flat angles C4'-P-C4' energy: -127.083 flat angles P-C4'-P energy: -59.886 tors. eta vs tors. theta energy: -53.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1029.024934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.024934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.024934 (E_RNA) where: Base-Base interactions energy: -589.337 where: short stacking energy: -313.661 Base-Backbone interact. energy: -0.279 local terms energy: -439.408562 where: bonds (distance) C4'-P energy: -114.211 bonds (distance) P-C4' energy: -131.325 flat angles C4'-P-C4' energy: -102.348 flat angles P-C4'-P energy: -55.285 tors. eta vs tors. theta energy: -36.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -887.766074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.766074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.766074 (E_RNA) where: Base-Base interactions energy: -471.288 where: short stacking energy: -277.486 Base-Backbone interact. energy: -4.079 local terms energy: -412.399092 where: bonds (distance) C4'-P energy: -81.420 bonds (distance) P-C4' energy: -125.365 flat angles C4'-P-C4' energy: -105.826 flat angles P-C4'-P energy: -84.783 tors. eta vs tors. theta energy: -15.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2312.570896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2312.570896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2312.570896 (E_RNA) where: Base-Base interactions energy: -1547.298 where: short stacking energy: -746.106 Base-Backbone interact. energy: -2.898 local terms energy: -762.375640 where: bonds (distance) C4'-P energy: -139.853 bonds (distance) P-C4' energy: -155.510 flat angles C4'-P-C4' energy: -176.947 flat angles P-C4'-P energy: -112.788 tors. eta vs tors. theta energy: -177.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2082.440998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.440998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.440998 (E_RNA) where: Base-Base interactions energy: -1358.398 where: short stacking energy: -693.493 Base-Backbone interact. energy: 0.603 local terms energy: -724.646774 where: bonds (distance) C4'-P energy: -140.718 bonds (distance) P-C4' energy: -149.391 flat angles C4'-P-C4' energy: -155.829 flat angles P-C4'-P energy: -94.857 tors. eta vs tors. theta energy: -183.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2112.117170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.117170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.117170 (E_RNA) where: Base-Base interactions energy: -1406.729 where: short stacking energy: -625.932 Base-Backbone interact. energy: -3.636 local terms energy: -701.751896 where: bonds (distance) C4'-P energy: -146.304 bonds (distance) P-C4' energy: -145.270 flat angles C4'-P-C4' energy: -151.802 flat angles P-C4'-P energy: -91.047 tors. eta vs tors. theta energy: -167.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1830.050507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1830.050507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1830.050507 (E_RNA) where: Base-Base interactions energy: -1161.244 where: short stacking energy: -622.638 Base-Backbone interact. energy: -1.276 local terms energy: -667.530572 where: bonds (distance) C4'-P energy: -120.574 bonds (distance) P-C4' energy: -144.141 flat angles C4'-P-C4' energy: -144.907 flat angles P-C4'-P energy: -95.369 tors. eta vs tors. theta energy: -162.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1732.107512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.107512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.107512 (E_RNA) where: Base-Base interactions energy: -1138.755 where: short stacking energy: -582.654 Base-Backbone interact. energy: -2.232 local terms energy: -591.120378 where: bonds (distance) C4'-P energy: -113.166 bonds (distance) P-C4' energy: -128.909 flat angles C4'-P-C4' energy: -151.948 flat angles P-C4'-P energy: -83.022 tors. eta vs tors. theta energy: -114.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1601.781542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.781542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.781542 (E_RNA) where: Base-Base interactions energy: -990.413 where: short stacking energy: -511.127 Base-Backbone interact. energy: -3.165 local terms energy: -608.203605 where: bonds (distance) C4'-P energy: -126.127 bonds (distance) P-C4' energy: -145.697 flat angles C4'-P-C4' energy: -142.212 flat angles P-C4'-P energy: -84.073 tors. eta vs tors. theta energy: -110.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1456.638495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.638495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.638495 (E_RNA) where: Base-Base interactions energy: -929.330 where: short stacking energy: -442.664 Base-Backbone interact. energy: 0.235 local terms energy: -527.543068 where: bonds (distance) C4'-P energy: -120.415 bonds (distance) P-C4' energy: -145.389 flat angles C4'-P-C4' energy: -123.806 flat angles P-C4'-P energy: -74.203 tors. eta vs tors. theta energy: -63.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1372.208549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.208549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.208549 (E_RNA) where: Base-Base interactions energy: -851.313 where: short stacking energy: -393.190 Base-Backbone interact. energy: -3.769 local terms energy: -517.126901 where: bonds (distance) C4'-P energy: -121.326 bonds (distance) P-C4' energy: -140.207 flat angles C4'-P-C4' energy: -128.504 flat angles P-C4'-P energy: -71.590 tors. eta vs tors. theta energy: -55.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -929.662778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.662778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.662778 (E_RNA) where: Base-Base interactions energy: -512.681 where: short stacking energy: -286.836 Base-Backbone interact. energy: -2.608 local terms energy: -414.373861 where: bonds (distance) C4'-P energy: -106.867 bonds (distance) P-C4' energy: -127.232 flat angles C4'-P-C4' energy: -92.990 flat angles P-C4'-P energy: -61.338 tors. eta vs tors. theta energy: -25.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -941.184884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.184884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.184884 (E_RNA) where: Base-Base interactions energy: -513.797 where: short stacking energy: -277.034 Base-Backbone interact. energy: -2.338 local terms energy: -425.050192 where: bonds (distance) C4'-P energy: -118.948 bonds (distance) P-C4' energy: -130.300 flat angles C4'-P-C4' energy: -97.833 flat angles P-C4'-P energy: -67.001 tors. eta vs tors. theta energy: -10.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2353.035362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2353.035362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2353.035362 (E_RNA) where: Base-Base interactions energy: -1596.008 where: short stacking energy: -751.598 Base-Backbone interact. energy: -3.107 local terms energy: -753.919995 where: bonds (distance) C4'-P energy: -142.101 bonds (distance) P-C4' energy: -153.116 flat angles C4'-P-C4' energy: -168.676 flat angles P-C4'-P energy: -114.248 tors. eta vs tors. theta energy: -175.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2216.719757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.719757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2216.719757 (E_RNA) where: Base-Base interactions energy: -1475.369 where: short stacking energy: -679.211 Base-Backbone interact. energy: -5.664 local terms energy: -735.686768 where: bonds (distance) C4'-P energy: -144.524 bonds (distance) P-C4' energy: -163.804 flat angles C4'-P-C4' energy: -174.180 flat angles P-C4'-P energy: -86.112 tors. eta vs tors. theta energy: -167.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1985.625964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1985.625964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1985.625964 (E_RNA) where: Base-Base interactions energy: -1296.637 where: short stacking energy: -658.518 Base-Backbone interact. energy: -4.309 local terms energy: -684.680564 where: bonds (distance) C4'-P energy: -139.427 bonds (distance) P-C4' energy: -126.121 flat angles C4'-P-C4' energy: -159.056 flat angles P-C4'-P energy: -97.920 tors. eta vs tors. theta energy: -162.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1799.672162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.672162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.672162 (E_RNA) where: Base-Base interactions energy: -1157.642 where: short stacking energy: -531.874 Base-Backbone interact. energy: -1.221 local terms energy: -640.808290 where: bonds (distance) C4'-P energy: -122.905 bonds (distance) P-C4' energy: -153.397 flat angles C4'-P-C4' energy: -155.271 flat angles P-C4'-P energy: -91.697 tors. eta vs tors. theta energy: -117.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1667.764628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1667.764628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.764628 (E_RNA) where: Base-Base interactions energy: -1052.156 where: short stacking energy: -556.359 Base-Backbone interact. energy: -0.980 local terms energy: -614.628575 where: bonds (distance) C4'-P energy: -131.444 bonds (distance) P-C4' energy: -149.898 flat angles C4'-P-C4' energy: -136.755 flat angles P-C4'-P energy: -67.031 tors. eta vs tors. theta energy: -129.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1678.547175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1678.547175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.547175 (E_RNA) where: Base-Base interactions energy: -1061.075 where: short stacking energy: -531.739 Base-Backbone interact. energy: 0.843 local terms energy: -618.314736 where: bonds (distance) C4'-P energy: -120.609 bonds (distance) P-C4' energy: -137.159 flat angles C4'-P-C4' energy: -141.005 flat angles P-C4'-P energy: -96.187 tors. eta vs tors. theta energy: -123.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1510.320969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.320969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.320969 (E_RNA) where: Base-Base interactions energy: -990.300 where: short stacking energy: -464.658 Base-Backbone interact. energy: -3.171 local terms energy: -516.850041 where: bonds (distance) C4'-P energy: -123.756 bonds (distance) P-C4' energy: -123.054 flat angles C4'-P-C4' energy: -134.658 flat angles P-C4'-P energy: -74.929 tors. eta vs tors. theta energy: -60.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1376.970553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.970553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.970553 (E_RNA) where: Base-Base interactions energy: -835.616 where: short stacking energy: -412.237 Base-Backbone interact. energy: -1.857 local terms energy: -539.498002 where: bonds (distance) C4'-P energy: -145.286 bonds (distance) P-C4' energy: -134.904 flat angles C4'-P-C4' energy: -111.426 flat angles P-C4'-P energy: -74.899 tors. eta vs tors. theta energy: -72.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -956.049402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.049402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.049402 (E_RNA) where: Base-Base interactions energy: -476.632 where: short stacking energy: -285.066 Base-Backbone interact. energy: -1.776 local terms energy: -477.641345 where: bonds (distance) C4'-P energy: -128.706 bonds (distance) P-C4' energy: -132.710 flat angles C4'-P-C4' energy: -138.700 flat angles P-C4'-P energy: -68.375 tors. eta vs tors. theta energy: -9.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -923.765341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.765341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.765341 (E_RNA) where: Base-Base interactions energy: -522.258 where: short stacking energy: -299.946 Base-Backbone interact. energy: -2.399 local terms energy: -399.107906 where: bonds (distance) C4'-P energy: -101.215 bonds (distance) P-C4' energy: -120.248 flat angles C4'-P-C4' energy: -84.966 flat angles P-C4'-P energy: -63.172 tors. eta vs tors. theta energy: -29.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2401.944212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2401.944212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2401.944212 (E_RNA) where: Base-Base interactions energy: -1618.799 where: short stacking energy: -773.356 Base-Backbone interact. energy: -4.303 local terms energy: -778.842232 where: bonds (distance) C4'-P energy: -149.621 bonds (distance) P-C4' energy: -146.060 flat angles C4'-P-C4' energy: -166.809 flat angles P-C4'-P energy: -129.817 tors. eta vs tors. theta energy: -186.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2196.704631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.704631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.704631 (E_RNA) where: Base-Base interactions energy: -1457.289 where: short stacking energy: -683.980 Base-Backbone interact. energy: -6.543 local terms energy: -732.872584 where: bonds (distance) C4'-P energy: -136.213 bonds (distance) P-C4' energy: -150.517 flat angles C4'-P-C4' energy: -155.187 flat angles P-C4'-P energy: -112.429 tors. eta vs tors. theta energy: -178.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2001.342969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.342969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.342969 (E_RNA) where: Base-Base interactions energy: -1289.342 where: short stacking energy: -658.262 Base-Backbone interact. energy: -0.440 local terms energy: -711.560554 where: bonds (distance) C4'-P energy: -133.435 bonds (distance) P-C4' energy: -152.953 flat angles C4'-P-C4' energy: -161.593 flat angles P-C4'-P energy: -98.114 tors. eta vs tors. theta energy: -165.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1875.724902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.724902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.724902 (E_RNA) where: Base-Base interactions energy: -1214.379 where: short stacking energy: -574.313 Base-Backbone interact. energy: -3.970 local terms energy: -657.375819 where: bonds (distance) C4'-P energy: -146.957 bonds (distance) P-C4' energy: -135.109 flat angles C4'-P-C4' energy: -158.501 flat angles P-C4'-P energy: -78.895 tors. eta vs tors. theta energy: -137.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1818.211024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.211024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.211024 (E_RNA) where: Base-Base interactions energy: -1179.823 where: short stacking energy: -570.223 Base-Backbone interact. energy: -0.098 local terms energy: -638.290166 where: bonds (distance) C4'-P energy: -129.829 bonds (distance) P-C4' energy: -141.424 flat angles C4'-P-C4' energy: -142.835 flat angles P-C4'-P energy: -89.784 tors. eta vs tors. theta energy: -134.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1582.135122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.135122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.135122 (E_RNA) where: Base-Base interactions energy: -997.471 where: short stacking energy: -490.360 Base-Backbone interact. energy: 1.057 local terms energy: -585.720852 where: bonds (distance) C4'-P energy: -124.350 bonds (distance) P-C4' energy: -140.523 flat angles C4'-P-C4' energy: -146.855 flat angles P-C4'-P energy: -86.454 tors. eta vs tors. theta energy: -87.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1483.996693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.996693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.996693 (E_RNA) where: Base-Base interactions energy: -971.018 where: short stacking energy: -443.099 Base-Backbone interact. energy: 1.668 local terms energy: -514.646517 where: bonds (distance) C4'-P energy: -122.154 bonds (distance) P-C4' energy: -128.220 flat angles C4'-P-C4' energy: -137.659 flat angles P-C4'-P energy: -59.128 tors. eta vs tors. theta energy: -67.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1386.756673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.756673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.756673 (E_RNA) where: Base-Base interactions energy: -894.154 where: short stacking energy: -443.680 Base-Backbone interact. energy: 1.822 local terms energy: -494.424650 where: bonds (distance) C4'-P energy: -129.092 bonds (distance) P-C4' energy: -112.514 flat angles C4'-P-C4' energy: -123.979 flat angles P-C4'-P energy: -58.560 tors. eta vs tors. theta energy: -70.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1008.812763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.812763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.812763 (E_RNA) where: Base-Base interactions energy: -578.399 where: short stacking energy: -316.975 Base-Backbone interact. energy: -1.278 local terms energy: -429.135498 where: bonds (distance) C4'-P energy: -112.275 bonds (distance) P-C4' energy: -114.803 flat angles C4'-P-C4' energy: -126.362 flat angles P-C4'-P energy: -52.077 tors. eta vs tors. theta energy: -23.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -907.584809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.584809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.584809 (E_RNA) where: Base-Base interactions energy: -480.228 where: short stacking energy: -278.585 Base-Backbone interact. energy: -2.202 local terms energy: -425.154211 where: bonds (distance) C4'-P energy: -103.753 bonds (distance) P-C4' energy: -125.665 flat angles C4'-P-C4' energy: -117.551 flat angles P-C4'-P energy: -54.489 tors. eta vs tors. theta energy: -23.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2390.061556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2390.061556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2390.061556 (E_RNA) where: Base-Base interactions energy: -1603.327 where: short stacking energy: -772.491 Base-Backbone interact. energy: -5.161 local terms energy: -781.573333 where: bonds (distance) C4'-P energy: -153.333 bonds (distance) P-C4' energy: -160.082 flat angles C4'-P-C4' energy: -169.743 flat angles P-C4'-P energy: -102.178 tors. eta vs tors. theta energy: -196.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2242.347990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2242.347990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2242.347990 (E_RNA) where: Base-Base interactions energy: -1476.413 where: short stacking energy: -666.837 Base-Backbone interact. energy: -0.068 local terms energy: -765.867285 where: bonds (distance) C4'-P energy: -155.529 bonds (distance) P-C4' energy: -149.336 flat angles C4'-P-C4' energy: -166.661 flat angles P-C4'-P energy: -113.575 tors. eta vs tors. theta energy: -180.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1962.716399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.716399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.716399 (E_RNA) where: Base-Base interactions energy: -1256.844 where: short stacking energy: -632.823 Base-Backbone interact. energy: -4.462 local terms energy: -701.410707 where: bonds (distance) C4'-P energy: -148.349 bonds (distance) P-C4' energy: -144.966 flat angles C4'-P-C4' energy: -151.414 flat angles P-C4'-P energy: -93.514 tors. eta vs tors. theta energy: -163.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1900.946405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1900.946405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1900.946405 (E_RNA) where: Base-Base interactions energy: -1268.468 where: short stacking energy: -601.819 Base-Backbone interact. energy: -1.394 local terms energy: -631.083992 where: bonds (distance) C4'-P energy: -121.697 bonds (distance) P-C4' energy: -148.458 flat angles C4'-P-C4' energy: -143.475 flat angles P-C4'-P energy: -104.705 tors. eta vs tors. theta energy: -112.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1941.966132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1941.966132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1941.966132 (E_RNA) where: Base-Base interactions energy: -1284.285 where: short stacking energy: -619.246 Base-Backbone interact. energy: -0.587 local terms energy: -657.093758 where: bonds (distance) C4'-P energy: -144.588 bonds (distance) P-C4' energy: -127.761 flat angles C4'-P-C4' energy: -139.721 flat angles P-C4'-P energy: -94.018 tors. eta vs tors. theta energy: -151.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1576.109867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.109867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.109867 (E_RNA) where: Base-Base interactions energy: -1026.505 where: short stacking energy: -488.290 Base-Backbone interact. energy: -1.339 local terms energy: -548.266213 where: bonds (distance) C4'-P energy: -134.407 bonds (distance) P-C4' energy: -145.899 flat angles C4'-P-C4' energy: -121.551 flat angles P-C4'-P energy: -72.225 tors. eta vs tors. theta energy: -74.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1479.987694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.987694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.987694 (E_RNA) where: Base-Base interactions energy: -912.308 where: short stacking energy: -468.030 Base-Backbone interact. energy: -0.208 local terms energy: -567.472490 where: bonds (distance) C4'-P energy: -111.987 bonds (distance) P-C4' energy: -139.056 flat angles C4'-P-C4' energy: -144.580 flat angles P-C4'-P energy: -80.057 tors. eta vs tors. theta energy: -91.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1437.478291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.478291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.478291 (E_RNA) where: Base-Base interactions energy: -898.318 where: short stacking energy: -432.838 Base-Backbone interact. energy: -2.602 local terms energy: -536.558309 where: bonds (distance) C4'-P energy: -125.718 bonds (distance) P-C4' energy: -122.245 flat angles C4'-P-C4' energy: -125.345 flat angles P-C4'-P energy: -80.542 tors. eta vs tors. theta energy: -82.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1002.705015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.705015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.705015 (E_RNA) where: Base-Base interactions energy: -552.891 where: short stacking energy: -274.801 Base-Backbone interact. energy: 1.562 local terms energy: -451.375903 where: bonds (distance) C4'-P energy: -114.611 bonds (distance) P-C4' energy: -132.094 flat angles C4'-P-C4' energy: -135.498 flat angles P-C4'-P energy: -55.048 tors. eta vs tors. theta energy: -14.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -932.278199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.278199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.278199 (E_RNA) where: Base-Base interactions energy: -506.530 where: short stacking energy: -291.861 Base-Backbone interact. energy: 3.829 local terms energy: -429.576890 where: bonds (distance) C4'-P energy: -122.919 bonds (distance) P-C4' energy: -123.875 flat angles C4'-P-C4' energy: -115.563 flat angles P-C4'-P energy: -59.983 tors. eta vs tors. theta energy: -7.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2366.516793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.516793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2366.516793 (E_RNA) where: Base-Base interactions energy: -1587.133 where: short stacking energy: -747.240 Base-Backbone interact. energy: -4.870 local terms energy: -774.513567 where: bonds (distance) C4'-P energy: -147.543 bonds (distance) P-C4' energy: -159.073 flat angles C4'-P-C4' energy: -170.629 flat angles P-C4'-P energy: -112.597 tors. eta vs tors. theta energy: -184.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2272.100943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2272.100943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2272.100943 (E_RNA) where: Base-Base interactions energy: -1508.444 where: short stacking energy: -692.745 Base-Backbone interact. energy: 1.593 local terms energy: -765.250356 where: bonds (distance) C4'-P energy: -135.786 bonds (distance) P-C4' energy: -158.317 flat angles C4'-P-C4' energy: -168.901 flat angles P-C4'-P energy: -117.014 tors. eta vs tors. theta energy: -185.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2024.806794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.806794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.806794 (E_RNA) where: Base-Base interactions energy: -1332.189 where: short stacking energy: -652.850 Base-Backbone interact. energy: -1.857 local terms energy: -690.760550 where: bonds (distance) C4'-P energy: -136.202 bonds (distance) P-C4' energy: -143.765 flat angles C4'-P-C4' energy: -162.238 flat angles P-C4'-P energy: -83.842 tors. eta vs tors. theta energy: -164.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1896.444392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1896.444392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1896.444392 (E_RNA) where: Base-Base interactions energy: -1249.010 where: short stacking energy: -606.216 Base-Backbone interact. energy: -3.781 local terms energy: -643.653755 where: bonds (distance) C4'-P energy: -142.825 bonds (distance) P-C4' energy: -137.644 flat angles C4'-P-C4' energy: -146.105 flat angles P-C4'-P energy: -89.013 tors. eta vs tors. theta energy: -128.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1933.310347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1933.310347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1933.310347 (E_RNA) where: Base-Base interactions energy: -1266.335 where: short stacking energy: -600.375 Base-Backbone interact. energy: -5.461 local terms energy: -661.514648 where: bonds (distance) C4'-P energy: -137.314 bonds (distance) P-C4' energy: -131.268 flat angles C4'-P-C4' energy: -155.004 flat angles P-C4'-P energy: -91.601 tors. eta vs tors. theta energy: -146.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1637.959767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.959767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.959767 (E_RNA) where: Base-Base interactions energy: -1077.857 where: short stacking energy: -504.771 Base-Backbone interact. energy: -3.258 local terms energy: -556.845104 where: bonds (distance) C4'-P energy: -115.351 bonds (distance) P-C4' energy: -145.527 flat angles C4'-P-C4' energy: -127.188 flat angles P-C4'-P energy: -69.726 tors. eta vs tors. theta energy: -99.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1552.707415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.707415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1552.707415 (E_RNA) where: Base-Base interactions energy: -1020.231 where: short stacking energy: -470.889 Base-Backbone interact. energy: -2.531 local terms energy: -529.945250 where: bonds (distance) C4'-P energy: -134.157 bonds (distance) P-C4' energy: -114.938 flat angles C4'-P-C4' energy: -131.955 flat angles P-C4'-P energy: -66.277 tors. eta vs tors. theta energy: -82.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1315.944687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.944687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.944687 (E_RNA) where: Base-Base interactions energy: -776.442 where: short stacking energy: -408.921 Base-Backbone interact. energy: -0.750 local terms energy: -538.753614 where: bonds (distance) C4'-P energy: -119.805 bonds (distance) P-C4' energy: -141.039 flat angles C4'-P-C4' energy: -140.401 flat angles P-C4'-P energy: -70.757 tors. eta vs tors. theta energy: -66.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -973.393523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.393523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.393523 (E_RNA) where: Base-Base interactions energy: -552.129 where: short stacking energy: -305.229 Base-Backbone interact. energy: -1.047 local terms energy: -420.217423 where: bonds (distance) C4'-P energy: -115.020 bonds (distance) P-C4' energy: -128.115 flat angles C4'-P-C4' energy: -95.022 flat angles P-C4'-P energy: -54.467 tors. eta vs tors. theta energy: -27.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -915.631739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.631739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.631739 (E_RNA) where: Base-Base interactions energy: -463.707 where: short stacking energy: -256.557 Base-Backbone interact. energy: -3.254 local terms energy: -448.670607 where: bonds (distance) C4'-P energy: -123.327 bonds (distance) P-C4' energy: -139.781 flat angles C4'-P-C4' energy: -116.704 flat angles P-C4'-P energy: -55.285 tors. eta vs tors. theta energy: -13.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2362.957665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2362.957665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2362.957665 (E_RNA) where: Base-Base interactions energy: -1622.272 where: short stacking energy: -770.230 Base-Backbone interact. energy: 1.623 local terms energy: -742.308741 where: bonds (distance) C4'-P energy: -135.760 bonds (distance) P-C4' energy: -149.144 flat angles C4'-P-C4' energy: -159.424 flat angles P-C4'-P energy: -106.125 tors. eta vs tors. theta energy: -191.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2282.676049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2282.676049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.676049 (E_RNA) where: Base-Base interactions energy: -1508.077 where: short stacking energy: -704.723 Base-Backbone interact. energy: -4.517 local terms energy: -770.081280 where: bonds (distance) C4'-P energy: -146.915 bonds (distance) P-C4' energy: -145.473 flat angles C4'-P-C4' energy: -169.977 flat angles P-C4'-P energy: -111.179 tors. eta vs tors. theta energy: -196.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2030.647660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2030.647660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2030.647660 (E_RNA) where: Base-Base interactions energy: -1313.152 where: short stacking energy: -651.253 Base-Backbone interact. energy: -4.179 local terms energy: -713.316203 where: bonds (distance) C4'-P energy: -139.947 bonds (distance) P-C4' energy: -153.575 flat angles C4'-P-C4' energy: -157.882 flat angles P-C4'-P energy: -89.350 tors. eta vs tors. theta energy: -172.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -2012.159325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.159325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.159325 (E_RNA) where: Base-Base interactions energy: -1320.412 where: short stacking energy: -625.273 Base-Backbone interact. energy: -2.704 local terms energy: -689.043628 where: bonds (distance) C4'-P energy: -123.355 bonds (distance) P-C4' energy: -155.183 flat angles C4'-P-C4' energy: -157.727 flat angles P-C4'-P energy: -91.530 tors. eta vs tors. theta energy: -161.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1860.948324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.948324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.948324 (E_RNA) where: Base-Base interactions energy: -1240.323 where: short stacking energy: -556.294 Base-Backbone interact. energy: -4.883 local terms energy: -615.741975 where: bonds (distance) C4'-P energy: -143.274 bonds (distance) P-C4' energy: -122.967 flat angles C4'-P-C4' energy: -147.387 flat angles P-C4'-P energy: -83.344 tors. eta vs tors. theta energy: -118.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1648.657093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.657093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.657093 (E_RNA) where: Base-Base interactions energy: -1054.815 where: short stacking energy: -495.791 Base-Backbone interact. energy: -0.360 local terms energy: -593.482553 where: bonds (distance) C4'-P energy: -133.211 bonds (distance) P-C4' energy: -144.994 flat angles C4'-P-C4' energy: -139.016 flat angles P-C4'-P energy: -80.575 tors. eta vs tors. theta energy: -95.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1523.756530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.756530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.756530 (E_RNA) where: Base-Base interactions energy: -961.974 where: short stacking energy: -458.098 Base-Backbone interact. energy: -4.732 local terms energy: -557.050143 where: bonds (distance) C4'-P energy: -129.459 bonds (distance) P-C4' energy: -136.353 flat angles C4'-P-C4' energy: -149.107 flat angles P-C4'-P energy: -55.233 tors. eta vs tors. theta energy: -86.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1346.723132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.723132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.723132 (E_RNA) where: Base-Base interactions energy: -820.197 where: short stacking energy: -382.822 Base-Backbone interact. energy: -0.062 local terms energy: -526.464597 where: bonds (distance) C4'-P energy: -123.851 bonds (distance) P-C4' energy: -129.631 flat angles C4'-P-C4' energy: -134.161 flat angles P-C4'-P energy: -86.249 tors. eta vs tors. theta energy: -52.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1024.792317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.792317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.792317 (E_RNA) where: Base-Base interactions energy: -615.202 where: short stacking energy: -317.796 Base-Backbone interact. energy: -1.430 local terms energy: -408.160257 where: bonds (distance) C4'-P energy: -115.504 bonds (distance) P-C4' energy: -128.078 flat angles C4'-P-C4' energy: -113.882 flat angles P-C4'-P energy: -43.439 tors. eta vs tors. theta energy: -7.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -861.675069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.675069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.675069 (E_RNA) where: Base-Base interactions energy: -433.990 where: short stacking energy: -242.754 Base-Backbone interact. energy: -0.418 local terms energy: -427.267023 where: bonds (distance) C4'-P energy: -125.510 bonds (distance) P-C4' energy: -140.855 flat angles C4'-P-C4' energy: -113.571 flat angles P-C4'-P energy: -48.916 tors. eta vs tors. theta energy: 1.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2341.338059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2341.338059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2341.338059 (E_RNA) where: Base-Base interactions energy: -1566.950 where: short stacking energy: -700.146 Base-Backbone interact. energy: -3.614 local terms energy: -770.774620 where: bonds (distance) C4'-P energy: -165.059 bonds (distance) P-C4' energy: -149.080 flat angles C4'-P-C4' energy: -164.968 flat angles P-C4'-P energy: -107.542 tors. eta vs tors. theta energy: -184.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2297.325461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2297.325461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2297.325461 (E_RNA) where: Base-Base interactions energy: -1533.687 where: short stacking energy: -729.920 Base-Backbone interact. energy: -1.323 local terms energy: -762.315507 where: bonds (distance) C4'-P energy: -148.087 bonds (distance) P-C4' energy: -151.692 flat angles C4'-P-C4' energy: -166.627 flat angles P-C4'-P energy: -121.523 tors. eta vs tors. theta energy: -174.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2108.439948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2108.439948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2108.439948 (E_RNA) where: Base-Base interactions energy: -1413.164 where: short stacking energy: -685.010 Base-Backbone interact. energy: -0.693 local terms energy: -694.582105 where: bonds (distance) C4'-P energy: -149.644 bonds (distance) P-C4' energy: -144.311 flat angles C4'-P-C4' energy: -151.496 flat angles P-C4'-P energy: -90.970 tors. eta vs tors. theta energy: -158.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1905.610006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1905.610006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1905.610006 (E_RNA) where: Base-Base interactions energy: -1246.868 where: short stacking energy: -608.283 Base-Backbone interact. energy: -4.419 local terms energy: -654.323882 where: bonds (distance) C4'-P energy: -118.647 bonds (distance) P-C4' energy: -145.800 flat angles C4'-P-C4' energy: -158.203 flat angles P-C4'-P energy: -79.919 tors. eta vs tors. theta energy: -151.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1862.427383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1862.427383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1862.427383 (E_RNA) where: Base-Base interactions energy: -1263.204 where: short stacking energy: -563.908 Base-Backbone interact. energy: 0.822 local terms energy: -600.044933 where: bonds (distance) C4'-P energy: -107.331 bonds (distance) P-C4' energy: -133.174 flat angles C4'-P-C4' energy: -161.049 flat angles P-C4'-P energy: -91.311 tors. eta vs tors. theta energy: -107.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1649.511914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.511914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.511914 (E_RNA) where: Base-Base interactions energy: -1055.469 where: short stacking energy: -521.481 Base-Backbone interact. energy: -2.741 local terms energy: -591.302560 where: bonds (distance) C4'-P energy: -129.131 bonds (distance) P-C4' energy: -122.990 flat angles C4'-P-C4' energy: -146.222 flat angles P-C4'-P energy: -82.659 tors. eta vs tors. theta energy: -110.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1558.390674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.390674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.390674 (E_RNA) where: Base-Base interactions energy: -975.695 where: short stacking energy: -456.601 Base-Backbone interact. energy: -1.060 local terms energy: -581.635656 where: bonds (distance) C4'-P energy: -128.799 bonds (distance) P-C4' energy: -152.260 flat angles C4'-P-C4' energy: -137.354 flat angles P-C4'-P energy: -81.389 tors. eta vs tors. theta energy: -81.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1376.778892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.778892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.778892 (E_RNA) where: Base-Base interactions energy: -845.709 where: short stacking energy: -428.264 Base-Backbone interact. energy: 5.848 local terms energy: -536.918133 where: bonds (distance) C4'-P energy: -128.856 bonds (distance) P-C4' energy: -134.929 flat angles C4'-P-C4' energy: -122.531 flat angles P-C4'-P energy: -76.462 tors. eta vs tors. theta energy: -74.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1035.262614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.262614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.262614 (E_RNA) where: Base-Base interactions energy: -601.283 where: short stacking energy: -331.619 Base-Backbone interact. energy: 4.847 local terms energy: -438.826781 where: bonds (distance) C4'-P energy: -117.601 bonds (distance) P-C4' energy: -127.448 flat angles C4'-P-C4' energy: -108.869 flat angles P-C4'-P energy: -52.404 tors. eta vs tors. theta energy: -32.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -874.606208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.606208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.606208 (E_RNA) where: Base-Base interactions energy: -469.586 where: short stacking energy: -244.226 Base-Backbone interact. energy: -1.356 local terms energy: -403.664189 where: bonds (distance) C4'-P energy: -121.382 bonds (distance) P-C4' energy: -120.488 flat angles C4'-P-C4' energy: -96.040 flat angles P-C4'-P energy: -58.452 tors. eta vs tors. theta energy: -7.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2363.407212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2363.407212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2363.407212 (E_RNA) where: Base-Base interactions energy: -1577.277 where: short stacking energy: -735.055 Base-Backbone interact. energy: -2.327 local terms energy: -783.803512 where: bonds (distance) C4'-P energy: -155.002 bonds (distance) P-C4' energy: -149.844 flat angles C4'-P-C4' energy: -171.612 flat angles P-C4'-P energy: -108.735 tors. eta vs tors. theta energy: -198.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2278.287759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2278.287759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2278.287759 (E_RNA) where: Base-Base interactions energy: -1536.924 where: short stacking energy: -731.749 Base-Backbone interact. energy: 1.160 local terms energy: -742.523625 where: bonds (distance) C4'-P energy: -133.151 bonds (distance) P-C4' energy: -151.653 flat angles C4'-P-C4' energy: -173.865 flat angles P-C4'-P energy: -102.412 tors. eta vs tors. theta energy: -181.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2131.920699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2131.920699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2131.920699 (E_RNA) where: Base-Base interactions energy: -1439.449 where: short stacking energy: -660.979 Base-Backbone interact. energy: -1.380 local terms energy: -691.091769 where: bonds (distance) C4'-P energy: -137.166 bonds (distance) P-C4' energy: -145.544 flat angles C4'-P-C4' energy: -163.262 flat angles P-C4'-P energy: -89.769 tors. eta vs tors. theta energy: -155.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1900.859017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1900.859017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1900.859017 (E_RNA) where: Base-Base interactions energy: -1236.036 where: short stacking energy: -613.500 Base-Backbone interact. energy: -3.468 local terms energy: -661.354485 where: bonds (distance) C4'-P energy: -134.026 bonds (distance) P-C4' energy: -148.260 flat angles C4'-P-C4' energy: -153.325 flat angles P-C4'-P energy: -77.089 tors. eta vs tors. theta energy: -148.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1849.978406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1849.978406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1849.978406 (E_RNA) where: Base-Base interactions energy: -1242.016 where: short stacking energy: -565.460 Base-Backbone interact. energy: 1.906 local terms energy: -609.868901 where: bonds (distance) C4'-P energy: -138.399 bonds (distance) P-C4' energy: -141.300 flat angles C4'-P-C4' energy: -146.574 flat angles P-C4'-P energy: -86.875 tors. eta vs tors. theta energy: -96.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1694.866392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.866392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.866392 (E_RNA) where: Base-Base interactions energy: -1160.576 where: short stacking energy: -508.188 Base-Backbone interact. energy: 0.112 local terms energy: -534.402845 where: bonds (distance) C4'-P energy: -112.198 bonds (distance) P-C4' energy: -133.352 flat angles C4'-P-C4' energy: -114.929 flat angles P-C4'-P energy: -70.705 tors. eta vs tors. theta energy: -103.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1523.413832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.413832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.413832 (E_RNA) where: Base-Base interactions energy: -959.261 where: short stacking energy: -485.087 Base-Backbone interact. energy: -1.794 local terms energy: -562.358390 where: bonds (distance) C4'-P energy: -119.699 bonds (distance) P-C4' energy: -128.760 flat angles C4'-P-C4' energy: -139.620 flat angles P-C4'-P energy: -76.793 tors. eta vs tors. theta energy: -97.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1377.400533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.400533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.400533 (E_RNA) where: Base-Base interactions energy: -848.708 where: short stacking energy: -425.890 Base-Backbone interact. energy: -2.342 local terms energy: -526.349782 where: bonds (distance) C4'-P energy: -129.712 bonds (distance) P-C4' energy: -121.448 flat angles C4'-P-C4' energy: -126.215 flat angles P-C4'-P energy: -70.754 tors. eta vs tors. theta energy: -78.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1080.483166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.483166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.483166 (E_RNA) where: Base-Base interactions energy: -597.939 where: short stacking energy: -333.030 Base-Backbone interact. energy: -0.276 local terms energy: -482.267992 where: bonds (distance) C4'-P energy: -139.769 bonds (distance) P-C4' energy: -128.254 flat angles C4'-P-C4' energy: -113.243 flat angles P-C4'-P energy: -63.693 tors. eta vs tors. theta energy: -37.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -850.710246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.710246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.710246 (E_RNA) where: Base-Base interactions energy: -467.519 where: short stacking energy: -266.516 Base-Backbone interact. energy: 4.414 local terms energy: -387.604978 where: bonds (distance) C4'-P energy: -111.082 bonds (distance) P-C4' energy: -116.746 flat angles C4'-P-C4' energy: -91.746 flat angles P-C4'-P energy: -58.358 tors. eta vs tors. theta energy: -9.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2340.840533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.840533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.840533 (E_RNA) where: Base-Base interactions energy: -1602.656 where: short stacking energy: -726.392 Base-Backbone interact. energy: 4.016 local terms energy: -742.201050 where: bonds (distance) C4'-P energy: -140.938 bonds (distance) P-C4' energy: -155.328 flat angles C4'-P-C4' energy: -165.331 flat angles P-C4'-P energy: -92.115 tors. eta vs tors. theta energy: -188.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2344.479365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2344.479365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.479365 (E_RNA) where: Base-Base interactions energy: -1595.516 where: short stacking energy: -753.087 Base-Backbone interact. energy: -5.711 local terms energy: -743.252218 where: bonds (distance) C4'-P energy: -144.630 bonds (distance) P-C4' energy: -148.212 flat angles C4'-P-C4' energy: -149.005 flat angles P-C4'-P energy: -116.069 tors. eta vs tors. theta energy: -185.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2225.863903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2225.863903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2225.863903 (E_RNA) where: Base-Base interactions energy: -1501.659 where: short stacking energy: -694.712 Base-Backbone interact. energy: -2.660 local terms energy: -721.545287 where: bonds (distance) C4'-P energy: -138.360 bonds (distance) P-C4' energy: -149.052 flat angles C4'-P-C4' energy: -165.626 flat angles P-C4'-P energy: -101.210 tors. eta vs tors. theta energy: -167.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1945.149507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1945.149507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.149507 (E_RNA) where: Base-Base interactions energy: -1243.682 where: short stacking energy: -639.389 Base-Backbone interact. energy: -3.345 local terms energy: -698.123047 where: bonds (distance) C4'-P energy: -141.344 bonds (distance) P-C4' energy: -142.714 flat angles C4'-P-C4' energy: -142.661 flat angles P-C4'-P energy: -101.221 tors. eta vs tors. theta energy: -170.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1860.998421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.998421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.998421 (E_RNA) where: Base-Base interactions energy: -1234.130 where: short stacking energy: -581.846 Base-Backbone interact. energy: -5.398 local terms energy: -621.471033 where: bonds (distance) C4'-P energy: -122.823 bonds (distance) P-C4' energy: -140.285 flat angles C4'-P-C4' energy: -157.367 flat angles P-C4'-P energy: -90.909 tors. eta vs tors. theta energy: -110.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1767.973073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1767.973073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1767.973073 (E_RNA) where: Base-Base interactions energy: -1125.593 where: short stacking energy: -509.734 Base-Backbone interact. energy: 9.731 local terms energy: -652.110763 where: bonds (distance) C4'-P energy: -141.061 bonds (distance) P-C4' energy: -148.054 flat angles C4'-P-C4' energy: -149.588 flat angles P-C4'-P energy: -103.886 tors. eta vs tors. theta energy: -109.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1506.865892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.865892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.865892 (E_RNA) where: Base-Base interactions energy: -972.938 where: short stacking energy: -463.858 Base-Backbone interact. energy: -1.157 local terms energy: -532.770643 where: bonds (distance) C4'-P energy: -117.277 bonds (distance) P-C4' energy: -133.232 flat angles C4'-P-C4' energy: -123.038 flat angles P-C4'-P energy: -87.497 tors. eta vs tors. theta energy: -71.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1362.694857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.694857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.694857 (E_RNA) where: Base-Base interactions energy: -836.734 where: short stacking energy: -417.580 Base-Backbone interact. energy: 5.910 local terms energy: -531.870459 where: bonds (distance) C4'-P energy: -117.559 bonds (distance) P-C4' energy: -137.862 flat angles C4'-P-C4' energy: -128.388 flat angles P-C4'-P energy: -79.329 tors. eta vs tors. theta energy: -68.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1078.509607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.509607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.509607 (E_RNA) where: Base-Base interactions energy: -622.053 where: short stacking energy: -342.070 Base-Backbone interact. energy: 1.034 local terms energy: -457.490665 where: bonds (distance) C4'-P energy: -99.687 bonds (distance) P-C4' energy: -141.028 flat angles C4'-P-C4' energy: -101.765 flat angles P-C4'-P energy: -78.803 tors. eta vs tors. theta energy: -36.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -934.478702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.478702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.478702 (E_RNA) where: Base-Base interactions energy: -557.200 where: short stacking energy: -293.402 Base-Backbone interact. energy: -1.309 local terms energy: -375.969352 where: bonds (distance) C4'-P energy: -96.824 bonds (distance) P-C4' energy: -145.321 flat angles C4'-P-C4' energy: -82.997 flat angles P-C4'-P energy: -40.054 tors. eta vs tors. theta energy: -10.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2363.470941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2363.470941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2363.470941 (E_RNA) where: Base-Base interactions energy: -1592.407 where: short stacking energy: -724.569 Base-Backbone interact. energy: -1.902 local terms energy: -769.162082 where: bonds (distance) C4'-P energy: -151.952 bonds (distance) P-C4' energy: -156.311 flat angles C4'-P-C4' energy: -169.457 flat angles P-C4'-P energy: -103.462 tors. eta vs tors. theta energy: -187.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2305.534552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2305.534552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2305.534552 (E_RNA) where: Base-Base interactions energy: -1550.788 where: short stacking energy: -731.977 Base-Backbone interact. energy: 4.122 local terms energy: -758.868403 where: bonds (distance) C4'-P energy: -150.446 bonds (distance) P-C4' energy: -157.658 flat angles C4'-P-C4' energy: -172.620 flat angles P-C4'-P energy: -100.610 tors. eta vs tors. theta energy: -177.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2251.867102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.867102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.867102 (E_RNA) where: Base-Base interactions energy: -1518.971 where: short stacking energy: -709.042 Base-Backbone interact. energy: -2.206 local terms energy: -730.689944 where: bonds (distance) C4'-P energy: -145.541 bonds (distance) P-C4' energy: -138.457 flat angles C4'-P-C4' energy: -154.358 flat angles P-C4'-P energy: -115.265 tors. eta vs tors. theta energy: -177.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1932.099041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.099041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1932.099041 (E_RNA) where: Base-Base interactions energy: -1304.275 where: short stacking energy: -601.883 Base-Backbone interact. energy: -0.984 local terms energy: -626.839658 where: bonds (distance) C4'-P energy: -128.905 bonds (distance) P-C4' energy: -134.708 flat angles C4'-P-C4' energy: -150.113 flat angles P-C4'-P energy: -78.122 tors. eta vs tors. theta energy: -134.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1814.384801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1814.384801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1814.384801 (E_RNA) where: Base-Base interactions energy: -1191.483 where: short stacking energy: -571.447 Base-Backbone interact. energy: 1.347 local terms energy: -624.248838 where: bonds (distance) C4'-P energy: -112.549 bonds (distance) P-C4' energy: -135.799 flat angles C4'-P-C4' energy: -149.807 flat angles P-C4'-P energy: -94.650 tors. eta vs tors. theta energy: -131.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1845.667669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.667669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.667669 (E_RNA) where: Base-Base interactions energy: -1221.501 where: short stacking energy: -554.961 Base-Backbone interact. energy: -2.149 local terms energy: -622.017728 where: bonds (distance) C4'-P energy: -130.803 bonds (distance) P-C4' energy: -139.809 flat angles C4'-P-C4' energy: -142.801 flat angles P-C4'-P energy: -91.103 tors. eta vs tors. theta energy: -117.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1535.198706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.198706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.198706 (E_RNA) where: Base-Base interactions energy: -999.745 where: short stacking energy: -484.285 Base-Backbone interact. energy: 4.134 local terms energy: -539.587951 where: bonds (distance) C4'-P energy: -128.701 bonds (distance) P-C4' energy: -127.347 flat angles C4'-P-C4' energy: -136.583 flat angles P-C4'-P energy: -77.249 tors. eta vs tors. theta energy: -69.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1350.586817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.586817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.586817 (E_RNA) where: Base-Base interactions energy: -862.391 where: short stacking energy: -406.969 Base-Backbone interact. energy: 2.629 local terms energy: -490.825057 where: bonds (distance) C4'-P energy: -117.856 bonds (distance) P-C4' energy: -128.348 flat angles C4'-P-C4' energy: -119.537 flat angles P-C4'-P energy: -73.085 tors. eta vs tors. theta energy: -51.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1047.478835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.478835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.478835 (E_RNA) where: Base-Base interactions energy: -589.534 where: short stacking energy: -321.819 Base-Backbone interact. energy: 11.059 local terms energy: -469.003413 where: bonds (distance) C4'-P energy: -122.515 bonds (distance) P-C4' energy: -123.325 flat angles C4'-P-C4' energy: -126.468 flat angles P-C4'-P energy: -63.635 tors. eta vs tors. theta energy: -33.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -938.012778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.012778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.012778 (E_RNA) where: Base-Base interactions energy: -497.317 where: short stacking energy: -262.124 Base-Backbone interact. energy: -1.061 local terms energy: -439.634296 where: bonds (distance) C4'-P energy: -126.704 bonds (distance) P-C4' energy: -132.085 flat angles C4'-P-C4' energy: -118.134 flat angles P-C4'-P energy: -70.375 tors. eta vs tors. theta energy: 7.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2396.631614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2396.631614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2396.631614 (E_RNA) where: Base-Base interactions energy: -1629.128 where: short stacking energy: -749.075 Base-Backbone interact. energy: -1.813 local terms energy: -765.691149 where: bonds (distance) C4'-P energy: -154.306 bonds (distance) P-C4' energy: -151.430 flat angles C4'-P-C4' energy: -173.685 flat angles P-C4'-P energy: -91.985 tors. eta vs tors. theta energy: -194.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2369.869214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2369.869214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2369.869214 (E_RNA) where: Base-Base interactions energy: -1615.200 where: short stacking energy: -757.033 Base-Backbone interact. energy: 0.848 local terms energy: -755.518010 where: bonds (distance) C4'-P energy: -147.907 bonds (distance) P-C4' energy: -160.740 flat angles C4'-P-C4' energy: -167.175 flat angles P-C4'-P energy: -96.685 tors. eta vs tors. theta energy: -183.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2245.491122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2245.491122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2245.491122 (E_RNA) where: Base-Base interactions energy: -1523.616 where: short stacking energy: -717.533 Base-Backbone interact. energy: -1.373 local terms energy: -720.502199 where: bonds (distance) C4'-P energy: -137.069 bonds (distance) P-C4' energy: -129.403 flat angles C4'-P-C4' energy: -161.404 flat angles P-C4'-P energy: -112.320 tors. eta vs tors. theta energy: -180.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1942.551598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.551598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.551598 (E_RNA) where: Base-Base interactions energy: -1301.501 where: short stacking energy: -572.876 Base-Backbone interact. energy: 3.573 local terms energy: -644.622715 where: bonds (distance) C4'-P energy: -143.023 bonds (distance) P-C4' energy: -140.604 flat angles C4'-P-C4' energy: -145.918 flat angles P-C4'-P energy: -82.214 tors. eta vs tors. theta energy: -132.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1829.306106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1829.306106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1829.306106 (E_RNA) where: Base-Base interactions energy: -1167.807 where: short stacking energy: -553.156 Base-Backbone interact. energy: 0.709 local terms energy: -662.208083 where: bonds (distance) C4'-P energy: -150.104 bonds (distance) P-C4' energy: -140.596 flat angles C4'-P-C4' energy: -149.265 flat angles P-C4'-P energy: -95.392 tors. eta vs tors. theta energy: -126.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1826.780883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1826.780883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1826.780883 (E_RNA) where: Base-Base interactions energy: -1220.334 where: short stacking energy: -568.436 Base-Backbone interact. energy: -0.294 local terms energy: -606.153214 where: bonds (distance) C4'-P energy: -119.321 bonds (distance) P-C4' energy: -136.273 flat angles C4'-P-C4' energy: -142.468 flat angles P-C4'-P energy: -86.315 tors. eta vs tors. theta energy: -121.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1567.834851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.834851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.834851 (E_RNA) where: Base-Base interactions energy: -996.718 where: short stacking energy: -473.427 Base-Backbone interact. energy: -0.453 local terms energy: -570.663353 where: bonds (distance) C4'-P energy: -138.507 bonds (distance) P-C4' energy: -124.693 flat angles C4'-P-C4' energy: -126.425 flat angles P-C4'-P energy: -84.547 tors. eta vs tors. theta energy: -96.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1346.098836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.098836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.098836 (E_RNA) where: Base-Base interactions energy: -835.403 where: short stacking energy: -385.040 Base-Backbone interact. energy: -5.033 local terms energy: -505.663023 where: bonds (distance) C4'-P energy: -112.351 bonds (distance) P-C4' energy: -130.535 flat angles C4'-P-C4' energy: -129.529 flat angles P-C4'-P energy: -71.478 tors. eta vs tors. theta energy: -61.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1094.371730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.371730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.371730 (E_RNA) where: Base-Base interactions energy: -620.908 where: short stacking energy: -335.951 Base-Backbone interact. energy: -1.495 local terms energy: -471.968256 where: bonds (distance) C4'-P energy: -125.979 bonds (distance) P-C4' energy: -124.489 flat angles C4'-P-C4' energy: -122.710 flat angles P-C4'-P energy: -70.472 tors. eta vs tors. theta energy: -28.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -994.077894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.077894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.077894 (E_RNA) where: Base-Base interactions energy: -538.765 where: short stacking energy: -300.280 Base-Backbone interact. energy: -2.802 local terms energy: -452.511594 where: bonds (distance) C4'-P energy: -121.675 bonds (distance) P-C4' energy: -131.226 flat angles C4'-P-C4' energy: -118.116 flat angles P-C4'-P energy: -59.261 tors. eta vs tors. theta energy: -22.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2423.043484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2423.043484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2423.043484 (E_RNA) where: Base-Base interactions energy: -1642.574 where: short stacking energy: -744.757 Base-Backbone interact. energy: -4.804 local terms energy: -775.665246 where: bonds (distance) C4'-P energy: -152.440 bonds (distance) P-C4' energy: -153.617 flat angles C4'-P-C4' energy: -174.462 flat angles P-C4'-P energy: -105.462 tors. eta vs tors. theta energy: -189.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2401.515080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2401.515080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2401.515080 (E_RNA) where: Base-Base interactions energy: -1638.939 where: short stacking energy: -756.335 Base-Backbone interact. energy: -3.003 local terms energy: -759.573135 where: bonds (distance) C4'-P energy: -143.321 bonds (distance) P-C4' energy: -150.056 flat angles C4'-P-C4' energy: -164.063 flat angles P-C4'-P energy: -90.640 tors. eta vs tors. theta energy: -211.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2184.576892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2184.576892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2184.576892 (E_RNA) where: Base-Base interactions energy: -1464.942 where: short stacking energy: -648.200 Base-Backbone interact. energy: -0.726 local terms energy: -718.908731 where: bonds (distance) C4'-P energy: -139.473 bonds (distance) P-C4' energy: -144.865 flat angles C4'-P-C4' energy: -163.083 flat angles P-C4'-P energy: -107.777 tors. eta vs tors. theta energy: -163.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -2036.783846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2036.783846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2036.783846 (E_RNA) where: Base-Base interactions energy: -1377.158 where: short stacking energy: -589.108 Base-Backbone interact. energy: 0.804 local terms energy: -660.430477 where: bonds (distance) C4'-P energy: -133.844 bonds (distance) P-C4' energy: -153.447 flat angles C4'-P-C4' energy: -145.957 flat angles P-C4'-P energy: -96.274 tors. eta vs tors. theta energy: -130.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1757.869788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1757.869788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.869788 (E_RNA) where: Base-Base interactions energy: -1125.333 where: short stacking energy: -525.450 Base-Backbone interact. energy: -0.266 local terms energy: -632.270148 where: bonds (distance) C4'-P energy: -128.605 bonds (distance) P-C4' energy: -148.132 flat angles C4'-P-C4' energy: -156.471 flat angles P-C4'-P energy: -90.239 tors. eta vs tors. theta energy: -108.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1827.311006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.311006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.311006 (E_RNA) where: Base-Base interactions energy: -1234.118 where: short stacking energy: -548.984 Base-Backbone interact. energy: -1.685 local terms energy: -591.507899 where: bonds (distance) C4'-P energy: -130.481 bonds (distance) P-C4' energy: -119.827 flat angles C4'-P-C4' energy: -149.956 flat angles P-C4'-P energy: -76.125 tors. eta vs tors. theta energy: -115.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1587.970918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.970918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.970918 (E_RNA) where: Base-Base interactions energy: -1023.931 where: short stacking energy: -505.333 Base-Backbone interact. energy: 1.416 local terms energy: -565.455925 where: bonds (distance) C4'-P energy: -124.412 bonds (distance) P-C4' energy: -125.087 flat angles C4'-P-C4' energy: -128.327 flat angles P-C4'-P energy: -81.271 tors. eta vs tors. theta energy: -106.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1348.391750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.391750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.391750 (E_RNA) where: Base-Base interactions energy: -853.881 where: short stacking energy: -429.238 Base-Backbone interact. energy: -1.533 local terms energy: -492.977011 where: bonds (distance) C4'-P energy: -116.105 bonds (distance) P-C4' energy: -111.174 flat angles C4'-P-C4' energy: -136.002 flat angles P-C4'-P energy: -72.628 tors. eta vs tors. theta energy: -57.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1149.467440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.467440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.467440 (E_RNA) where: Base-Base interactions energy: -680.379 where: short stacking energy: -347.765 Base-Backbone interact. energy: 3.828 local terms energy: -472.916689 where: bonds (distance) C4'-P energy: -111.583 bonds (distance) P-C4' energy: -126.251 flat angles C4'-P-C4' energy: -113.622 flat angles P-C4'-P energy: -78.013 tors. eta vs tors. theta energy: -43.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1047.804781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.804781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.804781 (E_RNA) where: Base-Base interactions energy: -579.755 where: short stacking energy: -319.703 Base-Backbone interact. energy: 0.126 local terms energy: -468.174935 where: bonds (distance) C4'-P energy: -133.420 bonds (distance) P-C4' energy: -96.401 flat angles C4'-P-C4' energy: -124.977 flat angles P-C4'-P energy: -76.687 tors. eta vs tors. theta energy: -36.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2469.842910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2469.842910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2469.842910 (E_RNA) where: Base-Base interactions energy: -1701.643 where: short stacking energy: -739.569 Base-Backbone interact. energy: -2.166 local terms energy: -766.034120 where: bonds (distance) C4'-P energy: -158.732 bonds (distance) P-C4' energy: -152.842 flat angles C4'-P-C4' energy: -164.240 flat angles P-C4'-P energy: -102.255 tors. eta vs tors. theta energy: -187.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2313.088146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2313.088146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2313.088146 (E_RNA) where: Base-Base interactions energy: -1571.286 where: short stacking energy: -705.865 Base-Backbone interact. energy: -3.123 local terms energy: -738.679146 where: bonds (distance) C4'-P energy: -135.188 bonds (distance) P-C4' energy: -147.854 flat angles C4'-P-C4' energy: -167.137 flat angles P-C4'-P energy: -110.791 tors. eta vs tors. theta energy: -177.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2285.740955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2285.740955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2285.740955 (E_RNA) where: Base-Base interactions energy: -1569.706 where: short stacking energy: -725.131 Base-Backbone interact. energy: -1.067 local terms energy: -714.967714 where: bonds (distance) C4'-P energy: -146.339 bonds (distance) P-C4' energy: -129.189 flat angles C4'-P-C4' energy: -165.447 flat angles P-C4'-P energy: -106.445 tors. eta vs tors. theta energy: -167.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -2118.871294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2118.871294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.871294 (E_RNA) where: Base-Base interactions energy: -1457.718 where: short stacking energy: -663.368 Base-Backbone interact. energy: -1.809 local terms energy: -659.343697 where: bonds (distance) C4'-P energy: -126.704 bonds (distance) P-C4' energy: -143.245 flat angles C4'-P-C4' energy: -148.621 flat angles P-C4'-P energy: -94.957 tors. eta vs tors. theta energy: -145.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1842.821842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1842.821842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1842.821842 (E_RNA) where: Base-Base interactions energy: -1193.595 where: short stacking energy: -548.061 Base-Backbone interact. energy: 1.029 local terms energy: -650.255432 where: bonds (distance) C4'-P energy: -144.880 bonds (distance) P-C4' energy: -135.662 flat angles C4'-P-C4' energy: -150.306 flat angles P-C4'-P energy: -101.149 tors. eta vs tors. theta energy: -118.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1702.243657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.243657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.243657 (E_RNA) where: Base-Base interactions energy: -1135.025 where: short stacking energy: -532.581 Base-Backbone interact. energy: -0.599 local terms energy: -566.619948 where: bonds (distance) C4'-P energy: -102.545 bonds (distance) P-C4' energy: -117.372 flat angles C4'-P-C4' energy: -132.385 flat angles P-C4'-P energy: -99.648 tors. eta vs tors. theta energy: -114.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1658.239503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.239503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.239503 (E_RNA) where: Base-Base interactions energy: -1055.644 where: short stacking energy: -534.942 Base-Backbone interact. energy: -0.513 local terms energy: -602.082220 where: bonds (distance) C4'-P energy: -120.901 bonds (distance) P-C4' energy: -128.294 flat angles C4'-P-C4' energy: -146.266 flat angles P-C4'-P energy: -86.668 tors. eta vs tors. theta energy: -119.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1337.382819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.382819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.382819 (E_RNA) where: Base-Base interactions energy: -859.509 where: short stacking energy: -446.542 Base-Backbone interact. energy: 7.973 local terms energy: -485.846593 where: bonds (distance) C4'-P energy: -107.438 bonds (distance) P-C4' energy: -113.359 flat angles C4'-P-C4' energy: -116.881 flat angles P-C4'-P energy: -79.442 tors. eta vs tors. theta energy: -68.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1145.484332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.484332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.484332 (E_RNA) where: Base-Base interactions energy: -671.509 where: short stacking energy: -366.212 Base-Backbone interact. energy: 2.796 local terms energy: -476.771711 where: bonds (distance) C4'-P energy: -116.490 bonds (distance) P-C4' energy: -123.223 flat angles C4'-P-C4' energy: -110.253 flat angles P-C4'-P energy: -87.811 tors. eta vs tors. theta energy: -38.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -981.469138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.469138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.469138 (E_RNA) where: Base-Base interactions energy: -578.285 where: short stacking energy: -283.117 Base-Backbone interact. energy: 3.130 local terms energy: -406.314066 where: bonds (distance) C4'-P energy: -114.955 bonds (distance) P-C4' energy: -128.215 flat angles C4'-P-C4' energy: -96.861 flat angles P-C4'-P energy: -45.869 tors. eta vs tors. theta energy: -20.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2481.154626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2481.154626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2481.154626 (E_RNA) where: Base-Base interactions energy: -1697.263 where: short stacking energy: -768.017 Base-Backbone interact. energy: 1.041 local terms energy: -784.932764 where: bonds (distance) C4'-P energy: -160.356 bonds (distance) P-C4' energy: -148.003 flat angles C4'-P-C4' energy: -173.653 flat angles P-C4'-P energy: -111.475 tors. eta vs tors. theta energy: -191.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2303.983038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2303.983038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2303.983038 (E_RNA) where: Base-Base interactions energy: -1553.640 where: short stacking energy: -702.662 Base-Backbone interact. energy: -3.062 local terms energy: -747.281421 where: bonds (distance) C4'-P energy: -145.257 bonds (distance) P-C4' energy: -153.529 flat angles C4'-P-C4' energy: -167.416 flat angles P-C4'-P energy: -106.825 tors. eta vs tors. theta energy: -174.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2306.268630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.268630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.268630 (E_RNA) where: Base-Base interactions energy: -1575.383 where: short stacking energy: -701.368 Base-Backbone interact. energy: -3.832 local terms energy: -727.053620 where: bonds (distance) C4'-P energy: -145.758 bonds (distance) P-C4' energy: -161.276 flat angles C4'-P-C4' energy: -152.409 flat angles P-C4'-P energy: -98.064 tors. eta vs tors. theta energy: -169.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2104.011867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2104.011867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2104.011867 (E_RNA) where: Base-Base interactions energy: -1440.610 where: short stacking energy: -654.415 Base-Backbone interact. energy: 1.647 local terms energy: -665.048723 where: bonds (distance) C4'-P energy: -135.324 bonds (distance) P-C4' energy: -146.293 flat angles C4'-P-C4' energy: -132.209 flat angles P-C4'-P energy: -100.014 tors. eta vs tors. theta energy: -151.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1847.902052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1847.902052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1847.902052 (E_RNA) where: Base-Base interactions energy: -1239.199 where: short stacking energy: -555.236 Base-Backbone interact. energy: 5.879 local terms energy: -614.582024 where: bonds (distance) C4'-P energy: -131.670 bonds (distance) P-C4' energy: -136.426 flat angles C4'-P-C4' energy: -147.047 flat angles P-C4'-P energy: -78.395 tors. eta vs tors. theta energy: -121.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1685.171513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.171513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.171513 (E_RNA) where: Base-Base interactions energy: -1063.498 where: short stacking energy: -515.195 Base-Backbone interact. energy: -3.222 local terms energy: -618.451346 where: bonds (distance) C4'-P energy: -121.134 bonds (distance) P-C4' energy: -151.147 flat angles C4'-P-C4' energy: -137.789 flat angles P-C4'-P energy: -95.828 tors. eta vs tors. theta energy: -112.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1673.514697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.514697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.514697 (E_RNA) where: Base-Base interactions energy: -1088.787 where: short stacking energy: -490.796 Base-Backbone interact. energy: 1.270 local terms energy: -585.998412 where: bonds (distance) C4'-P energy: -108.737 bonds (distance) P-C4' energy: -147.658 flat angles C4'-P-C4' energy: -138.212 flat angles P-C4'-P energy: -97.824 tors. eta vs tors. theta energy: -93.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1359.758423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.758423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.758423 (E_RNA) where: Base-Base interactions energy: -847.386 where: short stacking energy: -409.880 Base-Backbone interact. energy: 0.978 local terms energy: -513.350748 where: bonds (distance) C4'-P energy: -124.655 bonds (distance) P-C4' energy: -148.995 flat angles C4'-P-C4' energy: -109.527 flat angles P-C4'-P energy: -65.630 tors. eta vs tors. theta energy: -64.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1143.187332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.187332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.187332 (E_RNA) where: Base-Base interactions energy: -655.067 where: short stacking energy: -349.542 Base-Backbone interact. energy: -1.773 local terms energy: -486.347873 where: bonds (distance) C4'-P energy: -129.876 bonds (distance) P-C4' energy: -125.454 flat angles C4'-P-C4' energy: -134.992 flat angles P-C4'-P energy: -60.180 tors. eta vs tors. theta energy: -35.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1003.839957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.839957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.839957 (E_RNA) where: Base-Base interactions energy: -572.505 where: short stacking energy: -299.501 Base-Backbone interact. energy: 5.708 local terms energy: -437.043014 where: bonds (distance) C4'-P energy: -107.271 bonds (distance) P-C4' energy: -111.719 flat angles C4'-P-C4' energy: -107.036 flat angles P-C4'-P energy: -83.105 tors. eta vs tors. theta energy: -27.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2508.136517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2508.136517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2508.136517 (E_RNA) where: Base-Base interactions energy: -1729.843 where: short stacking energy: -788.572 Base-Backbone interact. energy: 0.252 local terms energy: -778.545880 where: bonds (distance) C4'-P energy: -143.770 bonds (distance) P-C4' energy: -149.269 flat angles C4'-P-C4' energy: -169.396 flat angles P-C4'-P energy: -109.719 tors. eta vs tors. theta energy: -206.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2280.722379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.722379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.722379 (E_RNA) where: Base-Base interactions energy: -1513.280 where: short stacking energy: -712.470 Base-Backbone interact. energy: -2.689 local terms energy: -764.753277 where: bonds (distance) C4'-P energy: -149.006 bonds (distance) P-C4' energy: -150.453 flat angles C4'-P-C4' energy: -174.707 flat angles P-C4'-P energy: -95.870 tors. eta vs tors. theta energy: -194.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2331.221082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2331.221082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2331.221082 (E_RNA) where: Base-Base interactions energy: -1594.711 where: short stacking energy: -695.056 Base-Backbone interact. energy: -3.318 local terms energy: -733.191968 where: bonds (distance) C4'-P energy: -139.196 bonds (distance) P-C4' energy: -155.704 flat angles C4'-P-C4' energy: -165.516 flat angles P-C4'-P energy: -105.677 tors. eta vs tors. theta energy: -167.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2094.509956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2094.509956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2094.509956 (E_RNA) where: Base-Base interactions energy: -1419.422 where: short stacking energy: -625.491 Base-Backbone interact. energy: -0.721 local terms energy: -674.366761 where: bonds (distance) C4'-P energy: -139.705 bonds (distance) P-C4' energy: -132.425 flat angles C4'-P-C4' energy: -165.009 flat angles P-C4'-P energy: -90.292 tors. eta vs tors. theta energy: -146.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1880.796953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1880.796953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1880.796953 (E_RNA) where: Base-Base interactions energy: -1238.466 where: short stacking energy: -586.933 Base-Backbone interact. energy: -3.987 local terms energy: -638.343286 where: bonds (distance) C4'-P energy: -146.626 bonds (distance) P-C4' energy: -142.476 flat angles C4'-P-C4' energy: -139.720 flat angles P-C4'-P energy: -81.159 tors. eta vs tors. theta energy: -128.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1705.088895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.088895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1705.088895 (E_RNA) where: Base-Base interactions energy: -1086.974 where: short stacking energy: -536.519 Base-Backbone interact. energy: -3.906 local terms energy: -614.209215 where: bonds (distance) C4'-P energy: -138.195 bonds (distance) P-C4' energy: -131.154 flat angles C4'-P-C4' energy: -133.646 flat angles P-C4'-P energy: -89.722 tors. eta vs tors. theta energy: -121.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1632.793702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.793702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.793702 (E_RNA) where: Base-Base interactions energy: -1048.785 where: short stacking energy: -507.909 Base-Backbone interact. energy: -1.183 local terms energy: -582.826083 where: bonds (distance) C4'-P energy: -135.152 bonds (distance) P-C4' energy: -118.102 flat angles C4'-P-C4' energy: -127.894 flat angles P-C4'-P energy: -99.127 tors. eta vs tors. theta energy: -102.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1379.304966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.304966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.304966 (E_RNA) where: Base-Base interactions energy: -850.176 where: short stacking energy: -428.464 Base-Backbone interact. energy: -2.316 local terms energy: -526.813074 where: bonds (distance) C4'-P energy: -108.178 bonds (distance) P-C4' energy: -135.722 flat angles C4'-P-C4' energy: -116.475 flat angles P-C4'-P energy: -77.817 tors. eta vs tors. theta energy: -88.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1133.702344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.702344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1133.702344 (E_RNA) where: Base-Base interactions energy: -703.445 where: short stacking energy: -325.712 Base-Backbone interact. energy: 1.184 local terms energy: -431.441548 where: bonds (distance) C4'-P energy: -135.849 bonds (distance) P-C4' energy: -131.336 flat angles C4'-P-C4' energy: -87.597 flat angles P-C4'-P energy: -62.506 tors. eta vs tors. theta energy: -14.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1138.913610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.913610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.913610 (E_RNA) where: Base-Base interactions energy: -682.267 where: short stacking energy: -338.217 Base-Backbone interact. energy: 4.549 local terms energy: -461.195270 where: bonds (distance) C4'-P energy: -125.907 bonds (distance) P-C4' energy: -125.171 flat angles C4'-P-C4' energy: -117.670 flat angles P-C4'-P energy: -58.028 tors. eta vs tors. theta energy: -34.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2518.598888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2518.598888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2518.598888 (E_RNA) where: Base-Base interactions energy: -1723.012 where: short stacking energy: -797.392 Base-Backbone interact. energy: -1.568 local terms energy: -794.019184 where: bonds (distance) C4'-P energy: -162.664 bonds (distance) P-C4' energy: -150.374 flat angles C4'-P-C4' energy: -172.026 flat angles P-C4'-P energy: -112.763 tors. eta vs tors. theta energy: -196.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2355.385401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.385401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.385401 (E_RNA) where: Base-Base interactions energy: -1592.386 where: short stacking energy: -739.720 Base-Backbone interact. energy: -2.187 local terms energy: -760.811580 where: bonds (distance) C4'-P energy: -152.952 bonds (distance) P-C4' energy: -139.521 flat angles C4'-P-C4' energy: -160.860 flat angles P-C4'-P energy: -96.834 tors. eta vs tors. theta energy: -210.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2301.812165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.812165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.812165 (E_RNA) where: Base-Base interactions energy: -1566.787 where: short stacking energy: -712.102 Base-Backbone interact. energy: -1.775 local terms energy: -733.250176 where: bonds (distance) C4'-P energy: -152.153 bonds (distance) P-C4' energy: -126.553 flat angles C4'-P-C4' energy: -168.734 flat angles P-C4'-P energy: -98.729 tors. eta vs tors. theta energy: -187.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2102.753204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.753204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2102.753204 (E_RNA) where: Base-Base interactions energy: -1432.972 where: short stacking energy: -634.645 Base-Backbone interact. energy: -5.926 local terms energy: -663.854997 where: bonds (distance) C4'-P energy: -149.378 bonds (distance) P-C4' energy: -154.430 flat angles C4'-P-C4' energy: -149.784 flat angles P-C4'-P energy: -79.437 tors. eta vs tors. theta energy: -130.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1917.060674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1917.060674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.060674 (E_RNA) where: Base-Base interactions energy: -1295.095 where: short stacking energy: -615.394 Base-Backbone interact. energy: -3.939 local terms energy: -618.026476 where: bonds (distance) C4'-P energy: -123.402 bonds (distance) P-C4' energy: -131.149 flat angles C4'-P-C4' energy: -146.021 flat angles P-C4'-P energy: -85.636 tors. eta vs tors. theta energy: -131.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1690.179445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.179445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.179445 (E_RNA) where: Base-Base interactions energy: -1045.154 where: short stacking energy: -536.124 Base-Backbone interact. energy: 2.681 local terms energy: -647.705807 where: bonds (distance) C4'-P energy: -132.564 bonds (distance) P-C4' energy: -141.681 flat angles C4'-P-C4' energy: -148.253 flat angles P-C4'-P energy: -88.984 tors. eta vs tors. theta energy: -136.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1685.735143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.735143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.735143 (E_RNA) where: Base-Base interactions energy: -1092.773 where: short stacking energy: -527.740 Base-Backbone interact. energy: -1.015 local terms energy: -591.947094 where: bonds (distance) C4'-P energy: -116.192 bonds (distance) P-C4' energy: -133.755 flat angles C4'-P-C4' energy: -139.776 flat angles P-C4'-P energy: -86.712 tors. eta vs tors. theta energy: -115.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1344.826443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.826443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.826443 (E_RNA) where: Base-Base interactions energy: -823.258 where: short stacking energy: -401.028 Base-Backbone interact. energy: -3.921 local terms energy: -517.647006 where: bonds (distance) C4'-P energy: -132.994 bonds (distance) P-C4' energy: -129.144 flat angles C4'-P-C4' energy: -130.805 flat angles P-C4'-P energy: -71.897 tors. eta vs tors. theta energy: -52.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1184.984464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.984464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.984464 (E_RNA) where: Base-Base interactions energy: -697.407 where: short stacking energy: -339.280 Base-Backbone interact. energy: -1.940 local terms energy: -485.637264 where: bonds (distance) C4'-P energy: -116.631 bonds (distance) P-C4' energy: -132.826 flat angles C4'-P-C4' energy: -115.703 flat angles P-C4'-P energy: -72.138 tors. eta vs tors. theta energy: -48.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1065.699892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.699892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.699892 (E_RNA) where: Base-Base interactions energy: -620.922 where: short stacking energy: -332.846 Base-Backbone interact. energy: -0.365 local terms energy: -444.412871 where: bonds (distance) C4'-P energy: -129.497 bonds (distance) P-C4' energy: -107.904 flat angles C4'-P-C4' energy: -121.332 flat angles P-C4'-P energy: -52.955 tors. eta vs tors. theta energy: -32.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2480.447470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2480.447470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2480.447470 (E_RNA) where: Base-Base interactions energy: -1689.873 where: short stacking energy: -758.022 Base-Backbone interact. energy: 1.088 local terms energy: -791.662753 where: bonds (distance) C4'-P energy: -144.506 bonds (distance) P-C4' energy: -161.564 flat angles C4'-P-C4' energy: -177.248 flat angles P-C4'-P energy: -105.369 tors. eta vs tors. theta energy: -202.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2382.717642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2382.717642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2382.717642 (E_RNA) where: Base-Base interactions energy: -1592.940 where: short stacking energy: -749.587 Base-Backbone interact. energy: -4.309 local terms energy: -785.469038 where: bonds (distance) C4'-P energy: -149.840 bonds (distance) P-C4' energy: -162.542 flat angles C4'-P-C4' energy: -153.529 flat angles P-C4'-P energy: -119.671 tors. eta vs tors. theta energy: -199.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2314.921237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2314.921237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2314.921237 (E_RNA) where: Base-Base interactions energy: -1594.239 where: short stacking energy: -701.833 Base-Backbone interact. energy: -1.794 local terms energy: -718.888235 where: bonds (distance) C4'-P energy: -137.614 bonds (distance) P-C4' energy: -139.557 flat angles C4'-P-C4' energy: -166.805 flat angles P-C4'-P energy: -102.174 tors. eta vs tors. theta energy: -172.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2115.560146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.560146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.560146 (E_RNA) where: Base-Base interactions energy: -1417.301 where: short stacking energy: -645.196 Base-Backbone interact. energy: -0.173 local terms energy: -698.086276 where: bonds (distance) C4'-P energy: -149.034 bonds (distance) P-C4' energy: -143.837 flat angles C4'-P-C4' energy: -153.565 flat angles P-C4'-P energy: -100.146 tors. eta vs tors. theta energy: -151.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1977.491031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1977.491031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1977.491031 (E_RNA) where: Base-Base interactions energy: -1321.364 where: short stacking energy: -610.627 Base-Backbone interact. energy: -3.815 local terms energy: -652.312880 where: bonds (distance) C4'-P energy: -139.260 bonds (distance) P-C4' energy: -129.182 flat angles C4'-P-C4' energy: -161.413 flat angles P-C4'-P energy: -88.638 tors. eta vs tors. theta energy: -133.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1638.608232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.608232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.608232 (E_RNA) where: Base-Base interactions energy: -1044.736 where: short stacking energy: -539.343 Base-Backbone interact. energy: -2.737 local terms energy: -591.135262 where: bonds (distance) C4'-P energy: -117.488 bonds (distance) P-C4' energy: -135.239 flat angles C4'-P-C4' energy: -143.629 flat angles P-C4'-P energy: -75.206 tors. eta vs tors. theta energy: -119.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1688.752196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.752196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.752196 (E_RNA) where: Base-Base interactions energy: -1090.173 where: short stacking energy: -502.578 Base-Backbone interact. energy: 0.333 local terms energy: -598.911960 where: bonds (distance) C4'-P energy: -125.780 bonds (distance) P-C4' energy: -153.907 flat angles C4'-P-C4' energy: -131.306 flat angles P-C4'-P energy: -82.817 tors. eta vs tors. theta energy: -105.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1399.716287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.716287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.716287 (E_RNA) where: Base-Base interactions energy: -890.568 where: short stacking energy: -424.038 Base-Backbone interact. energy: 0.245 local terms energy: -509.393569 where: bonds (distance) C4'-P energy: -120.665 bonds (distance) P-C4' energy: -126.599 flat angles C4'-P-C4' energy: -118.146 flat angles P-C4'-P energy: -71.656 tors. eta vs tors. theta energy: -72.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1201.050549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.050549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1201.050549 (E_RNA) where: Base-Base interactions energy: -714.332 where: short stacking energy: -375.735 Base-Backbone interact. energy: -2.777 local terms energy: -483.941550 where: bonds (distance) C4'-P energy: -112.795 bonds (distance) P-C4' energy: -140.082 flat angles C4'-P-C4' energy: -123.751 flat angles P-C4'-P energy: -52.906 tors. eta vs tors. theta energy: -54.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1048.428617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.428617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.428617 (E_RNA) where: Base-Base interactions energy: -600.429 where: short stacking energy: -285.685 Base-Backbone interact. energy: 7.977 local terms energy: -455.976206 where: bonds (distance) C4'-P energy: -126.055 bonds (distance) P-C4' energy: -137.839 flat angles C4'-P-C4' energy: -110.473 flat angles P-C4'-P energy: -49.326 tors. eta vs tors. theta energy: -32.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2491.738783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2491.738783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2491.738783 (E_RNA) where: Base-Base interactions energy: -1701.200 where: short stacking energy: -776.113 Base-Backbone interact. energy: -1.005 local terms energy: -789.533150 where: bonds (distance) C4'-P energy: -147.696 bonds (distance) P-C4' energy: -165.727 flat angles C4'-P-C4' energy: -168.214 flat angles P-C4'-P energy: -103.775 tors. eta vs tors. theta energy: -204.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2354.316984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2354.316984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.316984 (E_RNA) where: Base-Base interactions energy: -1607.143 where: short stacking energy: -723.952 Base-Backbone interact. energy: -1.357 local terms energy: -745.816955 where: bonds (distance) C4'-P energy: -150.174 bonds (distance) P-C4' energy: -139.162 flat angles C4'-P-C4' energy: -177.841 flat angles P-C4'-P energy: -102.709 tors. eta vs tors. theta energy: -175.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2315.619184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2315.619184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2315.619184 (E_RNA) where: Base-Base interactions energy: -1578.392 where: short stacking energy: -722.923 Base-Backbone interact. energy: -3.845 local terms energy: -733.382585 where: bonds (distance) C4'-P energy: -157.434 bonds (distance) P-C4' energy: -141.559 flat angles C4'-P-C4' energy: -154.427 flat angles P-C4'-P energy: -84.738 tors. eta vs tors. theta energy: -195.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2176.669017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.669017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.669017 (E_RNA) where: Base-Base interactions energy: -1489.918 where: short stacking energy: -646.806 Base-Backbone interact. energy: -5.875 local terms energy: -680.876169 where: bonds (distance) C4'-P energy: -123.682 bonds (distance) P-C4' energy: -135.156 flat angles C4'-P-C4' energy: -163.010 flat angles P-C4'-P energy: -112.488 tors. eta vs tors. theta energy: -146.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -2047.846691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2047.846691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2047.846691 (E_RNA) where: Base-Base interactions energy: -1365.241 where: short stacking energy: -641.497 Base-Backbone interact. energy: 0.712 local terms energy: -683.318139 where: bonds (distance) C4'-P energy: -120.296 bonds (distance) P-C4' energy: -140.032 flat angles C4'-P-C4' energy: -156.949 flat angles P-C4'-P energy: -103.127 tors. eta vs tors. theta energy: -162.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1787.531201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.531201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.531201 (E_RNA) where: Base-Base interactions energy: -1197.482 where: short stacking energy: -574.852 Base-Backbone interact. energy: 2.314 local terms energy: -592.363795 where: bonds (distance) C4'-P energy: -124.530 bonds (distance) P-C4' energy: -132.015 flat angles C4'-P-C4' energy: -130.831 flat angles P-C4'-P energy: -80.668 tors. eta vs tors. theta energy: -124.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1651.142321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.142321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.142321 (E_RNA) where: Base-Base interactions energy: -1060.613 where: short stacking energy: -513.430 Base-Backbone interact. energy: 7.267 local terms energy: -597.797237 where: bonds (distance) C4'-P energy: -135.699 bonds (distance) P-C4' energy: -148.046 flat angles C4'-P-C4' energy: -124.101 flat angles P-C4'-P energy: -80.228 tors. eta vs tors. theta energy: -109.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1348.040007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.040007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.040007 (E_RNA) where: Base-Base interactions energy: -853.154 where: short stacking energy: -416.260 Base-Backbone interact. energy: 1.368 local terms energy: -496.253980 where: bonds (distance) C4'-P energy: -128.708 bonds (distance) P-C4' energy: -127.693 flat angles C4'-P-C4' energy: -123.587 flat angles P-C4'-P energy: -62.544 tors. eta vs tors. theta energy: -53.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1159.471438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.471438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.471438 (E_RNA) where: Base-Base interactions energy: -714.380 where: short stacking energy: -345.263 Base-Backbone interact. energy: 13.557 local terms energy: -458.648439 where: bonds (distance) C4'-P energy: -130.343 bonds (distance) P-C4' energy: -125.454 flat angles C4'-P-C4' energy: -110.751 flat angles P-C4'-P energy: -48.069 tors. eta vs tors. theta energy: -44.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1044.547180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.547180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.547180 (E_RNA) where: Base-Base interactions energy: -620.722 where: short stacking energy: -312.426 Base-Backbone interact. energy: -2.659 local terms energy: -421.165981 where: bonds (distance) C4'-P energy: -111.088 bonds (distance) P-C4' energy: -113.988 flat angles C4'-P-C4' energy: -105.435 flat angles P-C4'-P energy: -81.556 tors. eta vs tors. theta energy: -9.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2519.017549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2519.017549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2519.017549 (E_RNA) where: Base-Base interactions energy: -1741.606 where: short stacking energy: -799.286 Base-Backbone interact. energy: 2.373 local terms energy: -779.785211 where: bonds (distance) C4'-P energy: -151.912 bonds (distance) P-C4' energy: -152.943 flat angles C4'-P-C4' energy: -165.496 flat angles P-C4'-P energy: -105.433 tors. eta vs tors. theta energy: -204.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2368.206241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2368.206241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2368.206241 (E_RNA) where: Base-Base interactions energy: -1602.538 where: short stacking energy: -738.082 Base-Backbone interact. energy: -4.813 local terms energy: -760.854723 where: bonds (distance) C4'-P energy: -145.142 bonds (distance) P-C4' energy: -148.537 flat angles C4'-P-C4' energy: -176.601 flat angles P-C4'-P energy: -110.025 tors. eta vs tors. theta energy: -180.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2306.526087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.526087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.526087 (E_RNA) where: Base-Base interactions energy: -1534.595 where: short stacking energy: -714.832 Base-Backbone interact. energy: 2.038 local terms energy: -773.968948 where: bonds (distance) C4'-P energy: -145.680 bonds (distance) P-C4' energy: -171.600 flat angles C4'-P-C4' energy: -157.866 flat angles P-C4'-P energy: -110.006 tors. eta vs tors. theta energy: -188.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -2156.852866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.852866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.852866 (E_RNA) where: Base-Base interactions energy: -1482.533 where: short stacking energy: -613.164 Base-Backbone interact. energy: 0.730 local terms energy: -675.050152 where: bonds (distance) C4'-P energy: -143.197 bonds (distance) P-C4' energy: -146.827 flat angles C4'-P-C4' energy: -146.287 flat angles P-C4'-P energy: -98.057 tors. eta vs tors. theta energy: -140.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1998.009701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1998.009701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1998.009701 (E_RNA) where: Base-Base interactions energy: -1389.009 where: short stacking energy: -621.922 Base-Backbone interact. energy: 2.049 local terms energy: -611.049909 where: bonds (distance) C4'-P energy: -127.239 bonds (distance) P-C4' energy: -130.295 flat angles C4'-P-C4' energy: -154.029 flat angles P-C4'-P energy: -90.763 tors. eta vs tors. theta energy: -108.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1813.354349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1813.354349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.354349 (E_RNA) where: Base-Base interactions energy: -1187.155 where: short stacking energy: -550.791 Base-Backbone interact. energy: -3.026 local terms energy: -623.173431 where: bonds (distance) C4'-P energy: -119.089 bonds (distance) P-C4' energy: -137.040 flat angles C4'-P-C4' energy: -151.263 flat angles P-C4'-P energy: -91.015 tors. eta vs tors. theta energy: -124.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1569.415912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.415912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.415912 (E_RNA) where: Base-Base interactions energy: -1003.573 where: short stacking energy: -505.582 Base-Backbone interact. energy: 0.281 local terms energy: -566.124139 where: bonds (distance) C4'-P energy: -115.703 bonds (distance) P-C4' energy: -120.144 flat angles C4'-P-C4' energy: -142.256 flat angles P-C4'-P energy: -73.449 tors. eta vs tors. theta energy: -114.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1358.434919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.434919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.434919 (E_RNA) where: Base-Base interactions energy: -844.789 where: short stacking energy: -401.816 Base-Backbone interact. energy: -3.963 local terms energy: -509.682019 where: bonds (distance) C4'-P energy: -114.871 bonds (distance) P-C4' energy: -131.181 flat angles C4'-P-C4' energy: -140.584 flat angles P-C4'-P energy: -77.689 tors. eta vs tors. theta energy: -45.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1172.785519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.785519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1172.785519 (E_RNA) where: Base-Base interactions energy: -715.760 where: short stacking energy: -362.907 Base-Backbone interact. energy: 6.979 local terms energy: -464.004573 where: bonds (distance) C4'-P energy: -106.869 bonds (distance) P-C4' energy: -137.101 flat angles C4'-P-C4' energy: -123.653 flat angles P-C4'-P energy: -45.943 tors. eta vs tors. theta energy: -50.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1010.221196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.221196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.221196 (E_RNA) where: Base-Base interactions energy: -591.447 where: short stacking energy: -288.348 Base-Backbone interact. energy: -1.400 local terms energy: -417.374735 where: bonds (distance) C4'-P energy: -116.045 bonds (distance) P-C4' energy: -127.224 flat angles C4'-P-C4' energy: -101.308 flat angles P-C4'-P energy: -49.672 tors. eta vs tors. theta energy: -23.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2536.554307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2536.554307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2536.554307 (E_RNA) where: Base-Base interactions energy: -1748.851 where: short stacking energy: -774.086 Base-Backbone interact. energy: -0.881 local terms energy: -786.821894 where: bonds (distance) C4'-P energy: -145.113 bonds (distance) P-C4' energy: -162.253 flat angles C4'-P-C4' energy: -167.349 flat angles P-C4'-P energy: -107.711 tors. eta vs tors. theta energy: -204.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2317.318039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2317.318039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2317.318039 (E_RNA) where: Base-Base interactions energy: -1577.738 where: short stacking energy: -724.124 Base-Backbone interact. energy: 1.762 local terms energy: -741.341494 where: bonds (distance) C4'-P energy: -153.537 bonds (distance) P-C4' energy: -144.782 flat angles C4'-P-C4' energy: -159.661 flat angles P-C4'-P energy: -104.093 tors. eta vs tors. theta energy: -179.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2289.322678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2289.322678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2289.322678 (E_RNA) where: Base-Base interactions energy: -1532.365 where: short stacking energy: -721.840 Base-Backbone interact. energy: -4.311 local terms energy: -752.646673 where: bonds (distance) C4'-P energy: -162.817 bonds (distance) P-C4' energy: -133.498 flat angles C4'-P-C4' energy: -166.097 flat angles P-C4'-P energy: -96.276 tors. eta vs tors. theta energy: -193.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2084.622438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2084.622438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2084.622438 (E_RNA) where: Base-Base interactions energy: -1421.974 where: short stacking energy: -623.302 Base-Backbone interact. energy: -0.829 local terms energy: -661.819412 where: bonds (distance) C4'-P energy: -132.348 bonds (distance) P-C4' energy: -131.660 flat angles C4'-P-C4' energy: -163.725 flat angles P-C4'-P energy: -101.356 tors. eta vs tors. theta energy: -132.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -2087.796044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2087.796044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2087.796044 (E_RNA) where: Base-Base interactions energy: -1435.261 where: short stacking energy: -633.283 Base-Backbone interact. energy: -2.932 local terms energy: -649.603365 where: bonds (distance) C4'-P energy: -141.546 bonds (distance) P-C4' energy: -140.291 flat angles C4'-P-C4' energy: -135.696 flat angles P-C4'-P energy: -100.664 tors. eta vs tors. theta energy: -131.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1812.909747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.909747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.909747 (E_RNA) where: Base-Base interactions energy: -1185.249 where: short stacking energy: -536.573 Base-Backbone interact. energy: -3.072 local terms energy: -624.588655 where: bonds (distance) C4'-P energy: -143.593 bonds (distance) P-C4' energy: -138.059 flat angles C4'-P-C4' energy: -147.943 flat angles P-C4'-P energy: -85.691 tors. eta vs tors. theta energy: -109.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1556.715004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.715004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.715004 (E_RNA) where: Base-Base interactions energy: -936.861 where: short stacking energy: -473.493 Base-Backbone interact. energy: 3.378 local terms energy: -623.231469 where: bonds (distance) C4'-P energy: -148.586 bonds (distance) P-C4' energy: -141.081 flat angles C4'-P-C4' energy: -148.407 flat angles P-C4'-P energy: -90.655 tors. eta vs tors. theta energy: -94.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1380.897047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.897047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.897047 (E_RNA) where: Base-Base interactions energy: -857.917 where: short stacking energy: -429.294 Base-Backbone interact. energy: 0.987 local terms energy: -523.967170 where: bonds (distance) C4'-P energy: -127.368 bonds (distance) P-C4' energy: -130.854 flat angles C4'-P-C4' energy: -133.154 flat angles P-C4'-P energy: -60.915 tors. eta vs tors. theta energy: -71.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1204.500959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.500959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.500959 (E_RNA) where: Base-Base interactions energy: -715.788 where: short stacking energy: -366.566 Base-Backbone interact. energy: 1.734 local terms energy: -490.446989 where: bonds (distance) C4'-P energy: -127.415 bonds (distance) P-C4' energy: -131.248 flat angles C4'-P-C4' energy: -108.774 flat angles P-C4'-P energy: -60.557 tors. eta vs tors. theta energy: -62.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -909.167609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.167609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.167609 (E_RNA) where: Base-Base interactions energy: -507.703 where: short stacking energy: -297.881 Base-Backbone interact. energy: 6.532 local terms energy: -407.996466 where: bonds (distance) C4'-P energy: -107.971 bonds (distance) P-C4' energy: -133.387 flat angles C4'-P-C4' energy: -95.487 flat angles P-C4'-P energy: -59.990 tors. eta vs tors. theta energy: -11.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2537.765795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2537.765795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2537.765795 (E_RNA) where: Base-Base interactions energy: -1741.938 where: short stacking energy: -766.287 Base-Backbone interact. energy: -4.667 local terms energy: -791.160197 where: bonds (distance) C4'-P energy: -156.812 bonds (distance) P-C4' energy: -160.309 flat angles C4'-P-C4' energy: -166.898 flat angles P-C4'-P energy: -112.433 tors. eta vs tors. theta energy: -194.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2426.842184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2426.842184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2426.842184 (E_RNA) where: Base-Base interactions energy: -1679.524 where: short stacking energy: -753.881 Base-Backbone interact. energy: -3.633 local terms energy: -743.685227 where: bonds (distance) C4'-P energy: -150.133 bonds (distance) P-C4' energy: -151.319 flat angles C4'-P-C4' energy: -161.208 flat angles P-C4'-P energy: -92.931 tors. eta vs tors. theta energy: -188.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2324.245779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2324.245779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.245779 (E_RNA) where: Base-Base interactions energy: -1567.916 where: short stacking energy: -729.665 Base-Backbone interact. energy: -3.765 local terms energy: -752.565303 where: bonds (distance) C4'-P energy: -132.795 bonds (distance) P-C4' energy: -146.605 flat angles C4'-P-C4' energy: -157.639 flat angles P-C4'-P energy: -110.066 tors. eta vs tors. theta energy: -205.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2128.000134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.000134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.000134 (E_RNA) where: Base-Base interactions energy: -1447.638 where: short stacking energy: -640.889 Base-Backbone interact. energy: -1.662 local terms energy: -678.700274 where: bonds (distance) C4'-P energy: -142.593 bonds (distance) P-C4' energy: -140.256 flat angles C4'-P-C4' energy: -142.444 flat angles P-C4'-P energy: -106.606 tors. eta vs tors. theta energy: -146.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -2064.213485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2064.213485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2064.213485 (E_RNA) where: Base-Base interactions energy: -1416.341 where: short stacking energy: -616.539 Base-Backbone interact. energy: -2.875 local terms energy: -644.997396 where: bonds (distance) C4'-P energy: -130.734 bonds (distance) P-C4' energy: -137.966 flat angles C4'-P-C4' energy: -144.711 flat angles P-C4'-P energy: -89.114 tors. eta vs tors. theta energy: -142.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1826.828290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1826.828290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1826.828290 (E_RNA) where: Base-Base interactions energy: -1227.765 where: short stacking energy: -580.044 Base-Backbone interact. energy: -1.763 local terms energy: -597.300072 where: bonds (distance) C4'-P energy: -106.062 bonds (distance) P-C4' energy: -132.715 flat angles C4'-P-C4' energy: -146.711 flat angles P-C4'-P energy: -76.363 tors. eta vs tors. theta energy: -135.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1517.188715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.188715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.188715 (E_RNA) where: Base-Base interactions energy: -993.366 where: short stacking energy: -499.990 Base-Backbone interact. energy: 2.227 local terms energy: -526.049899 where: bonds (distance) C4'-P energy: -107.751 bonds (distance) P-C4' energy: -128.853 flat angles C4'-P-C4' energy: -123.696 flat angles P-C4'-P energy: -77.476 tors. eta vs tors. theta energy: -88.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1407.394041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.394041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.394041 (E_RNA) where: Base-Base interactions energy: -901.935 where: short stacking energy: -446.380 Base-Backbone interact. energy: -0.797 local terms energy: -504.661344 where: bonds (distance) C4'-P energy: -115.637 bonds (distance) P-C4' energy: -126.508 flat angles C4'-P-C4' energy: -123.124 flat angles P-C4'-P energy: -78.726 tors. eta vs tors. theta energy: -60.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1117.127718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.127718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.127718 (E_RNA) where: Base-Base interactions energy: -648.842 where: short stacking energy: -332.728 Base-Backbone interact. energy: 5.590 local terms energy: -473.875368 where: bonds (distance) C4'-P energy: -116.752 bonds (distance) P-C4' energy: -126.056 flat angles C4'-P-C4' energy: -109.352 flat angles P-C4'-P energy: -80.245 tors. eta vs tors. theta energy: -41.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -943.360441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.360441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.360441 (E_RNA) where: Base-Base interactions energy: -522.875 where: short stacking energy: -303.355 Base-Backbone interact. energy: 1.377 local terms energy: -421.862582 where: bonds (distance) C4'-P energy: -124.327 bonds (distance) P-C4' energy: -135.890 flat angles C4'-P-C4' energy: -100.497 flat angles P-C4'-P energy: -44.712 tors. eta vs tors. theta energy: -16.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2558.770718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2558.770718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2558.770718 (E_RNA) where: Base-Base interactions energy: -1754.232 where: short stacking energy: -803.626 Base-Backbone interact. energy: -3.781 local terms energy: -800.758029 where: bonds (distance) C4'-P energy: -157.512 bonds (distance) P-C4' energy: -150.553 flat angles C4'-P-C4' energy: -178.899 flat angles P-C4'-P energy: -108.105 tors. eta vs tors. theta energy: -205.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2446.998418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2446.998418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2446.998418 (E_RNA) where: Base-Base interactions energy: -1695.760 where: short stacking energy: -737.177 Base-Backbone interact. energy: 1.895 local terms energy: -753.133983 where: bonds (distance) C4'-P energy: -146.223 bonds (distance) P-C4' energy: -150.771 flat angles C4'-P-C4' energy: -169.879 flat angles P-C4'-P energy: -111.747 tors. eta vs tors. theta energy: -174.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2280.644298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.644298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.644298 (E_RNA) where: Base-Base interactions energy: -1549.930 where: short stacking energy: -701.180 Base-Backbone interact. energy: -3.651 local terms energy: -727.063021 where: bonds (distance) C4'-P energy: -129.383 bonds (distance) P-C4' energy: -146.207 flat angles C4'-P-C4' energy: -159.763 flat angles P-C4'-P energy: -107.970 tors. eta vs tors. theta energy: -183.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2213.842423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2213.842423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2213.842423 (E_RNA) where: Base-Base interactions energy: -1551.930 where: short stacking energy: -657.781 Base-Backbone interact. energy: -1.431 local terms energy: -660.482392 where: bonds (distance) C4'-P energy: -125.892 bonds (distance) P-C4' energy: -128.991 flat angles C4'-P-C4' energy: -159.308 flat angles P-C4'-P energy: -84.748 tors. eta vs tors. theta energy: -161.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -2035.097812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2035.097812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2035.097812 (E_RNA) where: Base-Base interactions energy: -1421.470 where: short stacking energy: -620.869 Base-Backbone interact. energy: -2.613 local terms energy: -611.014718 where: bonds (distance) C4'-P energy: -115.854 bonds (distance) P-C4' energy: -130.423 flat angles C4'-P-C4' energy: -150.247 flat angles P-C4'-P energy: -83.659 tors. eta vs tors. theta energy: -130.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1895.818944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.818944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.818944 (E_RNA) where: Base-Base interactions energy: -1237.982 where: short stacking energy: -595.958 Base-Backbone interact. energy: 0.675 local terms energy: -658.512183 where: bonds (distance) C4'-P energy: -121.517 bonds (distance) P-C4' energy: -124.275 flat angles C4'-P-C4' energy: -151.000 flat angles P-C4'-P energy: -117.982 tors. eta vs tors. theta energy: -143.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1557.733898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.733898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.733898 (E_RNA) where: Base-Base interactions energy: -991.354 where: short stacking energy: -476.377 Base-Backbone interact. energy: -2.657 local terms energy: -563.722743 where: bonds (distance) C4'-P energy: -119.478 bonds (distance) P-C4' energy: -128.964 flat angles C4'-P-C4' energy: -121.499 flat angles P-C4'-P energy: -77.395 tors. eta vs tors. theta energy: -116.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1376.134847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.134847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.134847 (E_RNA) where: Base-Base interactions energy: -843.522 where: short stacking energy: -412.290 Base-Backbone interact. energy: -1.814 local terms energy: -530.798606 where: bonds (distance) C4'-P energy: -126.014 bonds (distance) P-C4' energy: -131.143 flat angles C4'-P-C4' energy: -127.682 flat angles P-C4'-P energy: -78.874 tors. eta vs tors. theta energy: -67.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1185.245540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.245540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.245540 (E_RNA) where: Base-Base interactions energy: -738.340 where: short stacking energy: -373.645 Base-Backbone interact. energy: -2.703 local terms energy: -444.202439 where: bonds (distance) C4'-P energy: -98.141 bonds (distance) P-C4' energy: -127.427 flat angles C4'-P-C4' energy: -120.170 flat angles P-C4'-P energy: -53.540 tors. eta vs tors. theta energy: -44.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -913.143534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.143534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.143534 (E_RNA) where: Base-Base interactions energy: -515.361 where: short stacking energy: -253.968 Base-Backbone interact. energy: 4.777 local terms energy: -402.559048 where: bonds (distance) C4'-P energy: -128.348 bonds (distance) P-C4' energy: -108.949 flat angles C4'-P-C4' energy: -102.695 flat angles P-C4'-P energy: -53.057 tors. eta vs tors. theta energy: -9.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2505.659998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.659998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.659998 (E_RNA) where: Base-Base interactions energy: -1745.134 where: short stacking energy: -777.012 Base-Backbone interact. energy: -5.312 local terms energy: -755.214645 where: bonds (distance) C4'-P energy: -151.452 bonds (distance) P-C4' energy: -154.942 flat angles C4'-P-C4' energy: -162.313 flat angles P-C4'-P energy: -96.260 tors. eta vs tors. theta energy: -190.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2487.346651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2487.346651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2487.346651 (E_RNA) where: Base-Base interactions energy: -1724.768 where: short stacking energy: -766.500 Base-Backbone interact. energy: -3.943 local terms energy: -758.636228 where: bonds (distance) C4'-P energy: -155.445 bonds (distance) P-C4' energy: -144.643 flat angles C4'-P-C4' energy: -168.568 flat angles P-C4'-P energy: -103.804 tors. eta vs tors. theta energy: -186.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2246.869201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2246.869201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2246.869201 (E_RNA) where: Base-Base interactions energy: -1543.687 where: short stacking energy: -704.427 Base-Backbone interact. energy: -2.081 local terms energy: -701.100958 where: bonds (distance) C4'-P energy: -124.520 bonds (distance) P-C4' energy: -138.167 flat angles C4'-P-C4' energy: -166.148 flat angles P-C4'-P energy: -92.366 tors. eta vs tors. theta energy: -179.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2198.835369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2198.835369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2198.835369 (E_RNA) where: Base-Base interactions energy: -1509.396 where: short stacking energy: -621.220 Base-Backbone interact. energy: -6.241 local terms energy: -683.198143 where: bonds (distance) C4'-P energy: -136.833 bonds (distance) P-C4' energy: -156.752 flat angles C4'-P-C4' energy: -155.485 flat angles P-C4'-P energy: -94.151 tors. eta vs tors. theta energy: -139.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -2082.674041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.674041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.674041 (E_RNA) where: Base-Base interactions energy: -1426.646 where: short stacking energy: -618.124 Base-Backbone interact. energy: -4.851 local terms energy: -651.177520 where: bonds (distance) C4'-P energy: -123.340 bonds (distance) P-C4' energy: -144.824 flat angles C4'-P-C4' energy: -146.528 flat angles P-C4'-P energy: -99.147 tors. eta vs tors. theta energy: -137.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1860.487577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.487577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.487577 (E_RNA) where: Base-Base interactions energy: -1242.531 where: short stacking energy: -581.784 Base-Backbone interact. energy: -3.070 local terms energy: -614.886104 where: bonds (distance) C4'-P energy: -116.392 bonds (distance) P-C4' energy: -133.075 flat angles C4'-P-C4' energy: -145.364 flat angles P-C4'-P energy: -90.980 tors. eta vs tors. theta energy: -129.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1485.139668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.139668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.139668 (E_RNA) where: Base-Base interactions energy: -938.207 where: short stacking energy: -459.916 Base-Backbone interact. energy: -2.366 local terms energy: -544.566919 where: bonds (distance) C4'-P energy: -110.133 bonds (distance) P-C4' energy: -125.957 flat angles C4'-P-C4' energy: -116.209 flat angles P-C4'-P energy: -100.518 tors. eta vs tors. theta energy: -91.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1369.202736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.202736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.202736 (E_RNA) where: Base-Base interactions energy: -845.681 where: short stacking energy: -427.502 Base-Backbone interact. energy: 1.116 local terms energy: -524.638078 where: bonds (distance) C4'-P energy: -110.983 bonds (distance) P-C4' energy: -157.300 flat angles C4'-P-C4' energy: -123.257 flat angles P-C4'-P energy: -67.120 tors. eta vs tors. theta energy: -65.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1210.647778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.647778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.647778 (E_RNA) where: Base-Base interactions energy: -722.158 where: short stacking energy: -396.773 Base-Backbone interact. energy: -2.556 local terms energy: -485.933709 where: bonds (distance) C4'-P energy: -111.952 bonds (distance) P-C4' energy: -109.443 flat angles C4'-P-C4' energy: -133.976 flat angles P-C4'-P energy: -62.877 tors. eta vs tors. theta energy: -67.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -925.226405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.226405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.226405 (E_RNA) where: Base-Base interactions energy: -465.730 where: short stacking energy: -255.395 Base-Backbone interact. energy: 1.364 local terms energy: -460.860559 where: bonds (distance) C4'-P energy: -116.888 bonds (distance) P-C4' energy: -129.902 flat angles C4'-P-C4' energy: -132.068 flat angles P-C4'-P energy: -64.205 tors. eta vs tors. theta energy: -17.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2520.222825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2520.222825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2520.222825 (E_RNA) where: Base-Base interactions energy: -1736.680 where: short stacking energy: -767.943 Base-Backbone interact. energy: -2.324 local terms energy: -781.219200 where: bonds (distance) C4'-P energy: -141.204 bonds (distance) P-C4' energy: -149.844 flat angles C4'-P-C4' energy: -174.010 flat angles P-C4'-P energy: -130.140 tors. eta vs tors. theta energy: -186.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2521.560661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2521.560661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.560661 (E_RNA) where: Base-Base interactions energy: -1732.088 where: short stacking energy: -771.940 Base-Backbone interact. energy: -2.916 local terms energy: -786.556816 where: bonds (distance) C4'-P energy: -147.742 bonds (distance) P-C4' energy: -150.738 flat angles C4'-P-C4' energy: -168.974 flat angles P-C4'-P energy: -112.351 tors. eta vs tors. theta energy: -206.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2230.718261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2230.718261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2230.718261 (E_RNA) where: Base-Base interactions energy: -1548.642 where: short stacking energy: -718.899 Base-Backbone interact. energy: -3.110 local terms energy: -678.966217 where: bonds (distance) C4'-P energy: -115.546 bonds (distance) P-C4' energy: -133.638 flat angles C4'-P-C4' energy: -159.804 flat angles P-C4'-P energy: -90.507 tors. eta vs tors. theta energy: -179.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2228.475158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2228.475158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2228.475158 (E_RNA) where: Base-Base interactions energy: -1509.429 where: short stacking energy: -646.287 Base-Backbone interact. energy: -3.077 local terms energy: -715.968517 where: bonds (distance) C4'-P energy: -141.777 bonds (distance) P-C4' energy: -159.015 flat angles C4'-P-C4' energy: -156.113 flat angles P-C4'-P energy: -90.217 tors. eta vs tors. theta energy: -168.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -2080.873278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2080.873278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2080.873278 (E_RNA) where: Base-Base interactions energy: -1446.337 where: short stacking energy: -603.778 Base-Backbone interact. energy: -4.162 local terms energy: -630.374078 where: bonds (distance) C4'-P energy: -140.425 bonds (distance) P-C4' energy: -120.501 flat angles C4'-P-C4' energy: -150.771 flat angles P-C4'-P energy: -86.300 tors. eta vs tors. theta energy: -132.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1872.055240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1872.055240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1872.055240 (E_RNA) where: Base-Base interactions energy: -1243.735 where: short stacking energy: -594.138 Base-Backbone interact. energy: -4.412 local terms energy: -623.908069 where: bonds (distance) C4'-P energy: -135.127 bonds (distance) P-C4' energy: -144.970 flat angles C4'-P-C4' energy: -139.356 flat angles P-C4'-P energy: -79.243 tors. eta vs tors. theta energy: -125.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1559.188533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.188533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.188533 (E_RNA) where: Base-Base interactions energy: -977.006 where: short stacking energy: -473.556 Base-Backbone interact. energy: -1.259 local terms energy: -580.923202 where: bonds (distance) C4'-P energy: -104.494 bonds (distance) P-C4' energy: -138.963 flat angles C4'-P-C4' energy: -146.742 flat angles P-C4'-P energy: -79.884 tors. eta vs tors. theta energy: -110.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1367.199010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.199010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.199010 (E_RNA) where: Base-Base interactions energy: -849.631 where: short stacking energy: -416.851 Base-Backbone interact. energy: 5.315 local terms energy: -522.883523 where: bonds (distance) C4'-P energy: -128.582 bonds (distance) P-C4' energy: -152.390 flat angles C4'-P-C4' energy: -122.684 flat angles P-C4'-P energy: -66.832 tors. eta vs tors. theta energy: -52.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1196.752527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.752527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.752527 (E_RNA) where: Base-Base interactions energy: -703.658 where: short stacking energy: -370.317 Base-Backbone interact. energy: 0.026 local terms energy: -493.119960 where: bonds (distance) C4'-P energy: -127.146 bonds (distance) P-C4' energy: -125.631 flat angles C4'-P-C4' energy: -127.639 flat angles P-C4'-P energy: -60.464 tors. eta vs tors. theta energy: -52.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -993.028223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.028223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.028223 (E_RNA) where: Base-Base interactions energy: -558.906 where: short stacking energy: -308.448 Base-Backbone interact. energy: -0.124 local terms energy: -433.998470 where: bonds (distance) C4'-P energy: -120.001 bonds (distance) P-C4' energy: -123.047 flat angles C4'-P-C4' energy: -107.037 flat angles P-C4'-P energy: -58.409 tors. eta vs tors. theta energy: -25.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2493.421055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2493.421055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2493.421055 (E_RNA) where: Base-Base interactions energy: -1751.612 where: short stacking energy: -761.949 Base-Backbone interact. energy: -5.812 local terms energy: -735.996778 where: bonds (distance) C4'-P energy: -151.976 bonds (distance) P-C4' energy: -137.116 flat angles C4'-P-C4' energy: -175.439 flat angles P-C4'-P energy: -100.779 tors. eta vs tors. theta energy: -170.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2464.701482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2464.701482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2464.701482 (E_RNA) where: Base-Base interactions energy: -1679.438 where: short stacking energy: -788.108 Base-Backbone interact. energy: 2.507 local terms energy: -787.769977 where: bonds (distance) C4'-P energy: -155.319 bonds (distance) P-C4' energy: -150.245 flat angles C4'-P-C4' energy: -156.274 flat angles P-C4'-P energy: -116.604 tors. eta vs tors. theta energy: -209.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2306.907162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.907162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.907162 (E_RNA) where: Base-Base interactions energy: -1575.752 where: short stacking energy: -676.885 Base-Backbone interact. energy: -1.065 local terms energy: -730.090403 where: bonds (distance) C4'-P energy: -145.829 bonds (distance) P-C4' energy: -149.117 flat angles C4'-P-C4' energy: -163.408 flat angles P-C4'-P energy: -100.223 tors. eta vs tors. theta energy: -171.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2128.700302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.700302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.700302 (E_RNA) where: Base-Base interactions energy: -1452.166 where: short stacking energy: -673.971 Base-Backbone interact. energy: -3.257 local terms energy: -673.277257 where: bonds (distance) C4'-P energy: -127.977 bonds (distance) P-C4' energy: -137.450 flat angles C4'-P-C4' energy: -147.782 flat angles P-C4'-P energy: -100.276 tors. eta vs tors. theta energy: -159.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -2053.343355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2053.343355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2053.343355 (E_RNA) where: Base-Base interactions energy: -1391.160 where: short stacking energy: -616.231 Base-Backbone interact. energy: 1.546 local terms energy: -663.729833 where: bonds (distance) C4'-P energy: -130.691 bonds (distance) P-C4' energy: -141.980 flat angles C4'-P-C4' energy: -151.352 flat angles P-C4'-P energy: -94.615 tors. eta vs tors. theta energy: -145.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1850.226949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1850.226949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1850.226949 (E_RNA) where: Base-Base interactions energy: -1218.236 where: short stacking energy: -579.743 Base-Backbone interact. energy: -4.288 local terms energy: -627.702883 where: bonds (distance) C4'-P energy: -119.793 bonds (distance) P-C4' energy: -132.486 flat angles C4'-P-C4' energy: -150.931 flat angles P-C4'-P energy: -94.296 tors. eta vs tors. theta energy: -130.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1552.497504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.497504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1552.497504 (E_RNA) where: Base-Base interactions energy: -978.178 where: short stacking energy: -495.429 Base-Backbone interact. energy: 0.750 local terms energy: -575.068650 where: bonds (distance) C4'-P energy: -126.247 bonds (distance) P-C4' energy: -141.977 flat angles C4'-P-C4' energy: -119.746 flat angles P-C4'-P energy: -84.407 tors. eta vs tors. theta energy: -102.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1381.407888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.407888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.407888 (E_RNA) where: Base-Base interactions energy: -894.677 where: short stacking energy: -407.811 Base-Backbone interact. energy: 0.872 local terms energy: -487.603128 where: bonds (distance) C4'-P energy: -109.709 bonds (distance) P-C4' energy: -126.207 flat angles C4'-P-C4' energy: -134.197 flat angles P-C4'-P energy: -53.027 tors. eta vs tors. theta energy: -64.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1182.847484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.847484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.847484 (E_RNA) where: Base-Base interactions energy: -714.711 where: short stacking energy: -343.713 Base-Backbone interact. energy: -2.103 local terms energy: -466.033513 where: bonds (distance) C4'-P energy: -109.335 bonds (distance) P-C4' energy: -125.820 flat angles C4'-P-C4' energy: -133.534 flat angles P-C4'-P energy: -63.355 tors. eta vs tors. theta energy: -33.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -944.772089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.772089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.772089 (E_RNA) where: Base-Base interactions energy: -536.984 where: short stacking energy: -303.127 Base-Backbone interact. energy: 0.788 local terms energy: -408.575935 where: bonds (distance) C4'-P energy: -120.235 bonds (distance) P-C4' energy: -120.561 flat angles C4'-P-C4' energy: -96.484 flat angles P-C4'-P energy: -53.016 tors. eta vs tors. theta energy: -18.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2501.720552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2501.720552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2501.720552 (E_RNA) where: Base-Base interactions energy: -1722.440 where: short stacking energy: -762.437 Base-Backbone interact. energy: -3.124 local terms energy: -776.156523 where: bonds (distance) C4'-P energy: -146.260 bonds (distance) P-C4' energy: -160.003 flat angles C4'-P-C4' energy: -185.125 flat angles P-C4'-P energy: -102.227 tors. eta vs tors. theta energy: -182.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2391.741057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2391.741057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2391.741057 (E_RNA) where: Base-Base interactions energy: -1646.864 where: short stacking energy: -722.205 Base-Backbone interact. energy: -3.907 local terms energy: -740.970053 where: bonds (distance) C4'-P energy: -146.710 bonds (distance) P-C4' energy: -145.251 flat angles C4'-P-C4' energy: -154.807 flat angles P-C4'-P energy: -104.627 tors. eta vs tors. theta energy: -189.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2392.125282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2392.125282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2392.125282 (E_RNA) where: Base-Base interactions energy: -1647.900 where: short stacking energy: -761.685 Base-Backbone interact. energy: -2.810 local terms energy: -741.415895 where: bonds (distance) C4'-P energy: -146.145 bonds (distance) P-C4' energy: -141.400 flat angles C4'-P-C4' energy: -169.132 flat angles P-C4'-P energy: -86.539 tors. eta vs tors. theta energy: -198.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2110.293221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.293221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.293221 (E_RNA) where: Base-Base interactions energy: -1420.334 where: short stacking energy: -657.754 Base-Backbone interact. energy: -5.670 local terms energy: -684.289828 where: bonds (distance) C4'-P energy: -147.100 bonds (distance) P-C4' energy: -146.646 flat angles C4'-P-C4' energy: -140.193 flat angles P-C4'-P energy: -96.936 tors. eta vs tors. theta energy: -153.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2024.954740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.954740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.954740 (E_RNA) where: Base-Base interactions energy: -1365.902 where: short stacking energy: -606.097 Base-Backbone interact. energy: -1.068 local terms energy: -657.984668 where: bonds (distance) C4'-P energy: -134.995 bonds (distance) P-C4' energy: -147.666 flat angles C4'-P-C4' energy: -148.976 flat angles P-C4'-P energy: -102.254 tors. eta vs tors. theta energy: -124.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1930.191470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1930.191470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1930.191470 (E_RNA) where: Base-Base interactions energy: -1285.421 where: short stacking energy: -617.100 Base-Backbone interact. energy: -0.269 local terms energy: -644.502202 where: bonds (distance) C4'-P energy: -114.098 bonds (distance) P-C4' energy: -148.679 flat angles C4'-P-C4' energy: -145.986 flat angles P-C4'-P energy: -94.792 tors. eta vs tors. theta energy: -140.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1517.720441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.720441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.720441 (E_RNA) where: Base-Base interactions energy: -938.805 where: short stacking energy: -469.823 Base-Backbone interact. energy: 0.099 local terms energy: -579.013678 where: bonds (distance) C4'-P energy: -117.507 bonds (distance) P-C4' energy: -143.059 flat angles C4'-P-C4' energy: -134.085 flat angles P-C4'-P energy: -84.109 tors. eta vs tors. theta energy: -100.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1445.847683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.847683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.847683 (E_RNA) where: Base-Base interactions energy: -929.919 where: short stacking energy: -408.276 Base-Backbone interact. energy: -2.799 local terms energy: -513.129477 where: bonds (distance) C4'-P energy: -116.884 bonds (distance) P-C4' energy: -140.141 flat angles C4'-P-C4' energy: -126.974 flat angles P-C4'-P energy: -67.220 tors. eta vs tors. theta energy: -61.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1198.255911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.255911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.255911 (E_RNA) where: Base-Base interactions energy: -745.445 where: short stacking energy: -380.205 Base-Backbone interact. energy: -3.815 local terms energy: -448.995081 where: bonds (distance) C4'-P energy: -101.500 bonds (distance) P-C4' energy: -122.118 flat angles C4'-P-C4' energy: -114.100 flat angles P-C4'-P energy: -66.867 tors. eta vs tors. theta energy: -44.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -964.042218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.042218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.042218 (E_RNA) where: Base-Base interactions energy: -554.040 where: short stacking energy: -284.219 Base-Backbone interact. energy: 1.958 local terms energy: -411.960183 where: bonds (distance) C4'-P energy: -104.603 bonds (distance) P-C4' energy: -120.909 flat angles C4'-P-C4' energy: -97.502 flat angles P-C4'-P energy: -80.241 tors. eta vs tors. theta energy: -8.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2539.311896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2539.311896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2539.311896 (E_RNA) where: Base-Base interactions energy: -1759.047 where: short stacking energy: -768.405 Base-Backbone interact. energy: -6.828 local terms energy: -773.437132 where: bonds (distance) C4'-P energy: -149.411 bonds (distance) P-C4' energy: -142.218 flat angles C4'-P-C4' energy: -183.015 flat angles P-C4'-P energy: -113.698 tors. eta vs tors. theta energy: -185.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2407.678627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2407.678627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2407.678627 (E_RNA) where: Base-Base interactions energy: -1652.603 where: short stacking energy: -713.691 Base-Backbone interact. energy: -1.683 local terms energy: -753.392930 where: bonds (distance) C4'-P energy: -147.063 bonds (distance) P-C4' energy: -160.093 flat angles C4'-P-C4' energy: -170.320 flat angles P-C4'-P energy: -99.343 tors. eta vs tors. theta energy: -176.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2393.790386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2393.790386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2393.790386 (E_RNA) where: Base-Base interactions energy: -1629.117 where: short stacking energy: -731.170 Base-Backbone interact. energy: -2.245 local terms energy: -762.427540 where: bonds (distance) C4'-P energy: -154.925 bonds (distance) P-C4' energy: -156.240 flat angles C4'-P-C4' energy: -158.408 flat angles P-C4'-P energy: -105.936 tors. eta vs tors. theta energy: -186.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2176.524655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.524655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.524655 (E_RNA) where: Base-Base interactions energy: -1437.388 where: short stacking energy: -681.674 Base-Backbone interact. energy: -6.474 local terms energy: -732.663463 where: bonds (distance) C4'-P energy: -137.857 bonds (distance) P-C4' energy: -148.473 flat angles C4'-P-C4' energy: -157.260 flat angles P-C4'-P energy: -107.291 tors. eta vs tors. theta energy: -181.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2055.275522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.275522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.275522 (E_RNA) where: Base-Base interactions energy: -1408.446 where: short stacking energy: -639.632 Base-Backbone interact. energy: -2.258 local terms energy: -644.571571 where: bonds (distance) C4'-P energy: -128.851 bonds (distance) P-C4' energy: -130.051 flat angles C4'-P-C4' energy: -136.631 flat angles P-C4'-P energy: -105.543 tors. eta vs tors. theta energy: -143.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1936.248237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.248237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.248237 (E_RNA) where: Base-Base interactions energy: -1266.083 where: short stacking energy: -592.718 Base-Backbone interact. energy: -2.551 local terms energy: -667.614250 where: bonds (distance) C4'-P energy: -123.072 bonds (distance) P-C4' energy: -141.937 flat angles C4'-P-C4' energy: -150.630 flat angles P-C4'-P energy: -107.680 tors. eta vs tors. theta energy: -144.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1515.749041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.749041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.749041 (E_RNA) where: Base-Base interactions energy: -983.439 where: short stacking energy: -443.311 Base-Backbone interact. energy: 0.844 local terms energy: -533.153479 where: bonds (distance) C4'-P energy: -131.394 bonds (distance) P-C4' energy: -143.586 flat angles C4'-P-C4' energy: -125.691 flat angles P-C4'-P energy: -78.148 tors. eta vs tors. theta energy: -54.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1500.020952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.020952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.020952 (E_RNA) where: Base-Base interactions energy: -981.568 where: short stacking energy: -467.380 Base-Backbone interact. energy: -2.164 local terms energy: -516.288890 where: bonds (distance) C4'-P energy: -110.349 bonds (distance) P-C4' energy: -121.064 flat angles C4'-P-C4' energy: -119.955 flat angles P-C4'-P energy: -86.201 tors. eta vs tors. theta energy: -78.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1269.487588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.487588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.487588 (E_RNA) where: Base-Base interactions energy: -771.539 where: short stacking energy: -394.900 Base-Backbone interact. energy: -1.508 local terms energy: -496.440785 where: bonds (distance) C4'-P energy: -110.355 bonds (distance) P-C4' energy: -130.204 flat angles C4'-P-C4' energy: -128.418 flat angles P-C4'-P energy: -68.220 tors. eta vs tors. theta energy: -59.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -953.233046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.233046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.233046 (E_RNA) where: Base-Base interactions energy: -511.138 where: short stacking energy: -277.834 Base-Backbone interact. energy: 1.762 local terms energy: -443.857682 where: bonds (distance) C4'-P energy: -101.035 bonds (distance) P-C4' energy: -128.257 flat angles C4'-P-C4' energy: -127.714 flat angles P-C4'-P energy: -63.749 tors. eta vs tors. theta energy: -23.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2572.891250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2572.891250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2572.891250 (E_RNA) where: Base-Base interactions energy: -1818.995 where: short stacking energy: -773.860 Base-Backbone interact. energy: -3.129 local terms energy: -750.767334 where: bonds (distance) C4'-P energy: -155.021 bonds (distance) P-C4' energy: -140.330 flat angles C4'-P-C4' energy: -168.173 flat angles P-C4'-P energy: -104.852 tors. eta vs tors. theta energy: -182.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2406.410315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.410315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2406.410315 (E_RNA) where: Base-Base interactions energy: -1663.327 where: short stacking energy: -721.186 Base-Backbone interact. energy: -5.450 local terms energy: -737.632434 where: bonds (distance) C4'-P energy: -142.849 bonds (distance) P-C4' energy: -149.337 flat angles C4'-P-C4' energy: -158.349 flat angles P-C4'-P energy: -108.595 tors. eta vs tors. theta energy: -178.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2439.966980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2439.966980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2439.966980 (E_RNA) where: Base-Base interactions energy: -1674.223 where: short stacking energy: -752.289 Base-Backbone interact. energy: -2.090 local terms energy: -763.653795 where: bonds (distance) C4'-P energy: -145.571 bonds (distance) P-C4' energy: -154.547 flat angles C4'-P-C4' energy: -163.118 flat angles P-C4'-P energy: -97.031 tors. eta vs tors. theta energy: -203.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2182.937895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2182.937895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.937895 (E_RNA) where: Base-Base interactions energy: -1468.198 where: short stacking energy: -680.277 Base-Backbone interact. energy: -1.353 local terms energy: -713.386602 where: bonds (distance) C4'-P energy: -142.030 bonds (distance) P-C4' energy: -143.619 flat angles C4'-P-C4' energy: -149.096 flat angles P-C4'-P energy: -101.538 tors. eta vs tors. theta energy: -177.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2020.762460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2020.762460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2020.762460 (E_RNA) where: Base-Base interactions energy: -1388.442 where: short stacking energy: -561.163 Base-Backbone interact. energy: 2.074 local terms energy: -634.394965 where: bonds (distance) C4'-P energy: -125.363 bonds (distance) P-C4' energy: -139.030 flat angles C4'-P-C4' energy: -150.140 flat angles P-C4'-P energy: -95.847 tors. eta vs tors. theta energy: -124.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1888.677311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1888.677311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1888.677311 (E_RNA) where: Base-Base interactions energy: -1260.588 where: short stacking energy: -609.852 Base-Backbone interact. energy: -0.858 local terms energy: -627.231396 where: bonds (distance) C4'-P energy: -117.819 bonds (distance) P-C4' energy: -133.230 flat angles C4'-P-C4' energy: -153.819 flat angles P-C4'-P energy: -69.362 tors. eta vs tors. theta energy: -153.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1476.983274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.983274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.983274 (E_RNA) where: Base-Base interactions energy: -943.783 where: short stacking energy: -454.378 Base-Backbone interact. energy: -0.535 local terms energy: -532.664685 where: bonds (distance) C4'-P energy: -116.419 bonds (distance) P-C4' energy: -119.514 flat angles C4'-P-C4' energy: -138.046 flat angles P-C4'-P energy: -65.091 tors. eta vs tors. theta energy: -93.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1439.645586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.645586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.645586 (E_RNA) where: Base-Base interactions energy: -892.014 where: short stacking energy: -445.572 Base-Backbone interact. energy: 2.954 local terms energy: -550.584911 where: bonds (distance) C4'-P energy: -124.707 bonds (distance) P-C4' energy: -134.138 flat angles C4'-P-C4' energy: -135.385 flat angles P-C4'-P energy: -84.017 tors. eta vs tors. theta energy: -72.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1246.161210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.161210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.161210 (E_RNA) where: Base-Base interactions energy: -761.060 where: short stacking energy: -366.620 Base-Backbone interact. energy: 1.276 local terms energy: -486.376911 where: bonds (distance) C4'-P energy: -119.715 bonds (distance) P-C4' energy: -136.509 flat angles C4'-P-C4' energy: -113.461 flat angles P-C4'-P energy: -62.102 tors. eta vs tors. theta energy: -54.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -965.814364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.814364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.814364 (E_RNA) where: Base-Base interactions energy: -562.299 where: short stacking energy: -295.211 Base-Backbone interact. energy: 8.939 local terms energy: -412.453487 where: bonds (distance) C4'-P energy: -107.013 bonds (distance) P-C4' energy: -117.817 flat angles C4'-P-C4' energy: -124.023 flat angles P-C4'-P energy: -58.619 tors. eta vs tors. theta energy: -4.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2545.656332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2545.656332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2545.656332 (E_RNA) where: Base-Base interactions energy: -1783.158 where: short stacking energy: -783.015 Base-Backbone interact. energy: -0.535 local terms energy: -761.963431 where: bonds (distance) C4'-P energy: -138.064 bonds (distance) P-C4' energy: -151.511 flat angles C4'-P-C4' energy: -171.831 flat angles P-C4'-P energy: -110.609 tors. eta vs tors. theta energy: -189.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2406.752685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.752685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2406.752685 (E_RNA) where: Base-Base interactions energy: -1673.943 where: short stacking energy: -709.269 Base-Backbone interact. energy: -3.761 local terms energy: -729.049018 where: bonds (distance) C4'-P energy: -148.185 bonds (distance) P-C4' energy: -131.749 flat angles C4'-P-C4' energy: -160.305 flat angles P-C4'-P energy: -112.306 tors. eta vs tors. theta energy: -176.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2408.211887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2408.211887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2408.211887 (E_RNA) where: Base-Base interactions energy: -1647.715 where: short stacking energy: -750.413 Base-Backbone interact. energy: -1.604 local terms energy: -758.893379 where: bonds (distance) C4'-P energy: -139.616 bonds (distance) P-C4' energy: -144.412 flat angles C4'-P-C4' energy: -161.131 flat angles P-C4'-P energy: -106.871 tors. eta vs tors. theta energy: -206.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2216.651039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.651039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2216.651039 (E_RNA) where: Base-Base interactions energy: -1493.867 where: short stacking energy: -660.857 Base-Backbone interact. energy: -1.148 local terms energy: -721.635853 where: bonds (distance) C4'-P energy: -146.300 bonds (distance) P-C4' energy: -135.071 flat angles C4'-P-C4' energy: -154.664 flat angles P-C4'-P energy: -111.229 tors. eta vs tors. theta energy: -174.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2029.140970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.140970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.140970 (E_RNA) where: Base-Base interactions energy: -1371.935 where: short stacking energy: -611.337 Base-Backbone interact. energy: -8.211 local terms energy: -648.994878 where: bonds (distance) C4'-P energy: -146.285 bonds (distance) P-C4' energy: -137.385 flat angles C4'-P-C4' energy: -131.599 flat angles P-C4'-P energy: -98.826 tors. eta vs tors. theta energy: -134.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1933.991554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1933.991554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1933.991554 (E_RNA) where: Base-Base interactions energy: -1265.268 where: short stacking energy: -620.908 Base-Backbone interact. energy: -2.644 local terms energy: -666.079280 where: bonds (distance) C4'-P energy: -133.581 bonds (distance) P-C4' energy: -142.943 flat angles C4'-P-C4' energy: -150.986 flat angles P-C4'-P energy: -92.910 tors. eta vs tors. theta energy: -145.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1645.103683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.103683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.103683 (E_RNA) where: Base-Base interactions energy: -1023.988 where: short stacking energy: -508.063 Base-Backbone interact. energy: 0.765 local terms energy: -621.880892 where: bonds (distance) C4'-P energy: -149.578 bonds (distance) P-C4' energy: -137.481 flat angles C4'-P-C4' energy: -145.942 flat angles P-C4'-P energy: -79.340 tors. eta vs tors. theta energy: -109.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1466.304477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.304477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.304477 (E_RNA) where: Base-Base interactions energy: -930.517 where: short stacking energy: -424.473 Base-Backbone interact. energy: -0.160 local terms energy: -535.627798 where: bonds (distance) C4'-P energy: -106.000 bonds (distance) P-C4' energy: -131.849 flat angles C4'-P-C4' energy: -144.220 flat angles P-C4'-P energy: -81.984 tors. eta vs tors. theta energy: -71.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1229.739289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.739289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.739289 (E_RNA) where: Base-Base interactions energy: -741.871 where: short stacking energy: -337.428 Base-Backbone interact. energy: -3.192 local terms energy: -484.676190 where: bonds (distance) C4'-P energy: -128.043 bonds (distance) P-C4' energy: -121.548 flat angles C4'-P-C4' energy: -107.466 flat angles P-C4'-P energy: -87.510 tors. eta vs tors. theta energy: -40.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1057.815551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.815551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.815551 (E_RNA) where: Base-Base interactions energy: -638.610 where: short stacking energy: -307.469 Base-Backbone interact. energy: -2.791 local terms energy: -416.414831 where: bonds (distance) C4'-P energy: -97.476 bonds (distance) P-C4' energy: -111.504 flat angles C4'-P-C4' energy: -114.938 flat angles P-C4'-P energy: -70.192 tors. eta vs tors. theta energy: -22.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2558.492960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2558.492960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2558.492960 (E_RNA) where: Base-Base interactions energy: -1816.400 where: short stacking energy: -769.182 Base-Backbone interact. energy: -0.285 local terms energy: -741.807495 where: bonds (distance) C4'-P energy: -144.359 bonds (distance) P-C4' energy: -143.261 flat angles C4'-P-C4' energy: -156.447 flat angles P-C4'-P energy: -107.122 tors. eta vs tors. theta energy: -190.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2414.418404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2414.418404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2414.418404 (E_RNA) where: Base-Base interactions energy: -1678.447 where: short stacking energy: -715.015 Base-Backbone interact. energy: -3.620 local terms energy: -732.352059 where: bonds (distance) C4'-P energy: -135.605 bonds (distance) P-C4' energy: -146.452 flat angles C4'-P-C4' energy: -169.250 flat angles P-C4'-P energy: -107.210 tors. eta vs tors. theta energy: -173.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2363.487533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2363.487533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2363.487533 (E_RNA) where: Base-Base interactions energy: -1601.649 where: short stacking energy: -744.648 Base-Backbone interact. energy: -2.614 local terms energy: -759.225019 where: bonds (distance) C4'-P energy: -148.910 bonds (distance) P-C4' energy: -136.210 flat angles C4'-P-C4' energy: -167.365 flat angles P-C4'-P energy: -104.806 tors. eta vs tors. theta energy: -201.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -2186.393510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.393510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.393510 (E_RNA) where: Base-Base interactions energy: -1504.898 where: short stacking energy: -672.771 Base-Backbone interact. energy: -0.492 local terms energy: -681.003330 where: bonds (distance) C4'-P energy: -124.714 bonds (distance) P-C4' energy: -138.506 flat angles C4'-P-C4' energy: -152.188 flat angles P-C4'-P energy: -98.639 tors. eta vs tors. theta energy: -166.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -2053.878756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2053.878756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2053.878756 (E_RNA) where: Base-Base interactions energy: -1398.417 where: short stacking energy: -608.605 Base-Backbone interact. energy: -3.530 local terms energy: -651.931832 where: bonds (distance) C4'-P energy: -119.180 bonds (distance) P-C4' energy: -149.359 flat angles C4'-P-C4' energy: -152.901 flat angles P-C4'-P energy: -94.700 tors. eta vs tors. theta energy: -135.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1972.234817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1972.234817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1972.234817 (E_RNA) where: Base-Base interactions energy: -1326.125 where: short stacking energy: -588.703 Base-Backbone interact. energy: 2.367 local terms energy: -648.476425 where: bonds (distance) C4'-P energy: -132.145 bonds (distance) P-C4' energy: -151.289 flat angles C4'-P-C4' energy: -142.954 flat angles P-C4'-P energy: -81.224 tors. eta vs tors. theta energy: -140.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1601.189279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.189279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.189279 (E_RNA) where: Base-Base interactions energy: -1042.112 where: short stacking energy: -517.356 Base-Backbone interact. energy: -1.731 local terms energy: -557.346296 where: bonds (distance) C4'-P energy: -124.007 bonds (distance) P-C4' energy: -121.926 flat angles C4'-P-C4' energy: -114.953 flat angles P-C4'-P energy: -96.272 tors. eta vs tors. theta energy: -100.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1395.516447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.516447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.516447 (E_RNA) where: Base-Base interactions energy: -902.140 where: short stacking energy: -415.201 Base-Backbone interact. energy: -3.311 local terms energy: -490.065187 where: bonds (distance) C4'-P energy: -115.759 bonds (distance) P-C4' energy: -111.330 flat angles C4'-P-C4' energy: -123.025 flat angles P-C4'-P energy: -81.499 tors. eta vs tors. theta energy: -58.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1231.092465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.092465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.092465 (E_RNA) where: Base-Base interactions energy: -721.433 where: short stacking energy: -361.074 Base-Backbone interact. energy: -2.849 local terms energy: -506.810392 where: bonds (distance) C4'-P energy: -133.514 bonds (distance) P-C4' energy: -125.924 flat angles C4'-P-C4' energy: -118.622 flat angles P-C4'-P energy: -80.606 tors. eta vs tors. theta energy: -48.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1133.466756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.466756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1133.466756 (E_RNA) where: Base-Base interactions energy: -666.218 where: short stacking energy: -313.404 Base-Backbone interact. energy: -3.348 local terms energy: -463.900734 where: bonds (distance) C4'-P energy: -98.939 bonds (distance) P-C4' energy: -127.155 flat angles C4'-P-C4' energy: -142.132 flat angles P-C4'-P energy: -81.015 tors. eta vs tors. theta energy: -14.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2629.527516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2629.527516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2629.527516 (E_RNA) where: Base-Base interactions energy: -1834.655 where: short stacking energy: -792.273 Base-Backbone interact. energy: -3.062 local terms energy: -791.809925 where: bonds (distance) C4'-P energy: -143.662 bonds (distance) P-C4' energy: -147.649 flat angles C4'-P-C4' energy: -172.359 flat angles P-C4'-P energy: -129.785 tors. eta vs tors. theta energy: -198.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2461.627779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2461.627779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2461.627779 (E_RNA) where: Base-Base interactions energy: -1707.514 where: short stacking energy: -736.736 Base-Backbone interact. energy: -3.433 local terms energy: -750.681201 where: bonds (distance) C4'-P energy: -140.142 bonds (distance) P-C4' energy: -161.596 flat angles C4'-P-C4' energy: -151.905 flat angles P-C4'-P energy: -115.062 tors. eta vs tors. theta energy: -181.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2348.940585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.940585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.940585 (E_RNA) where: Base-Base interactions energy: -1583.664 where: short stacking energy: -720.115 Base-Backbone interact. energy: -2.601 local terms energy: -762.675713 where: bonds (distance) C4'-P energy: -131.332 bonds (distance) P-C4' energy: -150.773 flat angles C4'-P-C4' energy: -167.665 flat angles P-C4'-P energy: -117.172 tors. eta vs tors. theta energy: -195.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -2269.773693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2269.773693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2269.773693 (E_RNA) where: Base-Base interactions energy: -1542.019 where: short stacking energy: -691.353 Base-Backbone interact. energy: -3.384 local terms energy: -724.370750 where: bonds (distance) C4'-P energy: -142.020 bonds (distance) P-C4' energy: -139.361 flat angles C4'-P-C4' energy: -162.872 flat angles P-C4'-P energy: -104.161 tors. eta vs tors. theta energy: -175.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -2102.511816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.511816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2102.511816 (E_RNA) where: Base-Base interactions energy: -1457.204 where: short stacking energy: -636.776 Base-Backbone interact. energy: -3.094 local terms energy: -642.213824 where: bonds (distance) C4'-P energy: -117.489 bonds (distance) P-C4' energy: -127.727 flat angles C4'-P-C4' energy: -134.061 flat angles P-C4'-P energy: -114.589 tors. eta vs tors. theta energy: -148.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1923.185388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1923.185388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1923.185388 (E_RNA) where: Base-Base interactions energy: -1311.766 where: short stacking energy: -611.945 Base-Backbone interact. energy: -2.014 local terms energy: -609.405866 where: bonds (distance) C4'-P energy: -116.729 bonds (distance) P-C4' energy: -129.777 flat angles C4'-P-C4' energy: -152.938 flat angles P-C4'-P energy: -87.695 tors. eta vs tors. theta energy: -122.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1603.799846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.799846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.799846 (E_RNA) where: Base-Base interactions energy: -1038.290 where: short stacking energy: -499.958 Base-Backbone interact. energy: 0.091 local terms energy: -565.600216 where: bonds (distance) C4'-P energy: -118.409 bonds (distance) P-C4' energy: -115.709 flat angles C4'-P-C4' energy: -142.641 flat angles P-C4'-P energy: -83.715 tors. eta vs tors. theta energy: -105.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1380.906670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.906670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.906670 (E_RNA) where: Base-Base interactions energy: -842.614 where: short stacking energy: -401.520 Base-Backbone interact. energy: 0.156 local terms energy: -538.448747 where: bonds (distance) C4'-P energy: -129.855 bonds (distance) P-C4' energy: -129.335 flat angles C4'-P-C4' energy: -134.085 flat angles P-C4'-P energy: -90.529 tors. eta vs tors. theta energy: -54.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1316.426408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.426408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.426408 (E_RNA) where: Base-Base interactions energy: -818.475 where: short stacking energy: -392.353 Base-Backbone interact. energy: -4.049 local terms energy: -493.901683 where: bonds (distance) C4'-P energy: -109.844 bonds (distance) P-C4' energy: -139.200 flat angles C4'-P-C4' energy: -108.304 flat angles P-C4'-P energy: -82.746 tors. eta vs tors. theta energy: -53.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1196.303953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.303953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.303953 (E_RNA) where: Base-Base interactions energy: -738.427 where: short stacking energy: -357.359 Base-Backbone interact. energy: -1.550 local terms energy: -456.326994 where: bonds (distance) C4'-P energy: -122.007 bonds (distance) P-C4' energy: -123.445 flat angles C4'-P-C4' energy: -117.595 flat angles P-C4'-P energy: -57.035 tors. eta vs tors. theta energy: -36.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2576.302422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2576.302422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2576.302422 (E_RNA) where: Base-Base interactions energy: -1808.227 where: short stacking energy: -796.522 Base-Backbone interact. energy: -5.526 local terms energy: -762.549343 where: bonds (distance) C4'-P energy: -133.253 bonds (distance) P-C4' energy: -159.114 flat angles C4'-P-C4' energy: -168.771 flat angles P-C4'-P energy: -107.907 tors. eta vs tors. theta energy: -193.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2413.323865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2413.323865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2413.323865 (E_RNA) where: Base-Base interactions energy: -1668.012 where: short stacking energy: -719.711 Base-Backbone interact. energy: 2.114 local terms energy: -747.425102 where: bonds (distance) C4'-P energy: -154.498 bonds (distance) P-C4' energy: -147.354 flat angles C4'-P-C4' energy: -168.291 flat angles P-C4'-P energy: -105.434 tors. eta vs tors. theta energy: -171.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2355.546513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.546513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.546513 (E_RNA) where: Base-Base interactions energy: -1574.730 where: short stacking energy: -724.863 Base-Backbone interact. energy: -3.166 local terms energy: -777.650434 where: bonds (distance) C4'-P energy: -136.183 bonds (distance) P-C4' energy: -150.364 flat angles C4'-P-C4' energy: -172.927 flat angles P-C4'-P energy: -111.227 tors. eta vs tors. theta energy: -206.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -2223.040768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2223.040768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2223.040768 (E_RNA) where: Base-Base interactions energy: -1528.493 where: short stacking energy: -688.238 Base-Backbone interact. energy: -2.517 local terms energy: -692.030337 where: bonds (distance) C4'-P energy: -137.484 bonds (distance) P-C4' energy: -128.387 flat angles C4'-P-C4' energy: -141.521 flat angles P-C4'-P energy: -101.311 tors. eta vs tors. theta energy: -183.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -2047.972930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2047.972930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2047.972930 (E_RNA) where: Base-Base interactions energy: -1396.307 where: short stacking energy: -620.583 Base-Backbone interact. energy: -6.156 local terms energy: -645.510012 where: bonds (distance) C4'-P energy: -127.491 bonds (distance) P-C4' energy: -137.984 flat angles C4'-P-C4' energy: -144.002 flat angles P-C4'-P energy: -103.114 tors. eta vs tors. theta energy: -132.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1907.114063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.114063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1907.114063 (E_RNA) where: Base-Base interactions energy: -1273.334 where: short stacking energy: -595.560 Base-Backbone interact. energy: -2.505 local terms energy: -631.275511 where: bonds (distance) C4'-P energy: -126.662 bonds (distance) P-C4' energy: -135.121 flat angles C4'-P-C4' energy: -138.267 flat angles P-C4'-P energy: -96.272 tors. eta vs tors. theta energy: -134.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1630.616507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.616507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.616507 (E_RNA) where: Base-Base interactions energy: -1060.254 where: short stacking energy: -504.448 Base-Backbone interact. energy: -5.375 local terms energy: -564.986862 where: bonds (distance) C4'-P energy: -114.281 bonds (distance) P-C4' energy: -138.079 flat angles C4'-P-C4' energy: -132.317 flat angles P-C4'-P energy: -74.216 tors. eta vs tors. theta energy: -106.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1367.241005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.241005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.241005 (E_RNA) where: Base-Base interactions energy: -883.524 where: short stacking energy: -418.936 Base-Backbone interact. energy: -3.258 local terms energy: -480.459223 where: bonds (distance) C4'-P energy: -111.193 bonds (distance) P-C4' energy: -125.888 flat angles C4'-P-C4' energy: -110.854 flat angles P-C4'-P energy: -68.346 tors. eta vs tors. theta energy: -64.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1296.348890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.348890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.348890 (E_RNA) where: Base-Base interactions energy: -808.644 where: short stacking energy: -382.619 Base-Backbone interact. energy: -2.892 local terms energy: -484.813009 where: bonds (distance) C4'-P energy: -120.184 bonds (distance) P-C4' energy: -138.852 flat angles C4'-P-C4' energy: -111.326 flat angles P-C4'-P energy: -69.840 tors. eta vs tors. theta energy: -44.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1160.520614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.520614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.520614 (E_RNA) where: Base-Base interactions energy: -712.665 where: short stacking energy: -320.392 Base-Backbone interact. energy: -0.269 local terms energy: -447.586203 where: bonds (distance) C4'-P energy: -116.077 bonds (distance) P-C4' energy: -126.905 flat angles C4'-P-C4' energy: -119.160 flat angles P-C4'-P energy: -55.546 tors. eta vs tors. theta energy: -29.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -2579.377670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2579.377670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2579.377670 (E_RNA) where: Base-Base interactions energy: -1790.293 where: short stacking energy: -799.729 Base-Backbone interact. energy: 0.550 local terms energy: -789.634066 where: bonds (distance) C4'-P energy: -148.525 bonds (distance) P-C4' energy: -152.606 flat angles C4'-P-C4' energy: -173.818 flat angles P-C4'-P energy: -116.806 tors. eta vs tors. theta energy: -197.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2429.464678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2429.464678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2429.464678 (E_RNA) where: Base-Base interactions energy: -1670.219 where: short stacking energy: -704.580 Base-Backbone interact. energy: -3.771 local terms energy: -755.474651 where: bonds (distance) C4'-P energy: -160.100 bonds (distance) P-C4' energy: -149.927 flat angles C4'-P-C4' energy: -163.842 flat angles P-C4'-P energy: -115.280 tors. eta vs tors. theta energy: -166.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2344.880788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2344.880788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.880788 (E_RNA) where: Base-Base interactions energy: -1609.576 where: short stacking energy: -734.238 Base-Backbone interact. energy: -0.151 local terms energy: -735.153480 where: bonds (distance) C4'-P energy: -139.064 bonds (distance) P-C4' energy: -136.341 flat angles C4'-P-C4' energy: -172.382 flat angles P-C4'-P energy: -92.171 tors. eta vs tors. theta energy: -195.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -2216.045957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.045957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2216.045957 (E_RNA) where: Base-Base interactions energy: -1512.327 where: short stacking energy: -684.443 Base-Backbone interact. energy: -5.471 local terms energy: -698.247945 where: bonds (distance) C4'-P energy: -112.259 bonds (distance) P-C4' energy: -138.741 flat angles C4'-P-C4' energy: -171.735 flat angles P-C4'-P energy: -96.644 tors. eta vs tors. theta energy: -178.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -2029.358820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.358820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.358820 (E_RNA) where: Base-Base interactions energy: -1389.837 where: short stacking energy: -606.795 Base-Backbone interact. energy: -5.241 local terms energy: -634.281242 where: bonds (distance) C4'-P energy: -122.840 bonds (distance) P-C4' energy: -141.521 flat angles C4'-P-C4' energy: -148.763 flat angles P-C4'-P energy: -93.615 tors. eta vs tors. theta energy: -127.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1909.654319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.654319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.654319 (E_RNA) where: Base-Base interactions energy: -1217.239 where: short stacking energy: -606.909 Base-Backbone interact. energy: -2.553 local terms energy: -689.862922 where: bonds (distance) C4'-P energy: -142.969 bonds (distance) P-C4' energy: -138.885 flat angles C4'-P-C4' energy: -145.464 flat angles P-C4'-P energy: -100.623 tors. eta vs tors. theta energy: -161.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1616.550966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.550966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.550966 (E_RNA) where: Base-Base interactions energy: -1013.560 where: short stacking energy: -496.164 Base-Backbone interact. energy: 2.041 local terms energy: -605.032669 where: bonds (distance) C4'-P energy: -129.448 bonds (distance) P-C4' energy: -147.759 flat angles C4'-P-C4' energy: -136.978 flat angles P-C4'-P energy: -75.689 tors. eta vs tors. theta energy: -115.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1375.304839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.304839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.304839 (E_RNA) where: Base-Base interactions energy: -833.973 where: short stacking energy: -426.904 Base-Backbone interact. energy: -3.927 local terms energy: -537.405585 where: bonds (distance) C4'-P energy: -121.687 bonds (distance) P-C4' energy: -149.761 flat angles C4'-P-C4' energy: -130.715 flat angles P-C4'-P energy: -76.563 tors. eta vs tors. theta energy: -58.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1250.583296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.583296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.583296 (E_RNA) where: Base-Base interactions energy: -767.198 where: short stacking energy: -377.148 Base-Backbone interact. energy: -1.329 local terms energy: -482.056758 where: bonds (distance) C4'-P energy: -94.324 bonds (distance) P-C4' energy: -113.388 flat angles C4'-P-C4' energy: -133.335 flat angles P-C4'-P energy: -87.486 tors. eta vs tors. theta energy: -53.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1145.586473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.586473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.586473 (E_RNA) where: Base-Base interactions energy: -674.798 where: short stacking energy: -348.365 Base-Backbone interact. energy: 0.627 local terms energy: -471.416316 where: bonds (distance) C4'-P energy: -115.134 bonds (distance) P-C4' energy: -127.390 flat angles C4'-P-C4' energy: -105.301 flat angles P-C4'-P energy: -80.842 tors. eta vs tors. theta energy: -42.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -2579.832367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2579.832367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2579.832367 (E_RNA) where: Base-Base interactions energy: -1795.504 where: short stacking energy: -789.315 Base-Backbone interact. energy: -3.019 local terms energy: -781.309130 where: bonds (distance) C4'-P energy: -133.468 bonds (distance) P-C4' energy: -150.927 flat angles C4'-P-C4' energy: -175.091 flat angles P-C4'-P energy: -118.440 tors. eta vs tors. theta energy: -203.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2426.783227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2426.783227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2426.783227 (E_RNA) where: Base-Base interactions energy: -1676.381 where: short stacking energy: -698.374 Base-Backbone interact. energy: -6.446 local terms energy: -743.956359 where: bonds (distance) C4'-P energy: -152.781 bonds (distance) P-C4' energy: -150.459 flat angles C4'-P-C4' energy: -157.263 flat angles P-C4'-P energy: -107.966 tors. eta vs tors. theta energy: -175.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2376.246127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2376.246127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2376.246127 (E_RNA) where: Base-Base interactions energy: -1601.443 where: short stacking energy: -757.473 Base-Backbone interact. energy: -2.925 local terms energy: -771.878095 where: bonds (distance) C4'-P energy: -160.172 bonds (distance) P-C4' energy: -142.917 flat angles C4'-P-C4' energy: -149.569 flat angles P-C4'-P energy: -115.513 tors. eta vs tors. theta energy: -203.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -2207.340336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.340336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.340336 (E_RNA) where: Base-Base interactions energy: -1485.230 where: short stacking energy: -659.404 Base-Backbone interact. energy: -4.670 local terms energy: -717.439408 where: bonds (distance) C4'-P energy: -152.917 bonds (distance) P-C4' energy: -147.695 flat angles C4'-P-C4' energy: -153.217 flat angles P-C4'-P energy: -99.665 tors. eta vs tors. theta energy: -163.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -2030.766309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2030.766309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2030.766309 (E_RNA) where: Base-Base interactions energy: -1386.465 where: short stacking energy: -606.761 Base-Backbone interact. energy: -3.885 local terms energy: -640.416538 where: bonds (distance) C4'-P energy: -119.537 bonds (distance) P-C4' energy: -142.967 flat angles C4'-P-C4' energy: -148.609 flat angles P-C4'-P energy: -98.534 tors. eta vs tors. theta energy: -130.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1962.452637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.452637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.452637 (E_RNA) where: Base-Base interactions energy: -1292.006 where: short stacking energy: -603.843 Base-Backbone interact. energy: -0.340 local terms energy: -670.106883 where: bonds (distance) C4'-P energy: -146.215 bonds (distance) P-C4' energy: -145.447 flat angles C4'-P-C4' energy: -143.183 flat angles P-C4'-P energy: -98.845 tors. eta vs tors. theta energy: -136.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1602.162087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.162087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.162087 (E_RNA) where: Base-Base interactions energy: -1030.635 where: short stacking energy: -492.410 Base-Backbone interact. energy: 4.495 local terms energy: -576.022258 where: bonds (distance) C4'-P energy: -133.388 bonds (distance) P-C4' energy: -139.888 flat angles C4'-P-C4' energy: -133.238 flat angles P-C4'-P energy: -77.402 tors. eta vs tors. theta energy: -92.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1402.410526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.410526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.410526 (E_RNA) where: Base-Base interactions energy: -838.992 where: short stacking energy: -433.632 Base-Backbone interact. energy: 7.311 local terms energy: -570.729700 where: bonds (distance) C4'-P energy: -128.132 bonds (distance) P-C4' energy: -147.265 flat angles C4'-P-C4' energy: -113.017 flat angles P-C4'-P energy: -91.619 tors. eta vs tors. theta energy: -90.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1185.369568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.369568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.369568 (E_RNA) where: Base-Base interactions energy: -751.107 where: short stacking energy: -353.204 Base-Backbone interact. energy: -0.979 local terms energy: -433.283760 where: bonds (distance) C4'-P energy: -112.315 bonds (distance) P-C4' energy: -117.385 flat angles C4'-P-C4' energy: -93.640 flat angles P-C4'-P energy: -61.978 tors. eta vs tors. theta energy: -47.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1145.093432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.093432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.093432 (E_RNA) where: Base-Base interactions energy: -645.075 where: short stacking energy: -315.162 Base-Backbone interact. energy: -1.773 local terms energy: -498.245457 where: bonds (distance) C4'-P energy: -111.855 bonds (distance) P-C4' energy: -123.909 flat angles C4'-P-C4' energy: -130.686 flat angles P-C4'-P energy: -92.489 tors. eta vs tors. theta energy: -39.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -2580.265765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.265765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2580.265765 (E_RNA) where: Base-Base interactions energy: -1775.401 where: short stacking energy: -775.929 Base-Backbone interact. energy: -3.998 local terms energy: -800.865863 where: bonds (distance) C4'-P energy: -156.161 bonds (distance) P-C4' energy: -143.512 flat angles C4'-P-C4' energy: -178.339 flat angles P-C4'-P energy: -125.283 tors. eta vs tors. theta energy: -197.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2444.690076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2444.690076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2444.690076 (E_RNA) where: Base-Base interactions energy: -1712.885 where: short stacking energy: -705.317 Base-Backbone interact. energy: -5.584 local terms energy: -726.221273 where: bonds (distance) C4'-P energy: -154.880 bonds (distance) P-C4' energy: -137.626 flat angles C4'-P-C4' energy: -158.574 flat angles P-C4'-P energy: -112.890 tors. eta vs tors. theta energy: -162.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2399.573635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2399.573635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2399.573635 (E_RNA) where: Base-Base interactions energy: -1613.020 where: short stacking energy: -765.272 Base-Backbone interact. energy: -2.828 local terms energy: -783.725656 where: bonds (distance) C4'-P energy: -149.490 bonds (distance) P-C4' energy: -149.367 flat angles C4'-P-C4' energy: -160.958 flat angles P-C4'-P energy: -112.893 tors. eta vs tors. theta energy: -211.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2225.874153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2225.874153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2225.874153 (E_RNA) where: Base-Base interactions energy: -1519.019 where: short stacking energy: -675.272 Base-Backbone interact. energy: -1.786 local terms energy: -705.069697 where: bonds (distance) C4'-P energy: -138.178 bonds (distance) P-C4' energy: -151.668 flat angles C4'-P-C4' energy: -151.064 flat angles P-C4'-P energy: -90.958 tors. eta vs tors. theta energy: -173.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -2065.605676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2065.605676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2065.605676 (E_RNA) where: Base-Base interactions energy: -1403.309 where: short stacking energy: -613.535 Base-Backbone interact. energy: -1.334 local terms energy: -660.963482 where: bonds (distance) C4'-P energy: -127.387 bonds (distance) P-C4' energy: -137.646 flat angles C4'-P-C4' energy: -162.727 flat angles P-C4'-P energy: -104.800 tors. eta vs tors. theta energy: -128.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1860.884844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.884844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.884844 (E_RNA) where: Base-Base interactions energy: -1257.310 where: short stacking energy: -604.086 Base-Backbone interact. energy: -1.918 local terms energy: -601.656830 where: bonds (distance) C4'-P energy: -132.011 bonds (distance) P-C4' energy: -120.884 flat angles C4'-P-C4' energy: -124.289 flat angles P-C4'-P energy: -93.405 tors. eta vs tors. theta energy: -131.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1594.061969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.061969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.061969 (E_RNA) where: Base-Base interactions energy: -998.801 where: short stacking energy: -464.740 Base-Backbone interact. energy: -3.928 local terms energy: -591.332750 where: bonds (distance) C4'-P energy: -121.354 bonds (distance) P-C4' energy: -133.297 flat angles C4'-P-C4' energy: -144.972 flat angles P-C4'-P energy: -98.789 tors. eta vs tors. theta energy: -92.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1450.483455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.483455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.483455 (E_RNA) where: Base-Base interactions energy: -920.695 where: short stacking energy: -449.137 Base-Backbone interact. energy: -0.725 local terms energy: -529.064107 where: bonds (distance) C4'-P energy: -113.638 bonds (distance) P-C4' energy: -135.730 flat angles C4'-P-C4' energy: -118.747 flat angles P-C4'-P energy: -70.760 tors. eta vs tors. theta energy: -90.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1220.463702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.463702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.463702 (E_RNA) where: Base-Base interactions energy: -716.339 where: short stacking energy: -366.800 Base-Backbone interact. energy: 3.739 local terms energy: -507.863241 where: bonds (distance) C4'-P energy: -127.118 bonds (distance) P-C4' energy: -133.528 flat angles C4'-P-C4' energy: -118.114 flat angles P-C4'-P energy: -72.139 tors. eta vs tors. theta energy: -56.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1128.686059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.686059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.686059 (E_RNA) where: Base-Base interactions energy: -672.607 where: short stacking energy: -339.699 Base-Backbone interact. energy: -1.559 local terms energy: -454.520652 where: bonds (distance) C4'-P energy: -116.802 bonds (distance) P-C4' energy: -122.769 flat angles C4'-P-C4' energy: -123.437 flat angles P-C4'-P energy: -46.051 tors. eta vs tors. theta energy: -45.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2559.898878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2559.898878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2559.898878 (E_RNA) where: Base-Base interactions energy: -1764.486 where: short stacking energy: -801.519 Base-Backbone interact. energy: -4.009 local terms energy: -791.403613 where: bonds (distance) C4'-P energy: -142.447 bonds (distance) P-C4' energy: -152.470 flat angles C4'-P-C4' energy: -171.514 flat angles P-C4'-P energy: -115.865 tors. eta vs tors. theta energy: -209.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2511.857368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2511.857368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2511.857368 (E_RNA) where: Base-Base interactions energy: -1682.445 where: short stacking energy: -773.587 Base-Backbone interact. energy: -1.298 local terms energy: -828.114443 where: bonds (distance) C4'-P energy: -158.328 bonds (distance) P-C4' energy: -157.316 flat angles C4'-P-C4' energy: -176.616 flat angles P-C4'-P energy: -112.039 tors. eta vs tors. theta energy: -223.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2391.141330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2391.141330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2391.141330 (E_RNA) where: Base-Base interactions energy: -1681.143 where: short stacking energy: -702.739 Base-Backbone interact. energy: -2.125 local terms energy: -707.872715 where: bonds (distance) C4'-P energy: -143.532 bonds (distance) P-C4' energy: -139.046 flat angles C4'-P-C4' energy: -147.593 flat angles P-C4'-P energy: -104.750 tors. eta vs tors. theta energy: -172.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2263.365719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2263.365719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2263.365719 (E_RNA) where: Base-Base interactions energy: -1517.975 where: short stacking energy: -665.779 Base-Backbone interact. energy: 2.847 local terms energy: -748.237820 where: bonds (distance) C4'-P energy: -155.565 bonds (distance) P-C4' energy: -159.344 flat angles C4'-P-C4' energy: -159.942 flat angles P-C4'-P energy: -101.087 tors. eta vs tors. theta energy: -172.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -2118.924015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2118.924015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.924015 (E_RNA) where: Base-Base interactions energy: -1451.094 where: short stacking energy: -615.779 Base-Backbone interact. energy: 0.534 local terms energy: -668.364089 where: bonds (distance) C4'-P energy: -118.051 bonds (distance) P-C4' energy: -152.070 flat angles C4'-P-C4' energy: -158.905 flat angles P-C4'-P energy: -87.950 tors. eta vs tors. theta energy: -151.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1899.746656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.746656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.746656 (E_RNA) where: Base-Base interactions energy: -1234.061 where: short stacking energy: -592.263 Base-Backbone interact. energy: -0.079 local terms energy: -665.606633 where: bonds (distance) C4'-P energy: -147.413 bonds (distance) P-C4' energy: -130.789 flat angles C4'-P-C4' energy: -158.569 flat angles P-C4'-P energy: -89.553 tors. eta vs tors. theta energy: -139.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1616.576914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.576914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.576914 (E_RNA) where: Base-Base interactions energy: -1041.226 where: short stacking energy: -491.093 Base-Backbone interact. energy: -0.600 local terms energy: -574.750351 where: bonds (distance) C4'-P energy: -118.277 bonds (distance) P-C4' energy: -139.323 flat angles C4'-P-C4' energy: -131.041 flat angles P-C4'-P energy: -81.935 tors. eta vs tors. theta energy: -104.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1429.474472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.474472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.474472 (E_RNA) where: Base-Base interactions energy: -871.980 where: short stacking energy: -434.202 Base-Backbone interact. energy: 9.306 local terms energy: -566.799971 where: bonds (distance) C4'-P energy: -121.302 bonds (distance) P-C4' energy: -147.391 flat angles C4'-P-C4' energy: -135.926 flat angles P-C4'-P energy: -75.487 tors. eta vs tors. theta energy: -86.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1216.301414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.301414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.301414 (E_RNA) where: Base-Base interactions energy: -742.249 where: short stacking energy: -348.428 Base-Backbone interact. energy: -2.435 local terms energy: -471.617662 where: bonds (distance) C4'-P energy: -111.917 bonds (distance) P-C4' energy: -124.370 flat angles C4'-P-C4' energy: -120.711 flat angles P-C4'-P energy: -58.312 tors. eta vs tors. theta energy: -56.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1156.724434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.724434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.724434 (E_RNA) where: Base-Base interactions energy: -701.817 where: short stacking energy: -346.012 Base-Backbone interact. energy: -3.844 local terms energy: -451.063590 where: bonds (distance) C4'-P energy: -113.860 bonds (distance) P-C4' energy: -137.767 flat angles C4'-P-C4' energy: -107.895 flat angles P-C4'-P energy: -59.396 tors. eta vs tors. theta energy: -32.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2560.765105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2560.765105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2560.765105 (E_RNA) where: Base-Base interactions energy: -1772.455 where: short stacking energy: -784.824 Base-Backbone interact. energy: -4.564 local terms energy: -783.746086 where: bonds (distance) C4'-P energy: -148.668 bonds (distance) P-C4' energy: -154.751 flat angles C4'-P-C4' energy: -161.717 flat angles P-C4'-P energy: -113.991 tors. eta vs tors. theta energy: -204.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2555.309504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2555.309504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2555.309504 (E_RNA) where: Base-Base interactions energy: -1737.835 where: short stacking energy: -811.724 Base-Backbone interact. energy: -2.886 local terms energy: -814.588223 where: bonds (distance) C4'-P energy: -158.299 bonds (distance) P-C4' energy: -149.069 flat angles C4'-P-C4' energy: -169.269 flat angles P-C4'-P energy: -113.112 tors. eta vs tors. theta energy: -224.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2379.816571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.816571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.816571 (E_RNA) where: Base-Base interactions energy: -1677.711 where: short stacking energy: -710.612 Base-Backbone interact. energy: -2.204 local terms energy: -699.901281 where: bonds (distance) C4'-P energy: -145.331 bonds (distance) P-C4' energy: -144.660 flat angles C4'-P-C4' energy: -133.300 flat angles P-C4'-P energy: -98.311 tors. eta vs tors. theta energy: -178.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -2196.934136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.934136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.934136 (E_RNA) where: Base-Base interactions energy: -1503.518 where: short stacking energy: -685.832 Base-Backbone interact. energy: -0.331 local terms energy: -693.085832 where: bonds (distance) C4'-P energy: -142.146 bonds (distance) P-C4' energy: -126.337 flat angles C4'-P-C4' energy: -149.034 flat angles P-C4'-P energy: -100.196 tors. eta vs tors. theta energy: -175.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -2115.236401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.236401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.236401 (E_RNA) where: Base-Base interactions energy: -1430.889 where: short stacking energy: -598.894 Base-Backbone interact. energy: -1.710 local terms energy: -682.638149 where: bonds (distance) C4'-P energy: -128.292 bonds (distance) P-C4' energy: -140.175 flat angles C4'-P-C4' energy: -161.822 flat angles P-C4'-P energy: -104.031 tors. eta vs tors. theta energy: -148.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1884.026512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1884.026512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1884.026512 (E_RNA) where: Base-Base interactions energy: -1221.977 where: short stacking energy: -581.645 Base-Backbone interact. energy: -1.977 local terms energy: -660.072766 where: bonds (distance) C4'-P energy: -131.703 bonds (distance) P-C4' energy: -141.829 flat angles C4'-P-C4' energy: -147.113 flat angles P-C4'-P energy: -93.267 tors. eta vs tors. theta energy: -146.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1624.747524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.747524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.747524 (E_RNA) where: Base-Base interactions energy: -1066.752 where: short stacking energy: -492.923 Base-Backbone interact. energy: 1.540 local terms energy: -559.535756 where: bonds (distance) C4'-P energy: -122.779 bonds (distance) P-C4' energy: -101.989 flat angles C4'-P-C4' energy: -139.520 flat angles P-C4'-P energy: -93.824 tors. eta vs tors. theta energy: -101.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1499.790805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.790805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.790805 (E_RNA) where: Base-Base interactions energy: -939.144 where: short stacking energy: -475.255 Base-Backbone interact. energy: -2.700 local terms energy: -557.947098 where: bonds (distance) C4'-P energy: -130.240 bonds (distance) P-C4' energy: -127.276 flat angles C4'-P-C4' energy: -130.974 flat angles P-C4'-P energy: -79.329 tors. eta vs tors. theta energy: -90.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1195.157120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.157120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.157120 (E_RNA) where: Base-Base interactions energy: -725.081 where: short stacking energy: -352.407 Base-Backbone interact. energy: 3.303 local terms energy: -473.379389 where: bonds (distance) C4'-P energy: -114.043 bonds (distance) P-C4' energy: -129.583 flat angles C4'-P-C4' energy: -123.436 flat angles P-C4'-P energy: -72.963 tors. eta vs tors. theta energy: -33.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1080.336240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.336240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.336240 (E_RNA) where: Base-Base interactions energy: -606.988 where: short stacking energy: -305.705 Base-Backbone interact. energy: -1.548 local terms energy: -471.800695 where: bonds (distance) C4'-P energy: -115.167 bonds (distance) P-C4' energy: -125.818 flat angles C4'-P-C4' energy: -122.820 flat angles P-C4'-P energy: -74.961 tors. eta vs tors. theta energy: -33.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -2535.732039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.732039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.732039 (E_RNA) where: Base-Base interactions energy: -1756.875 where: short stacking energy: -798.045 Base-Backbone interact. energy: -3.293 local terms energy: -775.564571 where: bonds (distance) C4'-P energy: -137.019 bonds (distance) P-C4' energy: -153.261 flat angles C4'-P-C4' energy: -172.005 flat angles P-C4'-P energy: -116.123 tors. eta vs tors. theta energy: -197.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2567.570486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2567.570486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2567.570486 (E_RNA) where: Base-Base interactions energy: -1767.514 where: short stacking energy: -825.958 Base-Backbone interact. energy: -4.597 local terms energy: -795.460186 where: bonds (distance) C4'-P energy: -149.829 bonds (distance) P-C4' energy: -141.886 flat angles C4'-P-C4' energy: -165.586 flat angles P-C4'-P energy: -115.836 tors. eta vs tors. theta energy: -222.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2354.192149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2354.192149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.192149 (E_RNA) where: Base-Base interactions energy: -1603.978 where: short stacking energy: -689.357 Base-Backbone interact. energy: -5.046 local terms energy: -745.168347 where: bonds (distance) C4'-P energy: -148.015 bonds (distance) P-C4' energy: -154.227 flat angles C4'-P-C4' energy: -156.966 flat angles P-C4'-P energy: -113.745 tors. eta vs tors. theta energy: -172.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -2256.845831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2256.845831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.845831 (E_RNA) where: Base-Base interactions energy: -1551.859 where: short stacking energy: -700.309 Base-Backbone interact. energy: -2.423 local terms energy: -702.564232 where: bonds (distance) C4'-P energy: -133.243 bonds (distance) P-C4' energy: -146.649 flat angles C4'-P-C4' energy: -144.770 flat angles P-C4'-P energy: -96.912 tors. eta vs tors. theta energy: -180.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -2124.611142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.611142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.611142 (E_RNA) where: Base-Base interactions energy: -1453.245 where: short stacking energy: -630.379 Base-Backbone interact. energy: 2.386 local terms energy: -673.751900 where: bonds (distance) C4'-P energy: -141.450 bonds (distance) P-C4' energy: -140.540 flat angles C4'-P-C4' energy: -153.844 flat angles P-C4'-P energy: -91.873 tors. eta vs tors. theta energy: -146.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1938.266841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1938.266841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1938.266841 (E_RNA) where: Base-Base interactions energy: -1271.783 where: short stacking energy: -609.609 Base-Backbone interact. energy: -3.493 local terms energy: -662.990152 where: bonds (distance) C4'-P energy: -124.129 bonds (distance) P-C4' energy: -132.033 flat angles C4'-P-C4' energy: -159.605 flat angles P-C4'-P energy: -95.063 tors. eta vs tors. theta energy: -152.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1658.033709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.033709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.033709 (E_RNA) where: Base-Base interactions energy: -1071.023 where: short stacking energy: -497.770 Base-Backbone interact. energy: -0.383 local terms energy: -586.627963 where: bonds (distance) C4'-P energy: -119.320 bonds (distance) P-C4' energy: -123.078 flat angles C4'-P-C4' energy: -140.591 flat angles P-C4'-P energy: -83.823 tors. eta vs tors. theta energy: -119.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1476.873112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.873112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.873112 (E_RNA) where: Base-Base interactions energy: -978.306 where: short stacking energy: -427.508 Base-Backbone interact. energy: 0.213 local terms energy: -498.779947 where: bonds (distance) C4'-P energy: -117.312 bonds (distance) P-C4' energy: -100.947 flat angles C4'-P-C4' energy: -123.648 flat angles P-C4'-P energy: -72.722 tors. eta vs tors. theta energy: -84.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1242.382492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.382492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.382492 (E_RNA) where: Base-Base interactions energy: -769.192 where: short stacking energy: -373.782 Base-Backbone interact. energy: 0.546 local terms energy: -473.736513 where: bonds (distance) C4'-P energy: -98.263 bonds (distance) P-C4' energy: -138.646 flat angles C4'-P-C4' energy: -123.323 flat angles P-C4'-P energy: -72.602 tors. eta vs tors. theta energy: -40.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1086.834115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.834115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.834115 (E_RNA) where: Base-Base interactions energy: -594.277 where: short stacking energy: -323.381 Base-Backbone interact. energy: -1.860 local terms energy: -490.697581 where: bonds (distance) C4'-P energy: -142.868 bonds (distance) P-C4' energy: -146.044 flat angles C4'-P-C4' energy: -117.004 flat angles P-C4'-P energy: -61.288 tors. eta vs tors. theta energy: -23.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -2546.207777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2546.207777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2546.207777 (E_RNA) where: Base-Base interactions energy: -1752.661 where: short stacking energy: -768.830 Base-Backbone interact. energy: -6.817 local terms energy: -786.729638 where: bonds (distance) C4'-P energy: -142.587 bonds (distance) P-C4' energy: -157.125 flat angles C4'-P-C4' energy: -179.289 flat angles P-C4'-P energy: -115.596 tors. eta vs tors. theta energy: -192.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2557.579707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2557.579707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2557.579707 (E_RNA) where: Base-Base interactions energy: -1760.852 where: short stacking energy: -800.295 Base-Backbone interact. energy: -1.425 local terms energy: -795.302727 where: bonds (distance) C4'-P energy: -148.068 bonds (distance) P-C4' energy: -155.050 flat angles C4'-P-C4' energy: -171.818 flat angles P-C4'-P energy: -106.486 tors. eta vs tors. theta energy: -213.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2306.715852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.715852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.715852 (E_RNA) where: Base-Base interactions energy: -1604.511 where: short stacking energy: -701.047 Base-Backbone interact. energy: -1.476 local terms energy: -700.729389 where: bonds (distance) C4'-P energy: -131.479 bonds (distance) P-C4' energy: -143.960 flat angles C4'-P-C4' energy: -155.930 flat angles P-C4'-P energy: -95.048 tors. eta vs tors. theta energy: -174.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -2237.062614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2237.062614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.062614 (E_RNA) where: Base-Base interactions energy: -1494.597 where: short stacking energy: -699.514 Base-Backbone interact. energy: -1.323 local terms energy: -741.142207 where: bonds (distance) C4'-P energy: -133.294 bonds (distance) P-C4' energy: -148.177 flat angles C4'-P-C4' energy: -170.749 flat angles P-C4'-P energy: -100.849 tors. eta vs tors. theta energy: -188.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -2141.668151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2141.668151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2141.668151 (E_RNA) where: Base-Base interactions energy: -1508.608 where: short stacking energy: -630.113 Base-Backbone interact. energy: -0.845 local terms energy: -632.215593 where: bonds (distance) C4'-P energy: -125.092 bonds (distance) P-C4' energy: -126.137 flat angles C4'-P-C4' energy: -148.751 flat angles P-C4'-P energy: -91.234 tors. eta vs tors. theta energy: -141.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1915.462046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.462046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.462046 (E_RNA) where: Base-Base interactions energy: -1235.855 where: short stacking energy: -582.099 Base-Backbone interact. energy: -1.717 local terms energy: -677.889924 where: bonds (distance) C4'-P energy: -138.811 bonds (distance) P-C4' energy: -139.254 flat angles C4'-P-C4' energy: -167.423 flat angles P-C4'-P energy: -97.330 tors. eta vs tors. theta energy: -135.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1620.763629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.763629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.763629 (E_RNA) where: Base-Base interactions energy: -1048.469 where: short stacking energy: -511.771 Base-Backbone interact. energy: -1.117 local terms energy: -571.177434 where: bonds (distance) C4'-P energy: -133.953 bonds (distance) P-C4' energy: -133.853 flat angles C4'-P-C4' energy: -144.353 flat angles P-C4'-P energy: -68.400 tors. eta vs tors. theta energy: -90.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1508.250277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.250277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.250277 (E_RNA) where: Base-Base interactions energy: -972.907 where: short stacking energy: -469.552 Base-Backbone interact. energy: 5.366 local terms energy: -540.709415 where: bonds (distance) C4'-P energy: -121.990 bonds (distance) P-C4' energy: -105.581 flat angles C4'-P-C4' energy: -123.667 flat angles P-C4'-P energy: -98.216 tors. eta vs tors. theta energy: -91.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1237.078128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.078128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.078128 (E_RNA) where: Base-Base interactions energy: -770.393 where: short stacking energy: -380.843 Base-Backbone interact. energy: -2.868 local terms energy: -463.816540 where: bonds (distance) C4'-P energy: -112.032 bonds (distance) P-C4' energy: -126.372 flat angles C4'-P-C4' energy: -104.531 flat angles P-C4'-P energy: -66.570 tors. eta vs tors. theta energy: -54.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1123.083795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.083795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.083795 (E_RNA) where: Base-Base interactions energy: -666.487 where: short stacking energy: -368.704 Base-Backbone interact. energy: -0.019 local terms energy: -456.578088 where: bonds (distance) C4'-P energy: -118.181 bonds (distance) P-C4' energy: -116.063 flat angles C4'-P-C4' energy: -108.725 flat angles P-C4'-P energy: -63.370 tors. eta vs tors. theta energy: -50.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -2570.545404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2570.545404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2570.545404 (E_RNA) where: Base-Base interactions energy: -1763.269 where: short stacking energy: -765.150 Base-Backbone interact. energy: -5.335 local terms energy: -801.940830 where: bonds (distance) C4'-P energy: -145.869 bonds (distance) P-C4' energy: -162.368 flat angles C4'-P-C4' energy: -169.176 flat angles P-C4'-P energy: -123.605 tors. eta vs tors. theta energy: -200.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2578.183202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2578.183202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2578.183202 (E_RNA) where: Base-Base interactions energy: -1798.642 where: short stacking energy: -813.623 Base-Backbone interact. energy: -4.408 local terms energy: -775.132355 where: bonds (distance) C4'-P energy: -135.417 bonds (distance) P-C4' energy: -150.026 flat angles C4'-P-C4' energy: -162.738 flat angles P-C4'-P energy: -112.427 tors. eta vs tors. theta energy: -214.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2316.272223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.272223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2316.272223 (E_RNA) where: Base-Base interactions energy: -1593.558 where: short stacking energy: -732.220 Base-Backbone interact. energy: -1.287 local terms energy: -721.427605 where: bonds (distance) C4'-P energy: -154.195 bonds (distance) P-C4' energy: -146.998 flat angles C4'-P-C4' energy: -159.223 flat angles P-C4'-P energy: -90.321 tors. eta vs tors. theta energy: -170.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -2224.515194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2224.515194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2224.515194 (E_RNA) where: Base-Base interactions energy: -1529.996 where: short stacking energy: -662.348 Base-Backbone interact. energy: 2.303 local terms energy: -696.822552 where: bonds (distance) C4'-P energy: -154.403 bonds (distance) P-C4' energy: -125.823 flat angles C4'-P-C4' energy: -151.032 flat angles P-C4'-P energy: -96.719 tors. eta vs tors. theta energy: -168.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -2173.213169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2173.213169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2173.213169 (E_RNA) where: Base-Base interactions energy: -1502.754 where: short stacking energy: -628.695 Base-Backbone interact. energy: 1.581 local terms energy: -672.040155 where: bonds (distance) C4'-P energy: -118.256 bonds (distance) P-C4' energy: -157.843 flat angles C4'-P-C4' energy: -161.847 flat angles P-C4'-P energy: -77.727 tors. eta vs tors. theta energy: -156.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1899.624654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.624654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.624654 (E_RNA) where: Base-Base interactions energy: -1257.285 where: short stacking energy: -600.379 Base-Backbone interact. energy: 1.951 local terms energy: -644.290637 where: bonds (distance) C4'-P energy: -106.717 bonds (distance) P-C4' energy: -133.861 flat angles C4'-P-C4' energy: -151.237 flat angles P-C4'-P energy: -95.712 tors. eta vs tors. theta energy: -156.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1609.744020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.744020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.744020 (E_RNA) where: Base-Base interactions energy: -1021.402 where: short stacking energy: -497.244 Base-Backbone interact. energy: -1.203 local terms energy: -587.139441 where: bonds (distance) C4'-P energy: -126.780 bonds (distance) P-C4' energy: -133.197 flat angles C4'-P-C4' energy: -124.950 flat angles P-C4'-P energy: -79.170 tors. eta vs tors. theta energy: -123.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1503.490577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.490577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1503.490577 (E_RNA) where: Base-Base interactions energy: -921.952 where: short stacking energy: -462.602 Base-Backbone interact. energy: -1.934 local terms energy: -579.604865 where: bonds (distance) C4'-P energy: -140.546 bonds (distance) P-C4' energy: -140.469 flat angles C4'-P-C4' energy: -122.138 flat angles P-C4'-P energy: -83.740 tors. eta vs tors. theta energy: -92.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1156.002750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.002750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.002750 (E_RNA) where: Base-Base interactions energy: -712.543 where: short stacking energy: -361.422 Base-Backbone interact. energy: 5.728 local terms energy: -449.187389 where: bonds (distance) C4'-P energy: -116.165 bonds (distance) P-C4' energy: -123.908 flat angles C4'-P-C4' energy: -127.907 flat angles P-C4'-P energy: -55.646 tors. eta vs tors. theta energy: -25.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1131.506911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.506911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.506911 (E_RNA) where: Base-Base interactions energy: -683.256 where: short stacking energy: -344.201 Base-Backbone interact. energy: -3.884 local terms energy: -444.367108 where: bonds (distance) C4'-P energy: -116.586 bonds (distance) P-C4' energy: -114.042 flat angles C4'-P-C4' energy: -115.165 flat angles P-C4'-P energy: -60.586 tors. eta vs tors. theta energy: -37.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -2580.112677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.112677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2580.112677 (E_RNA) where: Base-Base interactions energy: -1787.115 where: short stacking energy: -778.176 Base-Backbone interact. energy: -1.895 local terms energy: -791.102572 where: bonds (distance) C4'-P energy: -146.036 bonds (distance) P-C4' energy: -166.988 flat angles C4'-P-C4' energy: -163.070 flat angles P-C4'-P energy: -113.295 tors. eta vs tors. theta energy: -201.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2541.162374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2541.162374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2541.162374 (E_RNA) where: Base-Base interactions energy: -1766.851 where: short stacking energy: -780.855 Base-Backbone interact. energy: -3.776 local terms energy: -770.535891 where: bonds (distance) C4'-P energy: -141.636 bonds (distance) P-C4' energy: -145.731 flat angles C4'-P-C4' energy: -166.359 flat angles P-C4'-P energy: -100.961 tors. eta vs tors. theta energy: -215.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2347.343968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2347.343968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2347.343968 (E_RNA) where: Base-Base interactions energy: -1643.514 where: short stacking energy: -693.791 Base-Backbone interact. energy: -0.098 local terms energy: -703.731904 where: bonds (distance) C4'-P energy: -142.911 bonds (distance) P-C4' energy: -153.069 flat angles C4'-P-C4' energy: -165.611 flat angles P-C4'-P energy: -92.290 tors. eta vs tors. theta energy: -149.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -2241.598600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2241.598600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.598600 (E_RNA) where: Base-Base interactions energy: -1538.947 where: short stacking energy: -681.614 Base-Backbone interact. energy: -1.857 local terms energy: -700.794734 where: bonds (distance) C4'-P energy: -135.065 bonds (distance) P-C4' energy: -138.048 flat angles C4'-P-C4' energy: -143.584 flat angles P-C4'-P energy: -93.335 tors. eta vs tors. theta energy: -190.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -2136.953906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2136.953906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2136.953906 (E_RNA) where: Base-Base interactions energy: -1483.922 where: short stacking energy: -635.759 Base-Backbone interact. energy: -5.430 local terms energy: -647.602497 where: bonds (distance) C4'-P energy: -149.032 bonds (distance) P-C4' energy: -128.465 flat angles C4'-P-C4' energy: -144.306 flat angles P-C4'-P energy: -94.051 tors. eta vs tors. theta energy: -131.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1862.924039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1862.924039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1862.924039 (E_RNA) where: Base-Base interactions energy: -1219.807 where: short stacking energy: -561.770 Base-Backbone interact. energy: -3.444 local terms energy: -639.673060 where: bonds (distance) C4'-P energy: -143.102 bonds (distance) P-C4' energy: -140.346 flat angles C4'-P-C4' energy: -160.224 flat angles P-C4'-P energy: -72.508 tors. eta vs tors. theta energy: -123.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1677.785395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.785395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.785395 (E_RNA) where: Base-Base interactions energy: -1130.198 where: short stacking energy: -502.120 Base-Backbone interact. energy: -3.544 local terms energy: -544.042957 where: bonds (distance) C4'-P energy: -111.427 bonds (distance) P-C4' energy: -115.721 flat angles C4'-P-C4' energy: -163.102 flat angles P-C4'-P energy: -79.042 tors. eta vs tors. theta energy: -74.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1417.678657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.678657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.678657 (E_RNA) where: Base-Base interactions energy: -871.205 where: short stacking energy: -438.811 Base-Backbone interact. energy: -2.415 local terms energy: -544.058242 where: bonds (distance) C4'-P energy: -121.649 bonds (distance) P-C4' energy: -123.651 flat angles C4'-P-C4' energy: -133.665 flat angles P-C4'-P energy: -91.584 tors. eta vs tors. theta energy: -73.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1265.113274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.113274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.113274 (E_RNA) where: Base-Base interactions energy: -756.334 where: short stacking energy: -360.753 Base-Backbone interact. energy: -2.421 local terms energy: -506.357581 where: bonds (distance) C4'-P energy: -114.379 bonds (distance) P-C4' energy: -132.465 flat angles C4'-P-C4' energy: -121.509 flat angles P-C4'-P energy: -69.816 tors. eta vs tors. theta energy: -68.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1129.384649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.384649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.384649 (E_RNA) where: Base-Base interactions energy: -675.334 where: short stacking energy: -309.726 Base-Backbone interact. energy: -1.334 local terms energy: -452.716648 where: bonds (distance) C4'-P energy: -113.138 bonds (distance) P-C4' energy: -131.802 flat angles C4'-P-C4' energy: -110.886 flat angles P-C4'-P energy: -78.577 tors. eta vs tors. theta energy: -18.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -2578.398141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2578.398141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2578.398141 (E_RNA) where: Base-Base interactions energy: -1805.197 where: short stacking energy: -779.687 Base-Backbone interact. energy: -3.130 local terms energy: -770.070932 where: bonds (distance) C4'-P energy: -136.164 bonds (distance) P-C4' energy: -149.304 flat angles C4'-P-C4' energy: -169.054 flat angles P-C4'-P energy: -117.908 tors. eta vs tors. theta energy: -197.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2591.949192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2591.949192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2591.949192 (E_RNA) where: Base-Base interactions energy: -1794.133 where: short stacking energy: -784.116 Base-Backbone interact. energy: -3.383 local terms energy: -794.432851 where: bonds (distance) C4'-P energy: -143.264 bonds (distance) P-C4' energy: -159.846 flat angles C4'-P-C4' energy: -171.418 flat angles P-C4'-P energy: -110.540 tors. eta vs tors. theta energy: -209.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2361.931795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2361.931795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2361.931795 (E_RNA) where: Base-Base interactions energy: -1644.963 where: short stacking energy: -725.752 Base-Backbone interact. energy: -4.767 local terms energy: -712.201958 where: bonds (distance) C4'-P energy: -130.826 bonds (distance) P-C4' energy: -158.482 flat angles C4'-P-C4' energy: -163.028 flat angles P-C4'-P energy: -81.258 tors. eta vs tors. theta energy: -178.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -2262.423323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2262.423323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.423323 (E_RNA) where: Base-Base interactions energy: -1532.320 where: short stacking energy: -721.836 Base-Backbone interact. energy: -2.715 local terms energy: -727.388572 where: bonds (distance) C4'-P energy: -139.681 bonds (distance) P-C4' energy: -148.588 flat angles C4'-P-C4' energy: -142.805 flat angles P-C4'-P energy: -103.746 tors. eta vs tors. theta energy: -192.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -2093.527319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2093.527319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2093.527319 (E_RNA) where: Base-Base interactions energy: -1432.840 where: short stacking energy: -649.565 Base-Backbone interact. energy: -4.639 local terms energy: -656.048233 where: bonds (distance) C4'-P energy: -139.021 bonds (distance) P-C4' energy: -124.356 flat angles C4'-P-C4' energy: -153.120 flat angles P-C4'-P energy: -89.121 tors. eta vs tors. theta energy: -150.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1830.308376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1830.308376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1830.308376 (E_RNA) where: Base-Base interactions energy: -1188.000 where: short stacking energy: -565.111 Base-Backbone interact. energy: 0.239 local terms energy: -642.547383 where: bonds (distance) C4'-P energy: -140.925 bonds (distance) P-C4' energy: -148.709 flat angles C4'-P-C4' energy: -152.718 flat angles P-C4'-P energy: -88.753 tors. eta vs tors. theta energy: -111.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1683.458862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.458862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.458862 (E_RNA) where: Base-Base interactions energy: -1154.492 where: short stacking energy: -525.014 Base-Backbone interact. energy: -0.674 local terms energy: -528.292282 where: bonds (distance) C4'-P energy: -100.832 bonds (distance) P-C4' energy: -127.657 flat angles C4'-P-C4' energy: -140.337 flat angles P-C4'-P energy: -59.212 tors. eta vs tors. theta energy: -100.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1421.826399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.826399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.826399 (E_RNA) where: Base-Base interactions energy: -891.084 where: short stacking energy: -430.916 Base-Backbone interact. energy: -0.739 local terms energy: -530.003726 where: bonds (distance) C4'-P energy: -118.530 bonds (distance) P-C4' energy: -136.563 flat angles C4'-P-C4' energy: -107.036 flat angles P-C4'-P energy: -94.762 tors. eta vs tors. theta energy: -73.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1305.987130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.987130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.987130 (E_RNA) where: Base-Base interactions energy: -804.788 where: short stacking energy: -384.252 Base-Backbone interact. energy: 1.623 local terms energy: -502.821885 where: bonds (distance) C4'-P energy: -129.739 bonds (distance) P-C4' energy: -141.635 flat angles C4'-P-C4' energy: -128.510 flat angles P-C4'-P energy: -50.628 tors. eta vs tors. theta energy: -52.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1097.510898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.510898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.510898 (E_RNA) where: Base-Base interactions energy: -668.543 where: short stacking energy: -322.406 Base-Backbone interact. energy: 10.860 local terms energy: -439.827545 where: bonds (distance) C4'-P energy: -98.268 bonds (distance) P-C4' energy: -123.531 flat angles C4'-P-C4' energy: -119.833 flat angles P-C4'-P energy: -63.105 tors. eta vs tors. theta energy: -35.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -2664.780162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2664.780162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2664.780162 (E_RNA) where: Base-Base interactions energy: -1836.483 where: short stacking energy: -822.784 Base-Backbone interact. energy: -4.659 local terms energy: -823.638314 where: bonds (distance) C4'-P energy: -152.978 bonds (distance) P-C4' energy: -159.829 flat angles C4'-P-C4' energy: -175.329 flat angles P-C4'-P energy: -107.938 tors. eta vs tors. theta energy: -227.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2517.910633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2517.910633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2517.910633 (E_RNA) where: Base-Base interactions energy: -1744.467 where: short stacking energy: -788.524 Base-Backbone interact. energy: -4.443 local terms energy: -769.000788 where: bonds (distance) C4'-P energy: -136.009 bonds (distance) P-C4' energy: -146.483 flat angles C4'-P-C4' energy: -178.920 flat angles P-C4'-P energy: -120.437 tors. eta vs tors. theta energy: -187.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2349.412225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2349.412225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2349.412225 (E_RNA) where: Base-Base interactions energy: -1627.288 where: short stacking energy: -712.513 Base-Backbone interact. energy: 0.736 local terms energy: -722.859375 where: bonds (distance) C4'-P energy: -132.325 bonds (distance) P-C4' energy: -142.244 flat angles C4'-P-C4' energy: -169.315 flat angles P-C4'-P energy: -108.639 tors. eta vs tors. theta energy: -170.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2229.573916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2229.573916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2229.573916 (E_RNA) where: Base-Base interactions energy: -1510.461 where: short stacking energy: -670.167 Base-Backbone interact. energy: -1.921 local terms energy: -717.191747 where: bonds (distance) C4'-P energy: -143.333 bonds (distance) P-C4' energy: -143.906 flat angles C4'-P-C4' energy: -142.242 flat angles P-C4'-P energy: -117.242 tors. eta vs tors. theta energy: -170.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -2093.906494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2093.906494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2093.906494 (E_RNA) where: Base-Base interactions energy: -1436.645 where: short stacking energy: -633.564 Base-Backbone interact. energy: -6.889 local terms energy: -650.373274 where: bonds (distance) C4'-P energy: -146.843 bonds (distance) P-C4' energy: -141.237 flat angles C4'-P-C4' energy: -129.847 flat angles P-C4'-P energy: -87.765 tors. eta vs tors. theta energy: -144.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1814.088906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1814.088906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1814.088906 (E_RNA) where: Base-Base interactions energy: -1178.681 where: short stacking energy: -555.205 Base-Backbone interact. energy: -3.935 local terms energy: -631.473012 where: bonds (distance) C4'-P energy: -133.708 bonds (distance) P-C4' energy: -129.644 flat angles C4'-P-C4' energy: -151.571 flat angles P-C4'-P energy: -102.734 tors. eta vs tors. theta energy: -113.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1763.926589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1763.926589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.926589 (E_RNA) where: Base-Base interactions energy: -1198.749 where: short stacking energy: -529.911 Base-Backbone interact. energy: -0.277 local terms energy: -564.900721 where: bonds (distance) C4'-P energy: -113.169 bonds (distance) P-C4' energy: -124.990 flat angles C4'-P-C4' energy: -138.142 flat angles P-C4'-P energy: -77.216 tors. eta vs tors. theta energy: -111.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1457.669412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.669412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.669412 (E_RNA) where: Base-Base interactions energy: -917.312 where: short stacking energy: -435.674 Base-Backbone interact. energy: 0.374 local terms energy: -540.731604 where: bonds (distance) C4'-P energy: -125.553 bonds (distance) P-C4' energy: -135.268 flat angles C4'-P-C4' energy: -126.328 flat angles P-C4'-P energy: -79.000 tors. eta vs tors. theta energy: -74.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1396.689212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1396.689212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.689212 (E_RNA) where: Base-Base interactions energy: -879.874 where: short stacking energy: -418.947 Base-Backbone interact. energy: 7.067 local terms energy: -523.882183 where: bonds (distance) C4'-P energy: -125.158 bonds (distance) P-C4' energy: -119.508 flat angles C4'-P-C4' energy: -132.700 flat angles P-C4'-P energy: -78.629 tors. eta vs tors. theta energy: -67.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1157.864910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.864910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.864910 (E_RNA) where: Base-Base interactions energy: -714.588 where: short stacking energy: -320.676 Base-Backbone interact. energy: -2.045 local terms energy: -441.231912 where: bonds (distance) C4'-P energy: -110.272 bonds (distance) P-C4' energy: -131.905 flat angles C4'-P-C4' energy: -100.310 flat angles P-C4'-P energy: -72.885 tors. eta vs tors. theta energy: -25.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -2656.072061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2656.072061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2656.072061 (E_RNA) where: Base-Base interactions energy: -1849.262 where: short stacking energy: -829.937 Base-Backbone interact. energy: -0.381 local terms energy: -806.429157 where: bonds (distance) C4'-P energy: -152.090 bonds (distance) P-C4' energy: -159.418 flat angles C4'-P-C4' energy: -166.552 flat angles P-C4'-P energy: -99.880 tors. eta vs tors. theta energy: -228.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -2514.070674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.070674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.070674 (E_RNA) where: Base-Base interactions energy: -1751.905 where: short stacking energy: -762.701 Base-Backbone interact. energy: 5.343 local terms energy: -767.507881 where: bonds (distance) C4'-P energy: -139.606 bonds (distance) P-C4' energy: -147.924 flat angles C4'-P-C4' energy: -173.720 flat angles P-C4'-P energy: -113.086 tors. eta vs tors. theta energy: -193.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -2346.785011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2346.785011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2346.785011 (E_RNA) where: Base-Base interactions energy: -1608.666 where: short stacking energy: -696.149 Base-Backbone interact. energy: -4.529 local terms energy: -733.590424 where: bonds (distance) C4'-P energy: -138.065 bonds (distance) P-C4' energy: -142.915 flat angles C4'-P-C4' energy: -164.523 flat angles P-C4'-P energy: -108.858 tors. eta vs tors. theta energy: -179.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -2256.260758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2256.260758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.260758 (E_RNA) where: Base-Base interactions energy: -1534.485 where: short stacking energy: -700.805 Base-Backbone interact. energy: -1.906 local terms energy: -719.869701 where: bonds (distance) C4'-P energy: -130.884 bonds (distance) P-C4' energy: -126.643 flat angles C4'-P-C4' energy: -174.140 flat angles P-C4'-P energy: -102.357 tors. eta vs tors. theta energy: -185.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -2058.835676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2058.835676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.835676 (E_RNA) where: Base-Base interactions energy: -1397.598 where: short stacking energy: -612.631 Base-Backbone interact. energy: -12.047 local terms energy: -649.191108 where: bonds (distance) C4'-P energy: -128.407 bonds (distance) P-C4' energy: -148.464 flat angles C4'-P-C4' energy: -147.696 flat angles P-C4'-P energy: -94.425 tors. eta vs tors. theta energy: -130.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1819.310245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1819.310245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1819.310245 (E_RNA) where: Base-Base interactions energy: -1188.966 where: short stacking energy: -555.895 Base-Backbone interact. energy: -2.574 local terms energy: -627.769624 where: bonds (distance) C4'-P energy: -134.844 bonds (distance) P-C4' energy: -156.337 flat angles C4'-P-C4' energy: -137.776 flat angles P-C4'-P energy: -76.990 tors. eta vs tors. theta energy: -121.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1754.384062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1754.384062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.384062 (E_RNA) where: Base-Base interactions energy: -1169.512 where: short stacking energy: -545.036 Base-Backbone interact. energy: -0.471 local terms energy: -584.401329 where: bonds (distance) C4'-P energy: -112.387 bonds (distance) P-C4' energy: -143.044 flat angles C4'-P-C4' energy: -116.312 flat angles P-C4'-P energy: -94.541 tors. eta vs tors. theta energy: -118.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1551.780705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.780705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.780705 (E_RNA) where: Base-Base interactions energy: -1006.805 where: short stacking energy: -465.414 Base-Backbone interact. energy: 5.725 local terms energy: -550.700634 where: bonds (distance) C4'-P energy: -117.969 bonds (distance) P-C4' energy: -127.308 flat angles C4'-P-C4' energy: -131.047 flat angles P-C4'-P energy: -90.168 tors. eta vs tors. theta energy: -84.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1354.882895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.882895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.882895 (E_RNA) where: Base-Base interactions energy: -873.081 where: short stacking energy: -437.009 Base-Backbone interact. energy: -3.476 local terms energy: -478.325775 where: bonds (distance) C4'-P energy: -87.747 bonds (distance) P-C4' energy: -128.453 flat angles C4'-P-C4' energy: -127.347 flat angles P-C4'-P energy: -75.143 tors. eta vs tors. theta energy: -59.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1195.752640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.752640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.752640 (E_RNA) where: Base-Base interactions energy: -698.444 where: short stacking energy: -331.939 Base-Backbone interact. energy: -2.702 local terms energy: -494.606710 where: bonds (distance) C4'-P energy: -129.939 bonds (distance) P-C4' energy: -129.561 flat angles C4'-P-C4' energy: -126.676 flat angles P-C4'-P energy: -64.211 tors. eta vs tors. theta energy: -44.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -2725.996618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2725.996618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2725.996618 (E_RNA) where: Base-Base interactions energy: -1896.169 where: short stacking energy: -827.125 Base-Backbone interact. energy: -0.931 local terms energy: -828.896517 where: bonds (distance) C4'-P energy: -144.635 bonds (distance) P-C4' energy: -154.497 flat angles C4'-P-C4' energy: -176.484 flat angles P-C4'-P energy: -116.759 tors. eta vs tors. theta energy: -236.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -2491.323751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2491.323751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2491.323751 (E_RNA) where: Base-Base interactions energy: -1747.278 where: short stacking energy: -765.736 Base-Backbone interact. energy: -4.078 local terms energy: -739.968056 where: bonds (distance) C4'-P energy: -142.505 bonds (distance) P-C4' energy: -150.009 flat angles C4'-P-C4' energy: -171.803 flat angles P-C4'-P energy: -106.710 tors. eta vs tors. theta energy: -168.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -2381.541668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2381.541668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.541668 (E_RNA) where: Base-Base interactions energy: -1659.459 where: short stacking energy: -690.291 Base-Backbone interact. energy: -4.488 local terms energy: -717.594606 where: bonds (distance) C4'-P energy: -130.266 bonds (distance) P-C4' energy: -153.039 flat angles C4'-P-C4' energy: -160.274 flat angles P-C4'-P energy: -102.095 tors. eta vs tors. theta energy: -171.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -2256.781590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2256.781590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.781590 (E_RNA) where: Base-Base interactions energy: -1523.731 where: short stacking energy: -698.001 Base-Backbone interact. energy: -3.401 local terms energy: -729.649701 where: bonds (distance) C4'-P energy: -152.376 bonds (distance) P-C4' energy: -139.865 flat angles C4'-P-C4' energy: -152.263 flat angles P-C4'-P energy: -100.313 tors. eta vs tors. theta energy: -184.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -2078.258942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2078.258942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2078.258942 (E_RNA) where: Base-Base interactions energy: -1446.117 where: short stacking energy: -628.766 Base-Backbone interact. energy: -3.800 local terms energy: -628.342195 where: bonds (distance) C4'-P energy: -116.794 bonds (distance) P-C4' energy: -112.384 flat angles C4'-P-C4' energy: -160.293 flat angles P-C4'-P energy: -102.647 tors. eta vs tors. theta energy: -136.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1831.074597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1831.074597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1831.074597 (E_RNA) where: Base-Base interactions energy: -1216.745 where: short stacking energy: -575.211 Base-Backbone interact. energy: -1.062 local terms energy: -613.266662 where: bonds (distance) C4'-P energy: -126.239 bonds (distance) P-C4' energy: -141.613 flat angles C4'-P-C4' energy: -135.951 flat angles P-C4'-P energy: -80.990 tors. eta vs tors. theta energy: -128.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1709.422517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.422517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.422517 (E_RNA) where: Base-Base interactions energy: -1128.228 where: short stacking energy: -512.908 Base-Backbone interact. energy: 2.228 local terms energy: -583.423063 where: bonds (distance) C4'-P energy: -126.141 bonds (distance) P-C4' energy: -150.204 flat angles C4'-P-C4' energy: -130.508 flat angles P-C4'-P energy: -83.854 tors. eta vs tors. theta energy: -92.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1632.824669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.824669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.824669 (E_RNA) where: Base-Base interactions energy: -1061.890 where: short stacking energy: -502.559 Base-Backbone interact. energy: -0.843 local terms energy: -570.091510 where: bonds (distance) C4'-P energy: -117.329 bonds (distance) P-C4' energy: -140.937 flat angles C4'-P-C4' energy: -143.234 flat angles P-C4'-P energy: -82.727 tors. eta vs tors. theta energy: -85.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1366.459276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.459276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.459276 (E_RNA) where: Base-Base interactions energy: -840.865 where: short stacking energy: -394.883 Base-Backbone interact. energy: 0.058 local terms energy: -525.651758 where: bonds (distance) C4'-P energy: -108.514 bonds (distance) P-C4' energy: -149.108 flat angles C4'-P-C4' energy: -139.018 flat angles P-C4'-P energy: -74.656 tors. eta vs tors. theta energy: -54.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1123.081301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.081301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.081301 (E_RNA) where: Base-Base interactions energy: -691.545 where: short stacking energy: -333.565 Base-Backbone interact. energy: 3.108 local terms energy: -434.644170 where: bonds (distance) C4'-P energy: -107.951 bonds (distance) P-C4' energy: -122.257 flat angles C4'-P-C4' energy: -113.520 flat angles P-C4'-P energy: -74.082 tors. eta vs tors. theta energy: -16.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -2636.572895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2636.572895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2636.572895 (E_RNA) where: Base-Base interactions energy: -1824.832 where: short stacking energy: -793.931 Base-Backbone interact. energy: -4.200 local terms energy: -807.541072 where: bonds (distance) C4'-P energy: -148.987 bonds (distance) P-C4' energy: -162.453 flat angles C4'-P-C4' energy: -167.153 flat angles P-C4'-P energy: -114.389 tors. eta vs tors. theta energy: -214.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -2521.393504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2521.393504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.393504 (E_RNA) where: Base-Base interactions energy: -1762.313 where: short stacking energy: -757.192 Base-Backbone interact. energy: 1.489 local terms energy: -760.570013 where: bonds (distance) C4'-P energy: -152.273 bonds (distance) P-C4' energy: -158.012 flat angles C4'-P-C4' energy: -155.302 flat angles P-C4'-P energy: -99.661 tors. eta vs tors. theta energy: -195.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -2370.404396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2370.404396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2370.404396 (E_RNA) where: Base-Base interactions energy: -1652.088 where: short stacking energy: -733.687 Base-Backbone interact. energy: 3.193 local terms energy: -721.509914 where: bonds (distance) C4'-P energy: -120.972 bonds (distance) P-C4' energy: -161.920 flat angles C4'-P-C4' energy: -161.153 flat angles P-C4'-P energy: -93.161 tors. eta vs tors. theta energy: -184.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -2222.337065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2222.337065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2222.337065 (E_RNA) where: Base-Base interactions energy: -1498.624 where: short stacking energy: -702.894 Base-Backbone interact. energy: -2.102 local terms energy: -721.611690 where: bonds (distance) C4'-P energy: -142.438 bonds (distance) P-C4' energy: -147.362 flat angles C4'-P-C4' energy: -156.340 flat angles P-C4'-P energy: -90.518 tors. eta vs tors. theta energy: -184.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -2139.494505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2139.494505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2139.494505 (E_RNA) where: Base-Base interactions energy: -1458.345 where: short stacking energy: -631.012 Base-Backbone interact. energy: -1.561 local terms energy: -679.589066 where: bonds (distance) C4'-P energy: -147.406 bonds (distance) P-C4' energy: -139.107 flat angles C4'-P-C4' energy: -139.256 flat angles P-C4'-P energy: -104.517 tors. eta vs tors. theta energy: -149.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1873.024423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1873.024423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.024423 (E_RNA) where: Base-Base interactions energy: -1238.421 where: short stacking energy: -597.144 Base-Backbone interact. energy: -1.291 local terms energy: -633.311871 where: bonds (distance) C4'-P energy: -113.668 bonds (distance) P-C4' energy: -149.887 flat angles C4'-P-C4' energy: -138.484 flat angles P-C4'-P energy: -89.019 tors. eta vs tors. theta energy: -142.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1717.761853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.761853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.761853 (E_RNA) where: Base-Base interactions energy: -1109.555 where: short stacking energy: -505.651 Base-Backbone interact. energy: -0.625 local terms energy: -607.582036 where: bonds (distance) C4'-P energy: -116.247 bonds (distance) P-C4' energy: -156.257 flat angles C4'-P-C4' energy: -135.106 flat angles P-C4'-P energy: -81.495 tors. eta vs tors. theta energy: -118.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1580.161720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.161720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.161720 (E_RNA) where: Base-Base interactions energy: -1026.958 where: short stacking energy: -477.854 Base-Backbone interact. energy: -0.043 local terms energy: -553.160470 where: bonds (distance) C4'-P energy: -114.812 bonds (distance) P-C4' energy: -131.240 flat angles C4'-P-C4' energy: -130.290 flat angles P-C4'-P energy: -89.847 tors. eta vs tors. theta energy: -86.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1322.410987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.410987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.410987 (E_RNA) where: Base-Base interactions energy: -846.457 where: short stacking energy: -430.076 Base-Backbone interact. energy: -0.386 local terms energy: -475.567778 where: bonds (distance) C4'-P energy: -96.963 bonds (distance) P-C4' energy: -124.614 flat angles C4'-P-C4' energy: -130.668 flat angles P-C4'-P energy: -62.770 tors. eta vs tors. theta energy: -60.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1131.190427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.190427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.190427 (E_RNA) where: Base-Base interactions energy: -677.038 where: short stacking energy: -346.312 Base-Backbone interact. energy: 4.701 local terms energy: -458.853301 where: bonds (distance) C4'-P energy: -107.512 bonds (distance) P-C4' energy: -134.019 flat angles C4'-P-C4' energy: -113.375 flat angles P-C4'-P energy: -64.235 tors. eta vs tors. theta energy: -39.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -2633.047031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2633.047031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2633.047031 (E_RNA) where: Base-Base interactions energy: -1817.286 where: short stacking energy: -796.106 Base-Backbone interact. energy: 0.676 local terms energy: -816.436785 where: bonds (distance) C4'-P energy: -156.444 bonds (distance) P-C4' energy: -166.302 flat angles C4'-P-C4' energy: -167.032 flat angles P-C4'-P energy: -105.171 tors. eta vs tors. theta energy: -221.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -2501.189194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2501.189194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2501.189194 (E_RNA) where: Base-Base interactions energy: -1732.996 where: short stacking energy: -757.046 Base-Backbone interact. energy: -7.080 local terms energy: -761.113849 where: bonds (distance) C4'-P energy: -139.359 bonds (distance) P-C4' energy: -149.408 flat angles C4'-P-C4' energy: -165.045 flat angles P-C4'-P energy: -110.007 tors. eta vs tors. theta energy: -197.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -2333.796863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2333.796863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2333.796863 (E_RNA) where: Base-Base interactions energy: -1631.925 where: short stacking energy: -710.241 Base-Backbone interact. energy: -2.009 local terms energy: -699.862794 where: bonds (distance) C4'-P energy: -124.054 bonds (distance) P-C4' energy: -146.279 flat angles C4'-P-C4' energy: -161.219 flat angles P-C4'-P energy: -99.062 tors. eta vs tors. theta energy: -169.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -2245.729687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2245.729687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2245.729687 (E_RNA) where: Base-Base interactions energy: -1517.336 where: short stacking energy: -692.191 Base-Backbone interact. energy: -1.532 local terms energy: -726.861125 where: bonds (distance) C4'-P energy: -134.830 bonds (distance) P-C4' energy: -159.145 flat angles C4'-P-C4' energy: -157.594 flat angles P-C4'-P energy: -95.339 tors. eta vs tors. theta energy: -179.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -2156.098757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.098757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.098757 (E_RNA) where: Base-Base interactions energy: -1468.835 where: short stacking energy: -627.271 Base-Backbone interact. energy: -3.409 local terms energy: -683.854182 where: bonds (distance) C4'-P energy: -133.285 bonds (distance) P-C4' energy: -141.544 flat angles C4'-P-C4' energy: -144.828 flat angles P-C4'-P energy: -103.464 tors. eta vs tors. theta energy: -160.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1831.138980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1831.138980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1831.138980 (E_RNA) where: Base-Base interactions energy: -1200.238 where: short stacking energy: -567.612 Base-Backbone interact. energy: -1.955 local terms energy: -628.945367 where: bonds (distance) C4'-P energy: -139.334 bonds (distance) P-C4' energy: -128.613 flat angles C4'-P-C4' energy: -148.132 flat angles P-C4'-P energy: -91.644 tors. eta vs tors. theta energy: -121.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1677.890258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.890258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.890258 (E_RNA) where: Base-Base interactions energy: -1103.741 where: short stacking energy: -501.457 Base-Backbone interact. energy: -3.115 local terms energy: -571.034401 where: bonds (distance) C4'-P energy: -105.937 bonds (distance) P-C4' energy: -150.002 flat angles C4'-P-C4' energy: -136.878 flat angles P-C4'-P energy: -81.617 tors. eta vs tors. theta energy: -96.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1551.349491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.349491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.349491 (E_RNA) where: Base-Base interactions energy: -997.267 where: short stacking energy: -462.626 Base-Backbone interact. energy: -4.525 local terms energy: -549.557702 where: bonds (distance) C4'-P energy: -129.566 bonds (distance) P-C4' energy: -117.440 flat angles C4'-P-C4' energy: -121.108 flat angles P-C4'-P energy: -87.380 tors. eta vs tors. theta energy: -94.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1319.597039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.597039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.597039 (E_RNA) where: Base-Base interactions energy: -828.016 where: short stacking energy: -368.845 Base-Backbone interact. energy: 2.493 local terms energy: -494.073578 where: bonds (distance) C4'-P energy: -117.071 bonds (distance) P-C4' energy: -113.534 flat angles C4'-P-C4' energy: -118.736 flat angles P-C4'-P energy: -80.623 tors. eta vs tors. theta energy: -64.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1128.628986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.628986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.628986 (E_RNA) where: Base-Base interactions energy: -679.161 where: short stacking energy: -327.897 Base-Backbone interact. energy: 0.620 local terms energy: -450.088699 where: bonds (distance) C4'-P energy: -107.162 bonds (distance) P-C4' energy: -130.541 flat angles C4'-P-C4' energy: -111.082 flat angles P-C4'-P energy: -64.150 tors. eta vs tors. theta energy: -37.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -2634.285453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2634.285453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2634.285453 (E_RNA) where: Base-Base interactions energy: -1811.950 where: short stacking energy: -805.230 Base-Backbone interact. energy: -4.684 local terms energy: -817.651877 where: bonds (distance) C4'-P energy: -157.943 bonds (distance) P-C4' energy: -150.059 flat angles C4'-P-C4' energy: -175.311 flat angles P-C4'-P energy: -116.365 tors. eta vs tors. theta energy: -217.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -2514.081303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.081303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.081303 (E_RNA) where: Base-Base interactions energy: -1751.787 where: short stacking energy: -744.231 Base-Backbone interact. energy: 8.982 local terms energy: -771.275504 where: bonds (distance) C4'-P energy: -144.475 bonds (distance) P-C4' energy: -153.724 flat angles C4'-P-C4' energy: -169.805 flat angles P-C4'-P energy: -121.834 tors. eta vs tors. theta energy: -181.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -2362.354092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2362.354092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2362.354092 (E_RNA) where: Base-Base interactions energy: -1646.974 where: short stacking energy: -694.463 Base-Backbone interact. energy: 1.544 local terms energy: -716.924823 where: bonds (distance) C4'-P energy: -123.246 bonds (distance) P-C4' energy: -155.772 flat angles C4'-P-C4' energy: -167.020 flat angles P-C4'-P energy: -99.378 tors. eta vs tors. theta energy: -171.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -2196.961233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.961233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.961233 (E_RNA) where: Base-Base interactions energy: -1475.942 where: short stacking energy: -674.690 Base-Backbone interact. energy: -2.607 local terms energy: -718.413103 where: bonds (distance) C4'-P energy: -137.748 bonds (distance) P-C4' energy: -137.783 flat angles C4'-P-C4' energy: -152.864 flat angles P-C4'-P energy: -104.456 tors. eta vs tors. theta energy: -185.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -2141.461915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2141.461915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2141.461915 (E_RNA) where: Base-Base interactions energy: -1478.120 where: short stacking energy: -642.592 Base-Backbone interact. energy: -4.815 local terms energy: -658.526236 where: bonds (distance) C4'-P energy: -132.662 bonds (distance) P-C4' energy: -126.279 flat angles C4'-P-C4' energy: -142.281 flat angles P-C4'-P energy: -97.956 tors. eta vs tors. theta energy: -159.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1850.077740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1850.077740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1850.077740 (E_RNA) where: Base-Base interactions energy: -1220.035 where: short stacking energy: -579.014 Base-Backbone interact. energy: -1.643 local terms energy: -628.399916 where: bonds (distance) C4'-P energy: -112.864 bonds (distance) P-C4' energy: -140.507 flat angles C4'-P-C4' energy: -146.851 flat angles P-C4'-P energy: -85.847 tors. eta vs tors. theta energy: -142.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1711.551985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1711.551985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.551985 (E_RNA) where: Base-Base interactions energy: -1136.705 where: short stacking energy: -512.651 Base-Backbone interact. energy: -0.816 local terms energy: -574.030701 where: bonds (distance) C4'-P energy: -118.229 bonds (distance) P-C4' energy: -125.999 flat angles C4'-P-C4' energy: -142.127 flat angles P-C4'-P energy: -80.788 tors. eta vs tors. theta energy: -106.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1461.972184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.972184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.972184 (E_RNA) where: Base-Base interactions energy: -906.652 where: short stacking energy: -450.784 Base-Backbone interact. energy: 2.053 local terms energy: -557.373492 where: bonds (distance) C4'-P energy: -111.533 bonds (distance) P-C4' energy: -117.829 flat angles C4'-P-C4' energy: -134.386 flat angles P-C4'-P energy: -95.311 tors. eta vs tors. theta energy: -98.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1335.314494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.314494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.314494 (E_RNA) where: Base-Base interactions energy: -871.537 where: short stacking energy: -376.600 Base-Backbone interact. energy: -2.069 local terms energy: -461.708045 where: bonds (distance) C4'-P energy: -110.417 bonds (distance) P-C4' energy: -116.370 flat angles C4'-P-C4' energy: -120.333 flat angles P-C4'-P energy: -70.613 tors. eta vs tors. theta energy: -43.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1011.159440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.159440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.159440 (E_RNA) where: Base-Base interactions energy: -586.368 where: short stacking energy: -309.196 Base-Backbone interact. energy: 7.926 local terms energy: -432.716849 where: bonds (distance) C4'-P energy: -98.902 bonds (distance) P-C4' energy: -125.611 flat angles C4'-P-C4' energy: -108.157 flat angles P-C4'-P energy: -68.260 tors. eta vs tors. theta energy: -31.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -2667.953653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2667.953653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2667.953653 (E_RNA) where: Base-Base interactions energy: -1834.477 where: short stacking energy: -823.223 Base-Backbone interact. energy: -3.725 local terms energy: -829.750984 where: bonds (distance) C4'-P energy: -154.911 bonds (distance) P-C4' energy: -148.353 flat angles C4'-P-C4' energy: -183.002 flat angles P-C4'-P energy: -113.191 tors. eta vs tors. theta energy: -230.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -2516.759068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.759068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2516.759068 (E_RNA) where: Base-Base interactions energy: -1760.735 where: short stacking energy: -778.255 Base-Backbone interact. energy: 4.742 local terms energy: -760.766539 where: bonds (distance) C4'-P energy: -146.856 bonds (distance) P-C4' energy: -137.364 flat angles C4'-P-C4' energy: -180.072 flat angles P-C4'-P energy: -112.222 tors. eta vs tors. theta energy: -184.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -2350.139447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2350.139447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2350.139447 (E_RNA) where: Base-Base interactions energy: -1639.754 where: short stacking energy: -720.734 Base-Backbone interact. energy: -2.876 local terms energy: -707.509445 where: bonds (distance) C4'-P energy: -131.672 bonds (distance) P-C4' energy: -153.393 flat angles C4'-P-C4' energy: -156.713 flat angles P-C4'-P energy: -98.594 tors. eta vs tors. theta energy: -167.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -2210.179634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2210.179634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2210.179634 (E_RNA) where: Base-Base interactions energy: -1471.522 where: short stacking energy: -690.011 Base-Backbone interact. energy: -0.839 local terms energy: -737.818873 where: bonds (distance) C4'-P energy: -135.868 bonds (distance) P-C4' energy: -137.248 flat angles C4'-P-C4' energy: -156.837 flat angles P-C4'-P energy: -106.563 tors. eta vs tors. theta energy: -201.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -2185.199091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2185.199091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2185.199091 (E_RNA) where: Base-Base interactions energy: -1502.774 where: short stacking energy: -653.231 Base-Backbone interact. energy: 1.909 local terms energy: -684.334649 where: bonds (distance) C4'-P energy: -132.542 bonds (distance) P-C4' energy: -140.822 flat angles C4'-P-C4' energy: -154.765 flat angles P-C4'-P energy: -93.053 tors. eta vs tors. theta energy: -163.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1796.818956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1796.818956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1796.818956 (E_RNA) where: Base-Base interactions energy: -1182.820 where: short stacking energy: -565.138 Base-Backbone interact. energy: 2.586 local terms energy: -616.585159 where: bonds (distance) C4'-P energy: -128.953 bonds (distance) P-C4' energy: -136.645 flat angles C4'-P-C4' energy: -143.854 flat angles P-C4'-P energy: -82.877 tors. eta vs tors. theta energy: -124.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1646.018678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.018678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.018678 (E_RNA) where: Base-Base interactions energy: -1070.990 where: short stacking energy: -514.499 Base-Backbone interact. energy: 6.929 local terms energy: -581.957330 where: bonds (distance) C4'-P energy: -127.029 bonds (distance) P-C4' energy: -125.248 flat angles C4'-P-C4' energy: -139.113 flat angles P-C4'-P energy: -86.162 tors. eta vs tors. theta energy: -104.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1522.092962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.092962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.092962 (E_RNA) where: Base-Base interactions energy: -1006.243 where: short stacking energy: -486.565 Base-Backbone interact. energy: 0.410 local terms energy: -516.260015 where: bonds (distance) C4'-P energy: -100.926 bonds (distance) P-C4' energy: -123.451 flat angles C4'-P-C4' energy: -125.877 flat angles P-C4'-P energy: -70.261 tors. eta vs tors. theta energy: -95.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1384.267195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.267195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.267195 (E_RNA) where: Base-Base interactions energy: -860.827 where: short stacking energy: -382.841 Base-Backbone interact. energy: 3.691 local terms energy: -527.131054 where: bonds (distance) C4'-P energy: -110.661 bonds (distance) P-C4' energy: -147.849 flat angles C4'-P-C4' energy: -133.952 flat angles P-C4'-P energy: -81.155 tors. eta vs tors. theta energy: -53.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1050.615072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.615072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.615072 (E_RNA) where: Base-Base interactions energy: -589.880 where: short stacking energy: -287.421 Base-Backbone interact. energy: -6.879 local terms energy: -453.856703 where: bonds (distance) C4'-P energy: -110.969 bonds (distance) P-C4' energy: -138.623 flat angles C4'-P-C4' energy: -117.573 flat angles P-C4'-P energy: -68.486 tors. eta vs tors. theta energy: -18.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -2665.446358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2665.446358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2665.446358 (E_RNA) where: Base-Base interactions energy: -1836.313 where: short stacking energy: -808.649 Base-Backbone interact. energy: -0.256 local terms energy: -828.876494 where: bonds (distance) C4'-P energy: -144.493 bonds (distance) P-C4' energy: -156.305 flat angles C4'-P-C4' energy: -171.537 flat angles P-C4'-P energy: -130.525 tors. eta vs tors. theta energy: -226.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -2454.200214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2454.200214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2454.200214 (E_RNA) where: Base-Base interactions energy: -1695.316 where: short stacking energy: -713.189 Base-Backbone interact. energy: -2.773 local terms energy: -756.111400 where: bonds (distance) C4'-P energy: -151.621 bonds (distance) P-C4' energy: -160.510 flat angles C4'-P-C4' energy: -153.290 flat angles P-C4'-P energy: -111.439 tors. eta vs tors. theta energy: -179.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -2445.175631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2445.175631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2445.175631 (E_RNA) where: Base-Base interactions energy: -1702.893 where: short stacking energy: -747.567 Base-Backbone interact. energy: -4.294 local terms energy: -737.988865 where: bonds (distance) C4'-P energy: -142.877 bonds (distance) P-C4' energy: -152.354 flat angles C4'-P-C4' energy: -148.090 flat angles P-C4'-P energy: -117.427 tors. eta vs tors. theta energy: -177.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -2211.242047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2211.242047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.242047 (E_RNA) where: Base-Base interactions energy: -1491.716 where: short stacking energy: -683.729 Base-Backbone interact. energy: -4.573 local terms energy: -714.952184 where: bonds (distance) C4'-P energy: -130.554 bonds (distance) P-C4' energy: -133.286 flat angles C4'-P-C4' energy: -157.387 flat angles P-C4'-P energy: -94.807 tors. eta vs tors. theta energy: -198.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -2190.600399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2190.600399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2190.600399 (E_RNA) where: Base-Base interactions energy: -1539.898 where: short stacking energy: -659.165 Base-Backbone interact. energy: -1.525 local terms energy: -649.177393 where: bonds (distance) C4'-P energy: -111.530 bonds (distance) P-C4' energy: -146.506 flat angles C4'-P-C4' energy: -138.244 flat angles P-C4'-P energy: -94.186 tors. eta vs tors. theta energy: -158.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1810.732234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1810.732234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1810.732234 (E_RNA) where: Base-Base interactions energy: -1205.009 where: short stacking energy: -553.825 Base-Backbone interact. energy: 0.128 local terms energy: -605.851141 where: bonds (distance) C4'-P energy: -120.348 bonds (distance) P-C4' energy: -130.177 flat angles C4'-P-C4' energy: -136.637 flat angles P-C4'-P energy: -92.586 tors. eta vs tors. theta energy: -126.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1650.601822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.601822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.601822 (E_RNA) where: Base-Base interactions energy: -1062.205 where: short stacking energy: -496.970 Base-Backbone interact. energy: -2.233 local terms energy: -586.164011 where: bonds (distance) C4'-P energy: -140.878 bonds (distance) P-C4' energy: -144.134 flat angles C4'-P-C4' energy: -129.012 flat angles P-C4'-P energy: -94.867 tors. eta vs tors. theta energy: -77.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1560.533169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.533169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.533169 (E_RNA) where: Base-Base interactions energy: -1024.584 where: short stacking energy: -468.641 Base-Backbone interact. energy: -0.841 local terms energy: -535.107251 where: bonds (distance) C4'-P energy: -121.256 bonds (distance) P-C4' energy: -116.973 flat angles C4'-P-C4' energy: -137.839 flat angles P-C4'-P energy: -85.614 tors. eta vs tors. theta energy: -73.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1408.566931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.566931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.566931 (E_RNA) where: Base-Base interactions energy: -938.527 where: short stacking energy: -392.929 Base-Backbone interact. energy: -0.661 local terms energy: -469.378062 where: bonds (distance) C4'-P energy: -126.733 bonds (distance) P-C4' energy: -114.378 flat angles C4'-P-C4' energy: -111.747 flat angles P-C4'-P energy: -53.180 tors. eta vs tors. theta energy: -63.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1030.769543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.769543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.769543 (E_RNA) where: Base-Base interactions energy: -619.627 where: short stacking energy: -301.607 Base-Backbone interact. energy: -0.888 local terms energy: -410.253899 where: bonds (distance) C4'-P energy: -113.556 bonds (distance) P-C4' energy: -108.360 flat angles C4'-P-C4' energy: -97.864 flat angles P-C4'-P energy: -70.168 tors. eta vs tors. theta energy: -20.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -2654.782685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2654.782685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2654.782685 (E_RNA) where: Base-Base interactions energy: -1820.874 where: short stacking energy: -798.355 Base-Backbone interact. energy: -2.557 local terms energy: -831.351176 where: bonds (distance) C4'-P energy: -149.799 bonds (distance) P-C4' energy: -158.518 flat angles C4'-P-C4' energy: -180.430 flat angles P-C4'-P energy: -118.067 tors. eta vs tors. theta energy: -224.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -2459.171653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2459.171653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2459.171653 (E_RNA) where: Base-Base interactions energy: -1710.837 where: short stacking energy: -731.255 Base-Backbone interact. energy: -2.500 local terms energy: -745.834795 where: bonds (distance) C4'-P energy: -143.968 bonds (distance) P-C4' energy: -157.037 flat angles C4'-P-C4' energy: -159.788 flat angles P-C4'-P energy: -112.124 tors. eta vs tors. theta energy: -172.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -2451.252862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2451.252862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2451.252862 (E_RNA) where: Base-Base interactions energy: -1714.348 where: short stacking energy: -750.167 Base-Backbone interact. energy: -2.388 local terms energy: -734.517359 where: bonds (distance) C4'-P energy: -127.281 bonds (distance) P-C4' energy: -151.836 flat angles C4'-P-C4' energy: -161.566 flat angles P-C4'-P energy: -109.312 tors. eta vs tors. theta energy: -184.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -2280.415702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.415702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.415702 (E_RNA) where: Base-Base interactions energy: -1567.170 where: short stacking energy: -687.525 Base-Backbone interact. energy: -3.406 local terms energy: -709.839457 where: bonds (distance) C4'-P energy: -137.894 bonds (distance) P-C4' energy: -139.128 flat angles C4'-P-C4' energy: -163.362 flat angles P-C4'-P energy: -83.599 tors. eta vs tors. theta energy: -185.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -2213.836534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2213.836534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2213.836534 (E_RNA) where: Base-Base interactions energy: -1556.772 where: short stacking energy: -658.714 Base-Backbone interact. energy: -1.723 local terms energy: -655.340851 where: bonds (distance) C4'-P energy: -132.629 bonds (distance) P-C4' energy: -133.354 flat angles C4'-P-C4' energy: -156.595 flat angles P-C4'-P energy: -77.956 tors. eta vs tors. theta energy: -154.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1871.200022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.200022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.200022 (E_RNA) where: Base-Base interactions energy: -1215.761 where: short stacking energy: -573.887 Base-Backbone interact. energy: -1.270 local terms energy: -654.168257 where: bonds (distance) C4'-P energy: -127.257 bonds (distance) P-C4' energy: -163.550 flat angles C4'-P-C4' energy: -156.037 flat angles P-C4'-P energy: -97.224 tors. eta vs tors. theta energy: -110.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1624.981645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.981645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.981645 (E_RNA) where: Base-Base interactions energy: -1053.430 where: short stacking energy: -520.196 Base-Backbone interact. energy: -2.158 local terms energy: -569.393993 where: bonds (distance) C4'-P energy: -123.631 bonds (distance) P-C4' energy: -110.835 flat angles C4'-P-C4' energy: -136.691 flat angles P-C4'-P energy: -84.829 tors. eta vs tors. theta energy: -113.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1615.560991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.560991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.560991 (E_RNA) where: Base-Base interactions energy: -1087.297 where: short stacking energy: -503.064 Base-Backbone interact. energy: -2.406 local terms energy: -525.858384 where: bonds (distance) C4'-P energy: -112.098 bonds (distance) P-C4' energy: -118.710 flat angles C4'-P-C4' energy: -124.028 flat angles P-C4'-P energy: -67.164 tors. eta vs tors. theta energy: -103.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1373.075887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.075887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.075887 (E_RNA) where: Base-Base interactions energy: -886.927 where: short stacking energy: -393.343 Base-Backbone interact. energy: 4.645 local terms energy: -490.793679 where: bonds (distance) C4'-P energy: -109.581 bonds (distance) P-C4' energy: -117.067 flat angles C4'-P-C4' energy: -124.540 flat angles P-C4'-P energy: -66.886 tors. eta vs tors. theta energy: -72.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1019.552611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.552611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.552611 (E_RNA) where: Base-Base interactions energy: -553.102 where: short stacking energy: -306.044 Base-Backbone interact. energy: -4.332 local terms energy: -462.117827 where: bonds (distance) C4'-P energy: -122.534 bonds (distance) P-C4' energy: -131.300 flat angles C4'-P-C4' energy: -110.869 flat angles P-C4'-P energy: -63.399 tors. eta vs tors. theta energy: -34.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -2623.335444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2623.335444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2623.335444 (E_RNA) where: Base-Base interactions energy: -1819.418 where: short stacking energy: -786.458 Base-Backbone interact. energy: -2.845 local terms energy: -801.072629 where: bonds (distance) C4'-P energy: -157.198 bonds (distance) P-C4' energy: -143.486 flat angles C4'-P-C4' energy: -174.665 flat angles P-C4'-P energy: -110.492 tors. eta vs tors. theta energy: -215.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -2453.904822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2453.904822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2453.904822 (E_RNA) where: Base-Base interactions energy: -1728.867 where: short stacking energy: -737.986 Base-Backbone interact. energy: -0.682 local terms energy: -724.356353 where: bonds (distance) C4'-P energy: -137.421 bonds (distance) P-C4' energy: -151.448 flat angles C4'-P-C4' energy: -152.675 flat angles P-C4'-P energy: -104.960 tors. eta vs tors. theta energy: -177.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -2433.577903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2433.577903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2433.577903 (E_RNA) where: Base-Base interactions energy: -1708.910 where: short stacking energy: -742.784 Base-Backbone interact. energy: -4.296 local terms energy: -720.372063 where: bonds (distance) C4'-P energy: -140.945 bonds (distance) P-C4' energy: -158.423 flat angles C4'-P-C4' energy: -153.167 flat angles P-C4'-P energy: -97.718 tors. eta vs tors. theta energy: -170.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -2233.698517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2233.698517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2233.698517 (E_RNA) where: Base-Base interactions energy: -1531.963 where: short stacking energy: -673.987 Base-Backbone interact. energy: -2.232 local terms energy: -699.503632 where: bonds (distance) C4'-P energy: -135.054 bonds (distance) P-C4' energy: -137.300 flat angles C4'-P-C4' energy: -154.899 flat angles P-C4'-P energy: -86.628 tors. eta vs tors. theta energy: -185.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -2215.103849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2215.103849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.103849 (E_RNA) where: Base-Base interactions energy: -1527.951 where: short stacking energy: -660.732 Base-Backbone interact. energy: -0.815 local terms energy: -686.338150 where: bonds (distance) C4'-P energy: -133.488 bonds (distance) P-C4' energy: -146.708 flat angles C4'-P-C4' energy: -152.474 flat angles P-C4'-P energy: -99.024 tors. eta vs tors. theta energy: -154.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1848.095957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1848.095957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1848.095957 (E_RNA) where: Base-Base interactions energy: -1215.437 where: short stacking energy: -550.793 Base-Backbone interact. energy: -1.846 local terms energy: -630.813307 where: bonds (distance) C4'-P energy: -123.233 bonds (distance) P-C4' energy: -138.039 flat angles C4'-P-C4' energy: -162.915 flat angles P-C4'-P energy: -97.512 tors. eta vs tors. theta energy: -109.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1635.531750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.531750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.531750 (E_RNA) where: Base-Base interactions energy: -1045.585 where: short stacking energy: -512.699 Base-Backbone interact. energy: -1.971 local terms energy: -587.975177 where: bonds (distance) C4'-P energy: -127.439 bonds (distance) P-C4' energy: -134.232 flat angles C4'-P-C4' energy: -148.403 flat angles P-C4'-P energy: -67.061 tors. eta vs tors. theta energy: -110.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1597.403255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.403255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.403255 (E_RNA) where: Base-Base interactions energy: -1052.892 where: short stacking energy: -476.466 Base-Backbone interact. energy: -3.557 local terms energy: -540.953998 where: bonds (distance) C4'-P energy: -104.637 bonds (distance) P-C4' energy: -131.554 flat angles C4'-P-C4' energy: -129.568 flat angles P-C4'-P energy: -77.694 tors. eta vs tors. theta energy: -97.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1330.735772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.735772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.735772 (E_RNA) where: Base-Base interactions energy: -849.178 where: short stacking energy: -392.539 Base-Backbone interact. energy: -3.841 local terms energy: -477.716702 where: bonds (distance) C4'-P energy: -120.045 bonds (distance) P-C4' energy: -121.023 flat angles C4'-P-C4' energy: -117.450 flat angles P-C4'-P energy: -71.343 tors. eta vs tors. theta energy: -47.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -984.877757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.877757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.877757 (E_RNA) where: Base-Base interactions energy: -582.409 where: short stacking energy: -325.575 Base-Backbone interact. energy: -2.154 local terms energy: -400.314527 where: bonds (distance) C4'-P energy: -97.607 bonds (distance) P-C4' energy: -138.267 flat angles C4'-P-C4' energy: -98.050 flat angles P-C4'-P energy: -55.507 tors. eta vs tors. theta energy: -10.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -2664.454428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2664.454428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2664.454428 (E_RNA) where: Base-Base interactions energy: -1855.773 where: short stacking energy: -821.688 Base-Backbone interact. energy: -5.217 local terms energy: -803.465391 where: bonds (distance) C4'-P energy: -151.615 bonds (distance) P-C4' energy: -142.576 flat angles C4'-P-C4' energy: -172.468 flat angles P-C4'-P energy: -105.728 tors. eta vs tors. theta energy: -231.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -2472.002920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2472.002920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2472.002920 (E_RNA) where: Base-Base interactions energy: -1719.181 where: short stacking energy: -738.081 Base-Backbone interact. energy: -3.005 local terms energy: -749.815987 where: bonds (distance) C4'-P energy: -140.806 bonds (distance) P-C4' energy: -146.434 flat angles C4'-P-C4' energy: -168.094 flat angles P-C4'-P energy: -113.309 tors. eta vs tors. theta energy: -181.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -2477.174754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2477.174754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2477.174754 (E_RNA) where: Base-Base interactions energy: -1748.133 where: short stacking energy: -748.018 Base-Backbone interact. energy: -0.426 local terms energy: -728.615729 where: bonds (distance) C4'-P energy: -122.233 bonds (distance) P-C4' energy: -149.215 flat angles C4'-P-C4' energy: -155.422 flat angles P-C4'-P energy: -111.715 tors. eta vs tors. theta energy: -190.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -2226.531931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2226.531931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2226.531931 (E_RNA) where: Base-Base interactions energy: -1512.472 where: short stacking energy: -691.043 Base-Backbone interact. energy: -3.835 local terms energy: -710.224519 where: bonds (distance) C4'-P energy: -136.179 bonds (distance) P-C4' energy: -136.738 flat angles C4'-P-C4' energy: -150.192 flat angles P-C4'-P energy: -109.536 tors. eta vs tors. theta energy: -177.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -2259.598017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2259.598017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.598017 (E_RNA) where: Base-Base interactions energy: -1577.110 where: short stacking energy: -674.459 Base-Backbone interact. energy: -2.557 local terms energy: -679.931391 where: bonds (distance) C4'-P energy: -123.808 bonds (distance) P-C4' energy: -141.568 flat angles C4'-P-C4' energy: -157.789 flat angles P-C4'-P energy: -102.327 tors. eta vs tors. theta energy: -154.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1855.432879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1855.432879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1855.432879 (E_RNA) where: Base-Base interactions energy: -1238.878 where: short stacking energy: -577.739 Base-Backbone interact. energy: -1.637 local terms energy: -614.918232 where: bonds (distance) C4'-P energy: -134.196 bonds (distance) P-C4' energy: -127.964 flat angles C4'-P-C4' energy: -141.846 flat angles P-C4'-P energy: -76.364 tors. eta vs tors. theta energy: -134.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1700.939623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.939623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.939623 (E_RNA) where: Base-Base interactions energy: -1113.756 where: short stacking energy: -524.644 Base-Backbone interact. energy: -1.905 local terms energy: -585.279171 where: bonds (distance) C4'-P energy: -131.192 bonds (distance) P-C4' energy: -129.037 flat angles C4'-P-C4' energy: -147.936 flat angles P-C4'-P energy: -68.491 tors. eta vs tors. theta energy: -108.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1500.426085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.426085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.426085 (E_RNA) where: Base-Base interactions energy: -959.689 where: short stacking energy: -466.414 Base-Backbone interact. energy: 0.382 local terms energy: -541.118959 where: bonds (distance) C4'-P energy: -122.100 bonds (distance) P-C4' energy: -119.113 flat angles C4'-P-C4' energy: -127.222 flat angles P-C4'-P energy: -78.840 tors. eta vs tors. theta energy: -93.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1368.222482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.222482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.222482 (E_RNA) where: Base-Base interactions energy: -884.407 where: short stacking energy: -398.553 Base-Backbone interact. energy: 1.305 local terms energy: -485.120409 where: bonds (distance) C4'-P energy: -99.435 bonds (distance) P-C4' energy: -121.565 flat angles C4'-P-C4' energy: -119.391 flat angles P-C4'-P energy: -76.627 tors. eta vs tors. theta energy: -68.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1024.130636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.130636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.130636 (E_RNA) where: Base-Base interactions energy: -582.047 where: short stacking energy: -277.714 Base-Backbone interact. energy: 0.200 local terms energy: -442.283673 where: bonds (distance) C4'-P energy: -116.646 bonds (distance) P-C4' energy: -150.181 flat angles C4'-P-C4' energy: -112.232 flat angles P-C4'-P energy: -64.218 tors. eta vs tors. theta energy: 0.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -2670.763175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2670.763175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2670.763175 (E_RNA) where: Base-Base interactions energy: -1838.453 where: short stacking energy: -820.950 Base-Backbone interact. energy: -3.244 local terms energy: -829.065902 where: bonds (distance) C4'-P energy: -151.803 bonds (distance) P-C4' energy: -152.944 flat angles C4'-P-C4' energy: -172.916 flat angles P-C4'-P energy: -128.280 tors. eta vs tors. theta energy: -223.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -2473.210921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2473.210921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2473.210921 (E_RNA) where: Base-Base interactions energy: -1719.539 where: short stacking energy: -771.438 Base-Backbone interact. energy: -2.346 local terms energy: -751.326339 where: bonds (distance) C4'-P energy: -145.650 bonds (distance) P-C4' energy: -141.784 flat angles C4'-P-C4' energy: -167.142 flat angles P-C4'-P energy: -113.119 tors. eta vs tors. theta energy: -183.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -2381.070787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2381.070787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.070787 (E_RNA) where: Base-Base interactions energy: -1677.669 where: short stacking energy: -724.100 Base-Backbone interact. energy: -0.812 local terms energy: -702.589668 where: bonds (distance) C4'-P energy: -138.525 bonds (distance) P-C4' energy: -138.464 flat angles C4'-P-C4' energy: -159.693 flat angles P-C4'-P energy: -98.751 tors. eta vs tors. theta energy: -167.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -2227.563587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2227.563587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2227.563587 (E_RNA) where: Base-Base interactions energy: -1503.493 where: short stacking energy: -694.513 Base-Backbone interact. energy: -2.181 local terms energy: -721.889851 where: bonds (distance) C4'-P energy: -144.148 bonds (distance) P-C4' energy: -150.404 flat angles C4'-P-C4' energy: -143.261 flat angles P-C4'-P energy: -99.920 tors. eta vs tors. theta energy: -184.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -2199.569811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.569811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2199.569811 (E_RNA) where: Base-Base interactions energy: -1514.599 where: short stacking energy: -649.292 Base-Backbone interact. energy: -3.238 local terms energy: -681.732772 where: bonds (distance) C4'-P energy: -128.443 bonds (distance) P-C4' energy: -144.037 flat angles C4'-P-C4' energy: -160.664 flat angles P-C4'-P energy: -93.719 tors. eta vs tors. theta energy: -154.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1818.797412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.797412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.797412 (E_RNA) where: Base-Base interactions energy: -1224.426 where: short stacking energy: -577.332 Base-Backbone interact. energy: -0.507 local terms energy: -593.863909 where: bonds (distance) C4'-P energy: -134.236 bonds (distance) P-C4' energy: -113.370 flat angles C4'-P-C4' energy: -144.708 flat angles P-C4'-P energy: -83.068 tors. eta vs tors. theta energy: -118.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1692.446147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.446147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.446147 (E_RNA) where: Base-Base interactions energy: -1096.741 where: short stacking energy: -521.388 Base-Backbone interact. energy: -2.129 local terms energy: -593.575320 where: bonds (distance) C4'-P energy: -116.529 bonds (distance) P-C4' energy: -141.603 flat angles C4'-P-C4' energy: -139.547 flat angles P-C4'-P energy: -98.640 tors. eta vs tors. theta energy: -97.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1624.998605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.998605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.998605 (E_RNA) where: Base-Base interactions energy: -1086.181 where: short stacking energy: -521.594 Base-Backbone interact. energy: -0.279 local terms energy: -538.538430 where: bonds (distance) C4'-P energy: -117.646 bonds (distance) P-C4' energy: -116.328 flat angles C4'-P-C4' energy: -135.063 flat angles P-C4'-P energy: -63.282 tors. eta vs tors. theta energy: -106.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1351.256426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.256426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.256426 (E_RNA) where: Base-Base interactions energy: -872.683 where: short stacking energy: -381.330 Base-Backbone interact. energy: 0.897 local terms energy: -479.470900 where: bonds (distance) C4'-P energy: -110.350 bonds (distance) P-C4' energy: -122.329 flat angles C4'-P-C4' energy: -117.341 flat angles P-C4'-P energy: -70.208 tors. eta vs tors. theta energy: -59.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -965.070918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.070918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.070918 (E_RNA) where: Base-Base interactions energy: -553.373 where: short stacking energy: -301.390 Base-Backbone interact. energy: -4.714 local terms energy: -406.983997 where: bonds (distance) C4'-P energy: -122.150 bonds (distance) P-C4' energy: -113.575 flat angles C4'-P-C4' energy: -96.415 flat angles P-C4'-P energy: -57.465 tors. eta vs tors. theta energy: -17.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -2632.611522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2632.611522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2632.611522 (E_RNA) where: Base-Base interactions energy: -1808.542 where: short stacking energy: -792.848 Base-Backbone interact. energy: -1.939 local terms energy: -822.130361 where: bonds (distance) C4'-P energy: -131.556 bonds (distance) P-C4' energy: -160.736 flat angles C4'-P-C4' energy: -174.099 flat angles P-C4'-P energy: -128.664 tors. eta vs tors. theta energy: -227.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -2514.365728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.365728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.365728 (E_RNA) where: Base-Base interactions energy: -1736.577 where: short stacking energy: -762.738 Base-Backbone interact. energy: 0.889 local terms energy: -778.677567 where: bonds (distance) C4'-P energy: -143.134 bonds (distance) P-C4' energy: -164.183 flat angles C4'-P-C4' energy: -167.649 flat angles P-C4'-P energy: -114.907 tors. eta vs tors. theta energy: -188.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -2410.029914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2410.029914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2410.029914 (E_RNA) where: Base-Base interactions energy: -1678.902 where: short stacking energy: -710.469 Base-Backbone interact. energy: -3.076 local terms energy: -728.051940 where: bonds (distance) C4'-P energy: -133.812 bonds (distance) P-C4' energy: -159.375 flat angles C4'-P-C4' energy: -160.018 flat angles P-C4'-P energy: -103.630 tors. eta vs tors. theta energy: -171.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -2181.974897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.974897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.974897 (E_RNA) where: Base-Base interactions energy: -1457.133 where: short stacking energy: -675.143 Base-Backbone interact. energy: -2.636 local terms energy: -722.205832 where: bonds (distance) C4'-P energy: -152.960 bonds (distance) P-C4' energy: -143.492 flat angles C4'-P-C4' energy: -161.108 flat angles P-C4'-P energy: -87.439 tors. eta vs tors. theta energy: -177.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -2112.726789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.726789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.726789 (E_RNA) where: Base-Base interactions energy: -1485.019 where: short stacking energy: -600.019 Base-Backbone interact. energy: -1.743 local terms energy: -625.965004 where: bonds (distance) C4'-P energy: -110.353 bonds (distance) P-C4' energy: -140.883 flat angles C4'-P-C4' energy: -156.104 flat angles P-C4'-P energy: -96.412 tors. eta vs tors. theta energy: -122.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1882.814485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1882.814485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1882.814485 (E_RNA) where: Base-Base interactions energy: -1235.480 where: short stacking energy: -576.045 Base-Backbone interact. energy: 0.610 local terms energy: -647.944655 where: bonds (distance) C4'-P energy: -134.850 bonds (distance) P-C4' energy: -143.227 flat angles C4'-P-C4' energy: -152.128 flat angles P-C4'-P energy: -90.580 tors. eta vs tors. theta energy: -127.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1685.615131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.615131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.615131 (E_RNA) where: Base-Base interactions energy: -1131.135 where: short stacking energy: -516.405 Base-Backbone interact. energy: 3.423 local terms energy: -557.903615 where: bonds (distance) C4'-P energy: -119.383 bonds (distance) P-C4' energy: -131.354 flat angles C4'-P-C4' energy: -141.296 flat angles P-C4'-P energy: -66.452 tors. eta vs tors. theta energy: -99.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1608.884074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.884074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.884074 (E_RNA) where: Base-Base interactions energy: -1038.465 where: short stacking energy: -489.301 Base-Backbone interact. energy: -2.486 local terms energy: -567.933123 where: bonds (distance) C4'-P energy: -143.976 bonds (distance) P-C4' energy: -115.125 flat angles C4'-P-C4' energy: -123.050 flat angles P-C4'-P energy: -85.927 tors. eta vs tors. theta energy: -99.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1400.507398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.507398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.507398 (E_RNA) where: Base-Base interactions energy: -878.464 where: short stacking energy: -394.350 Base-Backbone interact. energy: 0.022 local terms energy: -522.066376 where: bonds (distance) C4'-P energy: -116.751 bonds (distance) P-C4' energy: -125.038 flat angles C4'-P-C4' energy: -136.931 flat angles P-C4'-P energy: -78.058 tors. eta vs tors. theta energy: -65.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -1004.436048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.436048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.436048 (E_RNA) where: Base-Base interactions energy: -552.977 where: short stacking energy: -309.649 Base-Backbone interact. energy: 0.062 local terms energy: -451.520348 where: bonds (distance) C4'-P energy: -117.056 bonds (distance) P-C4' energy: -134.543 flat angles C4'-P-C4' energy: -116.632 flat angles P-C4'-P energy: -64.926 tors. eta vs tors. theta energy: -18.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -2640.048027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2640.048027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2640.048027 (E_RNA) where: Base-Base interactions energy: -1839.408 where: short stacking energy: -843.709 Base-Backbone interact. energy: -0.917 local terms energy: -799.723353 where: bonds (distance) C4'-P energy: -149.323 bonds (distance) P-C4' energy: -143.636 flat angles C4'-P-C4' energy: -164.321 flat angles P-C4'-P energy: -111.413 tors. eta vs tors. theta energy: -231.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -2462.774644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2462.774644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2462.774644 (E_RNA) where: Base-Base interactions energy: -1713.062 where: short stacking energy: -780.198 Base-Backbone interact. energy: -0.904 local terms energy: -748.807816 where: bonds (distance) C4'-P energy: -128.891 bonds (distance) P-C4' energy: -161.768 flat angles C4'-P-C4' energy: -168.255 flat angles P-C4'-P energy: -107.076 tors. eta vs tors. theta energy: -182.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -2412.801159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2412.801159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2412.801159 (E_RNA) where: Base-Base interactions energy: -1693.060 where: short stacking energy: -740.166 Base-Backbone interact. energy: -3.824 local terms energy: -715.917316 where: bonds (distance) C4'-P energy: -131.465 bonds (distance) P-C4' energy: -141.906 flat angles C4'-P-C4' energy: -148.939 flat angles P-C4'-P energy: -95.079 tors. eta vs tors. theta energy: -198.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -2203.397738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2203.397738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2203.397738 (E_RNA) where: Base-Base interactions energy: -1483.387 where: short stacking energy: -692.393 Base-Backbone interact. energy: -3.333 local terms energy: -716.678057 where: bonds (distance) C4'-P energy: -140.255 bonds (distance) P-C4' energy: -125.209 flat angles C4'-P-C4' energy: -156.239 flat angles P-C4'-P energy: -117.065 tors. eta vs tors. theta energy: -177.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -2171.181222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2171.181222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2171.181222 (E_RNA) where: Base-Base interactions energy: -1479.746 where: short stacking energy: -639.713 Base-Backbone interact. energy: -0.940 local terms energy: -690.494619 where: bonds (distance) C4'-P energy: -134.553 bonds (distance) P-C4' energy: -140.322 flat angles C4'-P-C4' energy: -161.418 flat angles P-C4'-P energy: -106.546 tors. eta vs tors. theta energy: -147.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1857.147386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1857.147386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1857.147386 (E_RNA) where: Base-Base interactions energy: -1255.755 where: short stacking energy: -578.637 Base-Backbone interact. energy: 2.009 local terms energy: -603.401589 where: bonds (distance) C4'-P energy: -109.625 bonds (distance) P-C4' energy: -129.114 flat angles C4'-P-C4' energy: -140.884 flat angles P-C4'-P energy: -93.983 tors. eta vs tors. theta energy: -129.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1723.864843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.864843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1723.864843 (E_RNA) where: Base-Base interactions energy: -1120.435 where: short stacking energy: -518.156 Base-Backbone interact. energy: -4.248 local terms energy: -599.181655 where: bonds (distance) C4'-P energy: -130.805 bonds (distance) P-C4' energy: -139.511 flat angles C4'-P-C4' energy: -138.465 flat angles P-C4'-P energy: -91.842 tors. eta vs tors. theta energy: -98.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1645.038777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.038777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.038777 (E_RNA) where: Base-Base interactions energy: -1044.222 where: short stacking energy: -510.800 Base-Backbone interact. energy: 0.588 local terms energy: -601.405057 where: bonds (distance) C4'-P energy: -131.899 bonds (distance) P-C4' energy: -121.909 flat angles C4'-P-C4' energy: -139.987 flat angles P-C4'-P energy: -92.130 tors. eta vs tors. theta energy: -115.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1440.436489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.436489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.436489 (E_RNA) where: Base-Base interactions energy: -890.745 where: short stacking energy: -438.567 Base-Backbone interact. energy: -1.833 local terms energy: -547.858573 where: bonds (distance) C4'-P energy: -122.400 bonds (distance) P-C4' energy: -137.097 flat angles C4'-P-C4' energy: -144.190 flat angles P-C4'-P energy: -61.782 tors. eta vs tors. theta energy: -82.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -1004.294964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.294964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.294964 (E_RNA) where: Base-Base interactions energy: -574.475 where: short stacking energy: -283.701 Base-Backbone interact. energy: 0.460 local terms energy: -430.280106 where: bonds (distance) C4'-P energy: -113.352 bonds (distance) P-C4' energy: -114.330 flat angles C4'-P-C4' energy: -117.160 flat angles P-C4'-P energy: -69.851 tors. eta vs tors. theta energy: -15.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -2656.248050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2656.248050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2656.248050 (E_RNA) where: Base-Base interactions energy: -1833.809 where: short stacking energy: -800.438 Base-Backbone interact. energy: -7.426 local terms energy: -815.013329 where: bonds (distance) C4'-P energy: -164.756 bonds (distance) P-C4' energy: -164.590 flat angles C4'-P-C4' energy: -159.001 flat angles P-C4'-P energy: -113.074 tors. eta vs tors. theta energy: -213.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -2469.185457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2469.185457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2469.185457 (E_RNA) where: Base-Base interactions energy: -1738.481 where: short stacking energy: -755.369 Base-Backbone interact. energy: -1.080 local terms energy: -729.624520 where: bonds (distance) C4'-P energy: -132.988 bonds (distance) P-C4' energy: -146.596 flat angles C4'-P-C4' energy: -157.084 flat angles P-C4'-P energy: -99.030 tors. eta vs tors. theta energy: -193.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -2295.022391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2295.022391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.022391 (E_RNA) where: Base-Base interactions energy: -1581.325 where: short stacking energy: -687.865 Base-Backbone interact. energy: -1.433 local terms energy: -712.263773 where: bonds (distance) C4'-P energy: -137.424 bonds (distance) P-C4' energy: -153.217 flat angles C4'-P-C4' energy: -167.997 flat angles P-C4'-P energy: -97.301 tors. eta vs tors. theta energy: -156.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -2236.108683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.108683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.108683 (E_RNA) where: Base-Base interactions energy: -1513.127 where: short stacking energy: -661.094 Base-Backbone interact. energy: -4.918 local terms energy: -718.064144 where: bonds (distance) C4'-P energy: -145.387 bonds (distance) P-C4' energy: -140.460 flat angles C4'-P-C4' energy: -164.352 flat angles P-C4'-P energy: -95.460 tors. eta vs tors. theta energy: -172.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -2168.308479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2168.308479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2168.308479 (E_RNA) where: Base-Base interactions energy: -1513.340 where: short stacking energy: -635.967 Base-Backbone interact. energy: 0.672 local terms energy: -655.639783 where: bonds (distance) C4'-P energy: -120.080 bonds (distance) P-C4' energy: -130.140 flat angles C4'-P-C4' energy: -150.890 flat angles P-C4'-P energy: -102.946 tors. eta vs tors. theta energy: -151.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1928.085440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.085440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.085440 (E_RNA) where: Base-Base interactions energy: -1301.509 where: short stacking energy: -555.079 Base-Backbone interact. energy: -1.056 local terms energy: -625.519987 where: bonds (distance) C4'-P energy: -135.422 bonds (distance) P-C4' energy: -134.893 flat angles C4'-P-C4' energy: -152.523 flat angles P-C4'-P energy: -90.123 tors. eta vs tors. theta energy: -112.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1739.509159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.509159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.509159 (E_RNA) where: Base-Base interactions energy: -1171.057 where: short stacking energy: -560.288 Base-Backbone interact. energy: -2.412 local terms energy: -566.039520 where: bonds (distance) C4'-P energy: -108.630 bonds (distance) P-C4' energy: -113.322 flat angles C4'-P-C4' energy: -137.673 flat angles P-C4'-P energy: -83.439 tors. eta vs tors. theta energy: -122.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1523.856078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.856078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.856078 (E_RNA) where: Base-Base interactions energy: -1003.607 where: short stacking energy: -463.550 Base-Backbone interact. energy: -1.546 local terms energy: -518.703534 where: bonds (distance) C4'-P energy: -121.687 bonds (distance) P-C4' energy: -117.580 flat angles C4'-P-C4' energy: -127.444 flat angles P-C4'-P energy: -72.121 tors. eta vs tors. theta energy: -79.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1447.687263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.687263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.687263 (E_RNA) where: Base-Base interactions energy: -955.360 where: short stacking energy: -452.214 Base-Backbone interact. energy: -0.341 local terms energy: -491.986238 where: bonds (distance) C4'-P energy: -115.789 bonds (distance) P-C4' energy: -106.752 flat angles C4'-P-C4' energy: -109.019 flat angles P-C4'-P energy: -74.810 tors. eta vs tors. theta energy: -85.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -956.127761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.127761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.127761 (E_RNA) where: Base-Base interactions energy: -547.154 where: short stacking energy: -300.529 Base-Backbone interact. energy: -0.321 local terms energy: -408.653409 where: bonds (distance) C4'-P energy: -106.222 bonds (distance) P-C4' energy: -103.284 flat angles C4'-P-C4' energy: -119.182 flat angles P-C4'-P energy: -59.641 tors. eta vs tors. theta energy: -20.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -2667.302527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2667.302527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2667.302527 (E_RNA) where: Base-Base interactions energy: -1860.732 where: short stacking energy: -824.561 Base-Backbone interact. energy: -1.160 local terms energy: -805.410913 where: bonds (distance) C4'-P energy: -143.587 bonds (distance) P-C4' energy: -153.215 flat angles C4'-P-C4' energy: -168.784 flat angles P-C4'-P energy: -112.798 tors. eta vs tors. theta energy: -227.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -2496.434654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2496.434654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2496.434654 (E_RNA) where: Base-Base interactions energy: -1756.385 where: short stacking energy: -735.005 Base-Backbone interact. energy: -0.693 local terms energy: -739.356275 where: bonds (distance) C4'-P energy: -139.632 bonds (distance) P-C4' energy: -150.303 flat angles C4'-P-C4' energy: -162.553 flat angles P-C4'-P energy: -113.983 tors. eta vs tors. theta energy: -172.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -2360.945310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2360.945310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2360.945310 (E_RNA) where: Base-Base interactions energy: -1648.837 where: short stacking energy: -724.488 Base-Backbone interact. energy: -0.178 local terms energy: -711.931251 where: bonds (distance) C4'-P energy: -134.966 bonds (distance) P-C4' energy: -152.497 flat angles C4'-P-C4' energy: -157.890 flat angles P-C4'-P energy: -98.614 tors. eta vs tors. theta energy: -167.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -2250.320378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2250.320378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2250.320378 (E_RNA) where: Base-Base interactions energy: -1537.256 where: short stacking energy: -654.023 Base-Backbone interact. energy: 0.100 local terms energy: -713.164195 where: bonds (distance) C4'-P energy: -154.514 bonds (distance) P-C4' energy: -132.533 flat angles C4'-P-C4' energy: -144.860 flat angles P-C4'-P energy: -125.904 tors. eta vs tors. theta energy: -155.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -2193.217881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.217881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.217881 (E_RNA) where: Base-Base interactions energy: -1483.950 where: short stacking energy: -671.765 Base-Backbone interact. energy: -2.131 local terms energy: -707.136808 where: bonds (distance) C4'-P energy: -136.890 bonds (distance) P-C4' energy: -134.307 flat angles C4'-P-C4' energy: -164.730 flat angles P-C4'-P energy: -87.788 tors. eta vs tors. theta energy: -183.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1898.341460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1898.341460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1898.341460 (E_RNA) where: Base-Base interactions energy: -1273.939 where: short stacking energy: -577.261 Base-Backbone interact. energy: 1.376 local terms energy: -625.777670 where: bonds (distance) C4'-P energy: -129.596 bonds (distance) P-C4' energy: -138.211 flat angles C4'-P-C4' energy: -138.061 flat angles P-C4'-P energy: -90.659 tors. eta vs tors. theta energy: -129.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1727.978646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.978646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.978646 (E_RNA) where: Base-Base interactions energy: -1140.162 where: short stacking energy: -515.323 Base-Backbone interact. energy: -2.805 local terms energy: -585.010732 where: bonds (distance) C4'-P energy: -138.155 bonds (distance) P-C4' energy: -132.879 flat angles C4'-P-C4' energy: -128.026 flat angles P-C4'-P energy: -78.011 tors. eta vs tors. theta energy: -107.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1617.863569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.863569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.863569 (E_RNA) where: Base-Base interactions energy: -1059.450 where: short stacking energy: -504.498 Base-Backbone interact. energy: -3.576 local terms energy: -554.837712 where: bonds (distance) C4'-P energy: -114.307 bonds (distance) P-C4' energy: -115.255 flat angles C4'-P-C4' energy: -132.550 flat angles P-C4'-P energy: -86.617 tors. eta vs tors. theta energy: -106.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1321.331901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.331901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.331901 (E_RNA) where: Base-Base interactions energy: -837.700 where: short stacking energy: -368.633 Base-Backbone interact. energy: -1.618 local terms energy: -482.014217 where: bonds (distance) C4'-P energy: -119.831 bonds (distance) P-C4' energy: -129.978 flat angles C4'-P-C4' energy: -119.592 flat angles P-C4'-P energy: -60.639 tors. eta vs tors. theta energy: -51.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -955.084902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.084902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.084902 (E_RNA) where: Base-Base interactions energy: -495.724 where: short stacking energy: -252.095 Base-Backbone interact. energy: -5.363 local terms energy: -453.998145 where: bonds (distance) C4'-P energy: -122.877 bonds (distance) P-C4' energy: -140.898 flat angles C4'-P-C4' energy: -128.784 flat angles P-C4'-P energy: -61.161 tors. eta vs tors. theta energy: -0.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -2666.100755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2666.100755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2666.100755 (E_RNA) where: Base-Base interactions energy: -1856.890 where: short stacking energy: -822.700 Base-Backbone interact. energy: -2.075 local terms energy: -807.135502 where: bonds (distance) C4'-P energy: -145.957 bonds (distance) P-C4' energy: -151.121 flat angles C4'-P-C4' energy: -167.390 flat angles P-C4'-P energy: -117.502 tors. eta vs tors. theta energy: -225.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -2523.639631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2523.639631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2523.639631 (E_RNA) where: Base-Base interactions energy: -1756.383 where: short stacking energy: -766.453 Base-Backbone interact. energy: -2.239 local terms energy: -765.017482 where: bonds (distance) C4'-P energy: -137.815 bonds (distance) P-C4' energy: -151.559 flat angles C4'-P-C4' energy: -173.383 flat angles P-C4'-P energy: -109.536 tors. eta vs tors. theta energy: -192.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -2386.901985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2386.901985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2386.901985 (E_RNA) where: Base-Base interactions energy: -1663.979 where: short stacking energy: -703.844 Base-Backbone interact. energy: 0.681 local terms energy: -723.604581 where: bonds (distance) C4'-P energy: -154.695 bonds (distance) P-C4' energy: -141.459 flat angles C4'-P-C4' energy: -159.389 flat angles P-C4'-P energy: -109.304 tors. eta vs tors. theta energy: -158.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -2286.023638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2286.023638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2286.023638 (E_RNA) where: Base-Base interactions energy: -1581.067 where: short stacking energy: -662.184 Base-Backbone interact. energy: -3.124 local terms energy: -701.832362 where: bonds (distance) C4'-P energy: -151.987 bonds (distance) P-C4' energy: -121.121 flat angles C4'-P-C4' energy: -161.886 flat angles P-C4'-P energy: -96.763 tors. eta vs tors. theta energy: -170.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -2167.587410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2167.587410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2167.587410 (E_RNA) where: Base-Base interactions energy: -1451.180 where: short stacking energy: -678.673 Base-Backbone interact. energy: -0.275 local terms energy: -716.131879 where: bonds (distance) C4'-P energy: -147.371 bonds (distance) P-C4' energy: -127.761 flat angles C4'-P-C4' energy: -159.823 flat angles P-C4'-P energy: -105.265 tors. eta vs tors. theta energy: -175.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1907.720400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.720400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1907.720400 (E_RNA) where: Base-Base interactions energy: -1263.186 where: short stacking energy: -548.187 Base-Backbone interact. energy: -4.068 local terms energy: -640.466847 where: bonds (distance) C4'-P energy: -139.867 bonds (distance) P-C4' energy: -140.531 flat angles C4'-P-C4' energy: -142.366 flat angles P-C4'-P energy: -98.325 tors. eta vs tors. theta energy: -119.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1794.384821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1794.384821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1794.384821 (E_RNA) where: Base-Base interactions energy: -1175.605 where: short stacking energy: -566.147 Base-Backbone interact. energy: 1.705 local terms energy: -620.484961 where: bonds (distance) C4'-P energy: -123.556 bonds (distance) P-C4' energy: -141.935 flat angles C4'-P-C4' energy: -136.997 flat angles P-C4'-P energy: -85.607 tors. eta vs tors. theta energy: -132.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1568.628191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.628191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.628191 (E_RNA) where: Base-Base interactions energy: -1008.094 where: short stacking energy: -472.265 Base-Backbone interact. energy: -5.246 local terms energy: -555.288051 where: bonds (distance) C4'-P energy: -120.458 bonds (distance) P-C4' energy: -106.180 flat angles C4'-P-C4' energy: -150.496 flat angles P-C4'-P energy: -80.819 tors. eta vs tors. theta energy: -97.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1247.666757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.666757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.666757 (E_RNA) where: Base-Base interactions energy: -744.727 where: short stacking energy: -361.006 Base-Backbone interact. energy: 4.684 local terms energy: -507.624144 where: bonds (distance) C4'-P energy: -138.173 bonds (distance) P-C4' energy: -119.988 flat angles C4'-P-C4' energy: -130.082 flat angles P-C4'-P energy: -64.248 tors. eta vs tors. theta energy: -55.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -987.380295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.380295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.380295 (E_RNA) where: Base-Base interactions energy: -545.562 where: short stacking energy: -273.803 Base-Backbone interact. energy: 2.262 local terms energy: -444.079570 where: bonds (distance) C4'-P energy: -130.580 bonds (distance) P-C4' energy: -105.750 flat angles C4'-P-C4' energy: -112.325 flat angles P-C4'-P energy: -83.604 tors. eta vs tors. theta energy: -11.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -2643.621008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2643.621008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2643.621008 (E_RNA) where: Base-Base interactions energy: -1810.765 where: short stacking energy: -810.036 Base-Backbone interact. energy: -3.564 local terms energy: -829.291443 where: bonds (distance) C4'-P energy: -167.360 bonds (distance) P-C4' energy: -143.921 flat angles C4'-P-C4' energy: -176.902 flat angles P-C4'-P energy: -113.258 tors. eta vs tors. theta energy: -227.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -2505.792574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.792574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.792574 (E_RNA) where: Base-Base interactions energy: -1741.233 where: short stacking energy: -746.988 Base-Backbone interact. energy: 3.975 local terms energy: -768.535152 where: bonds (distance) C4'-P energy: -140.681 bonds (distance) P-C4' energy: -156.502 flat angles C4'-P-C4' energy: -163.348 flat angles P-C4'-P energy: -107.625 tors. eta vs tors. theta energy: -200.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -2392.890415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2392.890415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2392.890415 (E_RNA) where: Base-Base interactions energy: -1675.239 where: short stacking energy: -729.966 Base-Backbone interact. energy: -2.980 local terms energy: -714.671182 where: bonds (distance) C4'-P energy: -139.042 bonds (distance) P-C4' energy: -150.099 flat angles C4'-P-C4' energy: -161.776 flat angles P-C4'-P energy: -89.676 tors. eta vs tors. theta energy: -174.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -2272.249992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2272.249992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2272.249992 (E_RNA) where: Base-Base interactions energy: -1587.414 where: short stacking energy: -695.260 Base-Backbone interact. energy: -1.706 local terms energy: -683.129985 where: bonds (distance) C4'-P energy: -138.665 bonds (distance) P-C4' energy: -146.015 flat angles C4'-P-C4' energy: -155.884 flat angles P-C4'-P energy: -83.486 tors. eta vs tors. theta energy: -159.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -2183.120175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.120175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.120175 (E_RNA) where: Base-Base interactions energy: -1497.255 where: short stacking energy: -670.921 Base-Backbone interact. energy: -0.909 local terms energy: -684.955915 where: bonds (distance) C4'-P energy: -129.021 bonds (distance) P-C4' energy: -127.596 flat angles C4'-P-C4' energy: -153.861 flat angles P-C4'-P energy: -87.573 tors. eta vs tors. theta energy: -186.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1979.845822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.845822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.845822 (E_RNA) where: Base-Base interactions energy: -1344.278 where: short stacking energy: -600.642 Base-Backbone interact. energy: 0.873 local terms energy: -636.440841 where: bonds (distance) C4'-P energy: -135.580 bonds (distance) P-C4' energy: -151.690 flat angles C4'-P-C4' energy: -137.979 flat angles P-C4'-P energy: -84.615 tors. eta vs tors. theta energy: -126.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1790.958692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1790.958692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1790.958692 (E_RNA) where: Base-Base interactions energy: -1204.702 where: short stacking energy: -541.259 Base-Backbone interact. energy: 1.551 local terms energy: -587.807148 where: bonds (distance) C4'-P energy: -127.954 bonds (distance) P-C4' energy: -137.765 flat angles C4'-P-C4' energy: -134.570 flat angles P-C4'-P energy: -77.969 tors. eta vs tors. theta energy: -109.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1569.846245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.846245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.846245 (E_RNA) where: Base-Base interactions energy: -989.634 where: short stacking energy: -472.392 Base-Backbone interact. energy: 0.580 local terms energy: -580.792426 where: bonds (distance) C4'-P energy: -122.070 bonds (distance) P-C4' energy: -145.173 flat angles C4'-P-C4' energy: -141.529 flat angles P-C4'-P energy: -81.707 tors. eta vs tors. theta energy: -90.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1251.767504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.767504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.767504 (E_RNA) where: Base-Base interactions energy: -758.270 where: short stacking energy: -365.046 Base-Backbone interact. energy: 3.389 local terms energy: -496.886810 where: bonds (distance) C4'-P energy: -121.188 bonds (distance) P-C4' energy: -136.346 flat angles C4'-P-C4' energy: -127.367 flat angles P-C4'-P energy: -66.375 tors. eta vs tors. theta energy: -45.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -931.690369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.690369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.690369 (E_RNA) where: Base-Base interactions energy: -528.239 where: short stacking energy: -290.242 Base-Backbone interact. energy: -4.043 local terms energy: -399.408506 where: bonds (distance) C4'-P energy: -117.029 bonds (distance) P-C4' energy: -130.283 flat angles C4'-P-C4' energy: -112.177 flat angles P-C4'-P energy: -40.456 tors. eta vs tors. theta energy: 0.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -2649.763198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2649.763198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2649.763198 (E_RNA) where: Base-Base interactions energy: -1834.785 where: short stacking energy: -808.102 Base-Backbone interact. energy: 0.993 local terms energy: -815.971196 where: bonds (distance) C4'-P energy: -144.565 bonds (distance) P-C4' energy: -170.613 flat angles C4'-P-C4' energy: -172.314 flat angles P-C4'-P energy: -107.150 tors. eta vs tors. theta energy: -221.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -2512.540417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2512.540417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2512.540417 (E_RNA) where: Base-Base interactions energy: -1717.807 where: short stacking energy: -776.905 Base-Backbone interact. energy: -5.140 local terms energy: -789.592999 where: bonds (distance) C4'-P energy: -155.244 bonds (distance) P-C4' energy: -141.514 flat angles C4'-P-C4' energy: -170.799 flat angles P-C4'-P energy: -124.978 tors. eta vs tors. theta energy: -197.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -2389.327856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2389.327856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2389.327856 (E_RNA) where: Base-Base interactions energy: -1673.397 where: short stacking energy: -737.999 Base-Backbone interact. energy: -3.410 local terms energy: -712.520820 where: bonds (distance) C4'-P energy: -159.482 bonds (distance) P-C4' energy: -138.782 flat angles C4'-P-C4' energy: -146.244 flat angles P-C4'-P energy: -107.068 tors. eta vs tors. theta energy: -160.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -2240.506285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2240.506285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.506285 (E_RNA) where: Base-Base interactions energy: -1585.771 where: short stacking energy: -646.967 Base-Backbone interact. energy: 5.880 local terms energy: -660.614946 where: bonds (distance) C4'-P energy: -133.503 bonds (distance) P-C4' energy: -128.727 flat angles C4'-P-C4' energy: -158.629 flat angles P-C4'-P energy: -95.822 tors. eta vs tors. theta energy: -143.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -2187.233865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.233865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2187.233865 (E_RNA) where: Base-Base interactions energy: -1476.217 where: short stacking energy: -697.783 Base-Backbone interact. energy: -1.700 local terms energy: -709.315980 where: bonds (distance) C4'-P energy: -122.404 bonds (distance) P-C4' energy: -139.432 flat angles C4'-P-C4' energy: -160.122 flat angles P-C4'-P energy: -103.211 tors. eta vs tors. theta energy: -184.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1984.956873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1984.956873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1984.956873 (E_RNA) where: Base-Base interactions energy: -1362.608 where: short stacking energy: -637.435 Base-Backbone interact. energy: -6.107 local terms energy: -616.241536 where: bonds (distance) C4'-P energy: -109.748 bonds (distance) P-C4' energy: -123.662 flat angles C4'-P-C4' energy: -140.292 flat angles P-C4'-P energy: -86.667 tors. eta vs tors. theta energy: -155.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1819.741672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1819.741672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1819.741672 (E_RNA) where: Base-Base interactions energy: -1189.172 where: short stacking energy: -516.508 Base-Backbone interact. energy: 0.270 local terms energy: -630.839880 where: bonds (distance) C4'-P energy: -151.382 bonds (distance) P-C4' energy: -140.625 flat angles C4'-P-C4' energy: -130.265 flat angles P-C4'-P energy: -92.739 tors. eta vs tors. theta energy: -115.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1605.139318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.139318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.139318 (E_RNA) where: Base-Base interactions energy: -1040.098 where: short stacking energy: -478.657 Base-Backbone interact. energy: -3.415 local terms energy: -561.625444 where: bonds (distance) C4'-P energy: -136.822 bonds (distance) P-C4' energy: -132.691 flat angles C4'-P-C4' energy: -121.368 flat angles P-C4'-P energy: -79.706 tors. eta vs tors. theta energy: -91.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1338.946255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.946255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.946255 (E_RNA) where: Base-Base interactions energy: -842.524 where: short stacking energy: -407.807 Base-Backbone interact. energy: -2.850 local terms energy: -493.572058 where: bonds (distance) C4'-P energy: -95.581 bonds (distance) P-C4' energy: -127.961 flat angles C4'-P-C4' energy: -120.195 flat angles P-C4'-P energy: -81.317 tors. eta vs tors. theta energy: -68.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -937.579640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.579640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.579640 (E_RNA) where: Base-Base interactions energy: -540.505 where: short stacking energy: -295.723 Base-Backbone interact. energy: 1.952 local terms energy: -399.026564 where: bonds (distance) C4'-P energy: -123.358 bonds (distance) P-C4' energy: -104.944 flat angles C4'-P-C4' energy: -72.569 flat angles P-C4'-P energy: -66.332 tors. eta vs tors. theta energy: -31.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -2672.638327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2672.638327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2672.638327 (E_RNA) where: Base-Base interactions energy: -1845.010 where: short stacking energy: -815.942 Base-Backbone interact. energy: -2.998 local terms energy: -824.630412 where: bonds (distance) C4'-P energy: -149.720 bonds (distance) P-C4' energy: -149.543 flat angles C4'-P-C4' energy: -174.021 flat angles P-C4'-P energy: -129.214 tors. eta vs tors. theta energy: -222.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -2499.109043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2499.109043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.109043 (E_RNA) where: Base-Base interactions energy: -1726.903 where: short stacking energy: -745.289 Base-Backbone interact. energy: -3.642 local terms energy: -768.564358 where: bonds (distance) C4'-P energy: -140.188 bonds (distance) P-C4' energy: -161.330 flat angles C4'-P-C4' energy: -168.197 flat angles P-C4'-P energy: -110.402 tors. eta vs tors. theta energy: -188.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -2371.474234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.474234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.474234 (E_RNA) where: Base-Base interactions energy: -1664.058 where: short stacking energy: -725.214 Base-Backbone interact. energy: -1.079 local terms energy: -706.337086 where: bonds (distance) C4'-P energy: -139.104 bonds (distance) P-C4' energy: -130.690 flat angles C4'-P-C4' energy: -153.641 flat angles P-C4'-P energy: -110.008 tors. eta vs tors. theta energy: -172.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -2234.858217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2234.858217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2234.858217 (E_RNA) where: Base-Base interactions energy: -1559.165 where: short stacking energy: -650.063 Base-Backbone interact. energy: -2.491 local terms energy: -673.202539 where: bonds (distance) C4'-P energy: -146.798 bonds (distance) P-C4' energy: -145.436 flat angles C4'-P-C4' energy: -138.308 flat angles P-C4'-P energy: -97.394 tors. eta vs tors. theta energy: -145.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -2188.914853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2188.914853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2188.914853 (E_RNA) where: Base-Base interactions energy: -1503.435 where: short stacking energy: -682.686 Base-Backbone interact. energy: -0.394 local terms energy: -685.085346 where: bonds (distance) C4'-P energy: -118.973 bonds (distance) P-C4' energy: -154.014 flat angles C4'-P-C4' energy: -149.371 flat angles P-C4'-P energy: -86.709 tors. eta vs tors. theta energy: -176.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -2008.317150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2008.317150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2008.317150 (E_RNA) where: Base-Base interactions energy: -1392.619 where: short stacking energy: -624.738 Base-Backbone interact. energy: 4.655 local terms energy: -620.352881 where: bonds (distance) C4'-P energy: -121.962 bonds (distance) P-C4' energy: -140.161 flat angles C4'-P-C4' energy: -141.775 flat angles P-C4'-P energy: -89.105 tors. eta vs tors. theta energy: -127.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1851.558484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1851.558484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1851.558484 (E_RNA) where: Base-Base interactions energy: -1206.139 where: short stacking energy: -533.693 Base-Backbone interact. energy: -2.545 local terms energy: -642.874287 where: bonds (distance) C4'-P energy: -140.195 bonds (distance) P-C4' energy: -120.057 flat angles C4'-P-C4' energy: -155.591 flat angles P-C4'-P energy: -96.811 tors. eta vs tors. theta energy: -130.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1686.412577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.412577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.412577 (E_RNA) where: Base-Base interactions energy: -1096.653 where: short stacking energy: -517.389 Base-Backbone interact. energy: -0.706 local terms energy: -589.053639 where: bonds (distance) C4'-P energy: -129.212 bonds (distance) P-C4' energy: -129.373 flat angles C4'-P-C4' energy: -117.051 flat angles P-C4'-P energy: -97.722 tors. eta vs tors. theta energy: -115.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1380.292306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.292306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.292306 (E_RNA) where: Base-Base interactions energy: -866.968 where: short stacking energy: -424.447 Base-Backbone interact. energy: -0.255 local terms energy: -513.069383 where: bonds (distance) C4'-P energy: -104.663 bonds (distance) P-C4' energy: -122.191 flat angles C4'-P-C4' energy: -125.149 flat angles P-C4'-P energy: -74.769 tors. eta vs tors. theta energy: -86.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -899.591981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.591981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.591981 (E_RNA) where: Base-Base interactions energy: -432.075 where: short stacking energy: -240.403 Base-Backbone interact. energy: -0.444 local terms energy: -467.073411 where: bonds (distance) C4'-P energy: -101.121 bonds (distance) P-C4' energy: -157.472 flat angles C4'-P-C4' energy: -122.248 flat angles P-C4'-P energy: -68.274 tors. eta vs tors. theta energy: -17.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -2671.373084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2671.373084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2671.373084 (E_RNA) where: Base-Base interactions energy: -1868.433 where: short stacking energy: -825.217 Base-Backbone interact. energy: -2.595 local terms energy: -800.345126 where: bonds (distance) C4'-P energy: -145.150 bonds (distance) P-C4' energy: -148.181 flat angles C4'-P-C4' energy: -176.795 flat angles P-C4'-P energy: -91.957 tors. eta vs tors. theta energy: -238.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -2521.064595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2521.064595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.064595 (E_RNA) where: Base-Base interactions energy: -1740.533 where: short stacking energy: -731.616 Base-Backbone interact. energy: -1.462 local terms energy: -779.069654 where: bonds (distance) C4'-P energy: -147.324 bonds (distance) P-C4' energy: -157.784 flat angles C4'-P-C4' energy: -164.145 flat angles P-C4'-P energy: -119.524 tors. eta vs tors. theta energy: -190.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -2373.521508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.521508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.521508 (E_RNA) where: Base-Base interactions energy: -1674.009 where: short stacking energy: -723.014 Base-Backbone interact. energy: 1.272 local terms energy: -700.784533 where: bonds (distance) C4'-P energy: -137.729 bonds (distance) P-C4' energy: -139.192 flat angles C4'-P-C4' energy: -150.689 flat angles P-C4'-P energy: -98.230 tors. eta vs tors. theta energy: -174.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -2207.946988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.946988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.946988 (E_RNA) where: Base-Base interactions energy: -1561.933 where: short stacking energy: -638.445 Base-Backbone interact. energy: -6.622 local terms energy: -639.391284 where: bonds (distance) C4'-P energy: -141.357 bonds (distance) P-C4' energy: -134.790 flat angles C4'-P-C4' energy: -131.835 flat angles P-C4'-P energy: -92.072 tors. eta vs tors. theta energy: -139.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -2190.461511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2190.461511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2190.461511 (E_RNA) where: Base-Base interactions energy: -1482.866 where: short stacking energy: -692.110 Base-Backbone interact. energy: 0.218 local terms energy: -707.812704 where: bonds (distance) C4'-P energy: -129.804 bonds (distance) P-C4' energy: -137.750 flat angles C4'-P-C4' energy: -161.385 flat angles P-C4'-P energy: -107.625 tors. eta vs tors. theta energy: -171.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -2057.439500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2057.439500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2057.439500 (E_RNA) where: Base-Base interactions energy: -1392.672 where: short stacking energy: -633.217 Base-Backbone interact. energy: -2.974 local terms energy: -661.794320 where: bonds (distance) C4'-P energy: -129.649 bonds (distance) P-C4' energy: -147.292 flat angles C4'-P-C4' energy: -147.503 flat angles P-C4'-P energy: -100.697 tors. eta vs tors. theta energy: -136.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1871.359007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.359007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.359007 (E_RNA) where: Base-Base interactions energy: -1285.538 where: short stacking energy: -583.308 Base-Backbone interact. energy: -4.002 local terms energy: -581.819556 where: bonds (distance) C4'-P energy: -114.371 bonds (distance) P-C4' energy: -119.106 flat angles C4'-P-C4' energy: -140.501 flat angles P-C4'-P energy: -80.642 tors. eta vs tors. theta energy: -127.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1610.365571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.365571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.365571 (E_RNA) where: Base-Base interactions energy: -1071.655 where: short stacking energy: -513.583 Base-Backbone interact. energy: 3.128 local terms energy: -541.838580 where: bonds (distance) C4'-P energy: -117.051 bonds (distance) P-C4' energy: -123.055 flat angles C4'-P-C4' energy: -130.315 flat angles P-C4'-P energy: -79.848 tors. eta vs tors. theta energy: -91.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1396.280214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1396.280214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.280214 (E_RNA) where: Base-Base interactions energy: -896.131 where: short stacking energy: -417.442 Base-Backbone interact. energy: -1.875 local terms energy: -498.274215 where: bonds (distance) C4'-P energy: -103.191 bonds (distance) P-C4' energy: -112.595 flat angles C4'-P-C4' energy: -140.172 flat angles P-C4'-P energy: -82.053 tors. eta vs tors. theta energy: -60.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -928.637540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.637540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.637540 (E_RNA) where: Base-Base interactions energy: -477.690 where: short stacking energy: -270.771 Base-Backbone interact. energy: 1.090 local terms energy: -452.037941 where: bonds (distance) C4'-P energy: -128.547 bonds (distance) P-C4' energy: -134.504 flat angles C4'-P-C4' energy: -115.468 flat angles P-C4'-P energy: -64.557 tors. eta vs tors. theta energy: -8.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -2663.748210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2663.748210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2663.748210 (E_RNA) where: Base-Base interactions energy: -1842.566 where: short stacking energy: -800.224 Base-Backbone interact. energy: -1.145 local terms energy: -820.037634 where: bonds (distance) C4'-P energy: -153.461 bonds (distance) P-C4' energy: -157.048 flat angles C4'-P-C4' energy: -173.441 flat angles P-C4'-P energy: -106.038 tors. eta vs tors. theta energy: -230.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -2535.668238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.668238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.668238 (E_RNA) where: Base-Base interactions energy: -1746.561 where: short stacking energy: -759.047 Base-Backbone interact. energy: -7.094 local terms energy: -782.013657 where: bonds (distance) C4'-P energy: -151.883 bonds (distance) P-C4' energy: -154.930 flat angles C4'-P-C4' energy: -170.645 flat angles P-C4'-P energy: -106.197 tors. eta vs tors. theta energy: -198.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -2383.565442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.565442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2383.565442 (E_RNA) where: Base-Base interactions energy: -1678.357 where: short stacking energy: -707.829 Base-Backbone interact. energy: -0.944 local terms energy: -704.264484 where: bonds (distance) C4'-P energy: -153.532 bonds (distance) P-C4' energy: -131.905 flat angles C4'-P-C4' energy: -154.837 flat angles P-C4'-P energy: -92.894 tors. eta vs tors. theta energy: -171.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -2278.767759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2278.767759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2278.767759 (E_RNA) where: Base-Base interactions energy: -1614.873 where: short stacking energy: -711.822 Base-Backbone interact. energy: -3.091 local terms energy: -660.803863 where: bonds (distance) C4'-P energy: -149.624 bonds (distance) P-C4' energy: -116.678 flat angles C4'-P-C4' energy: -137.287 flat angles P-C4'-P energy: -99.583 tors. eta vs tors. theta energy: -157.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -2180.804221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2180.804221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2180.804221 (E_RNA) where: Base-Base interactions energy: -1465.313 where: short stacking energy: -675.687 Base-Backbone interact. energy: 1.070 local terms energy: -716.560747 where: bonds (distance) C4'-P energy: -146.028 bonds (distance) P-C4' energy: -138.402 flat angles C4'-P-C4' energy: -149.465 flat angles P-C4'-P energy: -108.694 tors. eta vs tors. theta energy: -173.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -2049.126992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2049.126992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2049.126992 (E_RNA) where: Base-Base interactions energy: -1418.427 where: short stacking energy: -643.466 Base-Backbone interact. energy: -1.960 local terms energy: -628.740087 where: bonds (distance) C4'-P energy: -108.981 bonds (distance) P-C4' energy: -132.648 flat angles C4'-P-C4' energy: -138.689 flat angles P-C4'-P energy: -91.404 tors. eta vs tors. theta energy: -157.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1843.260883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1843.260883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1843.260883 (E_RNA) where: Base-Base interactions energy: -1238.312 where: short stacking energy: -572.346 Base-Backbone interact. energy: -3.553 local terms energy: -601.395180 where: bonds (distance) C4'-P energy: -133.756 bonds (distance) P-C4' energy: -118.589 flat angles C4'-P-C4' energy: -135.716 flat angles P-C4'-P energy: -85.528 tors. eta vs tors. theta energy: -127.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1603.621395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.621395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.621395 (E_RNA) where: Base-Base interactions energy: -1052.099 where: short stacking energy: -468.167 Base-Backbone interact. energy: -0.329 local terms energy: -551.193408 where: bonds (distance) C4'-P energy: -109.601 bonds (distance) P-C4' energy: -125.508 flat angles C4'-P-C4' energy: -141.742 flat angles P-C4'-P energy: -82.309 tors. eta vs tors. theta energy: -92.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1469.655932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.655932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.655932 (E_RNA) where: Base-Base interactions energy: -929.376 where: short stacking energy: -430.415 Base-Backbone interact. energy: -1.291 local terms energy: -538.988810 where: bonds (distance) C4'-P energy: -118.243 bonds (distance) P-C4' energy: -134.640 flat angles C4'-P-C4' energy: -115.195 flat angles P-C4'-P energy: -78.428 tors. eta vs tors. theta energy: -92.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -991.546315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.546315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.546315 (E_RNA) where: Base-Base interactions energy: -539.404 where: short stacking energy: -295.459 Base-Backbone interact. energy: -1.738 local terms energy: -450.404814 where: bonds (distance) C4'-P energy: -117.864 bonds (distance) P-C4' energy: -133.387 flat angles C4'-P-C4' energy: -106.859 flat angles P-C4'-P energy: -58.508 tors. eta vs tors. theta energy: -33.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -2648.027835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2648.027835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2648.027835 (E_RNA) where: Base-Base interactions energy: -1849.274 where: short stacking energy: -812.661 Base-Backbone interact. energy: -3.130 local terms energy: -795.623248 where: bonds (distance) C4'-P energy: -152.107 bonds (distance) P-C4' energy: -151.619 flat angles C4'-P-C4' energy: -173.348 flat angles P-C4'-P energy: -104.889 tors. eta vs tors. theta energy: -213.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -2476.797978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2476.797978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2476.797978 (E_RNA) where: Base-Base interactions energy: -1705.917 where: short stacking energy: -761.543 Base-Backbone interact. energy: -5.154 local terms energy: -765.727718 where: bonds (distance) C4'-P energy: -146.987 bonds (distance) P-C4' energy: -147.027 flat angles C4'-P-C4' energy: -163.810 flat angles P-C4'-P energy: -111.562 tors. eta vs tors. theta energy: -196.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -2370.523321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2370.523321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2370.523321 (E_RNA) where: Base-Base interactions energy: -1658.425 where: short stacking energy: -727.653 Base-Backbone interact. energy: -0.888 local terms energy: -711.209587 where: bonds (distance) C4'-P energy: -141.034 bonds (distance) P-C4' energy: -147.895 flat angles C4'-P-C4' energy: -162.259 flat angles P-C4'-P energy: -90.499 tors. eta vs tors. theta energy: -169.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -2323.684074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2323.684074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2323.684074 (E_RNA) where: Base-Base interactions energy: -1612.770 where: short stacking energy: -690.692 Base-Backbone interact. energy: -7.015 local terms energy: -703.899152 where: bonds (distance) C4'-P energy: -141.546 bonds (distance) P-C4' energy: -140.987 flat angles C4'-P-C4' energy: -148.618 flat angles P-C4'-P energy: -97.553 tors. eta vs tors. theta energy: -175.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -2182.432008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2182.432008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.432008 (E_RNA) where: Base-Base interactions energy: -1511.354 where: short stacking energy: -693.736 Base-Backbone interact. energy: 1.024 local terms energy: -672.102404 where: bonds (distance) C4'-P energy: -132.206 bonds (distance) P-C4' energy: -121.398 flat angles C4'-P-C4' energy: -165.741 flat angles P-C4'-P energy: -79.050 tors. eta vs tors. theta energy: -173.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -2028.177291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2028.177291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2028.177291 (E_RNA) where: Base-Base interactions energy: -1390.723 where: short stacking energy: -624.513 Base-Backbone interact. energy: 1.650 local terms energy: -639.103799 where: bonds (distance) C4'-P energy: -101.327 bonds (distance) P-C4' energy: -140.915 flat angles C4'-P-C4' energy: -153.447 flat angles P-C4'-P energy: -88.579 tors. eta vs tors. theta energy: -154.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1757.627738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1757.627738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.627738 (E_RNA) where: Base-Base interactions energy: -1211.477 where: short stacking energy: -536.585 Base-Backbone interact. energy: 6.702 local terms energy: -552.852154 where: bonds (distance) C4'-P energy: -113.607 bonds (distance) P-C4' energy: -116.403 flat angles C4'-P-C4' energy: -143.972 flat angles P-C4'-P energy: -68.193 tors. eta vs tors. theta energy: -110.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1696.515161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.515161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.515161 (E_RNA) where: Base-Base interactions energy: -1108.507 where: short stacking energy: -527.357 Base-Backbone interact. energy: -3.299 local terms energy: -584.709025 where: bonds (distance) C4'-P energy: -134.771 bonds (distance) P-C4' energy: -131.241 flat angles C4'-P-C4' energy: -125.198 flat angles P-C4'-P energy: -80.480 tors. eta vs tors. theta energy: -113.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1490.840757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.840757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.840757 (E_RNA) where: Base-Base interactions energy: -971.652 where: short stacking energy: -437.360 Base-Backbone interact. energy: 2.038 local terms energy: -521.226808 where: bonds (distance) C4'-P energy: -103.928 bonds (distance) P-C4' energy: -135.983 flat angles C4'-P-C4' energy: -127.898 flat angles P-C4'-P energy: -82.623 tors. eta vs tors. theta energy: -70.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -1008.171755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.171755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.171755 (E_RNA) where: Base-Base interactions energy: -549.953 where: short stacking energy: -314.531 Base-Backbone interact. energy: 2.878 local terms energy: -461.096492 where: bonds (distance) C4'-P energy: -112.067 bonds (distance) P-C4' energy: -129.051 flat angles C4'-P-C4' energy: -126.678 flat angles P-C4'-P energy: -68.413 tors. eta vs tors. theta energy: -24.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -2655.453164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2655.453164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2655.453164 (E_RNA) where: Base-Base interactions energy: -1859.561 where: short stacking energy: -802.536 Base-Backbone interact. energy: -4.668 local terms energy: -791.224079 where: bonds (distance) C4'-P energy: -156.581 bonds (distance) P-C4' energy: -149.121 flat angles C4'-P-C4' energy: -159.628 flat angles P-C4'-P energy: -104.764 tors. eta vs tors. theta energy: -221.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -2577.419360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2577.419360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2577.419360 (E_RNA) where: Base-Base interactions energy: -1794.474 where: short stacking energy: -767.401 Base-Backbone interact. energy: 4.789 local terms energy: -787.733882 where: bonds (distance) C4'-P energy: -146.184 bonds (distance) P-C4' energy: -157.423 flat angles C4'-P-C4' energy: -175.293 flat angles P-C4'-P energy: -118.162 tors. eta vs tors. theta energy: -190.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -2362.153324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2362.153324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2362.153324 (E_RNA) where: Base-Base interactions energy: -1622.871 where: short stacking energy: -688.104 Base-Backbone interact. energy: -2.200 local terms energy: -737.082805 where: bonds (distance) C4'-P energy: -138.420 bonds (distance) P-C4' energy: -153.759 flat angles C4'-P-C4' energy: -170.442 flat angles P-C4'-P energy: -98.971 tors. eta vs tors. theta energy: -175.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -2248.673748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2248.673748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2248.673748 (E_RNA) where: Base-Base interactions energy: -1573.052 where: short stacking energy: -652.247 Base-Backbone interact. energy: -5.918 local terms energy: -669.703247 where: bonds (distance) C4'-P energy: -120.518 bonds (distance) P-C4' energy: -151.318 flat angles C4'-P-C4' energy: -145.364 flat angles P-C4'-P energy: -100.741 tors. eta vs tors. theta energy: -151.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -2235.783891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2235.783891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.783891 (E_RNA) where: Base-Base interactions energy: -1507.049 where: short stacking energy: -674.658 Base-Backbone interact. energy: -5.017 local terms energy: -723.718031 where: bonds (distance) C4'-P energy: -141.016 bonds (distance) P-C4' energy: -147.183 flat angles C4'-P-C4' energy: -155.185 flat angles P-C4'-P energy: -106.258 tors. eta vs tors. theta energy: -174.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1975.229466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1975.229466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1975.229466 (E_RNA) where: Base-Base interactions energy: -1370.800 where: short stacking energy: -593.090 Base-Backbone interact. energy: 1.180 local terms energy: -605.609537 where: bonds (distance) C4'-P energy: -131.885 bonds (distance) P-C4' energy: -129.748 flat angles C4'-P-C4' energy: -133.523 flat angles P-C4'-P energy: -82.892 tors. eta vs tors. theta energy: -127.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1730.678383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1730.678383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.678383 (E_RNA) where: Base-Base interactions energy: -1158.885 where: short stacking energy: -552.786 Base-Backbone interact. energy: 0.816 local terms energy: -572.608803 where: bonds (distance) C4'-P energy: -122.070 bonds (distance) P-C4' energy: -131.937 flat angles C4'-P-C4' energy: -128.916 flat angles P-C4'-P energy: -84.807 tors. eta vs tors. theta energy: -104.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1676.196884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.196884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.196884 (E_RNA) where: Base-Base interactions energy: -1086.168 where: short stacking energy: -487.405 Base-Backbone interact. energy: 0.908 local terms energy: -590.937481 where: bonds (distance) C4'-P energy: -115.758 bonds (distance) P-C4' energy: -154.315 flat angles C4'-P-C4' energy: -148.686 flat angles P-C4'-P energy: -64.493 tors. eta vs tors. theta energy: -107.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1467.891436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.891436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.891436 (E_RNA) where: Base-Base interactions energy: -970.450 where: short stacking energy: -435.159 Base-Backbone interact. energy: 0.487 local terms energy: -497.928373 where: bonds (distance) C4'-P energy: -113.207 bonds (distance) P-C4' energy: -101.944 flat angles C4'-P-C4' energy: -129.627 flat angles P-C4'-P energy: -70.051 tors. eta vs tors. theta energy: -83.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -962.808542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.808542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.808542 (E_RNA) where: Base-Base interactions energy: -546.786 where: short stacking energy: -292.652 Base-Backbone interact. energy: 1.694 local terms energy: -417.716757 where: bonds (distance) C4'-P energy: -116.960 bonds (distance) P-C4' energy: -136.088 flat angles C4'-P-C4' energy: -99.323 flat angles P-C4'-P energy: -51.796 tors. eta vs tors. theta energy: -13.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -2652.592481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2652.592481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2652.592481 (E_RNA) where: Base-Base interactions energy: -1859.360 where: short stacking energy: -830.806 Base-Backbone interact. energy: -2.531 local terms energy: -790.701535 where: bonds (distance) C4'-P energy: -138.356 bonds (distance) P-C4' energy: -158.577 flat angles C4'-P-C4' energy: -163.875 flat angles P-C4'-P energy: -100.780 tors. eta vs tors. theta energy: -229.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -2562.430633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2562.430633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2562.430633 (E_RNA) where: Base-Base interactions energy: -1795.806 where: short stacking energy: -770.793 Base-Backbone interact. energy: 5.411 local terms energy: -772.036235 where: bonds (distance) C4'-P energy: -148.821 bonds (distance) P-C4' energy: -143.622 flat angles C4'-P-C4' energy: -185.481 flat angles P-C4'-P energy: -105.312 tors. eta vs tors. theta energy: -188.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -2344.588313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2344.588313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.588313 (E_RNA) where: Base-Base interactions energy: -1625.315 where: short stacking energy: -699.122 Base-Backbone interact. energy: -5.153 local terms energy: -714.119984 where: bonds (distance) C4'-P energy: -143.048 bonds (distance) P-C4' energy: -152.060 flat angles C4'-P-C4' energy: -159.726 flat angles P-C4'-P energy: -103.401 tors. eta vs tors. theta energy: -155.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -2292.151642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2292.151642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2292.151642 (E_RNA) where: Base-Base interactions energy: -1612.009 where: short stacking energy: -651.004 Base-Backbone interact. energy: -0.545 local terms energy: -679.597751 where: bonds (distance) C4'-P energy: -146.357 bonds (distance) P-C4' energy: -123.040 flat angles C4'-P-C4' energy: -155.500 flat angles P-C4'-P energy: -101.034 tors. eta vs tors. theta energy: -153.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -2201.970305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2201.970305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2201.970305 (E_RNA) where: Base-Base interactions energy: -1511.116 where: short stacking energy: -685.231 Base-Backbone interact. energy: -2.376 local terms energy: -688.478332 where: bonds (distance) C4'-P energy: -120.302 bonds (distance) P-C4' energy: -151.585 flat angles C4'-P-C4' energy: -151.342 flat angles P-C4'-P energy: -99.714 tors. eta vs tors. theta energy: -165.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1984.895434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1984.895434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1984.895434 (E_RNA) where: Base-Base interactions energy: -1377.155 where: short stacking energy: -612.930 Base-Backbone interact. energy: -2.250 local terms energy: -605.489963 where: bonds (distance) C4'-P energy: -113.503 bonds (distance) P-C4' energy: -128.148 flat angles C4'-P-C4' energy: -155.090 flat angles P-C4'-P energy: -77.649 tors. eta vs tors. theta energy: -131.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1759.241379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1759.241379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.241379 (E_RNA) where: Base-Base interactions energy: -1188.901 where: short stacking energy: -530.145 Base-Backbone interact. energy: 0.489 local terms energy: -570.829468 where: bonds (distance) C4'-P energy: -125.381 bonds (distance) P-C4' energy: -117.366 flat angles C4'-P-C4' energy: -145.731 flat angles P-C4'-P energy: -77.162 tors. eta vs tors. theta energy: -105.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1652.118617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.118617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.118617 (E_RNA) where: Base-Base interactions energy: -1086.605 where: short stacking energy: -530.907 Base-Backbone interact. energy: 1.210 local terms energy: -566.723803 where: bonds (distance) C4'-P energy: -118.487 bonds (distance) P-C4' energy: -133.305 flat angles C4'-P-C4' energy: -128.491 flat angles P-C4'-P energy: -79.020 tors. eta vs tors. theta energy: -107.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1465.714677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.714677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.714677 (E_RNA) where: Base-Base interactions energy: -958.748 where: short stacking energy: -459.475 Base-Backbone interact. energy: 4.922 local terms energy: -511.888879 where: bonds (distance) C4'-P energy: -142.243 bonds (distance) P-C4' energy: -112.509 flat angles C4'-P-C4' energy: -106.563 flat angles P-C4'-P energy: -83.595 tors. eta vs tors. theta energy: -66.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -975.348682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.348682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.348682 (E_RNA) where: Base-Base interactions energy: -540.806 where: short stacking energy: -295.276 Base-Backbone interact. energy: -1.611 local terms energy: -432.931324 where: bonds (distance) C4'-P energy: -120.955 bonds (distance) P-C4' energy: -119.898 flat angles C4'-P-C4' energy: -106.387 flat angles P-C4'-P energy: -75.080 tors. eta vs tors. theta energy: -10.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -2683.117334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2683.117334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2683.117334 (E_RNA) where: Base-Base interactions energy: -1873.007 where: short stacking energy: -821.108 Base-Backbone interact. energy: -1.688 local terms energy: -808.422708 where: bonds (distance) C4'-P energy: -148.431 bonds (distance) P-C4' energy: -140.918 flat angles C4'-P-C4' energy: -158.418 flat angles P-C4'-P energy: -124.442 tors. eta vs tors. theta energy: -236.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -2525.936519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2525.936519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2525.936519 (E_RNA) where: Base-Base interactions energy: -1787.319 where: short stacking energy: -740.539 Base-Backbone interact. energy: 6.494 local terms energy: -745.111171 where: bonds (distance) C4'-P energy: -138.125 bonds (distance) P-C4' energy: -146.989 flat angles C4'-P-C4' energy: -170.783 flat angles P-C4'-P energy: -100.749 tors. eta vs tors. theta energy: -188.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -2373.220160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.220160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.220160 (E_RNA) where: Base-Base interactions energy: -1668.362 where: short stacking energy: -714.096 Base-Backbone interact. energy: -4.868 local terms energy: -699.990898 where: bonds (distance) C4'-P energy: -132.210 bonds (distance) P-C4' energy: -137.992 flat angles C4'-P-C4' energy: -152.459 flat angles P-C4'-P energy: -108.728 tors. eta vs tors. theta energy: -168.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -2289.720131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2289.720131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2289.720131 (E_RNA) where: Base-Base interactions energy: -1589.271 where: short stacking energy: -637.209 Base-Backbone interact. energy: -1.981 local terms energy: -698.468691 where: bonds (distance) C4'-P energy: -142.678 bonds (distance) P-C4' energy: -146.359 flat angles C4'-P-C4' energy: -154.039 flat angles P-C4'-P energy: -97.492 tors. eta vs tors. theta energy: -157.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -2218.620120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.620120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.620120 (E_RNA) where: Base-Base interactions energy: -1560.362 where: short stacking energy: -681.463 Base-Backbone interact. energy: -2.173 local terms energy: -656.084595 where: bonds (distance) C4'-P energy: -120.516 bonds (distance) P-C4' energy: -135.470 flat angles C4'-P-C4' energy: -150.772 flat angles P-C4'-P energy: -77.711 tors. eta vs tors. theta energy: -171.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1971.780600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.780600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.780600 (E_RNA) where: Base-Base interactions energy: -1326.725 where: short stacking energy: -586.797 Base-Backbone interact. energy: -2.628 local terms energy: -642.427413 where: bonds (distance) C4'-P energy: -130.805 bonds (distance) P-C4' energy: -126.207 flat angles C4'-P-C4' energy: -149.137 flat angles P-C4'-P energy: -104.486 tors. eta vs tors. theta energy: -131.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1729.480948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1729.480948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.480948 (E_RNA) where: Base-Base interactions energy: -1143.917 where: short stacking energy: -530.797 Base-Backbone interact. energy: -3.382 local terms energy: -582.181927 where: bonds (distance) C4'-P energy: -123.421 bonds (distance) P-C4' energy: -117.131 flat angles C4'-P-C4' energy: -132.809 flat angles P-C4'-P energy: -93.712 tors. eta vs tors. theta energy: -115.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1617.348322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.348322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.348322 (E_RNA) where: Base-Base interactions energy: -1023.346 where: short stacking energy: -498.717 Base-Backbone interact. energy: 2.384 local terms energy: -596.386291 where: bonds (distance) C4'-P energy: -127.423 bonds (distance) P-C4' energy: -142.048 flat angles C4'-P-C4' energy: -136.035 flat angles P-C4'-P energy: -85.345 tors. eta vs tors. theta energy: -105.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1402.025052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.025052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.025052 (E_RNA) where: Base-Base interactions energy: -899.318 where: short stacking energy: -394.656 Base-Backbone interact. energy: -0.616 local terms energy: -502.090523 where: bonds (distance) C4'-P energy: -128.705 bonds (distance) P-C4' energy: -139.160 flat angles C4'-P-C4' energy: -98.179 flat angles P-C4'-P energy: -78.046 tors. eta vs tors. theta energy: -58.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -1063.607267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.607267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.607267 (E_RNA) where: Base-Base interactions energy: -641.519 where: short stacking energy: -316.680 Base-Backbone interact. energy: -1.437 local terms energy: -420.651271 where: bonds (distance) C4'-P energy: -110.320 bonds (distance) P-C4' energy: -116.700 flat angles C4'-P-C4' energy: -119.569 flat angles P-C4'-P energy: -46.707 tors. eta vs tors. theta energy: -27.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -2679.490556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2679.490556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2679.490556 (E_RNA) where: Base-Base interactions energy: -1888.439 where: short stacking energy: -830.975 Base-Backbone interact. energy: -4.938 local terms energy: -786.113976 where: bonds (distance) C4'-P energy: -124.008 bonds (distance) P-C4' energy: -152.196 flat angles C4'-P-C4' energy: -171.194 flat angles P-C4'-P energy: -114.501 tors. eta vs tors. theta energy: -224.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -2534.726451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2534.726451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.726451 (E_RNA) where: Base-Base interactions energy: -1790.381 where: short stacking energy: -766.217 Base-Backbone interact. energy: -2.307 local terms energy: -742.038891 where: bonds (distance) C4'-P energy: -132.977 bonds (distance) P-C4' energy: -133.385 flat angles C4'-P-C4' energy: -178.300 flat angles P-C4'-P energy: -107.771 tors. eta vs tors. theta energy: -189.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -2375.109596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2375.109596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2375.109596 (E_RNA) where: Base-Base interactions energy: -1639.460 where: short stacking energy: -694.337 Base-Backbone interact. energy: -3.592 local terms energy: -732.057857 where: bonds (distance) C4'-P energy: -150.994 bonds (distance) P-C4' energy: -148.247 flat angles C4'-P-C4' energy: -164.961 flat angles P-C4'-P energy: -114.475 tors. eta vs tors. theta energy: -153.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -2251.432102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.432102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.432102 (E_RNA) where: Base-Base interactions energy: -1593.848 where: short stacking energy: -678.720 Base-Backbone interact. energy: -2.148 local terms energy: -655.436243 where: bonds (distance) C4'-P energy: -120.659 bonds (distance) P-C4' energy: -131.003 flat angles C4'-P-C4' energy: -141.559 flat angles P-C4'-P energy: -97.469 tors. eta vs tors. theta energy: -164.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -2181.552918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.552918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.552918 (E_RNA) where: Base-Base interactions energy: -1476.651 where: short stacking energy: -668.026 Base-Backbone interact. energy: -1.951 local terms energy: -702.950619 where: bonds (distance) C4'-P energy: -134.569 bonds (distance) P-C4' energy: -140.511 flat angles C4'-P-C4' energy: -147.794 flat angles P-C4'-P energy: -105.169 tors. eta vs tors. theta energy: -174.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -2018.802033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2018.802033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2018.802033 (E_RNA) where: Base-Base interactions energy: -1393.731 where: short stacking energy: -611.183 Base-Backbone interact. energy: 6.187 local terms energy: -631.257658 where: bonds (distance) C4'-P energy: -125.133 bonds (distance) P-C4' energy: -134.514 flat angles C4'-P-C4' energy: -155.546 flat angles P-C4'-P energy: -92.071 tors. eta vs tors. theta energy: -123.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1775.579945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1775.579945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1775.579945 (E_RNA) where: Base-Base interactions energy: -1190.650 where: short stacking energy: -562.152 Base-Backbone interact. energy: 2.150 local terms energy: -587.080050 where: bonds (distance) C4'-P energy: -120.552 bonds (distance) P-C4' energy: -133.683 flat angles C4'-P-C4' energy: -139.938 flat angles P-C4'-P energy: -76.503 tors. eta vs tors. theta energy: -116.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1668.861323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.861323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.861323 (E_RNA) where: Base-Base interactions energy: -1076.465 where: short stacking energy: -518.256 Base-Backbone interact. energy: -2.987 local terms energy: -589.409443 where: bonds (distance) C4'-P energy: -132.883 bonds (distance) P-C4' energy: -132.253 flat angles C4'-P-C4' energy: -131.016 flat angles P-C4'-P energy: -84.057 tors. eta vs tors. theta energy: -109.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1368.824344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.824344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.824344 (E_RNA) where: Base-Base interactions energy: -877.038 where: short stacking energy: -408.141 Base-Backbone interact. energy: -2.025 local terms energy: -489.761208 where: bonds (distance) C4'-P energy: -131.475 bonds (distance) P-C4' energy: -113.985 flat angles C4'-P-C4' energy: -116.355 flat angles P-C4'-P energy: -65.533 tors. eta vs tors. theta energy: -62.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -1095.397262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.397262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.397262 (E_RNA) where: Base-Base interactions energy: -656.951 where: short stacking energy: -339.981 Base-Backbone interact. energy: -1.399 local terms energy: -437.047899 where: bonds (distance) C4'-P energy: -107.186 bonds (distance) P-C4' energy: -121.901 flat angles C4'-P-C4' energy: -113.719 flat angles P-C4'-P energy: -55.023 tors. eta vs tors. theta energy: -39.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -2709.326745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2709.326745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2709.326745 (E_RNA) where: Base-Base interactions energy: -1913.322 where: short stacking energy: -867.303 Base-Backbone interact. energy: -0.230 local terms energy: -795.774406 where: bonds (distance) C4'-P energy: -148.571 bonds (distance) P-C4' energy: -139.129 flat angles C4'-P-C4' energy: -163.575 flat angles P-C4'-P energy: -108.443 tors. eta vs tors. theta energy: -236.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -2536.196358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2536.196358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2536.196358 (E_RNA) where: Base-Base interactions energy: -1782.798 where: short stacking energy: -749.850 Base-Backbone interact. energy: 2.975 local terms energy: -756.373251 where: bonds (distance) C4'-P energy: -145.858 bonds (distance) P-C4' energy: -143.243 flat angles C4'-P-C4' energy: -167.608 flat angles P-C4'-P energy: -101.742 tors. eta vs tors. theta energy: -197.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -2432.310176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2432.310176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2432.310176 (E_RNA) where: Base-Base interactions energy: -1694.405 where: short stacking energy: -731.990 Base-Backbone interact. energy: -2.218 local terms energy: -735.688089 where: bonds (distance) C4'-P energy: -153.992 bonds (distance) P-C4' energy: -142.532 flat angles C4'-P-C4' energy: -158.457 flat angles P-C4'-P energy: -96.973 tors. eta vs tors. theta energy: -183.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -2254.084591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2254.084591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2254.084591 (E_RNA) where: Base-Base interactions energy: -1561.182 where: short stacking energy: -660.018 Base-Backbone interact. energy: -1.117 local terms energy: -691.784682 where: bonds (distance) C4'-P energy: -134.114 bonds (distance) P-C4' energy: -146.585 flat angles C4'-P-C4' energy: -152.119 flat angles P-C4'-P energy: -102.764 tors. eta vs tors. theta energy: -156.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -2128.682491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.682491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.682491 (E_RNA) where: Base-Base interactions energy: -1429.974 where: short stacking energy: -624.728 Base-Backbone interact. energy: 0.695 local terms energy: -699.403620 where: bonds (distance) C4'-P energy: -127.954 bonds (distance) P-C4' energy: -151.268 flat angles C4'-P-C4' energy: -163.989 flat angles P-C4'-P energy: -92.323 tors. eta vs tors. theta energy: -163.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -2044.453026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2044.453026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2044.453026 (E_RNA) where: Base-Base interactions energy: -1415.061 where: short stacking energy: -614.173 Base-Backbone interact. energy: -3.038 local terms energy: -626.353907 where: bonds (distance) C4'-P energy: -99.420 bonds (distance) P-C4' energy: -137.623 flat angles C4'-P-C4' energy: -147.236 flat angles P-C4'-P energy: -99.388 tors. eta vs tors. theta energy: -142.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1819.404742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1819.404742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1819.404742 (E_RNA) where: Base-Base interactions energy: -1213.428 where: short stacking energy: -564.298 Base-Backbone interact. energy: 1.782 local terms energy: -607.758248 where: bonds (distance) C4'-P energy: -128.613 bonds (distance) P-C4' energy: -128.991 flat angles C4'-P-C4' energy: -140.041 flat angles P-C4'-P energy: -79.341 tors. eta vs tors. theta energy: -130.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -1615.163036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.163036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.163036 (E_RNA) where: Base-Base interactions energy: -1079.987 where: short stacking energy: -515.392 Base-Backbone interact. energy: -2.819 local terms energy: -532.357333 where: bonds (distance) C4'-P energy: -104.677 bonds (distance) P-C4' energy: -127.806 flat angles C4'-P-C4' energy: -110.161 flat angles P-C4'-P energy: -76.154 tors. eta vs tors. theta energy: -113.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -1404.656402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.656402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.656402 (E_RNA) where: Base-Base interactions energy: -900.098 where: short stacking energy: -423.062 Base-Backbone interact. energy: 8.859 local terms energy: -513.417651 where: bonds (distance) C4'-P energy: -106.091 bonds (distance) P-C4' energy: -135.360 flat angles C4'-P-C4' energy: -122.441 flat angles P-C4'-P energy: -85.438 tors. eta vs tors. theta energy: -64.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -1134.562010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.562010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.562010 (E_RNA) where: Base-Base interactions energy: -689.424 where: short stacking energy: -351.013 Base-Backbone interact. energy: 1.689 local terms energy: -446.826623 where: bonds (distance) C4'-P energy: -118.993 bonds (distance) P-C4' energy: -132.905 flat angles C4'-P-C4' energy: -121.967 flat angles P-C4'-P energy: -49.229 tors. eta vs tors. theta energy: -23.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -2687.166886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2687.166886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2687.166886 (E_RNA) where: Base-Base interactions energy: -1866.901 where: short stacking energy: -820.815 Base-Backbone interact. energy: -2.891 local terms energy: -817.374980 where: bonds (distance) C4'-P energy: -148.044 bonds (distance) P-C4' energy: -152.264 flat angles C4'-P-C4' energy: -174.992 flat angles P-C4'-P energy: -110.516 tors. eta vs tors. theta energy: -231.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -2548.294123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2548.294123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2548.294123 (E_RNA) where: Base-Base interactions energy: -1784.524 where: short stacking energy: -775.403 Base-Backbone interact. energy: -3.088 local terms energy: -760.681545 where: bonds (distance) C4'-P energy: -141.437 bonds (distance) P-C4' energy: -154.453 flat angles C4'-P-C4' energy: -168.878 flat angles P-C4'-P energy: -105.934 tors. eta vs tors. theta energy: -189.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -2391.025922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2391.025922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2391.025922 (E_RNA) where: Base-Base interactions energy: -1673.426 where: short stacking energy: -708.116 Base-Backbone interact. energy: 6.457 local terms energy: -724.057336 where: bonds (distance) C4'-P energy: -153.745 bonds (distance) P-C4' energy: -131.291 flat angles C4'-P-C4' energy: -169.309 flat angles P-C4'-P energy: -105.677 tors. eta vs tors. theta energy: -164.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -2277.841426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2277.841426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2277.841426 (E_RNA) where: Base-Base interactions energy: -1602.914 where: short stacking energy: -670.760 Base-Backbone interact. energy: -3.387 local terms energy: -671.540686 where: bonds (distance) C4'-P energy: -108.741 bonds (distance) P-C4' energy: -154.812 flat angles C4'-P-C4' energy: -135.896 flat angles P-C4'-P energy: -99.978 tors. eta vs tors. theta energy: -172.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -2183.722591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.722591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.722591 (E_RNA) where: Base-Base interactions energy: -1491.496 where: short stacking energy: -665.279 Base-Backbone interact. energy: -2.550 local terms energy: -689.677015 where: bonds (distance) C4'-P energy: -124.177 bonds (distance) P-C4' energy: -136.603 flat angles C4'-P-C4' energy: -154.443 flat angles P-C4'-P energy: -96.510 tors. eta vs tors. theta energy: -177.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -2045.794570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2045.794570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2045.794570 (E_RNA) where: Base-Base interactions energy: -1365.252 where: short stacking energy: -608.776 Base-Backbone interact. energy: -3.127 local terms energy: -677.415088 where: bonds (distance) C4'-P energy: -142.368 bonds (distance) P-C4' energy: -150.695 flat angles C4'-P-C4' energy: -132.008 flat angles P-C4'-P energy: -101.452 tors. eta vs tors. theta energy: -150.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1796.803271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1796.803271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1796.803271 (E_RNA) where: Base-Base interactions energy: -1173.336 where: short stacking energy: -552.941 Base-Backbone interact. energy: -0.689 local terms energy: -622.778210 where: bonds (distance) C4'-P energy: -135.069 bonds (distance) P-C4' energy: -123.332 flat angles C4'-P-C4' energy: -150.620 flat angles P-C4'-P energy: -94.863 tors. eta vs tors. theta energy: -118.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1583.359128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.359128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.359128 (E_RNA) where: Base-Base interactions energy: -1044.932 where: short stacking energy: -486.511 Base-Backbone interact. energy: 0.176 local terms energy: -538.603295 where: bonds (distance) C4'-P energy: -117.752 bonds (distance) P-C4' energy: -113.896 flat angles C4'-P-C4' energy: -135.789 flat angles P-C4'-P energy: -69.661 tors. eta vs tors. theta energy: -101.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -1424.244803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.244803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.244803 (E_RNA) where: Base-Base interactions energy: -899.204 where: short stacking energy: -432.526 Base-Backbone interact. energy: -1.530 local terms energy: -523.510075 where: bonds (distance) C4'-P energy: -125.581 bonds (distance) P-C4' energy: -111.165 flat angles C4'-P-C4' energy: -139.813 flat angles P-C4'-P energy: -72.382 tors. eta vs tors. theta energy: -74.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -1117.828185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.828185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.828185 (E_RNA) where: Base-Base interactions energy: -663.451 where: short stacking energy: -315.760 Base-Backbone interact. energy: 0.209 local terms energy: -454.585883 where: bonds (distance) C4'-P energy: -132.652 bonds (distance) P-C4' energy: -135.029 flat angles C4'-P-C4' energy: -96.566 flat angles P-C4'-P energy: -62.154 tors. eta vs tors. theta energy: -28.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -2656.188241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2656.188241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2656.188241 (E_RNA) where: Base-Base interactions energy: -1864.844 where: short stacking energy: -815.830 Base-Backbone interact. energy: -3.711 local terms energy: -787.632828 where: bonds (distance) C4'-P energy: -149.932 bonds (distance) P-C4' energy: -150.369 flat angles C4'-P-C4' energy: -162.785 flat angles P-C4'-P energy: -89.158 tors. eta vs tors. theta energy: -235.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -2534.542108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2534.542108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.542108 (E_RNA) where: Base-Base interactions energy: -1746.710 where: short stacking energy: -767.707 Base-Backbone interact. energy: 0.172 local terms energy: -788.004272 where: bonds (distance) C4'-P energy: -151.112 bonds (distance) P-C4' energy: -158.818 flat angles C4'-P-C4' energy: -173.092 flat angles P-C4'-P energy: -106.744 tors. eta vs tors. theta energy: -198.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -2381.468711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2381.468711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.468711 (E_RNA) where: Base-Base interactions energy: -1676.255 where: short stacking energy: -745.190 Base-Backbone interact. energy: -1.319 local terms energy: -703.895073 where: bonds (distance) C4'-P energy: -133.715 bonds (distance) P-C4' energy: -140.856 flat angles C4'-P-C4' energy: -154.512 flat angles P-C4'-P energy: -90.944 tors. eta vs tors. theta energy: -183.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -2310.046972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2310.046972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2310.046972 (E_RNA) where: Base-Base interactions energy: -1615.143 where: short stacking energy: -688.327 Base-Backbone interact. energy: 1.392 local terms energy: -696.295701 where: bonds (distance) C4'-P energy: -139.030 bonds (distance) P-C4' energy: -147.667 flat angles C4'-P-C4' energy: -146.476 flat angles P-C4'-P energy: -90.816 tors. eta vs tors. theta energy: -172.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -2203.445855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2203.445855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2203.445855 (E_RNA) where: Base-Base interactions energy: -1494.891 where: short stacking energy: -692.709 Base-Backbone interact. energy: -5.010 local terms energy: -703.544352 where: bonds (distance) C4'-P energy: -121.588 bonds (distance) P-C4' energy: -139.088 flat angles C4'-P-C4' energy: -156.305 flat angles P-C4'-P energy: -106.390 tors. eta vs tors. theta energy: -180.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -2026.782969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2026.782969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2026.782969 (E_RNA) where: Base-Base interactions energy: -1371.906 where: short stacking energy: -595.936 Base-Backbone interact. energy: -0.096 local terms energy: -654.780305 where: bonds (distance) C4'-P energy: -130.972 bonds (distance) P-C4' energy: -141.478 flat angles C4'-P-C4' energy: -148.456 flat angles P-C4'-P energy: -104.731 tors. eta vs tors. theta energy: -129.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -1791.358144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1791.358144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1791.358144 (E_RNA) where: Base-Base interactions energy: -1212.220 where: short stacking energy: -556.981 Base-Backbone interact. energy: 2.153 local terms energy: -581.291408 where: bonds (distance) C4'-P energy: -115.407 bonds (distance) P-C4' energy: -135.161 flat angles C4'-P-C4' energy: -129.510 flat angles P-C4'-P energy: -74.123 tors. eta vs tors. theta energy: -127.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -1626.546538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.546538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.546538 (E_RNA) where: Base-Base interactions energy: -1064.082 where: short stacking energy: -481.524 Base-Backbone interact. energy: 0.200 local terms energy: -562.664386 where: bonds (distance) C4'-P energy: -119.320 bonds (distance) P-C4' energy: -130.796 flat angles C4'-P-C4' energy: -140.641 flat angles P-C4'-P energy: -88.344 tors. eta vs tors. theta energy: -83.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -1446.021594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.021594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.021594 (E_RNA) where: Base-Base interactions energy: -948.346 where: short stacking energy: -451.111 Base-Backbone interact. energy: -3.961 local terms energy: -493.714146 where: bonds (distance) C4'-P energy: -102.295 bonds (distance) P-C4' energy: -120.235 flat angles C4'-P-C4' energy: -135.917 flat angles P-C4'-P energy: -58.871 tors. eta vs tors. theta energy: -76.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -1223.425157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.425157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.425157 (E_RNA) where: Base-Base interactions energy: -739.748 where: short stacking energy: -342.448 Base-Backbone interact. energy: 0.083 local terms energy: -483.760010 where: bonds (distance) C4'-P energy: -109.574 bonds (distance) P-C4' energy: -111.327 flat angles C4'-P-C4' energy: -128.021 flat angles P-C4'-P energy: -89.496 tors. eta vs tors. theta energy: -45.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -2689.898598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2689.898598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2689.898598 (E_RNA) where: Base-Base interactions energy: -1879.375 where: short stacking energy: -824.650 Base-Backbone interact. energy: -2.533 local terms energy: -807.990696 where: bonds (distance) C4'-P energy: -153.802 bonds (distance) P-C4' energy: -149.124 flat angles C4'-P-C4' energy: -177.890 flat angles P-C4'-P energy: -110.298 tors. eta vs tors. theta energy: -216.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -2606.173761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2606.173761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2606.173761 (E_RNA) where: Base-Base interactions energy: -1834.410 where: short stacking energy: -782.761 Base-Backbone interact. energy: 1.987 local terms energy: -773.751354 where: bonds (distance) C4'-P energy: -145.376 bonds (distance) P-C4' energy: -140.814 flat angles C4'-P-C4' energy: -170.731 flat angles P-C4'-P energy: -117.458 tors. eta vs tors. theta energy: -199.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -2387.132293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2387.132293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2387.132293 (E_RNA) where: Base-Base interactions energy: -1642.120 where: short stacking energy: -700.930 Base-Backbone interact. energy: -2.256 local terms energy: -742.755921 where: bonds (distance) C4'-P energy: -148.736 bonds (distance) P-C4' energy: -149.901 flat angles C4'-P-C4' energy: -163.195 flat angles P-C4'-P energy: -105.270 tors. eta vs tors. theta energy: -175.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -2301.328090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.328090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.328090 (E_RNA) where: Base-Base interactions energy: -1609.379 where: short stacking energy: -665.125 Base-Backbone interact. energy: -5.124 local terms energy: -686.824838 where: bonds (distance) C4'-P energy: -146.077 bonds (distance) P-C4' energy: -141.436 flat angles C4'-P-C4' energy: -160.421 flat angles P-C4'-P energy: -88.324 tors. eta vs tors. theta energy: -150.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -2200.260529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2200.260529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.260529 (E_RNA) where: Base-Base interactions energy: -1504.679 where: short stacking energy: -665.791 Base-Backbone interact. energy: -1.595 local terms energy: -693.986281 where: bonds (distance) C4'-P energy: -136.796 bonds (distance) P-C4' energy: -145.579 flat angles C4'-P-C4' energy: -157.913 flat angles P-C4'-P energy: -98.967 tors. eta vs tors. theta energy: -154.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -2046.104947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.104947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2046.104947 (E_RNA) where: Base-Base interactions energy: -1402.327 where: short stacking energy: -631.268 Base-Backbone interact. energy: -0.141 local terms energy: -643.636483 where: bonds (distance) C4'-P energy: -115.579 bonds (distance) P-C4' energy: -131.300 flat angles C4'-P-C4' energy: -143.869 flat angles P-C4'-P energy: -107.329 tors. eta vs tors. theta energy: -145.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1817.776765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1817.776765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1817.776765 (E_RNA) where: Base-Base interactions energy: -1190.171 where: short stacking energy: -570.922 Base-Backbone interact. energy: -4.163 local terms energy: -623.443325 where: bonds (distance) C4'-P energy: -118.218 bonds (distance) P-C4' energy: -136.254 flat angles C4'-P-C4' energy: -139.692 flat angles P-C4'-P energy: -94.835 tors. eta vs tors. theta energy: -134.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1677.011202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.011202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.011202 (E_RNA) where: Base-Base interactions energy: -1122.392 where: short stacking energy: -563.068 Base-Backbone interact. energy: -0.196 local terms energy: -554.423401 where: bonds (distance) C4'-P energy: -103.380 bonds (distance) P-C4' energy: -124.969 flat angles C4'-P-C4' energy: -122.488 flat angles P-C4'-P energy: -80.241 tors. eta vs tors. theta energy: -123.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1447.903712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.903712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.903712 (E_RNA) where: Base-Base interactions energy: -883.656 where: short stacking energy: -406.808 Base-Backbone interact. energy: -1.984 local terms energy: -562.263887 where: bonds (distance) C4'-P energy: -132.967 bonds (distance) P-C4' energy: -145.766 flat angles C4'-P-C4' energy: -138.797 flat angles P-C4'-P energy: -85.777 tors. eta vs tors. theta energy: -58.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -1293.656244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.656244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.656244 (E_RNA) where: Base-Base interactions energy: -842.502 where: short stacking energy: -403.670 Base-Backbone interact. energy: -2.199 local terms energy: -448.955630 where: bonds (distance) C4'-P energy: -113.827 bonds (distance) P-C4' energy: -99.001 flat angles C4'-P-C4' energy: -105.396 flat angles P-C4'-P energy: -65.326 tors. eta vs tors. theta energy: -65.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -2725.886921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2725.886921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2725.886921 (E_RNA) where: Base-Base interactions energy: -1884.724 where: short stacking energy: -819.208 Base-Backbone interact. energy: -4.405 local terms energy: -836.758004 where: bonds (distance) C4'-P energy: -157.141 bonds (distance) P-C4' energy: -164.039 flat angles C4'-P-C4' energy: -169.278 flat angles P-C4'-P energy: -114.354 tors. eta vs tors. theta energy: -231.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -2628.377894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2628.377894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2628.377894 (E_RNA) where: Base-Base interactions energy: -1841.904 where: short stacking energy: -775.281 Base-Backbone interact. energy: -2.655 local terms energy: -783.818258 where: bonds (distance) C4'-P energy: -146.791 bonds (distance) P-C4' energy: -147.310 flat angles C4'-P-C4' energy: -166.337 flat angles P-C4'-P energy: -113.670 tors. eta vs tors. theta energy: -209.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -2352.254146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2352.254146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2352.254146 (E_RNA) where: Base-Base interactions energy: -1625.074 where: short stacking energy: -712.206 Base-Backbone interact. energy: -4.281 local terms energy: -722.899006 where: bonds (distance) C4'-P energy: -141.842 bonds (distance) P-C4' energy: -158.057 flat angles C4'-P-C4' energy: -161.606 flat angles P-C4'-P energy: -100.798 tors. eta vs tors. theta energy: -160.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -2352.649058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2352.649058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2352.649058 (E_RNA) where: Base-Base interactions energy: -1668.017 where: short stacking energy: -689.420 Base-Backbone interact. energy: -3.331 local terms energy: -681.300782 where: bonds (distance) C4'-P energy: -122.745 bonds (distance) P-C4' energy: -136.977 flat angles C4'-P-C4' energy: -151.139 flat angles P-C4'-P energy: -103.885 tors. eta vs tors. theta energy: -166.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -2178.052671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2178.052671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2178.052671 (E_RNA) where: Base-Base interactions energy: -1461.587 where: short stacking energy: -665.389 Base-Backbone interact. energy: -2.127 local terms energy: -714.338334 where: bonds (distance) C4'-P energy: -132.930 bonds (distance) P-C4' energy: -165.677 flat angles C4'-P-C4' energy: -146.490 flat angles P-C4'-P energy: -99.426 tors. eta vs tors. theta energy: -169.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -2015.960566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.960566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.960566 (E_RNA) where: Base-Base interactions energy: -1340.509 where: short stacking energy: -613.643 Base-Backbone interact. energy: -1.698 local terms energy: -673.753640 where: bonds (distance) C4'-P energy: -126.483 bonds (distance) P-C4' energy: -140.118 flat angles C4'-P-C4' energy: -164.373 flat angles P-C4'-P energy: -97.327 tors. eta vs tors. theta energy: -145.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1824.500974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.500974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.500974 (E_RNA) where: Base-Base interactions energy: -1189.037 where: short stacking energy: -575.450 Base-Backbone interact. energy: -2.247 local terms energy: -633.217877 where: bonds (distance) C4'-P energy: -152.564 bonds (distance) P-C4' energy: -122.213 flat angles C4'-P-C4' energy: -143.448 flat angles P-C4'-P energy: -81.562 tors. eta vs tors. theta energy: -133.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1619.721030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.721030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.721030 (E_RNA) where: Base-Base interactions energy: -1045.898 where: short stacking energy: -513.834 Base-Backbone interact. energy: -0.067 local terms energy: -573.756138 where: bonds (distance) C4'-P energy: -132.752 bonds (distance) P-C4' energy: -126.164 flat angles C4'-P-C4' energy: -130.233 flat angles P-C4'-P energy: -77.144 tors. eta vs tors. theta energy: -107.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -1464.846116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.846116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.846116 (E_RNA) where: Base-Base interactions energy: -974.835 where: short stacking energy: -449.845 Base-Backbone interact. energy: -0.980 local terms energy: -489.031108 where: bonds (distance) C4'-P energy: -120.612 bonds (distance) P-C4' energy: -104.419 flat angles C4'-P-C4' energy: -96.096 flat angles P-C4'-P energy: -87.831 tors. eta vs tors. theta energy: -80.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -1248.292481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.292481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.292481 (E_RNA) where: Base-Base interactions energy: -809.006 where: short stacking energy: -387.197 Base-Backbone interact. energy: 4.302 local terms energy: -443.587965 where: bonds (distance) C4'-P energy: -110.266 bonds (distance) P-C4' energy: -122.860 flat angles C4'-P-C4' energy: -104.878 flat angles P-C4'-P energy: -72.284 tors. eta vs tors. theta energy: -33.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 9 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 30511957 moves confirmed later: 34544188 all moves confirmed: 65056145 percent of confirmed moves: 40.660091 current total energy: -2609.143028 recalc. total energy: -2609.143028 replica 7 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 28649968 moves confirmed later: 32059994 all moves confirmed: 60709962 percent of confirmed moves: 37.943726 current total energy: -2519.842382 recalc. total energy: -2519.842382 replica 8 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 31114736 moves confirmed later: 35510119 all moves confirmed: 66624855 percent of confirmed moves: 41.640534 current total energy: -2273.374269 recalc. total energy: -2273.374269 replica 5 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 34294725 moves confirmed later: 39592990 all moves confirmed: 73887715 percent of confirmed moves: 46.179822 current total energy: -2203.687555 recalc. total energy: -2203.687555 replica 6 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 31786900 moves confirmed later: 36171856 all moves confirmed: 67958756 percent of confirmed moves: 42.474223 current total energy: -2109.699565 recalc. total energy: -2109.699565 replica 2 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 38049420 moves confirmed later: 44337420 all moves confirmed: 82386840 percent of confirmed moves: 51.491775 current total energy: -1901.532419 recalc. total energy: -1901.532419 replica 4 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 35313113 moves confirmed later: 40570923 all moves confirmed: 75884036 percent of confirmed moves: 47.427523 current total energy: -1648.102419 recalc. total energy: -1648.102419 replica 10 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 46556356 moves confirmed later: 55698807 all moves confirmed: 102255163 percent of confirmed moves: 63.909477 current total energy: -1438.448769 recalc. total energy: -1438.448769 replica 1 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 47698131 moves confirmed later: 56939933 all moves confirmed: 104638064 percent of confirmed moves: 65.398790 current total energy: -1305.025853 recalc. total energy: -1305.025853 replica 3 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 44150578 moves confirmed later: 52289468 all moves confirmed: 96440046 percent of confirmed moves: 60.275029 current total energy: -956.228352 recalc. total energy: -956.228352 out arg RESULTS//1/Tetraloop_10_steps-99840a20_01 Time of doing 1600000 iterations: 8345.407 seconds