SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-95138c1a/inputs/seq.fa: 1 curr_seq: _GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCAUCACACACCGAUACUCACCCGCCUGAUUAACAUUAGCCCACCGCCCACCCCCGCUGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 60 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 305 n_atoms_counter: 305 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _..........................((.....))...((.....))............._ nucl1: 27, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 26, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 39, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 38, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 46 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 60.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -141.868663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.868663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.584217 (E_RNA) where: Base-Base interactions energy: -3.738 where: short stacking energy: -3.738 Base-Backbone interact. energy: -0.000 local terms energy: -233.845829 where: bonds (distance) C4'-P energy: -58.295 bonds (distance) P-C4' energy: -54.574 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -50.392 tors. eta vs tors. theta energy: -26.531 Dist. restrs. and SS energy: 95.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -447.984641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.984641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.765745 (E_RNA) where: Base-Base interactions energy: -271.538 where: short stacking energy: -129.486 Base-Backbone interact. energy: -1.190 local terms energy: -178.038021 where: bonds (distance) C4'-P energy: -37.142 bonds (distance) P-C4' energy: -38.032 flat angles C4'-P-C4' energy: -44.177 flat angles P-C4'-P energy: -23.999 tors. eta vs tors. theta energy: -34.688 Dist. restrs. and SS energy: 2.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -364.398719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.398719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.857149 (E_RNA) where: Base-Base interactions energy: -192.664 where: short stacking energy: -135.017 Base-Backbone interact. energy: -0.360 local terms energy: -173.833045 where: bonds (distance) C4'-P energy: -37.802 bonds (distance) P-C4' energy: -42.705 flat angles C4'-P-C4' energy: -37.193 flat angles P-C4'-P energy: -24.384 tors. eta vs tors. theta energy: -31.749 Dist. restrs. and SS energy: 2.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -370.913267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.913267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.261792 (E_RNA) where: Base-Base interactions energy: -187.968 where: short stacking energy: -121.617 Base-Backbone interact. energy: -1.522 local terms energy: -181.772539 where: bonds (distance) C4'-P energy: -45.197 bonds (distance) P-C4' energy: -39.910 flat angles C4'-P-C4' energy: -41.764 flat angles P-C4'-P energy: -26.741 tors. eta vs tors. theta energy: -28.160 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -344.932044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.932044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.652220 (E_RNA) where: Base-Base interactions energy: -180.514 where: short stacking energy: -135.585 Base-Backbone interact. energy: -0.192 local terms energy: -168.946268 where: bonds (distance) C4'-P energy: -36.751 bonds (distance) P-C4' energy: -40.037 flat angles C4'-P-C4' energy: -41.278 flat angles P-C4'-P energy: -21.515 tors. eta vs tors. theta energy: -29.366 Dist. restrs. and SS energy: 4.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -304.299773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.299773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.379847 (E_RNA) where: Base-Base interactions energy: -161.611 where: short stacking energy: -96.275 Base-Backbone interact. energy: -0.583 local terms energy: -142.185996 where: bonds (distance) C4'-P energy: -34.684 bonds (distance) P-C4' energy: -31.255 flat angles C4'-P-C4' energy: -40.737 flat angles P-C4'-P energy: -20.279 tors. eta vs tors. theta energy: -15.232 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -305.519348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.519348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.671544 (E_RNA) where: Base-Base interactions energy: -150.901 where: short stacking energy: -95.620 Base-Backbone interact. energy: 0.806 local terms energy: -155.575998 where: bonds (distance) C4'-P energy: -37.530 bonds (distance) P-C4' energy: -38.840 flat angles C4'-P-C4' energy: -38.119 flat angles P-C4'-P energy: -22.893 tors. eta vs tors. theta energy: -18.194 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -257.758350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.758350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.350648 (E_RNA) where: Base-Base interactions energy: -134.453 where: short stacking energy: -71.938 Base-Backbone interact. energy: 2.078 local terms energy: -127.975833 where: bonds (distance) C4'-P energy: -33.183 bonds (distance) P-C4' energy: -36.212 flat angles C4'-P-C4' energy: -36.054 flat angles P-C4'-P energy: -17.901 tors. eta vs tors. theta energy: -4.626 Dist. restrs. and SS energy: 2.592 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -246.617665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.617665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.931647 (E_RNA) where: Base-Base interactions energy: -123.572 where: short stacking energy: -84.680 Base-Backbone interact. energy: -0.585 local terms energy: -123.774750 where: bonds (distance) C4'-P energy: -27.212 bonds (distance) P-C4' energy: -32.944 flat angles C4'-P-C4' energy: -29.438 flat angles P-C4'-P energy: -28.173 tors. eta vs tors. theta energy: -6.008 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -207.281975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.281975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.606696 (E_RNA) where: Base-Base interactions energy: -79.016 where: short stacking energy: -52.474 Base-Backbone interact. energy: 0.058 local terms energy: -130.648835 where: bonds (distance) C4'-P energy: -33.920 bonds (distance) P-C4' energy: -40.984 flat angles C4'-P-C4' energy: -32.707 flat angles P-C4'-P energy: -25.014 tors. eta vs tors. theta energy: 1.976 Dist. restrs. and SS energy: 2.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -215.450753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.450753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.538541 (E_RNA) where: Base-Base interactions energy: -105.363 where: short stacking energy: -63.670 Base-Backbone interact. energy: -2.214 local terms energy: -110.961057 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -42.018 flat angles C4'-P-C4' energy: -36.930 flat angles P-C4'-P energy: -10.027 tors. eta vs tors. theta energy: 2.479 Dist. restrs. and SS energy: 3.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -487.420777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.420777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.328797 (E_RNA) where: Base-Base interactions energy: -299.799 where: short stacking energy: -155.613 Base-Backbone interact. energy: -0.949 local terms energy: -187.581010 where: bonds (distance) C4'-P energy: -43.108 bonds (distance) P-C4' energy: -44.015 flat angles C4'-P-C4' energy: -40.145 flat angles P-C4'-P energy: -19.081 tors. eta vs tors. theta energy: -41.232 Dist. restrs. and SS energy: 0.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -377.116587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.116587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.588557 (E_RNA) where: Base-Base interactions energy: -204.483 where: short stacking energy: -128.705 Base-Backbone interact. energy: -0.182 local terms energy: -172.923950 where: bonds (distance) C4'-P energy: -40.732 bonds (distance) P-C4' energy: -41.260 flat angles C4'-P-C4' energy: -37.428 flat angles P-C4'-P energy: -26.203 tors. eta vs tors. theta energy: -27.300 Dist. restrs. and SS energy: 0.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -349.708970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.708970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.767708 (E_RNA) where: Base-Base interactions energy: -190.393 where: short stacking energy: -130.550 Base-Backbone interact. energy: 0.029 local terms energy: -159.404349 where: bonds (distance) C4'-P energy: -34.893 bonds (distance) P-C4' energy: -39.744 flat angles C4'-P-C4' energy: -32.142 flat angles P-C4'-P energy: -21.931 tors. eta vs tors. theta energy: -30.695 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -397.688035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.688035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.743807 (E_RNA) where: Base-Base interactions energy: -236.720 where: short stacking energy: -111.147 Base-Backbone interact. energy: -0.472 local terms energy: -160.552103 where: bonds (distance) C4'-P energy: -34.371 bonds (distance) P-C4' energy: -40.616 flat angles C4'-P-C4' energy: -35.768 flat angles P-C4'-P energy: -22.557 tors. eta vs tors. theta energy: -27.240 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -332.290192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.290192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.408044 (E_RNA) where: Base-Base interactions energy: -185.064 where: short stacking energy: -123.205 Base-Backbone interact. energy: -0.696 local terms energy: -149.647883 where: bonds (distance) C4'-P energy: -30.914 bonds (distance) P-C4' energy: -39.472 flat angles C4'-P-C4' energy: -26.668 flat angles P-C4'-P energy: -27.021 tors. eta vs tors. theta energy: -25.571 Dist. restrs. and SS energy: 3.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -299.322422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.322422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.323188 (E_RNA) where: Base-Base interactions energy: -164.143 where: short stacking energy: -100.576 Base-Backbone interact. energy: -0.522 local terms energy: -135.658613 where: bonds (distance) C4'-P energy: -34.344 bonds (distance) P-C4' energy: -36.015 flat angles C4'-P-C4' energy: -36.733 flat angles P-C4'-P energy: -20.033 tors. eta vs tors. theta energy: -8.532 Dist. restrs. and SS energy: 1.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -264.052981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.052981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.990380 (E_RNA) where: Base-Base interactions energy: -128.799 where: short stacking energy: -81.515 Base-Backbone interact. energy: -1.027 local terms energy: -135.163970 where: bonds (distance) C4'-P energy: -30.623 bonds (distance) P-C4' energy: -39.271 flat angles C4'-P-C4' energy: -33.508 flat angles P-C4'-P energy: -19.832 tors. eta vs tors. theta energy: -11.930 Dist. restrs. and SS energy: 0.937 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -244.704272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.704272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.245255 (E_RNA) where: Base-Base interactions energy: -113.611 where: short stacking energy: -76.544 Base-Backbone interact. energy: -1.359 local terms energy: -131.274542 where: bonds (distance) C4'-P energy: -33.461 bonds (distance) P-C4' energy: -35.968 flat angles C4'-P-C4' energy: -24.872 flat angles P-C4'-P energy: -22.348 tors. eta vs tors. theta energy: -14.625 Dist. restrs. and SS energy: 1.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -248.837128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.837128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.399792 (E_RNA) where: Base-Base interactions energy: -120.100 where: short stacking energy: -70.798 Base-Backbone interact. energy: -0.724 local terms energy: -128.576560 where: bonds (distance) C4'-P energy: -37.711 bonds (distance) P-C4' energy: -31.473 flat angles C4'-P-C4' energy: -32.948 flat angles P-C4'-P energy: -14.988 tors. eta vs tors. theta energy: -11.456 Dist. restrs. and SS energy: 0.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -238.369814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.369814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.552083 (E_RNA) where: Base-Base interactions energy: -125.177 where: short stacking energy: -69.156 Base-Backbone interact. energy: 0.665 local terms energy: -115.040266 where: bonds (distance) C4'-P energy: -30.614 bonds (distance) P-C4' energy: -29.972 flat angles C4'-P-C4' energy: -27.538 flat angles P-C4'-P energy: -19.373 tors. eta vs tors. theta energy: -7.544 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -512.245619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.245619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.609122 (E_RNA) where: Base-Base interactions energy: -311.282 where: short stacking energy: -166.201 Base-Backbone interact. energy: -1.736 local terms energy: -200.590572 where: bonds (distance) C4'-P energy: -42.003 bonds (distance) P-C4' energy: -38.458 flat angles C4'-P-C4' energy: -42.586 flat angles P-C4'-P energy: -30.143 tors. eta vs tors. theta energy: -47.400 Dist. restrs. and SS energy: 1.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -376.056119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.056119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.459088 (E_RNA) where: Base-Base interactions energy: -213.554 where: short stacking energy: -140.420 Base-Backbone interact. energy: 1.135 local terms energy: -164.039933 where: bonds (distance) C4'-P energy: -38.873 bonds (distance) P-C4' energy: -39.396 flat angles C4'-P-C4' energy: -35.343 flat angles P-C4'-P energy: -23.730 tors. eta vs tors. theta energy: -26.698 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -469.420793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.420793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.490056 (E_RNA) where: Base-Base interactions energy: -296.494 where: short stacking energy: -140.245 Base-Backbone interact. energy: -3.878 local terms energy: -169.118129 where: bonds (distance) C4'-P energy: -28.041 bonds (distance) P-C4' energy: -39.013 flat angles C4'-P-C4' energy: -43.311 flat angles P-C4'-P energy: -20.687 tors. eta vs tors. theta energy: -38.065 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -360.241738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.241738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.328385 (E_RNA) where: Base-Base interactions energy: -198.840 where: short stacking energy: -125.490 Base-Backbone interact. energy: 0.718 local terms energy: -162.206437 where: bonds (distance) C4'-P energy: -39.039 bonds (distance) P-C4' energy: -42.568 flat angles C4'-P-C4' energy: -38.467 flat angles P-C4'-P energy: -16.785 tors. eta vs tors. theta energy: -25.348 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -341.637442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.637442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.005399 (E_RNA) where: Base-Base interactions energy: -181.578 where: short stacking energy: -120.005 Base-Backbone interact. energy: -1.010 local terms energy: -160.416590 where: bonds (distance) C4'-P energy: -41.598 bonds (distance) P-C4' energy: -38.535 flat angles C4'-P-C4' energy: -38.962 flat angles P-C4'-P energy: -18.825 tors. eta vs tors. theta energy: -22.496 Dist. restrs. and SS energy: 1.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -290.972706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.972706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.973213 (E_RNA) where: Base-Base interactions energy: -142.858 where: short stacking energy: -75.981 Base-Backbone interact. energy: -1.056 local terms energy: -147.059213 where: bonds (distance) C4'-P energy: -38.887 bonds (distance) P-C4' energy: -35.780 flat angles C4'-P-C4' energy: -39.831 flat angles P-C4'-P energy: -15.609 tors. eta vs tors. theta energy: -16.953 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -281.323247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.323247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.436232 (E_RNA) where: Base-Base interactions energy: -142.326 where: short stacking energy: -91.215 Base-Backbone interact. energy: 0.809 local terms energy: -139.919419 where: bonds (distance) C4'-P energy: -37.921 bonds (distance) P-C4' energy: -38.159 flat angles C4'-P-C4' energy: -31.487 flat angles P-C4'-P energy: -18.154 tors. eta vs tors. theta energy: -14.199 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -255.458044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.458044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.600671 (E_RNA) where: Base-Base interactions energy: -127.030 where: short stacking energy: -74.968 Base-Backbone interact. energy: -0.544 local terms energy: -128.026780 where: bonds (distance) C4'-P energy: -33.013 bonds (distance) P-C4' energy: -26.985 flat angles C4'-P-C4' energy: -36.161 flat angles P-C4'-P energy: -23.684 tors. eta vs tors. theta energy: -8.184 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -242.712796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.712796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.904283 (E_RNA) where: Base-Base interactions energy: -117.266 where: short stacking energy: -65.200 Base-Backbone interact. energy: 1.220 local terms energy: -126.858003 where: bonds (distance) C4'-P energy: -40.132 bonds (distance) P-C4' energy: -30.320 flat angles C4'-P-C4' energy: -30.718 flat angles P-C4'-P energy: -20.664 tors. eta vs tors. theta energy: -5.024 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -233.092382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.092382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.175259 (E_RNA) where: Base-Base interactions energy: -123.016 where: short stacking energy: -57.756 Base-Backbone interact. energy: 0.244 local terms energy: -110.403205 where: bonds (distance) C4'-P energy: -35.087 bonds (distance) P-C4' energy: -24.724 flat angles C4'-P-C4' energy: -29.046 flat angles P-C4'-P energy: -20.306 tors. eta vs tors. theta energy: -1.240 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -518.337252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.337252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.855244 (E_RNA) where: Base-Base interactions energy: -327.123 where: short stacking energy: -178.159 Base-Backbone interact. energy: -0.098 local terms energy: -192.633833 where: bonds (distance) C4'-P energy: -35.735 bonds (distance) P-C4' energy: -42.285 flat angles C4'-P-C4' energy: -37.559 flat angles P-C4'-P energy: -29.541 tors. eta vs tors. theta energy: -47.514 Dist. restrs. and SS energy: 1.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -464.161126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.161126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.898291 (E_RNA) where: Base-Base interactions energy: -279.306 where: short stacking energy: -135.933 Base-Backbone interact. energy: -0.563 local terms energy: -185.029933 where: bonds (distance) C4'-P energy: -32.477 bonds (distance) P-C4' energy: -44.727 flat angles C4'-P-C4' energy: -46.065 flat angles P-C4'-P energy: -26.417 tors. eta vs tors. theta energy: -35.344 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -376.152363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.152363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.961913 (E_RNA) where: Base-Base interactions energy: -211.543 where: short stacking energy: -129.043 Base-Backbone interact. energy: -0.733 local terms energy: -165.686320 where: bonds (distance) C4'-P energy: -35.813 bonds (distance) P-C4' energy: -41.179 flat angles C4'-P-C4' energy: -38.157 flat angles P-C4'-P energy: -25.168 tors. eta vs tors. theta energy: -25.369 Dist. restrs. and SS energy: 1.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -380.169657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.169657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.481023 (E_RNA) where: Base-Base interactions energy: -209.072 where: short stacking energy: -134.863 Base-Backbone interact. energy: -0.265 local terms energy: -171.143676 where: bonds (distance) C4'-P energy: -33.794 bonds (distance) P-C4' energy: -40.289 flat angles C4'-P-C4' energy: -31.411 flat angles P-C4'-P energy: -32.966 tors. eta vs tors. theta energy: -32.683 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -295.355949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.355949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.123440 (E_RNA) where: Base-Base interactions energy: -146.605 where: short stacking energy: -74.381 Base-Backbone interact. energy: 1.389 local terms energy: -150.906921 where: bonds (distance) C4'-P energy: -35.263 bonds (distance) P-C4' energy: -41.378 flat angles C4'-P-C4' energy: -31.176 flat angles P-C4'-P energy: -27.813 tors. eta vs tors. theta energy: -15.276 Dist. restrs. and SS energy: 0.767 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -305.671729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.671729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.712510 (E_RNA) where: Base-Base interactions energy: -149.343 where: short stacking energy: -95.674 Base-Backbone interact. energy: -0.581 local terms energy: -155.787690 where: bonds (distance) C4'-P energy: -40.698 bonds (distance) P-C4' energy: -35.477 flat angles C4'-P-C4' energy: -41.101 flat angles P-C4'-P energy: -22.763 tors. eta vs tors. theta energy: -15.748 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -295.768328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.768328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.481254 (E_RNA) where: Base-Base interactions energy: -153.359 where: short stacking energy: -84.835 Base-Backbone interact. energy: 0.119 local terms energy: -143.241555 where: bonds (distance) C4'-P energy: -34.582 bonds (distance) P-C4' energy: -33.251 flat angles C4'-P-C4' energy: -39.339 flat angles P-C4'-P energy: -21.368 tors. eta vs tors. theta energy: -14.702 Dist. restrs. and SS energy: 0.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -276.414936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.414936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.830551 (E_RNA) where: Base-Base interactions energy: -150.455 where: short stacking energy: -78.946 Base-Backbone interact. energy: 2.513 local terms energy: -132.888883 where: bonds (distance) C4'-P energy: -26.672 bonds (distance) P-C4' energy: -40.092 flat angles C4'-P-C4' energy: -32.018 flat angles P-C4'-P energy: -18.337 tors. eta vs tors. theta energy: -15.771 Dist. restrs. and SS energy: 4.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -236.135922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.135922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.233063 (E_RNA) where: Base-Base interactions energy: -111.340 where: short stacking energy: -60.236 Base-Backbone interact. energy: 1.164 local terms energy: -126.057601 where: bonds (distance) C4'-P energy: -38.852 bonds (distance) P-C4' energy: -37.357 flat angles C4'-P-C4' energy: -32.446 flat angles P-C4'-P energy: -21.723 tors. eta vs tors. theta energy: 4.321 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -235.225523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.225523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.273696 (E_RNA) where: Base-Base interactions energy: -121.261 where: short stacking energy: -70.088 Base-Backbone interact. energy: 0.319 local terms energy: -114.332312 where: bonds (distance) C4'-P energy: -34.031 bonds (distance) P-C4' energy: -36.508 flat angles C4'-P-C4' energy: -33.665 flat angles P-C4'-P energy: -6.351 tors. eta vs tors. theta energy: -3.777 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -508.703805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.703805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.172039 (E_RNA) where: Base-Base interactions energy: -311.819 where: short stacking energy: -160.497 Base-Backbone interact. energy: -0.175 local terms energy: -198.178789 where: bonds (distance) C4'-P energy: -39.880 bonds (distance) P-C4' energy: -43.412 flat angles C4'-P-C4' energy: -47.245 flat angles P-C4'-P energy: -26.633 tors. eta vs tors. theta energy: -41.009 Dist. restrs. and SS energy: 1.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -462.601353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.601353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.653125 (E_RNA) where: Base-Base interactions energy: -291.362 where: short stacking energy: -136.653 Base-Backbone interact. energy: -0.930 local terms energy: -170.361129 where: bonds (distance) C4'-P energy: -37.061 bonds (distance) P-C4' energy: -39.726 flat angles C4'-P-C4' energy: -35.995 flat angles P-C4'-P energy: -24.957 tors. eta vs tors. theta energy: -32.623 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -346.632251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.632251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.698538 (E_RNA) where: Base-Base interactions energy: -184.246 where: short stacking energy: -113.631 Base-Backbone interact. energy: -0.201 local terms energy: -162.251455 where: bonds (distance) C4'-P energy: -38.867 bonds (distance) P-C4' energy: -38.743 flat angles C4'-P-C4' energy: -37.172 flat angles P-C4'-P energy: -30.164 tors. eta vs tors. theta energy: -17.305 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -364.226691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.226691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.241916 (E_RNA) where: Base-Base interactions energy: -212.278 where: short stacking energy: -123.958 Base-Backbone interact. energy: -0.514 local terms energy: -151.450154 where: bonds (distance) C4'-P energy: -35.876 bonds (distance) P-C4' energy: -32.539 flat angles C4'-P-C4' energy: -36.931 flat angles P-C4'-P energy: -25.927 tors. eta vs tors. theta energy: -20.177 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -346.638077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.638077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.658232 (E_RNA) where: Base-Base interactions energy: -189.135 where: short stacking energy: -122.399 Base-Backbone interact. energy: -0.545 local terms energy: -156.979015 where: bonds (distance) C4'-P energy: -40.825 bonds (distance) P-C4' energy: -36.786 flat angles C4'-P-C4' energy: -36.907 flat angles P-C4'-P energy: -14.071 tors. eta vs tors. theta energy: -28.389 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -301.367904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.367904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.393128 (E_RNA) where: Base-Base interactions energy: -161.842 where: short stacking energy: -100.168 Base-Backbone interact. energy: 0.026 local terms energy: -139.577464 where: bonds (distance) C4'-P energy: -30.814 bonds (distance) P-C4' energy: -38.118 flat angles C4'-P-C4' energy: -34.873 flat angles P-C4'-P energy: -24.995 tors. eta vs tors. theta energy: -10.777 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -341.052603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.052603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.067424 (E_RNA) where: Base-Base interactions energy: -205.909 where: short stacking energy: -102.097 Base-Backbone interact. energy: -0.319 local terms energy: -134.839776 where: bonds (distance) C4'-P energy: -28.558 bonds (distance) P-C4' energy: -33.825 flat angles C4'-P-C4' energy: -21.861 flat angles P-C4'-P energy: -29.439 tors. eta vs tors. theta energy: -21.157 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -289.426606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.426606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.524004 (E_RNA) where: Base-Base interactions energy: -154.630 where: short stacking energy: -83.441 Base-Backbone interact. energy: 0.404 local terms energy: -135.297228 where: bonds (distance) C4'-P energy: -39.467 bonds (distance) P-C4' energy: -30.410 flat angles C4'-P-C4' energy: -28.749 flat angles P-C4'-P energy: -22.991 tors. eta vs tors. theta energy: -13.679 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -245.070651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.070651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.283492 (E_RNA) where: Base-Base interactions energy: -139.063 where: short stacking energy: -56.925 Base-Backbone interact. energy: -0.794 local terms energy: -105.425966 where: bonds (distance) C4'-P energy: -28.145 bonds (distance) P-C4' energy: -34.024 flat angles C4'-P-C4' energy: -31.159 flat angles P-C4'-P energy: -15.214 tors. eta vs tors. theta energy: 3.116 Dist. restrs. and SS energy: 0.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -228.681206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.681206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.720541 (E_RNA) where: Base-Base interactions energy: -124.306 where: short stacking energy: -78.312 Base-Backbone interact. energy: -0.452 local terms energy: -104.962496 where: bonds (distance) C4'-P energy: -27.627 bonds (distance) P-C4' energy: -30.576 flat angles C4'-P-C4' energy: -31.002 flat angles P-C4'-P energy: -7.157 tors. eta vs tors. theta energy: -8.600 Dist. restrs. and SS energy: 1.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -511.933015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.933015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.583414 (E_RNA) where: Base-Base interactions energy: -328.049 where: short stacking energy: -140.593 Base-Backbone interact. energy: -0.764 local terms energy: -185.769516 where: bonds (distance) C4'-P energy: -45.370 bonds (distance) P-C4' energy: -42.145 flat angles C4'-P-C4' energy: -36.721 flat angles P-C4'-P energy: -27.425 tors. eta vs tors. theta energy: -34.108 Dist. restrs. and SS energy: 2.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -477.067220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.067220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.310716 (E_RNA) where: Base-Base interactions energy: -296.236 where: short stacking energy: -146.379 Base-Backbone interact. energy: -1.399 local terms energy: -179.675832 where: bonds (distance) C4'-P energy: -36.274 bonds (distance) P-C4' energy: -41.686 flat angles C4'-P-C4' energy: -36.716 flat angles P-C4'-P energy: -25.110 tors. eta vs tors. theta energy: -39.890 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -354.165312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.165312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.242442 (E_RNA) where: Base-Base interactions energy: -181.884 where: short stacking energy: -111.211 Base-Backbone interact. energy: 1.335 local terms energy: -173.693168 where: bonds (distance) C4'-P energy: -36.898 bonds (distance) P-C4' energy: -42.380 flat angles C4'-P-C4' energy: -38.400 flat angles P-C4'-P energy: -34.041 tors. eta vs tors. theta energy: -21.974 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -361.667451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.667451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.867976 (E_RNA) where: Base-Base interactions energy: -198.428 where: short stacking energy: -109.160 Base-Backbone interact. energy: -0.953 local terms energy: -162.486828 where: bonds (distance) C4'-P energy: -33.172 bonds (distance) P-C4' energy: -48.351 flat angles C4'-P-C4' energy: -39.653 flat angles P-C4'-P energy: -21.482 tors. eta vs tors. theta energy: -19.829 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -331.572553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.572553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.903670 (E_RNA) where: Base-Base interactions energy: -181.954 where: short stacking energy: -96.776 Base-Backbone interact. energy: -0.702 local terms energy: -149.248224 where: bonds (distance) C4'-P energy: -39.804 bonds (distance) P-C4' energy: -35.053 flat angles C4'-P-C4' energy: -39.832 flat angles P-C4'-P energy: -21.925 tors. eta vs tors. theta energy: -12.635 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -311.173411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.173411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.798269 (E_RNA) where: Base-Base interactions energy: -164.666 where: short stacking energy: -93.415 Base-Backbone interact. energy: -1.112 local terms energy: -146.020806 where: bonds (distance) C4'-P energy: -37.592 bonds (distance) P-C4' energy: -42.756 flat angles C4'-P-C4' energy: -29.586 flat angles P-C4'-P energy: -24.536 tors. eta vs tors. theta energy: -11.551 Dist. restrs. and SS energy: 0.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -290.451079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.451079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.479056 (E_RNA) where: Base-Base interactions energy: -158.934 where: short stacking energy: -80.888 Base-Backbone interact. energy: -0.451 local terms energy: -131.094078 where: bonds (distance) C4'-P energy: -30.965 bonds (distance) P-C4' energy: -39.071 flat angles C4'-P-C4' energy: -34.339 flat angles P-C4'-P energy: -20.621 tors. eta vs tors. theta energy: -6.098 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -268.116998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.116998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.272773 (E_RNA) where: Base-Base interactions energy: -145.614 where: short stacking energy: -86.091 Base-Backbone interact. energy: 1.199 local terms energy: -124.858163 where: bonds (distance) C4'-P energy: -32.074 bonds (distance) P-C4' energy: -38.688 flat angles C4'-P-C4' energy: -35.954 flat angles P-C4'-P energy: -17.172 tors. eta vs tors. theta energy: -0.970 Dist. restrs. and SS energy: 1.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -276.207734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.207734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.465023 (E_RNA) where: Base-Base interactions energy: -143.497 where: short stacking energy: -70.200 Base-Backbone interact. energy: -0.804 local terms energy: -132.164502 where: bonds (distance) C4'-P energy: -30.086 bonds (distance) P-C4' energy: -41.443 flat angles C4'-P-C4' energy: -32.438 flat angles P-C4'-P energy: -16.571 tors. eta vs tors. theta energy: -11.627 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -219.920000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.920000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.923553 (E_RNA) where: Base-Base interactions energy: -121.610 where: short stacking energy: -61.936 Base-Backbone interact. energy: -0.786 local terms energy: -99.527043 where: bonds (distance) C4'-P energy: -17.327 bonds (distance) P-C4' energy: -35.917 flat angles C4'-P-C4' energy: -23.454 flat angles P-C4'-P energy: -20.587 tors. eta vs tors. theta energy: -2.242 Dist. restrs. and SS energy: 2.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -507.269128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.269128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.695649 (E_RNA) where: Base-Base interactions energy: -329.926 where: short stacking energy: -146.288 Base-Backbone interact. energy: -0.867 local terms energy: -179.903051 where: bonds (distance) C4'-P energy: -33.639 bonds (distance) P-C4' energy: -42.644 flat angles C4'-P-C4' energy: -40.714 flat angles P-C4'-P energy: -27.684 tors. eta vs tors. theta energy: -35.223 Dist. restrs. and SS energy: 3.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -506.703960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.703960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.867794 (E_RNA) where: Base-Base interactions energy: -311.906 where: short stacking energy: -157.660 Base-Backbone interact. energy: -0.092 local terms energy: -195.870105 where: bonds (distance) C4'-P energy: -36.917 bonds (distance) P-C4' energy: -45.382 flat angles C4'-P-C4' energy: -45.422 flat angles P-C4'-P energy: -24.642 tors. eta vs tors. theta energy: -43.507 Dist. restrs. and SS energy: 1.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -343.055117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.055117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.116473 (E_RNA) where: Base-Base interactions energy: -191.803 where: short stacking energy: -115.879 Base-Backbone interact. energy: -0.429 local terms energy: -150.883813 where: bonds (distance) C4'-P energy: -32.402 bonds (distance) P-C4' energy: -34.539 flat angles C4'-P-C4' energy: -38.295 flat angles P-C4'-P energy: -24.686 tors. eta vs tors. theta energy: -20.962 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -351.825852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.825852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.836124 (E_RNA) where: Base-Base interactions energy: -192.017 where: short stacking energy: -127.021 Base-Backbone interact. energy: -0.663 local terms energy: -159.156066 where: bonds (distance) C4'-P energy: -35.247 bonds (distance) P-C4' energy: -44.546 flat angles C4'-P-C4' energy: -36.215 flat angles P-C4'-P energy: -25.668 tors. eta vs tors. theta energy: -17.480 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -355.328244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.328244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.328244 (E_RNA) where: Base-Base interactions energy: -193.417 where: short stacking energy: -120.178 Base-Backbone interact. energy: 1.329 local terms energy: -163.240515 where: bonds (distance) C4'-P energy: -36.694 bonds (distance) P-C4' energy: -39.603 flat angles C4'-P-C4' energy: -36.700 flat angles P-C4'-P energy: -19.646 tors. eta vs tors. theta energy: -30.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -316.150895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.150895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.175467 (E_RNA) where: Base-Base interactions energy: -184.626 where: short stacking energy: -87.800 Base-Backbone interact. energy: 0.492 local terms energy: -132.040845 where: bonds (distance) C4'-P energy: -36.650 bonds (distance) P-C4' energy: -27.326 flat angles C4'-P-C4' energy: -34.789 flat angles P-C4'-P energy: -15.017 tors. eta vs tors. theta energy: -18.258 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -259.946103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.946103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.321627 (E_RNA) where: Base-Base interactions energy: -121.149 where: short stacking energy: -81.177 Base-Backbone interact. energy: -1.785 local terms energy: -139.386937 where: bonds (distance) C4'-P energy: -32.623 bonds (distance) P-C4' energy: -43.446 flat angles C4'-P-C4' energy: -27.912 flat angles P-C4'-P energy: -14.360 tors. eta vs tors. theta energy: -21.046 Dist. restrs. and SS energy: 2.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -250.890847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.890847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.453694 (E_RNA) where: Base-Base interactions energy: -130.368 where: short stacking energy: -93.724 Base-Backbone interact. energy: -0.716 local terms energy: -120.369734 where: bonds (distance) C4'-P energy: -36.319 bonds (distance) P-C4' energy: -30.050 flat angles C4'-P-C4' energy: -28.852 flat angles P-C4'-P energy: -16.106 tors. eta vs tors. theta energy: -9.042 Dist. restrs. and SS energy: 0.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -258.029086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.029086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.106567 (E_RNA) where: Base-Base interactions energy: -139.443 where: short stacking energy: -70.161 Base-Backbone interact. energy: -0.774 local terms energy: -117.889671 where: bonds (distance) C4'-P energy: -27.006 bonds (distance) P-C4' energy: -29.944 flat angles C4'-P-C4' energy: -35.278 flat angles P-C4'-P energy: -18.153 tors. eta vs tors. theta energy: -7.510 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -239.876343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.876343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.545994 (E_RNA) where: Base-Base interactions energy: -114.668 where: short stacking energy: -77.511 Base-Backbone interact. energy: 0.362 local terms energy: -128.240384 where: bonds (distance) C4'-P energy: -33.664 bonds (distance) P-C4' energy: -37.623 flat angles C4'-P-C4' energy: -31.120 flat angles P-C4'-P energy: -15.454 tors. eta vs tors. theta energy: -10.379 Dist. restrs. and SS energy: 2.670 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -522.571012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.571012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.601779 (E_RNA) where: Base-Base interactions energy: -322.692 where: short stacking energy: -153.736 Base-Backbone interact. energy: 0.379 local terms energy: -200.288962 where: bonds (distance) C4'-P energy: -37.848 bonds (distance) P-C4' energy: -40.336 flat angles C4'-P-C4' energy: -47.503 flat angles P-C4'-P energy: -34.409 tors. eta vs tors. theta energy: -40.193 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -497.476982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.476982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.877453 (E_RNA) where: Base-Base interactions energy: -307.776 where: short stacking energy: -160.631 Base-Backbone interact. energy: 1.784 local terms energy: -193.885801 where: bonds (distance) C4'-P energy: -36.090 bonds (distance) P-C4' energy: -42.495 flat angles C4'-P-C4' energy: -42.667 flat angles P-C4'-P energy: -30.117 tors. eta vs tors. theta energy: -42.516 Dist. restrs. and SS energy: 2.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -363.797375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.797375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.950701 (E_RNA) where: Base-Base interactions energy: -195.705 where: short stacking energy: -131.802 Base-Backbone interact. energy: -0.494 local terms energy: -167.751838 where: bonds (distance) C4'-P energy: -37.666 bonds (distance) P-C4' energy: -35.216 flat angles C4'-P-C4' energy: -39.159 flat angles P-C4'-P energy: -25.216 tors. eta vs tors. theta energy: -30.495 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -365.273425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.273425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.339723 (E_RNA) where: Base-Base interactions energy: -192.375 where: short stacking energy: -116.682 Base-Backbone interact. energy: -0.184 local terms energy: -172.780479 where: bonds (distance) C4'-P energy: -35.273 bonds (distance) P-C4' energy: -38.856 flat angles C4'-P-C4' energy: -44.796 flat angles P-C4'-P energy: -25.445 tors. eta vs tors. theta energy: -28.410 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -323.100249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.100249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.403331 (E_RNA) where: Base-Base interactions energy: -181.333 where: short stacking energy: -106.509 Base-Backbone interact. energy: -0.722 local terms energy: -141.348854 where: bonds (distance) C4'-P energy: -29.244 bonds (distance) P-C4' energy: -31.351 flat angles C4'-P-C4' energy: -39.669 flat angles P-C4'-P energy: -24.428 tors. eta vs tors. theta energy: -16.657 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -350.720671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.720671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.863539 (E_RNA) where: Base-Base interactions energy: -206.102 where: short stacking energy: -109.386 Base-Backbone interact. energy: -0.198 local terms energy: -144.563457 where: bonds (distance) C4'-P energy: -40.966 bonds (distance) P-C4' energy: -38.134 flat angles C4'-P-C4' energy: -33.465 flat angles P-C4'-P energy: -19.844 tors. eta vs tors. theta energy: -12.155 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -286.450692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.450692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.858703 (E_RNA) where: Base-Base interactions energy: -146.821 where: short stacking energy: -88.056 Base-Backbone interact. energy: -0.791 local terms energy: -139.247138 where: bonds (distance) C4'-P energy: -32.324 bonds (distance) P-C4' energy: -35.188 flat angles C4'-P-C4' energy: -29.894 flat angles P-C4'-P energy: -25.887 tors. eta vs tors. theta energy: -15.953 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -280.255254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.255254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.340481 (E_RNA) where: Base-Base interactions energy: -147.319 where: short stacking energy: -57.779 Base-Backbone interact. energy: 3.447 local terms energy: -136.467800 where: bonds (distance) C4'-P energy: -42.730 bonds (distance) P-C4' energy: -28.898 flat angles C4'-P-C4' energy: -32.671 flat angles P-C4'-P energy: -21.711 tors. eta vs tors. theta energy: -10.458 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -224.290940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.290940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.463544 (E_RNA) where: Base-Base interactions energy: -115.634 where: short stacking energy: -55.653 Base-Backbone interact. energy: 0.435 local terms energy: -110.264591 where: bonds (distance) C4'-P energy: -21.828 bonds (distance) P-C4' energy: -31.583 flat angles C4'-P-C4' energy: -29.068 flat angles P-C4'-P energy: -29.108 tors. eta vs tors. theta energy: 1.322 Dist. restrs. and SS energy: 1.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -240.872796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.872796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.466660 (E_RNA) where: Base-Base interactions energy: -110.938 where: short stacking energy: -56.728 Base-Backbone interact. energy: 1.031 local terms energy: -131.559867 where: bonds (distance) C4'-P energy: -34.039 bonds (distance) P-C4' energy: -36.531 flat angles C4'-P-C4' energy: -33.722 flat angles P-C4'-P energy: -23.308 tors. eta vs tors. theta energy: -3.959 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -518.437743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.437743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.919425 (E_RNA) where: Base-Base interactions energy: -323.520 where: short stacking energy: -168.793 Base-Backbone interact. energy: -2.041 local terms energy: -194.357788 where: bonds (distance) C4'-P energy: -37.916 bonds (distance) P-C4' energy: -36.064 flat angles C4'-P-C4' energy: -43.651 flat angles P-C4'-P energy: -28.741 tors. eta vs tors. theta energy: -47.985 Dist. restrs. and SS energy: 1.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -494.564105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.564105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.376663 (E_RNA) where: Base-Base interactions energy: -317.988 where: short stacking energy: -150.202 Base-Backbone interact. energy: -1.694 local terms energy: -175.695174 where: bonds (distance) C4'-P energy: -37.008 bonds (distance) P-C4' energy: -38.473 flat angles C4'-P-C4' energy: -44.684 flat angles P-C4'-P energy: -22.678 tors. eta vs tors. theta energy: -32.853 Dist. restrs. and SS energy: 0.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -411.337983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.337983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.495290 (E_RNA) where: Base-Base interactions energy: -218.772 where: short stacking energy: -158.380 Base-Backbone interact. energy: 0.386 local terms energy: -193.109124 where: bonds (distance) C4'-P energy: -41.676 bonds (distance) P-C4' energy: -44.576 flat angles C4'-P-C4' energy: -35.684 flat angles P-C4'-P energy: -29.127 tors. eta vs tors. theta energy: -42.047 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -364.560216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.560216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.848044 (E_RNA) where: Base-Base interactions energy: -181.813 where: short stacking energy: -128.789 Base-Backbone interact. energy: -1.694 local terms energy: -181.340674 where: bonds (distance) C4'-P energy: -39.548 bonds (distance) P-C4' energy: -44.250 flat angles C4'-P-C4' energy: -40.546 flat angles P-C4'-P energy: -21.410 tors. eta vs tors. theta energy: -35.587 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -364.083489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.083489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.199779 (E_RNA) where: Base-Base interactions energy: -215.583 where: short stacking energy: -103.017 Base-Backbone interact. energy: -1.048 local terms energy: -147.569565 where: bonds (distance) C4'-P energy: -40.848 bonds (distance) P-C4' energy: -33.035 flat angles C4'-P-C4' energy: -36.413 flat angles P-C4'-P energy: -22.976 tors. eta vs tors. theta energy: -14.297 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -293.942550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.942550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.030504 (E_RNA) where: Base-Base interactions energy: -160.868 where: short stacking energy: -100.541 Base-Backbone interact. energy: 1.604 local terms energy: -134.766515 where: bonds (distance) C4'-P energy: -30.181 bonds (distance) P-C4' energy: -37.413 flat angles C4'-P-C4' energy: -32.233 flat angles P-C4'-P energy: -19.596 tors. eta vs tors. theta energy: -15.343 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -292.573861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.573861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.852117 (E_RNA) where: Base-Base interactions energy: -158.539 where: short stacking energy: -81.996 Base-Backbone interact. energy: 1.058 local terms energy: -135.371206 where: bonds (distance) C4'-P energy: -31.696 bonds (distance) P-C4' energy: -42.775 flat angles C4'-P-C4' energy: -29.903 flat angles P-C4'-P energy: -12.612 tors. eta vs tors. theta energy: -18.385 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -287.074777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.074777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.114244 (E_RNA) where: Base-Base interactions energy: -156.640 where: short stacking energy: -93.268 Base-Backbone interact. energy: 0.012 local terms energy: -130.486585 where: bonds (distance) C4'-P energy: -27.937 bonds (distance) P-C4' energy: -36.647 flat angles C4'-P-C4' energy: -31.784 flat angles P-C4'-P energy: -21.163 tors. eta vs tors. theta energy: -12.956 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -262.917074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.917074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.917074 (E_RNA) where: Base-Base interactions energy: -147.599 where: short stacking energy: -91.651 Base-Backbone interact. energy: 2.114 local terms energy: -117.432451 where: bonds (distance) C4'-P energy: -15.004 bonds (distance) P-C4' energy: -34.166 flat angles C4'-P-C4' energy: -30.436 flat angles P-C4'-P energy: -24.405 tors. eta vs tors. theta energy: -13.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -209.778189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.778189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.176257 (E_RNA) where: Base-Base interactions energy: -100.116 where: short stacking energy: -64.697 Base-Backbone interact. energy: -0.023 local terms energy: -112.037060 where: bonds (distance) C4'-P energy: -38.002 bonds (distance) P-C4' energy: -33.007 flat angles C4'-P-C4' energy: -31.217 flat angles P-C4'-P energy: -13.213 tors. eta vs tors. theta energy: 3.402 Dist. restrs. and SS energy: 2.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -545.063424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.063424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.539668 (E_RNA) where: Base-Base interactions energy: -356.660 where: short stacking energy: -168.635 Base-Backbone interact. energy: -2.028 local terms energy: -186.852060 where: bonds (distance) C4'-P energy: -40.438 bonds (distance) P-C4' energy: -33.888 flat angles C4'-P-C4' energy: -41.391 flat angles P-C4'-P energy: -27.296 tors. eta vs tors. theta energy: -43.839 Dist. restrs. and SS energy: 0.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -510.319568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.319568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.558000 (E_RNA) where: Base-Base interactions energy: -328.719 where: short stacking energy: -167.845 Base-Backbone interact. energy: -0.444 local terms energy: -182.394669 where: bonds (distance) C4'-P energy: -33.847 bonds (distance) P-C4' energy: -37.426 flat angles C4'-P-C4' energy: -40.279 flat angles P-C4'-P energy: -26.243 tors. eta vs tors. theta energy: -44.601 Dist. restrs. and SS energy: 1.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -417.558248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.558248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.646170 (E_RNA) where: Base-Base interactions energy: -240.467 where: short stacking energy: -156.382 Base-Backbone interact. energy: -0.582 local terms energy: -176.596287 where: bonds (distance) C4'-P energy: -36.988 bonds (distance) P-C4' energy: -33.993 flat angles C4'-P-C4' energy: -40.183 flat angles P-C4'-P energy: -20.817 tors. eta vs tors. theta energy: -44.616 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -397.180818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.180818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.237936 (E_RNA) where: Base-Base interactions energy: -229.511 where: short stacking energy: -115.693 Base-Backbone interact. energy: 0.334 local terms energy: -168.060684 where: bonds (distance) C4'-P energy: -40.142 bonds (distance) P-C4' energy: -37.768 flat angles C4'-P-C4' energy: -33.747 flat angles P-C4'-P energy: -26.868 tors. eta vs tors. theta energy: -29.535 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -319.723906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.723906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.871177 (E_RNA) where: Base-Base interactions energy: -186.555 where: short stacking energy: -97.372 Base-Backbone interact. energy: -0.193 local terms energy: -133.123911 where: bonds (distance) C4'-P energy: -38.079 bonds (distance) P-C4' energy: -34.825 flat angles C4'-P-C4' energy: -34.020 flat angles P-C4'-P energy: -16.853 tors. eta vs tors. theta energy: -9.347 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -304.313790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.313790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.318010 (E_RNA) where: Base-Base interactions energy: -160.346 where: short stacking energy: -96.731 Base-Backbone interact. energy: 0.522 local terms energy: -144.494400 where: bonds (distance) C4'-P energy: -27.901 bonds (distance) P-C4' energy: -38.344 flat angles C4'-P-C4' energy: -38.356 flat angles P-C4'-P energy: -23.182 tors. eta vs tors. theta energy: -16.712 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -268.716242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.716242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.726466 (E_RNA) where: Base-Base interactions energy: -152.550 where: short stacking energy: -90.898 Base-Backbone interact. energy: -1.355 local terms energy: -114.821619 where: bonds (distance) C4'-P energy: -21.711 bonds (distance) P-C4' energy: -36.985 flat angles C4'-P-C4' energy: -30.221 flat angles P-C4'-P energy: -11.760 tors. eta vs tors. theta energy: -14.145 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -279.482959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.482959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.555571 (E_RNA) where: Base-Base interactions energy: -137.211 where: short stacking energy: -69.809 Base-Backbone interact. energy: -0.306 local terms energy: -142.038134 where: bonds (distance) C4'-P energy: -33.103 bonds (distance) P-C4' energy: -34.022 flat angles C4'-P-C4' energy: -36.021 flat angles P-C4'-P energy: -25.381 tors. eta vs tors. theta energy: -13.512 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -257.248910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.248910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.505898 (E_RNA) where: Base-Base interactions energy: -127.033 where: short stacking energy: -78.504 Base-Backbone interact. energy: 1.687 local terms energy: -132.159871 where: bonds (distance) C4'-P energy: -46.068 bonds (distance) P-C4' energy: -36.667 flat angles C4'-P-C4' energy: -25.191 flat angles P-C4'-P energy: -15.449 tors. eta vs tors. theta energy: -8.785 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -197.061576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.061576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.617301 (E_RNA) where: Base-Base interactions energy: -83.036 where: short stacking energy: -43.089 Base-Backbone interact. energy: -0.639 local terms energy: -121.942511 where: bonds (distance) C4'-P energy: -36.756 bonds (distance) P-C4' energy: -27.579 flat angles C4'-P-C4' energy: -32.654 flat angles P-C4'-P energy: -22.719 tors. eta vs tors. theta energy: -2.235 Dist. restrs. and SS energy: 8.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -533.516300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.516300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.325300 (E_RNA) where: Base-Base interactions energy: -345.991 where: short stacking energy: -167.514 Base-Backbone interact. energy: -1.477 local terms energy: -186.856889 where: bonds (distance) C4'-P energy: -40.977 bonds (distance) P-C4' energy: -38.360 flat angles C4'-P-C4' energy: -36.055 flat angles P-C4'-P energy: -27.666 tors. eta vs tors. theta energy: -43.799 Dist. restrs. and SS energy: 0.809 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -530.022573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.022573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.087490 (E_RNA) where: Base-Base interactions energy: -332.913 where: short stacking energy: -163.912 Base-Backbone interact. energy: -0.298 local terms energy: -197.876769 where: bonds (distance) C4'-P energy: -42.064 bonds (distance) P-C4' energy: -40.515 flat angles C4'-P-C4' energy: -41.951 flat angles P-C4'-P energy: -27.513 tors. eta vs tors. theta energy: -45.834 Dist. restrs. and SS energy: 1.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -424.334898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.334898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.350799 (E_RNA) where: Base-Base interactions energy: -255.994 where: short stacking energy: -128.422 Base-Backbone interact. energy: -1.147 local terms energy: -167.209762 where: bonds (distance) C4'-P energy: -36.773 bonds (distance) P-C4' energy: -48.945 flat angles C4'-P-C4' energy: -40.945 flat angles P-C4'-P energy: -18.392 tors. eta vs tors. theta energy: -22.154 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -373.762811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.762811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.791861 (E_RNA) where: Base-Base interactions energy: -201.543 where: short stacking energy: -137.529 Base-Backbone interact. energy: -0.654 local terms energy: -171.594803 where: bonds (distance) C4'-P energy: -37.626 bonds (distance) P-C4' energy: -30.292 flat angles C4'-P-C4' energy: -38.231 flat angles P-C4'-P energy: -27.402 tors. eta vs tors. theta energy: -38.043 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -366.995748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.995748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.284053 (E_RNA) where: Base-Base interactions energy: -204.401 where: short stacking energy: -120.096 Base-Backbone interact. energy: -0.517 local terms energy: -162.366276 where: bonds (distance) C4'-P energy: -35.957 bonds (distance) P-C4' energy: -40.932 flat angles C4'-P-C4' energy: -42.117 flat angles P-C4'-P energy: -18.244 tors. eta vs tors. theta energy: -25.116 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -323.071006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.071006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.071006 (E_RNA) where: Base-Base interactions energy: -180.095 where: short stacking energy: -100.192 Base-Backbone interact. energy: -0.639 local terms energy: -142.336657 where: bonds (distance) C4'-P energy: -37.841 bonds (distance) P-C4' energy: -31.086 flat angles C4'-P-C4' energy: -38.693 flat angles P-C4'-P energy: -15.797 tors. eta vs tors. theta energy: -18.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -276.786825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.786825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.851554 (E_RNA) where: Base-Base interactions energy: -150.173 where: short stacking energy: -73.906 Base-Backbone interact. energy: -0.732 local terms energy: -125.947333 where: bonds (distance) C4'-P energy: -30.810 bonds (distance) P-C4' energy: -32.448 flat angles C4'-P-C4' energy: -29.874 flat angles P-C4'-P energy: -26.090 tors. eta vs tors. theta energy: -6.726 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -283.739787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.739787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.993028 (E_RNA) where: Base-Base interactions energy: -152.237 where: short stacking energy: -77.245 Base-Backbone interact. energy: 1.252 local terms energy: -133.008424 where: bonds (distance) C4'-P energy: -40.615 bonds (distance) P-C4' energy: -32.222 flat angles C4'-P-C4' energy: -30.306 flat angles P-C4'-P energy: -18.013 tors. eta vs tors. theta energy: -11.852 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -258.481562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.481562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.875736 (E_RNA) where: Base-Base interactions energy: -144.651 where: short stacking energy: -81.526 Base-Backbone interact. energy: -0.614 local terms energy: -113.610598 where: bonds (distance) C4'-P energy: -28.178 bonds (distance) P-C4' energy: -29.752 flat angles C4'-P-C4' energy: -32.938 flat angles P-C4'-P energy: -11.046 tors. eta vs tors. theta energy: -11.696 Dist. restrs. and SS energy: 0.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -201.095894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.095894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.769035 (E_RNA) where: Base-Base interactions energy: -111.017 where: short stacking energy: -59.661 Base-Backbone interact. energy: -1.555 local terms energy: -92.196378 where: bonds (distance) C4'-P energy: -27.679 bonds (distance) P-C4' energy: -34.736 flat angles C4'-P-C4' energy: -28.130 flat angles P-C4'-P energy: -7.299 tors. eta vs tors. theta energy: 5.647 Dist. restrs. and SS energy: 3.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -523.688615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.688615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.117225 (E_RNA) where: Base-Base interactions energy: -340.086 where: short stacking energy: -165.452 Base-Backbone interact. energy: -1.725 local terms energy: -183.305662 where: bonds (distance) C4'-P energy: -36.967 bonds (distance) P-C4' energy: -38.895 flat angles C4'-P-C4' energy: -38.204 flat angles P-C4'-P energy: -28.419 tors. eta vs tors. theta energy: -40.820 Dist. restrs. and SS energy: 1.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -522.958507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.958507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.390367 (E_RNA) where: Base-Base interactions energy: -325.769 where: short stacking energy: -138.437 Base-Backbone interact. energy: -1.405 local terms energy: -197.216573 where: bonds (distance) C4'-P energy: -41.065 bonds (distance) P-C4' energy: -47.871 flat angles C4'-P-C4' energy: -41.878 flat angles P-C4'-P energy: -29.087 tors. eta vs tors. theta energy: -37.316 Dist. restrs. and SS energy: 1.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -442.046732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.046732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.178167 (E_RNA) where: Base-Base interactions energy: -259.616 where: short stacking energy: -144.255 Base-Backbone interact. energy: -1.055 local terms energy: -181.506463 where: bonds (distance) C4'-P energy: -38.169 bonds (distance) P-C4' energy: -39.845 flat angles C4'-P-C4' energy: -40.077 flat angles P-C4'-P energy: -25.377 tors. eta vs tors. theta energy: -38.040 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -376.192195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.192195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.750813 (E_RNA) where: Base-Base interactions energy: -210.904 where: short stacking energy: -118.275 Base-Backbone interact. energy: -0.621 local terms energy: -165.225777 where: bonds (distance) C4'-P energy: -35.964 bonds (distance) P-C4' energy: -35.303 flat angles C4'-P-C4' energy: -41.936 flat angles P-C4'-P energy: -23.110 tors. eta vs tors. theta energy: -28.913 Dist. restrs. and SS energy: 0.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -353.226787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.226787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.744960 (E_RNA) where: Base-Base interactions energy: -193.628 where: short stacking energy: -131.368 Base-Backbone interact. energy: -0.021 local terms energy: -160.096184 where: bonds (distance) C4'-P energy: -36.925 bonds (distance) P-C4' energy: -33.340 flat angles C4'-P-C4' energy: -37.273 flat angles P-C4'-P energy: -23.316 tors. eta vs tors. theta energy: -29.242 Dist. restrs. and SS energy: 0.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -335.618931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.618931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.645800 (E_RNA) where: Base-Base interactions energy: -175.317 where: short stacking energy: -111.445 Base-Backbone interact. energy: -0.503 local terms energy: -159.825801 where: bonds (distance) C4'-P energy: -35.821 bonds (distance) P-C4' energy: -31.319 flat angles C4'-P-C4' energy: -35.898 flat angles P-C4'-P energy: -31.307 tors. eta vs tors. theta energy: -25.480 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -294.425349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.425349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.587719 (E_RNA) where: Base-Base interactions energy: -163.005 where: short stacking energy: -106.764 Base-Backbone interact. energy: -0.611 local terms energy: -130.972243 where: bonds (distance) C4'-P energy: -34.470 bonds (distance) P-C4' energy: -30.223 flat angles C4'-P-C4' energy: -34.577 flat angles P-C4'-P energy: -11.708 tors. eta vs tors. theta energy: -19.995 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -263.596523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.596523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.687135 (E_RNA) where: Base-Base interactions energy: -121.982 where: short stacking energy: -63.368 Base-Backbone interact. energy: -0.217 local terms energy: -141.488297 where: bonds (distance) C4'-P energy: -33.023 bonds (distance) P-C4' energy: -40.176 flat angles C4'-P-C4' energy: -36.141 flat angles P-C4'-P energy: -22.357 tors. eta vs tors. theta energy: -9.792 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -255.002689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.002689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.720746 (E_RNA) where: Base-Base interactions energy: -128.421 where: short stacking energy: -79.394 Base-Backbone interact. energy: 0.649 local terms energy: -129.948815 where: bonds (distance) C4'-P energy: -29.840 bonds (distance) P-C4' energy: -29.206 flat angles C4'-P-C4' energy: -33.706 flat angles P-C4'-P energy: -21.180 tors. eta vs tors. theta energy: -16.016 Dist. restrs. and SS energy: 2.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -227.164197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.164197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.164197 (E_RNA) where: Base-Base interactions energy: -115.038 where: short stacking energy: -57.730 Base-Backbone interact. energy: 1.213 local terms energy: -113.339184 where: bonds (distance) C4'-P energy: -27.830 bonds (distance) P-C4' energy: -33.135 flat angles C4'-P-C4' energy: -35.126 flat angles P-C4'-P energy: -17.477 tors. eta vs tors. theta energy: 0.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -543.406079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.406079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.949860 (E_RNA) where: Base-Base interactions energy: -348.107 where: short stacking energy: -166.790 Base-Backbone interact. energy: 0.031 local terms energy: -196.873560 where: bonds (distance) C4'-P energy: -36.507 bonds (distance) P-C4' energy: -41.744 flat angles C4'-P-C4' energy: -43.105 flat angles P-C4'-P energy: -36.593 tors. eta vs tors. theta energy: -38.924 Dist. restrs. and SS energy: 1.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -499.890659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.890659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.485855 (E_RNA) where: Base-Base interactions energy: -313.682 where: short stacking energy: -151.568 Base-Backbone interact. energy: 1.523 local terms energy: -188.326594 where: bonds (distance) C4'-P energy: -39.493 bonds (distance) P-C4' energy: -39.585 flat angles C4'-P-C4' energy: -39.808 flat angles P-C4'-P energy: -26.361 tors. eta vs tors. theta energy: -43.079 Dist. restrs. and SS energy: 0.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -419.644126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.644126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.644126 (E_RNA) where: Base-Base interactions energy: -238.748 where: short stacking energy: -124.038 Base-Backbone interact. energy: -0.691 local terms energy: -180.205051 where: bonds (distance) C4'-P energy: -40.071 bonds (distance) P-C4' energy: -39.530 flat angles C4'-P-C4' energy: -40.996 flat angles P-C4'-P energy: -29.073 tors. eta vs tors. theta energy: -30.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -360.788745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.788745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.823011 (E_RNA) where: Base-Base interactions energy: -206.970 where: short stacking energy: -119.707 Base-Backbone interact. energy: -1.151 local terms energy: -152.701921 where: bonds (distance) C4'-P energy: -36.045 bonds (distance) P-C4' energy: -34.748 flat angles C4'-P-C4' energy: -34.669 flat angles P-C4'-P energy: -25.621 tors. eta vs tors. theta energy: -21.620 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -322.654018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.654018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.727667 (E_RNA) where: Base-Base interactions energy: -159.312 where: short stacking energy: -100.645 Base-Backbone interact. energy: 0.485 local terms energy: -163.900284 where: bonds (distance) C4'-P energy: -37.862 bonds (distance) P-C4' energy: -41.934 flat angles C4'-P-C4' energy: -40.946 flat angles P-C4'-P energy: -29.857 tors. eta vs tors. theta energy: -13.302 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -303.990542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.990542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.068537 (E_RNA) where: Base-Base interactions energy: -157.029 where: short stacking energy: -102.509 Base-Backbone interact. energy: -1.023 local terms energy: -146.016984 where: bonds (distance) C4'-P energy: -26.537 bonds (distance) P-C4' energy: -35.588 flat angles C4'-P-C4' energy: -27.737 flat angles P-C4'-P energy: -29.200 tors. eta vs tors. theta energy: -26.955 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -281.899499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.899499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.999446 (E_RNA) where: Base-Base interactions energy: -137.770 where: short stacking energy: -75.568 Base-Backbone interact. energy: -0.519 local terms energy: -143.710464 where: bonds (distance) C4'-P energy: -29.387 bonds (distance) P-C4' energy: -35.847 flat angles C4'-P-C4' energy: -32.406 flat angles P-C4'-P energy: -22.612 tors. eta vs tors. theta energy: -23.458 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -280.811852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.811852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.860009 (E_RNA) where: Base-Base interactions energy: -148.930 where: short stacking energy: -92.306 Base-Backbone interact. energy: 0.107 local terms energy: -132.036624 where: bonds (distance) C4'-P energy: -32.344 bonds (distance) P-C4' energy: -38.323 flat angles C4'-P-C4' energy: -30.227 flat angles P-C4'-P energy: -16.088 tors. eta vs tors. theta energy: -15.055 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -275.086735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.086735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.044128 (E_RNA) where: Base-Base interactions energy: -132.761 where: short stacking energy: -77.552 Base-Backbone interact. energy: 1.975 local terms energy: -146.257738 where: bonds (distance) C4'-P energy: -35.016 bonds (distance) P-C4' energy: -39.116 flat angles C4'-P-C4' energy: -31.517 flat angles P-C4'-P energy: -25.687 tors. eta vs tors. theta energy: -14.922 Dist. restrs. and SS energy: 1.957 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -230.917780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.917780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.004684 (E_RNA) where: Base-Base interactions energy: -109.788 where: short stacking energy: -57.664 Base-Backbone interact. energy: -0.641 local terms energy: -120.575930 where: bonds (distance) C4'-P energy: -32.135 bonds (distance) P-C4' energy: -36.943 flat angles C4'-P-C4' energy: -33.512 flat angles P-C4'-P energy: -15.938 tors. eta vs tors. theta energy: -2.047 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -539.446848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.446848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.510733 (E_RNA) where: Base-Base interactions energy: -350.951 where: short stacking energy: -178.430 Base-Backbone interact. energy: 0.803 local terms energy: -190.363327 where: bonds (distance) C4'-P energy: -30.297 bonds (distance) P-C4' energy: -41.375 flat angles C4'-P-C4' energy: -42.444 flat angles P-C4'-P energy: -29.246 tors. eta vs tors. theta energy: -47.002 Dist. restrs. and SS energy: 1.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -516.181425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.181425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.569569 (E_RNA) where: Base-Base interactions energy: -336.129 where: short stacking energy: -162.530 Base-Backbone interact. energy: -0.757 local terms energy: -180.683084 where: bonds (distance) C4'-P energy: -37.003 bonds (distance) P-C4' energy: -44.843 flat angles C4'-P-C4' energy: -40.025 flat angles P-C4'-P energy: -21.174 tors. eta vs tors. theta energy: -37.638 Dist. restrs. and SS energy: 1.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -424.892470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.892470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.010524 (E_RNA) where: Base-Base interactions energy: -250.880 where: short stacking energy: -135.750 Base-Backbone interact. energy: 1.689 local terms energy: -175.818986 where: bonds (distance) C4'-P energy: -39.606 bonds (distance) P-C4' energy: -47.025 flat angles C4'-P-C4' energy: -44.007 flat angles P-C4'-P energy: -17.369 tors. eta vs tors. theta energy: -27.811 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -387.600866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.600866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.600866 (E_RNA) where: Base-Base interactions energy: -226.313 where: short stacking energy: -129.990 Base-Backbone interact. energy: 0.748 local terms energy: -162.036294 where: bonds (distance) C4'-P energy: -36.210 bonds (distance) P-C4' energy: -40.277 flat angles C4'-P-C4' energy: -38.882 flat angles P-C4'-P energy: -21.219 tors. eta vs tors. theta energy: -25.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -358.210247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.210247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.215245 (E_RNA) where: Base-Base interactions energy: -204.300 where: short stacking energy: -127.251 Base-Backbone interact. energy: -0.114 local terms energy: -153.801276 where: bonds (distance) C4'-P energy: -28.462 bonds (distance) P-C4' energy: -30.305 flat angles C4'-P-C4' energy: -36.249 flat angles P-C4'-P energy: -25.616 tors. eta vs tors. theta energy: -33.169 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -287.333760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.333760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.649991 (E_RNA) where: Base-Base interactions energy: -153.736 where: short stacking energy: -90.170 Base-Backbone interact. energy: 2.451 local terms energy: -136.364491 where: bonds (distance) C4'-P energy: -25.631 bonds (distance) P-C4' energy: -38.981 flat angles C4'-P-C4' energy: -39.851 flat angles P-C4'-P energy: -16.946 tors. eta vs tors. theta energy: -14.956 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -280.262051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.262051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.310251 (E_RNA) where: Base-Base interactions energy: -143.232 where: short stacking energy: -92.192 Base-Backbone interact. energy: -0.924 local terms energy: -136.153753 where: bonds (distance) C4'-P energy: -35.577 bonds (distance) P-C4' energy: -33.054 flat angles C4'-P-C4' energy: -33.002 flat angles P-C4'-P energy: -23.104 tors. eta vs tors. theta energy: -11.418 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -257.028138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.028138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.264235 (E_RNA) where: Base-Base interactions energy: -138.950 where: short stacking energy: -64.726 Base-Backbone interact. energy: -0.445 local terms energy: -119.869899 where: bonds (distance) C4'-P energy: -35.515 bonds (distance) P-C4' energy: -28.465 flat angles C4'-P-C4' energy: -35.779 flat angles P-C4'-P energy: -13.639 tors. eta vs tors. theta energy: -6.472 Dist. restrs. and SS energy: 2.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -267.167381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.167381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.535173 (E_RNA) where: Base-Base interactions energy: -147.660 where: short stacking energy: -87.565 Base-Backbone interact. energy: -0.846 local terms energy: -119.029409 where: bonds (distance) C4'-P energy: -32.660 bonds (distance) P-C4' energy: -30.359 flat angles C4'-P-C4' energy: -30.164 flat angles P-C4'-P energy: -17.790 tors. eta vs tors. theta energy: -8.056 Dist. restrs. and SS energy: 0.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -225.011340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.011340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.471128 (E_RNA) where: Base-Base interactions energy: -124.256 where: short stacking energy: -58.672 Base-Backbone interact. energy: -0.699 local terms energy: -100.516021 where: bonds (distance) C4'-P energy: -34.366 bonds (distance) P-C4' energy: -26.415 flat angles C4'-P-C4' energy: -24.084 flat angles P-C4'-P energy: -20.168 tors. eta vs tors. theta energy: 4.518 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -561.810570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.810570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.809466 (E_RNA) where: Base-Base interactions energy: -365.313 where: short stacking energy: -170.041 Base-Backbone interact. energy: -0.485 local terms energy: -197.012139 where: bonds (distance) C4'-P energy: -37.557 bonds (distance) P-C4' energy: -42.682 flat angles C4'-P-C4' energy: -40.579 flat angles P-C4'-P energy: -25.817 tors. eta vs tors. theta energy: -50.377 Dist. restrs. and SS energy: 0.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -488.956847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.956847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.535370 (E_RNA) where: Base-Base interactions energy: -307.862 where: short stacking energy: -144.187 Base-Backbone interact. energy: 1.221 local terms energy: -183.894475 where: bonds (distance) C4'-P energy: -39.327 bonds (distance) P-C4' energy: -41.296 flat angles C4'-P-C4' energy: -44.070 flat angles P-C4'-P energy: -23.265 tors. eta vs tors. theta energy: -35.937 Dist. restrs. and SS energy: 1.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -417.553813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.553813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.554546 (E_RNA) where: Base-Base interactions energy: -229.416 where: short stacking energy: -139.477 Base-Backbone interact. energy: -1.064 local terms energy: -187.074638 where: bonds (distance) C4'-P energy: -41.020 bonds (distance) P-C4' energy: -40.511 flat angles C4'-P-C4' energy: -41.349 flat angles P-C4'-P energy: -26.282 tors. eta vs tors. theta energy: -37.912 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -369.854744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.854744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.128922 (E_RNA) where: Base-Base interactions energy: -212.028 where: short stacking energy: -115.839 Base-Backbone interact. energy: -0.580 local terms energy: -157.521669 where: bonds (distance) C4'-P energy: -31.959 bonds (distance) P-C4' energy: -35.479 flat angles C4'-P-C4' energy: -31.686 flat angles P-C4'-P energy: -34.451 tors. eta vs tors. theta energy: -23.948 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -369.763493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.763493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.052150 (E_RNA) where: Base-Base interactions energy: -221.471 where: short stacking energy: -124.280 Base-Backbone interact. energy: -1.508 local terms energy: -147.073403 where: bonds (distance) C4'-P energy: -33.707 bonds (distance) P-C4' energy: -41.544 flat angles C4'-P-C4' energy: -31.563 flat angles P-C4'-P energy: -19.513 tors. eta vs tors. theta energy: -20.746 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -318.963432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.963432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.991362 (E_RNA) where: Base-Base interactions energy: -171.308 where: short stacking energy: -108.227 Base-Backbone interact. energy: -0.161 local terms energy: -147.522321 where: bonds (distance) C4'-P energy: -29.795 bonds (distance) P-C4' energy: -40.232 flat angles C4'-P-C4' energy: -26.636 flat angles P-C4'-P energy: -30.068 tors. eta vs tors. theta energy: -20.790 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -300.253463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.253463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.418101 (E_RNA) where: Base-Base interactions energy: -178.046 where: short stacking energy: -98.879 Base-Backbone interact. energy: 0.550 local terms energy: -122.922044 where: bonds (distance) C4'-P energy: -28.490 bonds (distance) P-C4' energy: -36.120 flat angles C4'-P-C4' energy: -29.594 flat angles P-C4'-P energy: -13.763 tors. eta vs tors. theta energy: -14.956 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -279.701159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.701159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.003185 (E_RNA) where: Base-Base interactions energy: -157.043 where: short stacking energy: -85.547 Base-Backbone interact. energy: 0.796 local terms energy: -127.756603 where: bonds (distance) C4'-P energy: -32.127 bonds (distance) P-C4' energy: -34.119 flat angles C4'-P-C4' energy: -31.894 flat angles P-C4'-P energy: -13.116 tors. eta vs tors. theta energy: -16.501 Dist. restrs. and SS energy: 4.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -250.432904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.432904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.451960 (E_RNA) where: Base-Base interactions energy: -107.777 where: short stacking energy: -58.869 Base-Backbone interact. energy: 0.079 local terms energy: -142.754183 where: bonds (distance) C4'-P energy: -34.462 bonds (distance) P-C4' energy: -36.589 flat angles C4'-P-C4' energy: -31.340 flat angles P-C4'-P energy: -24.142 tors. eta vs tors. theta energy: -16.222 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -252.328214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.328214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.668571 (E_RNA) where: Base-Base interactions energy: -146.244 where: short stacking energy: -71.865 Base-Backbone interact. energy: 0.183 local terms energy: -106.607584 where: bonds (distance) C4'-P energy: -29.316 bonds (distance) P-C4' energy: -33.067 flat angles C4'-P-C4' energy: -24.152 flat angles P-C4'-P energy: -19.904 tors. eta vs tors. theta energy: -0.168 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -562.239837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.239837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.799258 (E_RNA) where: Base-Base interactions energy: -360.349 where: short stacking energy: -165.724 Base-Backbone interact. energy: -1.097 local terms energy: -202.353396 where: bonds (distance) C4'-P energy: -42.382 bonds (distance) P-C4' energy: -38.624 flat angles C4'-P-C4' energy: -43.552 flat angles P-C4'-P energy: -30.858 tors. eta vs tors. theta energy: -46.938 Dist. restrs. and SS energy: 1.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -504.245149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.245149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.341473 (E_RNA) where: Base-Base interactions energy: -313.867 where: short stacking energy: -168.011 Base-Backbone interact. energy: -1.125 local terms energy: -191.348667 where: bonds (distance) C4'-P energy: -36.338 bonds (distance) P-C4' energy: -42.658 flat angles C4'-P-C4' energy: -40.371 flat angles P-C4'-P energy: -29.940 tors. eta vs tors. theta energy: -42.042 Dist. restrs. and SS energy: 2.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -425.775369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.775369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.775369 (E_RNA) where: Base-Base interactions energy: -244.172 where: short stacking energy: -124.140 Base-Backbone interact. energy: -0.379 local terms energy: -181.224483 where: bonds (distance) C4'-P energy: -38.917 bonds (distance) P-C4' energy: -42.428 flat angles C4'-P-C4' energy: -46.528 flat angles P-C4'-P energy: -24.496 tors. eta vs tors. theta energy: -28.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -386.481951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.481951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.570989 (E_RNA) where: Base-Base interactions energy: -202.176 where: short stacking energy: -116.832 Base-Backbone interact. energy: -0.304 local terms energy: -184.091054 where: bonds (distance) C4'-P energy: -38.634 bonds (distance) P-C4' energy: -45.645 flat angles C4'-P-C4' energy: -40.385 flat angles P-C4'-P energy: -30.481 tors. eta vs tors. theta energy: -28.946 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -384.827658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.827658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.562874 (E_RNA) where: Base-Base interactions energy: -231.717 where: short stacking energy: -124.909 Base-Backbone interact. energy: -0.650 local terms energy: -156.195403 where: bonds (distance) C4'-P energy: -38.661 bonds (distance) P-C4' energy: -37.571 flat angles C4'-P-C4' energy: -27.291 flat angles P-C4'-P energy: -25.933 tors. eta vs tors. theta energy: -26.740 Dist. restrs. and SS energy: 3.735 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -309.017209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.017209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.407734 (E_RNA) where: Base-Base interactions energy: -167.127 where: short stacking energy: -104.222 Base-Backbone interact. energy: -0.626 local terms energy: -141.654550 where: bonds (distance) C4'-P energy: -33.601 bonds (distance) P-C4' energy: -35.860 flat angles C4'-P-C4' energy: -30.323 flat angles P-C4'-P energy: -20.652 tors. eta vs tors. theta energy: -21.218 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -282.110442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.110442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.273978 (E_RNA) where: Base-Base interactions energy: -138.158 where: short stacking energy: -78.164 Base-Backbone interact. energy: -0.814 local terms energy: -143.302598 where: bonds (distance) C4'-P energy: -30.148 bonds (distance) P-C4' energy: -39.133 flat angles C4'-P-C4' energy: -31.092 flat angles P-C4'-P energy: -22.365 tors. eta vs tors. theta energy: -20.564 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -250.984298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.984298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.294626 (E_RNA) where: Base-Base interactions energy: -120.722 where: short stacking energy: -71.809 Base-Backbone interact. energy: -0.446 local terms energy: -130.126939 where: bonds (distance) C4'-P energy: -41.324 bonds (distance) P-C4' energy: -35.973 flat angles C4'-P-C4' energy: -27.715 flat angles P-C4'-P energy: -19.440 tors. eta vs tors. theta energy: -5.676 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -229.908334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.908334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.908334 (E_RNA) where: Base-Base interactions energy: -112.408 where: short stacking energy: -60.497 Base-Backbone interact. energy: -0.330 local terms energy: -117.170279 where: bonds (distance) C4'-P energy: -38.024 bonds (distance) P-C4' energy: -35.557 flat angles C4'-P-C4' energy: -28.814 flat angles P-C4'-P energy: -16.813 tors. eta vs tors. theta energy: 2.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -219.330512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.330512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.645625 (E_RNA) where: Base-Base interactions energy: -90.313 where: short stacking energy: -60.925 Base-Backbone interact. energy: -0.713 local terms energy: -131.619735 where: bonds (distance) C4'-P energy: -26.650 bonds (distance) P-C4' energy: -40.202 flat angles C4'-P-C4' energy: -35.915 flat angles P-C4'-P energy: -19.013 tors. eta vs tors. theta energy: -9.840 Dist. restrs. and SS energy: 3.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -541.355720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.355720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.607138 (E_RNA) where: Base-Base interactions energy: -348.211 where: short stacking energy: -190.272 Base-Backbone interact. energy: -0.737 local terms energy: -194.658651 where: bonds (distance) C4'-P energy: -41.198 bonds (distance) P-C4' energy: -34.410 flat angles C4'-P-C4' energy: -43.600 flat angles P-C4'-P energy: -19.598 tors. eta vs tors. theta energy: -55.854 Dist. restrs. and SS energy: 2.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -517.273166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.273166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.478972 (E_RNA) where: Base-Base interactions energy: -317.682 where: short stacking energy: -154.679 Base-Backbone interact. energy: -1.505 local terms energy: -200.291961 where: bonds (distance) C4'-P energy: -45.718 bonds (distance) P-C4' energy: -38.225 flat angles C4'-P-C4' energy: -44.515 flat angles P-C4'-P energy: -32.003 tors. eta vs tors. theta energy: -39.832 Dist. restrs. and SS energy: 2.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -445.663245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.663245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.695506 (E_RNA) where: Base-Base interactions energy: -270.840 where: short stacking energy: -135.332 Base-Backbone interact. energy: 1.968 local terms energy: -176.824065 where: bonds (distance) C4'-P energy: -35.800 bonds (distance) P-C4' energy: -42.538 flat angles C4'-P-C4' energy: -38.463 flat angles P-C4'-P energy: -23.947 tors. eta vs tors. theta energy: -36.077 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -379.331603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.331603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.786331 (E_RNA) where: Base-Base interactions energy: -218.138 where: short stacking energy: -118.699 Base-Backbone interact. energy: -0.306 local terms energy: -161.341874 where: bonds (distance) C4'-P energy: -35.733 bonds (distance) P-C4' energy: -39.600 flat angles C4'-P-C4' energy: -40.680 flat angles P-C4'-P energy: -24.516 tors. eta vs tors. theta energy: -20.814 Dist. restrs. and SS energy: 0.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -329.861557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.861557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.861557 (E_RNA) where: Base-Base interactions energy: -189.871 where: short stacking energy: -114.444 Base-Backbone interact. energy: 1.028 local terms energy: -141.018649 where: bonds (distance) C4'-P energy: -30.084 bonds (distance) P-C4' energy: -40.070 flat angles C4'-P-C4' energy: -32.277 flat angles P-C4'-P energy: -19.580 tors. eta vs tors. theta energy: -19.008 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -319.831359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.831359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.178858 (E_RNA) where: Base-Base interactions energy: -186.407 where: short stacking energy: -105.913 Base-Backbone interact. energy: 2.725 local terms energy: -136.496157 where: bonds (distance) C4'-P energy: -34.832 bonds (distance) P-C4' energy: -30.970 flat angles C4'-P-C4' energy: -35.162 flat angles P-C4'-P energy: -14.837 tors. eta vs tors. theta energy: -20.695 Dist. restrs. and SS energy: 0.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -288.725860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.725860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.896965 (E_RNA) where: Base-Base interactions energy: -153.064 where: short stacking energy: -94.154 Base-Backbone interact. energy: 0.215 local terms energy: -136.048465 where: bonds (distance) C4'-P energy: -39.941 bonds (distance) P-C4' energy: -39.933 flat angles C4'-P-C4' energy: -25.011 flat angles P-C4'-P energy: -21.641 tors. eta vs tors. theta energy: -9.523 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -269.881642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.881642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.956946 (E_RNA) where: Base-Base interactions energy: -137.079 where: short stacking energy: -81.024 Base-Backbone interact. energy: 0.013 local terms energy: -132.890498 where: bonds (distance) C4'-P energy: -32.749 bonds (distance) P-C4' energy: -32.868 flat angles C4'-P-C4' energy: -31.857 flat angles P-C4'-P energy: -12.541 tors. eta vs tors. theta energy: -22.875 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -221.506286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.506286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.024202 (E_RNA) where: Base-Base interactions energy: -115.120 where: short stacking energy: -87.023 Base-Backbone interact. energy: 0.502 local terms energy: -108.406247 where: bonds (distance) C4'-P energy: -36.769 bonds (distance) P-C4' energy: -22.975 flat angles C4'-P-C4' energy: -20.701 flat angles P-C4'-P energy: -23.020 tors. eta vs tors. theta energy: -4.940 Dist. restrs. and SS energy: 1.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -223.314136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.314136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.335914 (E_RNA) where: Base-Base interactions energy: -107.232 where: short stacking energy: -59.487 Base-Backbone interact. energy: -0.431 local terms energy: -116.672840 where: bonds (distance) C4'-P energy: -25.929 bonds (distance) P-C4' energy: -30.571 flat angles C4'-P-C4' energy: -34.119 flat angles P-C4'-P energy: -15.458 tors. eta vs tors. theta energy: -10.597 Dist. restrs. and SS energy: 1.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -551.919594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.919594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.149458 (E_RNA) where: Base-Base interactions energy: -345.957 where: short stacking energy: -182.009 Base-Backbone interact. energy: -0.252 local terms energy: -207.941175 where: bonds (distance) C4'-P energy: -41.440 bonds (distance) P-C4' energy: -42.377 flat angles C4'-P-C4' energy: -41.157 flat angles P-C4'-P energy: -31.058 tors. eta vs tors. theta energy: -51.908 Dist. restrs. and SS energy: 2.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -519.011070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.011070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.693902 (E_RNA) where: Base-Base interactions energy: -335.597 where: short stacking energy: -158.714 Base-Backbone interact. energy: -2.100 local terms energy: -182.997269 where: bonds (distance) C4'-P energy: -41.434 bonds (distance) P-C4' energy: -45.498 flat angles C4'-P-C4' energy: -34.391 flat angles P-C4'-P energy: -20.242 tors. eta vs tors. theta energy: -41.433 Dist. restrs. and SS energy: 1.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -434.922101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.922101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.922101 (E_RNA) where: Base-Base interactions energy: -274.448 where: short stacking energy: -142.785 Base-Backbone interact. energy: -1.667 local terms energy: -158.806404 where: bonds (distance) C4'-P energy: -33.586 bonds (distance) P-C4' energy: -36.246 flat angles C4'-P-C4' energy: -40.081 flat angles P-C4'-P energy: -19.567 tors. eta vs tors. theta energy: -29.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -401.383277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.383277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.383277 (E_RNA) where: Base-Base interactions energy: -240.068 where: short stacking energy: -134.345 Base-Backbone interact. energy: 0.046 local terms energy: -161.361384 where: bonds (distance) C4'-P energy: -34.358 bonds (distance) P-C4' energy: -35.513 flat angles C4'-P-C4' energy: -35.699 flat angles P-C4'-P energy: -28.088 tors. eta vs tors. theta energy: -27.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -327.003760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.003760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.051853 (E_RNA) where: Base-Base interactions energy: -175.248 where: short stacking energy: -116.074 Base-Backbone interact. energy: 1.294 local terms energy: -153.098182 where: bonds (distance) C4'-P energy: -32.301 bonds (distance) P-C4' energy: -41.212 flat angles C4'-P-C4' energy: -38.754 flat angles P-C4'-P energy: -20.968 tors. eta vs tors. theta energy: -19.864 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -328.119938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.119938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.373714 (E_RNA) where: Base-Base interactions energy: -169.121 where: short stacking energy: -109.035 Base-Backbone interact. energy: 0.020 local terms energy: -159.273156 where: bonds (distance) C4'-P energy: -39.721 bonds (distance) P-C4' energy: -33.456 flat angles C4'-P-C4' energy: -31.332 flat angles P-C4'-P energy: -32.081 tors. eta vs tors. theta energy: -22.682 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -281.922696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.922696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.955439 (E_RNA) where: Base-Base interactions energy: -140.083 where: short stacking energy: -77.338 Base-Backbone interact. energy: -0.424 local terms energy: -141.447821 where: bonds (distance) C4'-P energy: -34.317 bonds (distance) P-C4' energy: -35.415 flat angles C4'-P-C4' energy: -35.474 flat angles P-C4'-P energy: -19.525 tors. eta vs tors. theta energy: -16.716 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -274.996722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.996722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.013240 (E_RNA) where: Base-Base interactions energy: -148.827 where: short stacking energy: -72.944 Base-Backbone interact. energy: 1.808 local terms energy: -127.994311 where: bonds (distance) C4'-P energy: -39.663 bonds (distance) P-C4' energy: -29.190 flat angles C4'-P-C4' energy: -31.329 flat angles P-C4'-P energy: -23.574 tors. eta vs tors. theta energy: -4.238 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -243.198076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.198076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.376499 (E_RNA) where: Base-Base interactions energy: -116.336 where: short stacking energy: -67.269 Base-Backbone interact. energy: -0.285 local terms energy: -126.755033 where: bonds (distance) C4'-P energy: -36.757 bonds (distance) P-C4' energy: -33.535 flat angles C4'-P-C4' energy: -31.650 flat angles P-C4'-P energy: -19.396 tors. eta vs tors. theta energy: -5.418 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -225.421874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.421874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.748495 (E_RNA) where: Base-Base interactions energy: -112.473 where: short stacking energy: -65.861 Base-Backbone interact. energy: 0.517 local terms energy: -113.793449 where: bonds (distance) C4'-P energy: -38.414 bonds (distance) P-C4' energy: -24.602 flat angles C4'-P-C4' energy: -27.288 flat angles P-C4'-P energy: -24.087 tors. eta vs tors. theta energy: 0.598 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -535.486112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.486112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.335593 (E_RNA) where: Base-Base interactions energy: -337.854 where: short stacking energy: -168.915 Base-Backbone interact. energy: -0.732 local terms energy: -198.749928 where: bonds (distance) C4'-P energy: -36.478 bonds (distance) P-C4' energy: -38.790 flat angles C4'-P-C4' energy: -40.179 flat angles P-C4'-P energy: -35.153 tors. eta vs tors. theta energy: -48.150 Dist. restrs. and SS energy: 1.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -533.176995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.176995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.666742 (E_RNA) where: Base-Base interactions energy: -333.439 where: short stacking energy: -165.089 Base-Backbone interact. energy: -0.697 local terms energy: -200.531287 where: bonds (distance) C4'-P energy: -39.699 bonds (distance) P-C4' energy: -45.093 flat angles C4'-P-C4' energy: -43.241 flat angles P-C4'-P energy: -29.033 tors. eta vs tors. theta energy: -43.464 Dist. restrs. and SS energy: 1.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -417.423946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.423946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.423946 (E_RNA) where: Base-Base interactions energy: -268.196 where: short stacking energy: -118.654 Base-Backbone interact. energy: 2.951 local terms energy: -152.178101 where: bonds (distance) C4'-P energy: -39.539 bonds (distance) P-C4' energy: -28.926 flat angles C4'-P-C4' energy: -36.631 flat angles P-C4'-P energy: -23.998 tors. eta vs tors. theta energy: -23.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -406.511542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.511542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.207312 (E_RNA) where: Base-Base interactions energy: -230.376 where: short stacking energy: -128.497 Base-Backbone interact. energy: -0.504 local terms energy: -176.327368 where: bonds (distance) C4'-P energy: -36.459 bonds (distance) P-C4' energy: -38.213 flat angles C4'-P-C4' energy: -34.333 flat angles P-C4'-P energy: -28.917 tors. eta vs tors. theta energy: -38.406 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -328.953013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.953013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.199959 (E_RNA) where: Base-Base interactions energy: -177.459 where: short stacking energy: -106.345 Base-Backbone interact. energy: -2.002 local terms energy: -149.738618 where: bonds (distance) C4'-P energy: -33.385 bonds (distance) P-C4' energy: -36.852 flat angles C4'-P-C4' energy: -37.079 flat angles P-C4'-P energy: -27.128 tors. eta vs tors. theta energy: -15.294 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -286.381726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.381726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.433573 (E_RNA) where: Base-Base interactions energy: -154.324 where: short stacking energy: -78.767 Base-Backbone interact. energy: -0.798 local terms energy: -131.311129 where: bonds (distance) C4'-P energy: -29.151 bonds (distance) P-C4' energy: -35.727 flat angles C4'-P-C4' energy: -29.636 flat angles P-C4'-P energy: -27.858 tors. eta vs tors. theta energy: -8.940 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -282.038195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.038195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.123475 (E_RNA) where: Base-Base interactions energy: -159.175 where: short stacking energy: -96.636 Base-Backbone interact. energy: -0.706 local terms energy: -122.242422 where: bonds (distance) C4'-P energy: -32.428 bonds (distance) P-C4' energy: -37.892 flat angles C4'-P-C4' energy: -13.284 flat angles P-C4'-P energy: -20.318 tors. eta vs tors. theta energy: -18.321 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -244.387669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.387669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.486337 (E_RNA) where: Base-Base interactions energy: -125.556 where: short stacking energy: -68.811 Base-Backbone interact. energy: -0.482 local terms energy: -118.448280 where: bonds (distance) C4'-P energy: -38.068 bonds (distance) P-C4' energy: -33.564 flat angles C4'-P-C4' energy: -25.657 flat angles P-C4'-P energy: -17.539 tors. eta vs tors. theta energy: -3.620 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -273.499909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.499909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.160867 (E_RNA) where: Base-Base interactions energy: -147.023 where: short stacking energy: -81.216 Base-Backbone interact. energy: 0.455 local terms energy: -127.593529 where: bonds (distance) C4'-P energy: -31.307 bonds (distance) P-C4' energy: -38.596 flat angles C4'-P-C4' energy: -26.710 flat angles P-C4'-P energy: -18.466 tors. eta vs tors. theta energy: -12.514 Dist. restrs. and SS energy: 0.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -222.244765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.244765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.312398 (E_RNA) where: Base-Base interactions energy: -104.025 where: short stacking energy: -53.727 Base-Backbone interact. energy: -0.544 local terms energy: -117.743785 where: bonds (distance) C4'-P energy: -28.381 bonds (distance) P-C4' energy: -33.034 flat angles C4'-P-C4' energy: -30.318 flat angles P-C4'-P energy: -17.118 tors. eta vs tors. theta energy: -8.894 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -529.202079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.202079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.652824 (E_RNA) where: Base-Base interactions energy: -340.723 where: short stacking energy: -162.805 Base-Backbone interact. energy: -0.542 local terms energy: -193.388371 where: bonds (distance) C4'-P energy: -31.887 bonds (distance) P-C4' energy: -44.840 flat angles C4'-P-C4' energy: -37.034 flat angles P-C4'-P energy: -31.274 tors. eta vs tors. theta energy: -48.354 Dist. restrs. and SS energy: 5.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -522.629526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.629526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.237164 (E_RNA) where: Base-Base interactions energy: -337.412 where: short stacking energy: -168.510 Base-Backbone interact. energy: -1.228 local terms energy: -186.597512 where: bonds (distance) C4'-P energy: -31.001 bonds (distance) P-C4' energy: -39.994 flat angles C4'-P-C4' energy: -42.831 flat angles P-C4'-P energy: -26.908 tors. eta vs tors. theta energy: -45.863 Dist. restrs. and SS energy: 2.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -420.292814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.292814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.887100 (E_RNA) where: Base-Base interactions energy: -247.614 where: short stacking energy: -139.010 Base-Backbone interact. energy: -1.111 local terms energy: -172.162868 where: bonds (distance) C4'-P energy: -42.652 bonds (distance) P-C4' energy: -40.283 flat angles C4'-P-C4' energy: -36.405 flat angles P-C4'-P energy: -28.854 tors. eta vs tors. theta energy: -23.969 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -374.327679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.327679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.361172 (E_RNA) where: Base-Base interactions energy: -207.278 where: short stacking energy: -135.190 Base-Backbone interact. energy: 0.676 local terms energy: -167.759356 where: bonds (distance) C4'-P energy: -35.102 bonds (distance) P-C4' energy: -38.757 flat angles C4'-P-C4' energy: -35.411 flat angles P-C4'-P energy: -25.473 tors. eta vs tors. theta energy: -33.016 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -381.875471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.875471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.986734 (E_RNA) where: Base-Base interactions energy: -223.432 where: short stacking energy: -120.839 Base-Backbone interact. energy: -0.269 local terms energy: -158.285820 where: bonds (distance) C4'-P energy: -42.439 bonds (distance) P-C4' energy: -32.996 flat angles C4'-P-C4' energy: -37.650 flat angles P-C4'-P energy: -21.147 tors. eta vs tors. theta energy: -24.054 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -310.306813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.306813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.358643 (E_RNA) where: Base-Base interactions energy: -164.308 where: short stacking energy: -104.617 Base-Backbone interact. energy: -0.722 local terms energy: -145.329090 where: bonds (distance) C4'-P energy: -40.175 bonds (distance) P-C4' energy: -37.889 flat angles C4'-P-C4' energy: -31.957 flat angles P-C4'-P energy: -20.643 tors. eta vs tors. theta energy: -14.666 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -274.995140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.995140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.094142 (E_RNA) where: Base-Base interactions energy: -140.823 where: short stacking energy: -72.375 Base-Backbone interact. energy: 2.619 local terms energy: -136.889661 where: bonds (distance) C4'-P energy: -35.913 bonds (distance) P-C4' energy: -35.511 flat angles C4'-P-C4' energy: -32.160 flat angles P-C4'-P energy: -27.995 tors. eta vs tors. theta energy: -5.310 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -259.206931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.206931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.558024 (E_RNA) where: Base-Base interactions energy: -146.569 where: short stacking energy: -68.826 Base-Backbone interact. energy: -0.544 local terms energy: -113.445217 where: bonds (distance) C4'-P energy: -29.214 bonds (distance) P-C4' energy: -31.890 flat angles C4'-P-C4' energy: -31.910 flat angles P-C4'-P energy: -11.048 tors. eta vs tors. theta energy: -9.383 Dist. restrs. and SS energy: 1.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -254.402338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.402338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.781119 (E_RNA) where: Base-Base interactions energy: -126.091 where: short stacking energy: -71.158 Base-Backbone interact. energy: 1.132 local terms energy: -129.821442 where: bonds (distance) C4'-P energy: -40.030 bonds (distance) P-C4' energy: -30.428 flat angles C4'-P-C4' energy: -38.407 flat angles P-C4'-P energy: -19.748 tors. eta vs tors. theta energy: -1.208 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -206.140880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.140880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.243809 (E_RNA) where: Base-Base interactions energy: -94.063 where: short stacking energy: -53.025 Base-Backbone interact. energy: -0.332 local terms energy: -112.848753 where: bonds (distance) C4'-P energy: -29.762 bonds (distance) P-C4' energy: -38.782 flat angles C4'-P-C4' energy: -31.224 flat angles P-C4'-P energy: -19.197 tors. eta vs tors. theta energy: 6.116 Dist. restrs. and SS energy: 1.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -541.667542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.667542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.167809 (E_RNA) where: Base-Base interactions energy: -354.804 where: short stacking energy: -164.510 Base-Backbone interact. energy: 1.304 local terms energy: -189.667151 where: bonds (distance) C4'-P energy: -39.084 bonds (distance) P-C4' energy: -39.062 flat angles C4'-P-C4' energy: -39.756 flat angles P-C4'-P energy: -28.694 tors. eta vs tors. theta energy: -43.071 Dist. restrs. and SS energy: 1.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -501.723630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.723630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.217940 (E_RNA) where: Base-Base interactions energy: -313.279 where: short stacking energy: -153.885 Base-Backbone interact. energy: -1.552 local terms energy: -188.387118 where: bonds (distance) C4'-P energy: -43.534 bonds (distance) P-C4' energy: -41.970 flat angles C4'-P-C4' energy: -37.317 flat angles P-C4'-P energy: -23.544 tors. eta vs tors. theta energy: -42.022 Dist. restrs. and SS energy: 1.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -391.390826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.390826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.433849 (E_RNA) where: Base-Base interactions energy: -233.201 where: short stacking energy: -118.614 Base-Backbone interact. energy: -0.634 local terms energy: -157.598865 where: bonds (distance) C4'-P energy: -42.771 bonds (distance) P-C4' energy: -40.038 flat angles C4'-P-C4' energy: -28.402 flat angles P-C4'-P energy: -21.628 tors. eta vs tors. theta energy: -24.760 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -358.341409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.341409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.341409 (E_RNA) where: Base-Base interactions energy: -199.628 where: short stacking energy: -126.627 Base-Backbone interact. energy: -0.337 local terms energy: -158.376751 where: bonds (distance) C4'-P energy: -33.505 bonds (distance) P-C4' energy: -42.496 flat angles C4'-P-C4' energy: -32.655 flat angles P-C4'-P energy: -22.453 tors. eta vs tors. theta energy: -27.267 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -384.871237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.871237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.895680 (E_RNA) where: Base-Base interactions energy: -216.826 where: short stacking energy: -138.771 Base-Backbone interact. energy: -0.347 local terms energy: -167.722793 where: bonds (distance) C4'-P energy: -40.392 bonds (distance) P-C4' energy: -33.641 flat angles C4'-P-C4' energy: -38.607 flat angles P-C4'-P energy: -26.828 tors. eta vs tors. theta energy: -28.256 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -305.484691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.484691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.378010 (E_RNA) where: Base-Base interactions energy: -148.488 where: short stacking energy: -85.358 Base-Backbone interact. energy: -0.414 local terms energy: -157.476504 where: bonds (distance) C4'-P energy: -37.717 bonds (distance) P-C4' energy: -42.750 flat angles C4'-P-C4' energy: -32.262 flat angles P-C4'-P energy: -23.405 tors. eta vs tors. theta energy: -21.344 Dist. restrs. and SS energy: 0.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -309.036400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.036400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.239589 (E_RNA) where: Base-Base interactions energy: -161.991 where: short stacking energy: -89.573 Base-Backbone interact. energy: -0.668 local terms energy: -146.581290 where: bonds (distance) C4'-P energy: -33.344 bonds (distance) P-C4' energy: -40.526 flat angles C4'-P-C4' energy: -30.917 flat angles P-C4'-P energy: -20.161 tors. eta vs tors. theta energy: -21.633 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -252.598812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.598812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.561255 (E_RNA) where: Base-Base interactions energy: -143.141 where: short stacking energy: -89.027 Base-Backbone interact. energy: -0.902 local terms energy: -114.518895 where: bonds (distance) C4'-P energy: -35.017 bonds (distance) P-C4' energy: -19.051 flat angles C4'-P-C4' energy: -35.010 flat angles P-C4'-P energy: -16.589 tors. eta vs tors. theta energy: -8.853 Dist. restrs. and SS energy: 5.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -251.888008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.888008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.985410 (E_RNA) where: Base-Base interactions energy: -127.091 where: short stacking energy: -72.022 Base-Backbone interact. energy: -0.187 local terms energy: -124.707749 where: bonds (distance) C4'-P energy: -31.705 bonds (distance) P-C4' energy: -36.726 flat angles C4'-P-C4' energy: -28.295 flat angles P-C4'-P energy: -25.650 tors. eta vs tors. theta energy: -2.332 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -221.977106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.977106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.076241 (E_RNA) where: Base-Base interactions energy: -110.488 where: short stacking energy: -57.594 Base-Backbone interact. energy: -0.494 local terms energy: -111.093687 where: bonds (distance) C4'-P energy: -27.758 bonds (distance) P-C4' energy: -25.640 flat angles C4'-P-C4' energy: -25.124 flat angles P-C4'-P energy: -30.676 tors. eta vs tors. theta energy: -1.895 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -561.278984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.278984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.176514 (E_RNA) where: Base-Base interactions energy: -355.330 where: short stacking energy: -186.026 Base-Backbone interact. energy: -0.294 local terms energy: -207.553092 where: bonds (distance) C4'-P energy: -37.713 bonds (distance) P-C4' energy: -44.227 flat angles C4'-P-C4' energy: -44.151 flat angles P-C4'-P energy: -32.481 tors. eta vs tors. theta energy: -48.982 Dist. restrs. and SS energy: 1.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -490.570403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.570403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.974988 (E_RNA) where: Base-Base interactions energy: -306.375 where: short stacking energy: -154.288 Base-Backbone interact. energy: -1.491 local terms energy: -184.109229 where: bonds (distance) C4'-P energy: -24.904 bonds (distance) P-C4' energy: -43.714 flat angles C4'-P-C4' energy: -38.151 flat angles P-C4'-P energy: -32.218 tors. eta vs tors. theta energy: -45.122 Dist. restrs. and SS energy: 1.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -438.409546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.409546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.446453 (E_RNA) where: Base-Base interactions energy: -258.804 where: short stacking energy: -144.948 Base-Backbone interact. energy: 0.869 local terms energy: -180.511024 where: bonds (distance) C4'-P energy: -29.958 bonds (distance) P-C4' energy: -43.094 flat angles C4'-P-C4' energy: -44.594 flat angles P-C4'-P energy: -30.107 tors. eta vs tors. theta energy: -32.758 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -405.908933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.908933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.994973 (E_RNA) where: Base-Base interactions energy: -241.654 where: short stacking energy: -130.831 Base-Backbone interact. energy: -0.641 local terms energy: -163.700559 where: bonds (distance) C4'-P energy: -36.892 bonds (distance) P-C4' energy: -42.333 flat angles C4'-P-C4' energy: -38.197 flat angles P-C4'-P energy: -23.450 tors. eta vs tors. theta energy: -22.829 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -345.764116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.764116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.865274 (E_RNA) where: Base-Base interactions energy: -187.553 where: short stacking energy: -114.459 Base-Backbone interact. energy: -0.905 local terms energy: -157.407711 where: bonds (distance) C4'-P energy: -41.115 bonds (distance) P-C4' energy: -37.997 flat angles C4'-P-C4' energy: -28.514 flat angles P-C4'-P energy: -24.157 tors. eta vs tors. theta energy: -25.625 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -318.995421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.995421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.996966 (E_RNA) where: Base-Base interactions energy: -172.590 where: short stacking energy: -111.526 Base-Backbone interact. energy: -0.264 local terms energy: -146.142720 where: bonds (distance) C4'-P energy: -39.833 bonds (distance) P-C4' energy: -30.202 flat angles C4'-P-C4' energy: -34.754 flat angles P-C4'-P energy: -20.360 tors. eta vs tors. theta energy: -20.994 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -294.274483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.274483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.283168 (E_RNA) where: Base-Base interactions energy: -162.604 where: short stacking energy: -95.088 Base-Backbone interact. energy: -0.392 local terms energy: -131.287311 where: bonds (distance) C4'-P energy: -28.134 bonds (distance) P-C4' energy: -36.887 flat angles C4'-P-C4' energy: -38.359 flat angles P-C4'-P energy: -19.866 tors. eta vs tors. theta energy: -8.042 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -253.603498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.603498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.335714 (E_RNA) where: Base-Base interactions energy: -122.994 where: short stacking energy: -57.593 Base-Backbone interact. energy: 0.685 local terms energy: -132.026406 where: bonds (distance) C4'-P energy: -31.367 bonds (distance) P-C4' energy: -38.322 flat angles C4'-P-C4' energy: -41.023 flat angles P-C4'-P energy: -19.593 tors. eta vs tors. theta energy: -1.722 Dist. restrs. and SS energy: 0.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -230.064571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.064571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.334884 (E_RNA) where: Base-Base interactions energy: -114.569 where: short stacking energy: -54.982 Base-Backbone interact. energy: 1.305 local terms energy: -120.070084 where: bonds (distance) C4'-P energy: -33.978 bonds (distance) P-C4' energy: -34.422 flat angles C4'-P-C4' energy: -27.728 flat angles P-C4'-P energy: -20.725 tors. eta vs tors. theta energy: -3.217 Dist. restrs. and SS energy: 3.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -227.449335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.449335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.544095 (E_RNA) where: Base-Base interactions energy: -112.626 where: short stacking energy: -67.872 Base-Backbone interact. energy: 0.473 local terms energy: -115.391173 where: bonds (distance) C4'-P energy: -32.633 bonds (distance) P-C4' energy: -35.134 flat angles C4'-P-C4' energy: -30.396 flat angles P-C4'-P energy: -11.724 tors. eta vs tors. theta energy: -5.505 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -528.853065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.853065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.112715 (E_RNA) where: Base-Base interactions energy: -334.569 where: short stacking energy: -164.766 Base-Backbone interact. energy: -2.652 local terms energy: -192.891886 where: bonds (distance) C4'-P energy: -38.861 bonds (distance) P-C4' energy: -36.493 flat angles C4'-P-C4' energy: -40.588 flat angles P-C4'-P energy: -27.627 tors. eta vs tors. theta energy: -49.322 Dist. restrs. and SS energy: 1.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -523.411742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.411742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.460783 (E_RNA) where: Base-Base interactions energy: -334.183 where: short stacking energy: -165.466 Base-Backbone interact. energy: 0.664 local terms energy: -192.942501 where: bonds (distance) C4'-P energy: -42.664 bonds (distance) P-C4' energy: -39.120 flat angles C4'-P-C4' energy: -39.176 flat angles P-C4'-P energy: -23.218 tors. eta vs tors. theta energy: -48.764 Dist. restrs. and SS energy: 3.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -407.078870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.078870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.222227 (E_RNA) where: Base-Base interactions energy: -236.443 where: short stacking energy: -136.935 Base-Backbone interact. energy: -0.389 local terms energy: -170.389878 where: bonds (distance) C4'-P energy: -30.835 bonds (distance) P-C4' energy: -36.351 flat angles C4'-P-C4' energy: -36.727 flat angles P-C4'-P energy: -27.578 tors. eta vs tors. theta energy: -38.899 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -396.729686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.729686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.734781 (E_RNA) where: Base-Base interactions energy: -242.879 where: short stacking energy: -123.298 Base-Backbone interact. energy: 0.307 local terms energy: -154.162491 where: bonds (distance) C4'-P energy: -36.788 bonds (distance) P-C4' energy: -38.537 flat angles C4'-P-C4' energy: -37.484 flat angles P-C4'-P energy: -21.743 tors. eta vs tors. theta energy: -19.610 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -345.113619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.113619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.145760 (E_RNA) where: Base-Base interactions energy: -183.778 where: short stacking energy: -120.271 Base-Backbone interact. energy: -0.319 local terms energy: -161.048680 where: bonds (distance) C4'-P energy: -36.400 bonds (distance) P-C4' energy: -34.508 flat angles C4'-P-C4' energy: -39.805 flat angles P-C4'-P energy: -25.239 tors. eta vs tors. theta energy: -25.097 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -324.420668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.420668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.548112 (E_RNA) where: Base-Base interactions energy: -187.654 where: short stacking energy: -98.462 Base-Backbone interact. energy: -1.368 local terms energy: -135.525663 where: bonds (distance) C4'-P energy: -34.339 bonds (distance) P-C4' energy: -34.669 flat angles C4'-P-C4' energy: -25.261 flat angles P-C4'-P energy: -30.424 tors. eta vs tors. theta energy: -10.833 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -275.108817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.108817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.108817 (E_RNA) where: Base-Base interactions energy: -148.943 where: short stacking energy: -96.638 Base-Backbone interact. energy: -1.323 local terms energy: -124.843093 where: bonds (distance) C4'-P energy: -36.123 bonds (distance) P-C4' energy: -33.261 flat angles C4'-P-C4' energy: -29.383 flat angles P-C4'-P energy: -12.702 tors. eta vs tors. theta energy: -13.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -246.268981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.268981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.665730 (E_RNA) where: Base-Base interactions energy: -124.296 where: short stacking energy: -81.747 Base-Backbone interact. energy: -0.846 local terms energy: -121.523678 where: bonds (distance) C4'-P energy: -18.734 bonds (distance) P-C4' energy: -29.053 flat angles C4'-P-C4' energy: -29.949 flat angles P-C4'-P energy: -27.876 tors. eta vs tors. theta energy: -15.911 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -237.610664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.610664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.676697 (E_RNA) where: Base-Base interactions energy: -112.031 where: short stacking energy: -61.694 Base-Backbone interact. energy: 4.924 local terms energy: -130.569964 where: bonds (distance) C4'-P energy: -34.402 bonds (distance) P-C4' energy: -36.368 flat angles C4'-P-C4' energy: -31.962 flat angles P-C4'-P energy: -21.790 tors. eta vs tors. theta energy: -6.049 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -231.453931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.453931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.858440 (E_RNA) where: Base-Base interactions energy: -123.879 where: short stacking energy: -50.326 Base-Backbone interact. energy: 1.113 local terms energy: -109.092455 where: bonds (distance) C4'-P energy: -32.239 bonds (distance) P-C4' energy: -31.838 flat angles C4'-P-C4' energy: -28.028 flat angles P-C4'-P energy: -13.666 tors. eta vs tors. theta energy: -3.321 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -509.741609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.741609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.438071 (E_RNA) where: Base-Base interactions energy: -323.828 where: short stacking energy: -163.824 Base-Backbone interact. energy: -0.463 local terms energy: -186.147361 where: bonds (distance) C4'-P energy: -41.840 bonds (distance) P-C4' energy: -38.917 flat angles C4'-P-C4' energy: -42.519 flat angles P-C4'-P energy: -27.027 tors. eta vs tors. theta energy: -35.845 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -524.702612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.702612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.008154 (E_RNA) where: Base-Base interactions energy: -331.348 where: short stacking energy: -172.316 Base-Backbone interact. energy: -0.695 local terms energy: -193.965853 where: bonds (distance) C4'-P energy: -39.579 bonds (distance) P-C4' energy: -42.253 flat angles C4'-P-C4' energy: -38.256 flat angles P-C4'-P energy: -24.283 tors. eta vs tors. theta energy: -49.595 Dist. restrs. and SS energy: 1.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -405.432973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.432973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.512359 (E_RNA) where: Base-Base interactions energy: -225.587 where: short stacking energy: -136.120 Base-Backbone interact. energy: -0.674 local terms energy: -179.251277 where: bonds (distance) C4'-P energy: -36.747 bonds (distance) P-C4' energy: -43.494 flat angles C4'-P-C4' energy: -45.046 flat angles P-C4'-P energy: -31.113 tors. eta vs tors. theta energy: -22.851 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -414.039383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.039383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.077690 (E_RNA) where: Base-Base interactions energy: -252.881 where: short stacking energy: -139.533 Base-Backbone interact. energy: -0.559 local terms energy: -160.638481 where: bonds (distance) C4'-P energy: -37.474 bonds (distance) P-C4' energy: -33.311 flat angles C4'-P-C4' energy: -38.255 flat angles P-C4'-P energy: -20.233 tors. eta vs tors. theta energy: -31.365 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -336.849888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.849888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.912079 (E_RNA) where: Base-Base interactions energy: -189.954 where: short stacking energy: -118.255 Base-Backbone interact. energy: -0.312 local terms energy: -146.646793 where: bonds (distance) C4'-P energy: -29.804 bonds (distance) P-C4' energy: -35.661 flat angles C4'-P-C4' energy: -36.933 flat angles P-C4'-P energy: -21.264 tors. eta vs tors. theta energy: -22.985 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -339.324085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.324085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.324085 (E_RNA) where: Base-Base interactions energy: -180.843 where: short stacking energy: -108.591 Base-Backbone interact. energy: 0.820 local terms energy: -159.301749 where: bonds (distance) C4'-P energy: -42.646 bonds (distance) P-C4' energy: -35.171 flat angles C4'-P-C4' energy: -39.691 flat angles P-C4'-P energy: -19.684 tors. eta vs tors. theta energy: -22.109 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -295.359889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.359889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.408456 (E_RNA) where: Base-Base interactions energy: -152.198 where: short stacking energy: -102.394 Base-Backbone interact. energy: -0.562 local terms energy: -142.648123 where: bonds (distance) C4'-P energy: -29.159 bonds (distance) P-C4' energy: -38.019 flat angles C4'-P-C4' energy: -38.291 flat angles P-C4'-P energy: -15.722 tors. eta vs tors. theta energy: -21.457 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -296.889676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.889676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.357055 (E_RNA) where: Base-Base interactions energy: -150.932 where: short stacking energy: -91.479 Base-Backbone interact. energy: -0.266 local terms energy: -146.158178 where: bonds (distance) C4'-P energy: -33.774 bonds (distance) P-C4' energy: -35.108 flat angles C4'-P-C4' energy: -30.342 flat angles P-C4'-P energy: -21.341 tors. eta vs tors. theta energy: -25.592 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -234.622623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.622623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.422526 (E_RNA) where: Base-Base interactions energy: -109.554 where: short stacking energy: -61.572 Base-Backbone interact. energy: -1.188 local terms energy: -126.679801 where: bonds (distance) C4'-P energy: -27.607 bonds (distance) P-C4' energy: -37.907 flat angles C4'-P-C4' energy: -31.799 flat angles P-C4'-P energy: -18.795 tors. eta vs tors. theta energy: -10.571 Dist. restrs. and SS energy: 2.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -202.372851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.372851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.729428 (E_RNA) where: Base-Base interactions energy: -93.264 where: short stacking energy: -50.160 Base-Backbone interact. energy: -0.800 local terms energy: -108.665425 where: bonds (distance) C4'-P energy: -33.697 bonds (distance) P-C4' energy: -36.338 flat angles C4'-P-C4' energy: -33.027 flat angles P-C4'-P energy: -15.095 tors. eta vs tors. theta energy: 9.491 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -533.595084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.595084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.563407 (E_RNA) where: Base-Base interactions energy: -337.434 where: short stacking energy: -176.156 Base-Backbone interact. energy: -1.280 local terms energy: -196.849583 where: bonds (distance) C4'-P energy: -38.731 bonds (distance) P-C4' energy: -44.422 flat angles C4'-P-C4' energy: -45.748 flat angles P-C4'-P energy: -25.031 tors. eta vs tors. theta energy: -42.918 Dist. restrs. and SS energy: 1.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -497.662536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.662536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.235641 (E_RNA) where: Base-Base interactions energy: -306.001 where: short stacking energy: -157.782 Base-Backbone interact. energy: 0.506 local terms energy: -194.740393 where: bonds (distance) C4'-P energy: -46.569 bonds (distance) P-C4' energy: -38.840 flat angles C4'-P-C4' energy: -42.682 flat angles P-C4'-P energy: -29.453 tors. eta vs tors. theta energy: -37.197 Dist. restrs. and SS energy: 2.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -407.614389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.614389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.716665 (E_RNA) where: Base-Base interactions energy: -233.401 where: short stacking energy: -126.598 Base-Backbone interact. energy: -0.349 local terms energy: -173.966494 where: bonds (distance) C4'-P energy: -34.991 bonds (distance) P-C4' energy: -39.316 flat angles C4'-P-C4' energy: -41.005 flat angles P-C4'-P energy: -28.454 tors. eta vs tors. theta energy: -30.200 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -424.897316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.897316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.027529 (E_RNA) where: Base-Base interactions energy: -250.111 where: short stacking energy: -134.478 Base-Backbone interact. energy: -0.539 local terms energy: -175.377525 where: bonds (distance) C4'-P energy: -41.182 bonds (distance) P-C4' energy: -42.584 flat angles C4'-P-C4' energy: -40.191 flat angles P-C4'-P energy: -25.700 tors. eta vs tors. theta energy: -25.722 Dist. restrs. and SS energy: 1.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -322.084866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.084866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.161071 (E_RNA) where: Base-Base interactions energy: -183.943 where: short stacking energy: -91.195 Base-Backbone interact. energy: 0.649 local terms energy: -138.867359 where: bonds (distance) C4'-P energy: -36.355 bonds (distance) P-C4' energy: -32.101 flat angles C4'-P-C4' energy: -34.768 flat angles P-C4'-P energy: -22.912 tors. eta vs tors. theta energy: -12.732 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -300.734518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.734518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.887893 (E_RNA) where: Base-Base interactions energy: -153.050 where: short stacking energy: -92.211 Base-Backbone interact. energy: -0.426 local terms energy: -147.411995 where: bonds (distance) C4'-P energy: -36.145 bonds (distance) P-C4' energy: -40.071 flat angles C4'-P-C4' energy: -29.931 flat angles P-C4'-P energy: -24.602 tors. eta vs tors. theta energy: -16.663 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -305.447118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.447118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.689717 (E_RNA) where: Base-Base interactions energy: -188.808 where: short stacking energy: -103.538 Base-Backbone interact. energy: -0.602 local terms energy: -116.279664 where: bonds (distance) C4'-P energy: -21.322 bonds (distance) P-C4' energy: -29.208 flat angles C4'-P-C4' energy: -24.397 flat angles P-C4'-P energy: -24.329 tors. eta vs tors. theta energy: -17.023 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -272.765928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.765928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.279351 (E_RNA) where: Base-Base interactions energy: -126.958 where: short stacking energy: -81.830 Base-Backbone interact. energy: -0.440 local terms energy: -145.881277 where: bonds (distance) C4'-P energy: -35.079 bonds (distance) P-C4' energy: -38.341 flat angles C4'-P-C4' energy: -37.516 flat angles P-C4'-P energy: -18.241 tors. eta vs tors. theta energy: -16.704 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -244.624219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.624219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.358444 (E_RNA) where: Base-Base interactions energy: -136.291 where: short stacking energy: -68.686 Base-Backbone interact. energy: -0.140 local terms energy: -109.927704 where: bonds (distance) C4'-P energy: -25.070 bonds (distance) P-C4' energy: -38.573 flat angles C4'-P-C4' energy: -33.528 flat angles P-C4'-P energy: -13.460 tors. eta vs tors. theta energy: 0.703 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -216.346455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.346455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.136078 (E_RNA) where: Base-Base interactions energy: -115.284 where: short stacking energy: -73.125 Base-Backbone interact. energy: -0.867 local terms energy: -100.984867 where: bonds (distance) C4'-P energy: -28.415 bonds (distance) P-C4' energy: -27.857 flat angles C4'-P-C4' energy: -18.141 flat angles P-C4'-P energy: -16.478 tors. eta vs tors. theta energy: -10.094 Dist. restrs. and SS energy: 0.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -554.214851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.214851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.604743 (E_RNA) where: Base-Base interactions energy: -367.873 where: short stacking energy: -195.594 Base-Backbone interact. energy: -1.049 local terms energy: -186.681859 where: bonds (distance) C4'-P energy: -30.191 bonds (distance) P-C4' energy: -40.135 flat angles C4'-P-C4' energy: -38.688 flat angles P-C4'-P energy: -28.776 tors. eta vs tors. theta energy: -48.893 Dist. restrs. and SS energy: 1.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -480.266686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.266686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.192747 (E_RNA) where: Base-Base interactions energy: -306.886 where: short stacking energy: -162.784 Base-Backbone interact. energy: -0.223 local terms energy: -174.083179 where: bonds (distance) C4'-P energy: -33.513 bonds (distance) P-C4' energy: -28.463 flat angles C4'-P-C4' energy: -43.683 flat angles P-C4'-P energy: -26.354 tors. eta vs tors. theta energy: -42.070 Dist. restrs. and SS energy: 0.926 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -438.918532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.918532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.947011 (E_RNA) where: Base-Base interactions energy: -245.503 where: short stacking energy: -146.787 Base-Backbone interact. energy: -0.473 local terms energy: -192.971045 where: bonds (distance) C4'-P energy: -40.455 bonds (distance) P-C4' energy: -43.374 flat angles C4'-P-C4' energy: -39.677 flat angles P-C4'-P energy: -30.684 tors. eta vs tors. theta energy: -38.781 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -408.693917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.693917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.770059 (E_RNA) where: Base-Base interactions energy: -245.607 where: short stacking energy: -119.521 Base-Backbone interact. energy: 2.088 local terms energy: -165.251637 where: bonds (distance) C4'-P energy: -33.022 bonds (distance) P-C4' energy: -39.081 flat angles C4'-P-C4' energy: -44.720 flat angles P-C4'-P energy: -21.244 tors. eta vs tors. theta energy: -27.185 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -316.431490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.431490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.502894 (E_RNA) where: Base-Base interactions energy: -152.164 where: short stacking energy: -98.057 Base-Backbone interact. energy: -1.366 local terms energy: -162.972170 where: bonds (distance) C4'-P energy: -41.404 bonds (distance) P-C4' energy: -40.316 flat angles C4'-P-C4' energy: -41.537 flat angles P-C4'-P energy: -21.574 tors. eta vs tors. theta energy: -18.141 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -314.470496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.470496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.569023 (E_RNA) where: Base-Base interactions energy: -171.605 where: short stacking energy: -95.358 Base-Backbone interact. energy: -0.523 local terms energy: -142.441460 where: bonds (distance) C4'-P energy: -28.376 bonds (distance) P-C4' energy: -32.476 flat angles C4'-P-C4' energy: -42.109 flat angles P-C4'-P energy: -22.176 tors. eta vs tors. theta energy: -17.303 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -347.291858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.291858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.694869 (E_RNA) where: Base-Base interactions energy: -196.667 where: short stacking energy: -100.234 Base-Backbone interact. energy: -0.235 local terms energy: -150.792661 where: bonds (distance) C4'-P energy: -38.470 bonds (distance) P-C4' energy: -38.829 flat angles C4'-P-C4' energy: -30.934 flat angles P-C4'-P energy: -20.838 tors. eta vs tors. theta energy: -21.721 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -245.406465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.406465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.771875 (E_RNA) where: Base-Base interactions energy: -116.784 where: short stacking energy: -67.469 Base-Backbone interact. energy: 0.122 local terms energy: -131.110328 where: bonds (distance) C4'-P energy: -37.734 bonds (distance) P-C4' energy: -33.195 flat angles C4'-P-C4' energy: -30.026 flat angles P-C4'-P energy: -25.193 tors. eta vs tors. theta energy: -4.962 Dist. restrs. and SS energy: 2.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -245.447609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.447609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.524733 (E_RNA) where: Base-Base interactions energy: -124.983 where: short stacking energy: -62.536 Base-Backbone interact. energy: -0.604 local terms energy: -119.937825 where: bonds (distance) C4'-P energy: -34.915 bonds (distance) P-C4' energy: -32.967 flat angles C4'-P-C4' energy: -28.810 flat angles P-C4'-P energy: -25.908 tors. eta vs tors. theta energy: 2.661 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -229.972349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.972349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.054107 (E_RNA) where: Base-Base interactions energy: -105.710 where: short stacking energy: -64.534 Base-Backbone interact. energy: 0.295 local terms energy: -127.639445 where: bonds (distance) C4'-P energy: -30.231 bonds (distance) P-C4' energy: -43.048 flat angles C4'-P-C4' energy: -31.438 flat angles P-C4'-P energy: -16.556 tors. eta vs tors. theta energy: -6.365 Dist. restrs. and SS energy: 3.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -541.708102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.708102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.903064 (E_RNA) where: Base-Base interactions energy: -349.590 where: short stacking energy: -162.861 Base-Backbone interact. energy: -1.494 local terms energy: -191.818705 where: bonds (distance) C4'-P energy: -40.516 bonds (distance) P-C4' energy: -39.127 flat angles C4'-P-C4' energy: -43.353 flat angles P-C4'-P energy: -26.985 tors. eta vs tors. theta energy: -41.838 Dist. restrs. and SS energy: 1.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -484.699775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.699775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.371188 (E_RNA) where: Base-Base interactions energy: -306.274 where: short stacking energy: -171.655 Base-Backbone interact. energy: 0.147 local terms energy: -179.244513 where: bonds (distance) C4'-P energy: -26.715 bonds (distance) P-C4' energy: -42.633 flat angles C4'-P-C4' energy: -44.275 flat angles P-C4'-P energy: -20.883 tors. eta vs tors. theta energy: -44.738 Dist. restrs. and SS energy: 0.671 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -431.582876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.582876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.582876 (E_RNA) where: Base-Base interactions energy: -267.545 where: short stacking energy: -142.975 Base-Backbone interact. energy: -0.513 local terms energy: -163.525317 where: bonds (distance) C4'-P energy: -27.848 bonds (distance) P-C4' energy: -39.202 flat angles C4'-P-C4' energy: -44.061 flat angles P-C4'-P energy: -22.044 tors. eta vs tors. theta energy: -30.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -404.370233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.370233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.507289 (E_RNA) where: Base-Base interactions energy: -242.421 where: short stacking energy: -140.050 Base-Backbone interact. energy: -0.385 local terms energy: -161.701118 where: bonds (distance) C4'-P energy: -37.543 bonds (distance) P-C4' energy: -38.286 flat angles C4'-P-C4' energy: -38.255 flat angles P-C4'-P energy: -15.365 tors. eta vs tors. theta energy: -32.253 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -332.391322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.391322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.562387 (E_RNA) where: Base-Base interactions energy: -184.779 where: short stacking energy: -114.763 Base-Backbone interact. energy: -1.366 local terms energy: -146.417207 where: bonds (distance) C4'-P energy: -34.985 bonds (distance) P-C4' energy: -36.926 flat angles C4'-P-C4' energy: -32.753 flat angles P-C4'-P energy: -19.319 tors. eta vs tors. theta energy: -22.434 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -319.762488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.762488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.922882 (E_RNA) where: Base-Base interactions energy: -163.091 where: short stacking energy: -104.297 Base-Backbone interact. energy: -0.070 local terms energy: -156.761403 where: bonds (distance) C4'-P energy: -29.800 bonds (distance) P-C4' energy: -38.110 flat angles C4'-P-C4' energy: -44.397 flat angles P-C4'-P energy: -19.601 tors. eta vs tors. theta energy: -24.852 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -335.128855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.128855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.225182 (E_RNA) where: Base-Base interactions energy: -185.892 where: short stacking energy: -95.328 Base-Backbone interact. energy: 1.431 local terms energy: -150.764224 where: bonds (distance) C4'-P energy: -41.371 bonds (distance) P-C4' energy: -41.647 flat angles C4'-P-C4' energy: -26.721 flat angles P-C4'-P energy: -24.850 tors. eta vs tors. theta energy: -16.175 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -255.155647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.155647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.973090 (E_RNA) where: Base-Base interactions energy: -133.011 where: short stacking energy: -90.633 Base-Backbone interact. energy: -0.937 local terms energy: -123.024999 where: bonds (distance) C4'-P energy: -31.883 bonds (distance) P-C4' energy: -31.950 flat angles C4'-P-C4' energy: -39.634 flat angles P-C4'-P energy: -17.767 tors. eta vs tors. theta energy: -1.790 Dist. restrs. and SS energy: 1.817 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -224.371865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.371865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.371865 (E_RNA) where: Base-Base interactions energy: -111.740 where: short stacking energy: -61.923 Base-Backbone interact. energy: 1.008 local terms energy: -113.639513 where: bonds (distance) C4'-P energy: -31.592 bonds (distance) P-C4' energy: -30.112 flat angles C4'-P-C4' energy: -28.255 flat angles P-C4'-P energy: -15.260 tors. eta vs tors. theta energy: -8.420 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -227.412868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.412868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.813613 (E_RNA) where: Base-Base interactions energy: -107.941 where: short stacking energy: -61.276 Base-Backbone interact. energy: 0.505 local terms energy: -120.377294 where: bonds (distance) C4'-P energy: -39.636 bonds (distance) P-C4' energy: -31.009 flat angles C4'-P-C4' energy: -31.785 flat angles P-C4'-P energy: -13.864 tors. eta vs tors. theta energy: -4.083 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -549.081409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.081409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.654343 (E_RNA) where: Base-Base interactions energy: -344.649 where: short stacking energy: -173.753 Base-Backbone interact. energy: -0.119 local terms energy: -205.885774 where: bonds (distance) C4'-P energy: -41.571 bonds (distance) P-C4' energy: -35.768 flat angles C4'-P-C4' energy: -46.224 flat angles P-C4'-P energy: -34.646 tors. eta vs tors. theta energy: -47.677 Dist. restrs. and SS energy: 1.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -491.059856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.059856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.635831 (E_RNA) where: Base-Base interactions energy: -304.032 where: short stacking energy: -175.379 Base-Backbone interact. energy: -0.355 local terms energy: -187.248973 where: bonds (distance) C4'-P energy: -35.989 bonds (distance) P-C4' energy: -36.016 flat angles C4'-P-C4' energy: -41.465 flat angles P-C4'-P energy: -26.411 tors. eta vs tors. theta energy: -47.368 Dist. restrs. and SS energy: 0.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -421.148600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.148600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.148600 (E_RNA) where: Base-Base interactions energy: -245.662 where: short stacking energy: -127.484 Base-Backbone interact. energy: -0.770 local terms energy: -174.716357 where: bonds (distance) C4'-P energy: -33.415 bonds (distance) P-C4' energy: -38.591 flat angles C4'-P-C4' energy: -40.633 flat angles P-C4'-P energy: -33.569 tors. eta vs tors. theta energy: -28.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -415.491112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.491112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.491112 (E_RNA) where: Base-Base interactions energy: -264.354 where: short stacking energy: -113.454 Base-Backbone interact. energy: -2.490 local terms energy: -148.647398 where: bonds (distance) C4'-P energy: -33.815 bonds (distance) P-C4' energy: -31.078 flat angles C4'-P-C4' energy: -38.757 flat angles P-C4'-P energy: -20.070 tors. eta vs tors. theta energy: -24.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -318.512056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.512056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.837250 (E_RNA) where: Base-Base interactions energy: -156.680 where: short stacking energy: -90.838 Base-Backbone interact. energy: -1.334 local terms energy: -160.823336 where: bonds (distance) C4'-P energy: -42.693 bonds (distance) P-C4' energy: -39.615 flat angles C4'-P-C4' energy: -31.238 flat angles P-C4'-P energy: -26.520 tors. eta vs tors. theta energy: -20.758 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -391.239727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.239727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.290130 (E_RNA) where: Base-Base interactions energy: -232.345 where: short stacking energy: -110.160 Base-Backbone interact. energy: -1.454 local terms energy: -157.491580 where: bonds (distance) C4'-P energy: -26.735 bonds (distance) P-C4' energy: -43.653 flat angles C4'-P-C4' energy: -41.779 flat angles P-C4'-P energy: -17.328 tors. eta vs tors. theta energy: -27.996 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -292.006004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.006004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.333312 (E_RNA) where: Base-Base interactions energy: -148.484 where: short stacking energy: -86.873 Base-Backbone interact. energy: 0.361 local terms energy: -144.210764 where: bonds (distance) C4'-P energy: -32.078 bonds (distance) P-C4' energy: -37.775 flat angles C4'-P-C4' energy: -32.481 flat angles P-C4'-P energy: -21.208 tors. eta vs tors. theta energy: -20.669 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -226.810323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.810323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.887255 (E_RNA) where: Base-Base interactions energy: -107.482 where: short stacking energy: -55.098 Base-Backbone interact. energy: -0.990 local terms energy: -119.415849 where: bonds (distance) C4'-P energy: -31.967 bonds (distance) P-C4' energy: -32.056 flat angles C4'-P-C4' energy: -27.518 flat angles P-C4'-P energy: -21.087 tors. eta vs tors. theta energy: -6.788 Dist. restrs. and SS energy: 1.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -249.860571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.860571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.888466 (E_RNA) where: Base-Base interactions energy: -122.818 where: short stacking energy: -68.258 Base-Backbone interact. energy: -0.997 local terms energy: -126.073116 where: bonds (distance) C4'-P energy: -35.343 bonds (distance) P-C4' energy: -31.640 flat angles C4'-P-C4' energy: -28.999 flat angles P-C4'-P energy: -23.397 tors. eta vs tors. theta energy: -6.694 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -252.131866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.131866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.162940 (E_RNA) where: Base-Base interactions energy: -123.173 where: short stacking energy: -70.027 Base-Backbone interact. energy: -0.318 local terms energy: -128.671279 where: bonds (distance) C4'-P energy: -27.933 bonds (distance) P-C4' energy: -38.317 flat angles C4'-P-C4' energy: -28.942 flat angles P-C4'-P energy: -24.464 tors. eta vs tors. theta energy: -9.014 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -541.336834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.336834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.304013 (E_RNA) where: Base-Base interactions energy: -355.235 where: short stacking energy: -169.996 Base-Backbone interact. energy: -0.232 local terms energy: -186.837521 where: bonds (distance) C4'-P energy: -36.247 bonds (distance) P-C4' energy: -36.502 flat angles C4'-P-C4' energy: -44.795 flat angles P-C4'-P energy: -27.024 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.967 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -501.038243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.038243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.501216 (E_RNA) where: Base-Base interactions energy: -308.636 where: short stacking energy: -160.864 Base-Backbone interact. energy: -0.328 local terms energy: -192.537210 where: bonds (distance) C4'-P energy: -37.183 bonds (distance) P-C4' energy: -43.462 flat angles C4'-P-C4' energy: -42.316 flat angles P-C4'-P energy: -31.301 tors. eta vs tors. theta energy: -38.275 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -436.455141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.455141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.672842 (E_RNA) where: Base-Base interactions energy: -275.842 where: short stacking energy: -143.643 Base-Backbone interact. energy: -0.457 local terms energy: -160.374558 where: bonds (distance) C4'-P energy: -34.453 bonds (distance) P-C4' energy: -37.186 flat angles C4'-P-C4' energy: -32.029 flat angles P-C4'-P energy: -26.697 tors. eta vs tors. theta energy: -30.009 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -408.491011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.491011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.498993 (E_RNA) where: Base-Base interactions energy: -235.269 where: short stacking energy: -123.211 Base-Backbone interact. energy: -0.207 local terms energy: -173.022746 where: bonds (distance) C4'-P energy: -41.592 bonds (distance) P-C4' energy: -38.793 flat angles C4'-P-C4' energy: -39.032 flat angles P-C4'-P energy: -19.128 tors. eta vs tors. theta energy: -34.478 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -416.233320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.233320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.630449 (E_RNA) where: Base-Base interactions energy: -250.372 where: short stacking energy: -128.586 Base-Backbone interact. energy: -0.388 local terms energy: -165.869857 where: bonds (distance) C4'-P energy: -41.899 bonds (distance) P-C4' energy: -33.722 flat angles C4'-P-C4' energy: -31.865 flat angles P-C4'-P energy: -24.875 tors. eta vs tors. theta energy: -33.509 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -321.698225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.698225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.993495 (E_RNA) where: Base-Base interactions energy: -172.130 where: short stacking energy: -98.516 Base-Backbone interact. energy: -1.722 local terms energy: -148.141081 where: bonds (distance) C4'-P energy: -31.341 bonds (distance) P-C4' energy: -42.710 flat angles C4'-P-C4' energy: -33.970 flat angles P-C4'-P energy: -19.210 tors. eta vs tors. theta energy: -20.910 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -309.519773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.519773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.588855 (E_RNA) where: Base-Base interactions energy: -166.323 where: short stacking energy: -95.121 Base-Backbone interact. energy: -0.643 local terms energy: -142.622322 where: bonds (distance) C4'-P energy: -35.898 bonds (distance) P-C4' energy: -31.524 flat angles C4'-P-C4' energy: -34.191 flat angles P-C4'-P energy: -21.987 tors. eta vs tors. theta energy: -19.023 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -284.345445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.345445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.971753 (E_RNA) where: Base-Base interactions energy: -147.737 where: short stacking energy: -87.494 Base-Backbone interact. energy: -0.323 local terms energy: -137.911686 where: bonds (distance) C4'-P energy: -38.731 bonds (distance) P-C4' energy: -29.244 flat angles C4'-P-C4' energy: -32.224 flat angles P-C4'-P energy: -21.721 tors. eta vs tors. theta energy: -15.992 Dist. restrs. and SS energy: 1.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -257.246867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.246867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.384882 (E_RNA) where: Base-Base interactions energy: -127.609 where: short stacking energy: -65.380 Base-Backbone interact. energy: -0.465 local terms energy: -129.311238 where: bonds (distance) C4'-P energy: -28.787 bonds (distance) P-C4' energy: -42.112 flat angles C4'-P-C4' energy: -34.924 flat angles P-C4'-P energy: -17.023 tors. eta vs tors. theta energy: -6.465 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -232.895213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.895213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.054702 (E_RNA) where: Base-Base interactions energy: -113.732 where: short stacking energy: -67.412 Base-Backbone interact. energy: -0.211 local terms energy: -119.111980 where: bonds (distance) C4'-P energy: -37.287 bonds (distance) P-C4' energy: -34.127 flat angles C4'-P-C4' energy: -27.729 flat angles P-C4'-P energy: -20.682 tors. eta vs tors. theta energy: 0.713 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -546.148221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.148221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.233367 (E_RNA) where: Base-Base interactions energy: -355.273 where: short stacking energy: -189.255 Base-Backbone interact. energy: -0.600 local terms energy: -191.361115 where: bonds (distance) C4'-P energy: -43.579 bonds (distance) P-C4' energy: -38.217 flat angles C4'-P-C4' energy: -36.923 flat angles P-C4'-P energy: -19.135 tors. eta vs tors. theta energy: -53.507 Dist. restrs. and SS energy: 1.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -498.472687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.472687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.209655 (E_RNA) where: Base-Base interactions energy: -302.753 where: short stacking energy: -160.696 Base-Backbone interact. energy: -2.119 local terms energy: -194.337434 where: bonds (distance) C4'-P energy: -38.471 bonds (distance) P-C4' energy: -39.381 flat angles C4'-P-C4' energy: -40.941 flat angles P-C4'-P energy: -27.905 tors. eta vs tors. theta energy: -47.640 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -446.607021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.607021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.623852 (E_RNA) where: Base-Base interactions energy: -293.607 where: short stacking energy: -146.030 Base-Backbone interact. energy: -2.533 local terms energy: -150.483026 where: bonds (distance) C4'-P energy: -30.675 bonds (distance) P-C4' energy: -30.053 flat angles C4'-P-C4' energy: -33.071 flat angles P-C4'-P energy: -24.318 tors. eta vs tors. theta energy: -32.366 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -407.733319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.733319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.092751 (E_RNA) where: Base-Base interactions energy: -236.532 where: short stacking energy: -132.711 Base-Backbone interact. energy: -1.219 local terms energy: -170.341286 where: bonds (distance) C4'-P energy: -33.102 bonds (distance) P-C4' energy: -38.321 flat angles C4'-P-C4' energy: -43.034 flat angles P-C4'-P energy: -22.038 tors. eta vs tors. theta energy: -33.845 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -408.222483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.222483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.604706 (E_RNA) where: Base-Base interactions energy: -230.153 where: short stacking energy: -130.386 Base-Backbone interact. energy: -0.512 local terms energy: -177.940170 where: bonds (distance) C4'-P energy: -38.398 bonds (distance) P-C4' energy: -44.676 flat angles C4'-P-C4' energy: -36.458 flat angles P-C4'-P energy: -23.900 tors. eta vs tors. theta energy: -34.508 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -340.742845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.742845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.035191 (E_RNA) where: Base-Base interactions energy: -192.641 where: short stacking energy: -96.107 Base-Backbone interact. energy: -1.815 local terms energy: -146.578528 where: bonds (distance) C4'-P energy: -32.928 bonds (distance) P-C4' energy: -31.273 flat angles C4'-P-C4' energy: -35.631 flat angles P-C4'-P energy: -28.669 tors. eta vs tors. theta energy: -18.077 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -279.851180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.851180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.868988 (E_RNA) where: Base-Base interactions energy: -136.097 where: short stacking energy: -80.779 Base-Backbone interact. energy: -0.587 local terms energy: -143.185070 where: bonds (distance) C4'-P energy: -43.023 bonds (distance) P-C4' energy: -35.896 flat angles C4'-P-C4' energy: -36.060 flat angles P-C4'-P energy: -13.383 tors. eta vs tors. theta energy: -14.824 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -332.976620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.976620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.111377 (E_RNA) where: Base-Base interactions energy: -203.039 where: short stacking energy: -100.659 Base-Backbone interact. energy: 2.198 local terms energy: -132.270883 where: bonds (distance) C4'-P energy: -36.649 bonds (distance) P-C4' energy: -25.132 flat angles C4'-P-C4' energy: -30.679 flat angles P-C4'-P energy: -21.612 tors. eta vs tors. theta energy: -18.199 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -267.769510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.769510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.813032 (E_RNA) where: Base-Base interactions energy: -140.638 where: short stacking energy: -82.060 Base-Backbone interact. energy: -1.472 local terms energy: -125.703226 where: bonds (distance) C4'-P energy: -31.630 bonds (distance) P-C4' energy: -34.180 flat angles C4'-P-C4' energy: -31.061 flat angles P-C4'-P energy: -24.681 tors. eta vs tors. theta energy: -4.151 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -240.852457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.852457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.861959 (E_RNA) where: Base-Base interactions energy: -131.753 where: short stacking energy: -75.175 Base-Backbone interact. energy: 0.984 local terms energy: -110.093107 where: bonds (distance) C4'-P energy: -26.867 bonds (distance) P-C4' energy: -30.698 flat angles C4'-P-C4' energy: -28.316 flat angles P-C4'-P energy: -15.113 tors. eta vs tors. theta energy: -9.098 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -543.193631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.193631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.712234 (E_RNA) where: Base-Base interactions energy: -337.813 where: short stacking energy: -177.018 Base-Backbone interact. energy: -0.768 local terms energy: -206.130435 where: bonds (distance) C4'-P energy: -40.332 bonds (distance) P-C4' energy: -43.258 flat angles C4'-P-C4' energy: -46.587 flat angles P-C4'-P energy: -29.553 tors. eta vs tors. theta energy: -46.401 Dist. restrs. and SS energy: 1.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -478.416550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.416550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.450572 (E_RNA) where: Base-Base interactions energy: -300.633 where: short stacking energy: -143.104 Base-Backbone interact. energy: -0.880 local terms energy: -176.937708 where: bonds (distance) C4'-P energy: -37.840 bonds (distance) P-C4' energy: -41.919 flat angles C4'-P-C4' energy: -38.291 flat angles P-C4'-P energy: -22.419 tors. eta vs tors. theta energy: -36.469 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -444.668787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.668787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.668787 (E_RNA) where: Base-Base interactions energy: -268.767 where: short stacking energy: -135.749 Base-Backbone interact. energy: -0.602 local terms energy: -175.300490 where: bonds (distance) C4'-P energy: -36.777 bonds (distance) P-C4' energy: -43.411 flat angles C4'-P-C4' energy: -36.961 flat angles P-C4'-P energy: -23.234 tors. eta vs tors. theta energy: -34.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -419.886993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.886993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.956531 (E_RNA) where: Base-Base interactions energy: -267.464 where: short stacking energy: -125.277 Base-Backbone interact. energy: -0.976 local terms energy: -151.516580 where: bonds (distance) C4'-P energy: -28.639 bonds (distance) P-C4' energy: -39.089 flat angles C4'-P-C4' energy: -40.055 flat angles P-C4'-P energy: -20.495 tors. eta vs tors. theta energy: -23.238 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -418.985073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.985073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.518845 (E_RNA) where: Base-Base interactions energy: -250.953 where: short stacking energy: -126.697 Base-Backbone interact. energy: -0.503 local terms energy: -168.062708 where: bonds (distance) C4'-P energy: -28.974 bonds (distance) P-C4' energy: -36.941 flat angles C4'-P-C4' energy: -34.398 flat angles P-C4'-P energy: -31.197 tors. eta vs tors. theta energy: -36.553 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -343.921402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.921402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.989141 (E_RNA) where: Base-Base interactions energy: -192.558 where: short stacking energy: -76.946 Base-Backbone interact. energy: -0.318 local terms energy: -151.113882 where: bonds (distance) C4'-P energy: -38.913 bonds (distance) P-C4' energy: -33.814 flat angles C4'-P-C4' energy: -41.697 flat angles P-C4'-P energy: -20.373 tors. eta vs tors. theta energy: -16.317 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -338.773059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.773059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.208561 (E_RNA) where: Base-Base interactions energy: -186.387 where: short stacking energy: -103.453 Base-Backbone interact. energy: -0.293 local terms energy: -152.528979 where: bonds (distance) C4'-P energy: -32.170 bonds (distance) P-C4' energy: -41.509 flat angles C4'-P-C4' energy: -40.147 flat angles P-C4'-P energy: -20.312 tors. eta vs tors. theta energy: -18.391 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -280.400263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.400263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.452046 (E_RNA) where: Base-Base interactions energy: -142.366 where: short stacking energy: -64.950 Base-Backbone interact. energy: 1.872 local terms energy: -139.958608 where: bonds (distance) C4'-P energy: -35.894 bonds (distance) P-C4' energy: -41.584 flat angles C4'-P-C4' energy: -34.414 flat angles P-C4'-P energy: -25.225 tors. eta vs tors. theta energy: -2.841 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -259.575099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.575099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.622113 (E_RNA) where: Base-Base interactions energy: -139.771 where: short stacking energy: -59.543 Base-Backbone interact. energy: -0.699 local terms energy: -119.152632 where: bonds (distance) C4'-P energy: -31.006 bonds (distance) P-C4' energy: -38.730 flat angles C4'-P-C4' energy: -30.533 flat angles P-C4'-P energy: -17.297 tors. eta vs tors. theta energy: -1.587 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -221.938053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.938053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.574191 (E_RNA) where: Base-Base interactions energy: -96.318 where: short stacking energy: -59.207 Base-Backbone interact. energy: 2.521 local terms energy: -131.777233 where: bonds (distance) C4'-P energy: -35.497 bonds (distance) P-C4' energy: -34.802 flat angles C4'-P-C4' energy: -36.798 flat angles P-C4'-P energy: -16.501 tors. eta vs tors. theta energy: -8.179 Dist. restrs. and SS energy: 3.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -536.162873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.162873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.295637 (E_RNA) where: Base-Base interactions energy: -339.080 where: short stacking energy: -183.568 Base-Backbone interact. energy: 0.278 local terms energy: -198.493250 where: bonds (distance) C4'-P energy: -34.536 bonds (distance) P-C4' energy: -44.496 flat angles C4'-P-C4' energy: -48.533 flat angles P-C4'-P energy: -26.352 tors. eta vs tors. theta energy: -44.577 Dist. restrs. and SS energy: 1.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -479.125410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.125410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.375488 (E_RNA) where: Base-Base interactions energy: -291.599 where: short stacking energy: -162.828 Base-Backbone interact. energy: -0.871 local terms energy: -186.905283 where: bonds (distance) C4'-P energy: -38.887 bonds (distance) P-C4' energy: -41.142 flat angles C4'-P-C4' energy: -43.056 flat angles P-C4'-P energy: -26.831 tors. eta vs tors. theta energy: -36.990 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -439.349843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.349843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.634266 (E_RNA) where: Base-Base interactions energy: -255.212 where: short stacking energy: -136.226 Base-Backbone interact. energy: -0.972 local terms energy: -183.450852 where: bonds (distance) C4'-P energy: -44.916 bonds (distance) P-C4' energy: -32.940 flat angles C4'-P-C4' energy: -39.808 flat angles P-C4'-P energy: -27.690 tors. eta vs tors. theta energy: -38.096 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -435.881075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.881075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.927711 (E_RNA) where: Base-Base interactions energy: -264.777 where: short stacking energy: -136.381 Base-Backbone interact. energy: -2.504 local terms energy: -168.647154 where: bonds (distance) C4'-P energy: -31.164 bonds (distance) P-C4' energy: -40.055 flat angles C4'-P-C4' energy: -36.031 flat angles P-C4'-P energy: -23.757 tors. eta vs tors. theta energy: -37.640 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -426.405660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.405660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.854964 (E_RNA) where: Base-Base interactions energy: -247.518 where: short stacking energy: -113.756 Base-Backbone interact. energy: -2.090 local terms energy: -177.247087 where: bonds (distance) C4'-P energy: -42.178 bonds (distance) P-C4' energy: -35.454 flat angles C4'-P-C4' energy: -44.793 flat angles P-C4'-P energy: -25.738 tors. eta vs tors. theta energy: -29.084 Dist. restrs. and SS energy: 0.449 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -357.063452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.063452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.067647 (E_RNA) where: Base-Base interactions energy: -215.653 where: short stacking energy: -120.326 Base-Backbone interact. energy: -0.081 local terms energy: -141.333158 where: bonds (distance) C4'-P energy: -27.798 bonds (distance) P-C4' energy: -32.308 flat angles C4'-P-C4' energy: -37.009 flat angles P-C4'-P energy: -19.616 tors. eta vs tors. theta energy: -24.602 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -342.091067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.091067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.137568 (E_RNA) where: Base-Base interactions energy: -211.605 where: short stacking energy: -114.602 Base-Backbone interact. energy: -0.595 local terms energy: -129.937526 where: bonds (distance) C4'-P energy: -27.720 bonds (distance) P-C4' energy: -33.867 flat angles C4'-P-C4' energy: -36.501 flat angles P-C4'-P energy: -19.221 tors. eta vs tors. theta energy: -12.629 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -279.611237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.611237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.964809 (E_RNA) where: Base-Base interactions energy: -153.335 where: short stacking energy: -87.587 Base-Backbone interact. energy: 3.816 local terms energy: -130.445799 where: bonds (distance) C4'-P energy: -31.006 bonds (distance) P-C4' energy: -39.323 flat angles C4'-P-C4' energy: -34.313 flat angles P-C4'-P energy: -16.595 tors. eta vs tors. theta energy: -9.209 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -232.798615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.798615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.893088 (E_RNA) where: Base-Base interactions energy: -109.300 where: short stacking energy: -67.132 Base-Backbone interact. energy: 0.340 local terms energy: -124.932899 where: bonds (distance) C4'-P energy: -33.196 bonds (distance) P-C4' energy: -37.275 flat angles C4'-P-C4' energy: -33.643 flat angles P-C4'-P energy: -18.444 tors. eta vs tors. theta energy: -2.375 Dist. restrs. and SS energy: 1.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -214.969983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.969983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.464351 (E_RNA) where: Base-Base interactions energy: -95.174 where: short stacking energy: -55.393 Base-Backbone interact. energy: -1.189 local terms energy: -121.101686 where: bonds (distance) C4'-P energy: -30.183 bonds (distance) P-C4' energy: -35.903 flat angles C4'-P-C4' energy: -27.328 flat angles P-C4'-P energy: -18.935 tors. eta vs tors. theta energy: -8.752 Dist. restrs. and SS energy: 2.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -511.225689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.225689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.383943 (E_RNA) where: Base-Base interactions energy: -329.299 where: short stacking energy: -164.098 Base-Backbone interact. energy: -0.254 local terms energy: -181.830984 where: bonds (distance) C4'-P energy: -42.171 bonds (distance) P-C4' energy: -34.247 flat angles C4'-P-C4' energy: -38.668 flat angles P-C4'-P energy: -24.955 tors. eta vs tors. theta energy: -41.790 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -485.586363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.586363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.747127 (E_RNA) where: Base-Base interactions energy: -281.355 where: short stacking energy: -149.746 Base-Backbone interact. energy: -2.717 local terms energy: -201.674946 where: bonds (distance) C4'-P energy: -35.544 bonds (distance) P-C4' energy: -43.390 flat angles C4'-P-C4' energy: -46.481 flat angles P-C4'-P energy: -25.631 tors. eta vs tors. theta energy: -50.629 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -472.796313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.796313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.913821 (E_RNA) where: Base-Base interactions energy: -291.952 where: short stacking energy: -164.172 Base-Backbone interact. energy: -1.802 local terms energy: -179.159933 where: bonds (distance) C4'-P energy: -41.012 bonds (distance) P-C4' energy: -29.471 flat angles C4'-P-C4' energy: -43.728 flat angles P-C4'-P energy: -23.202 tors. eta vs tors. theta energy: -41.746 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -401.857694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.857694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.857694 (E_RNA) where: Base-Base interactions energy: -236.295 where: short stacking energy: -117.595 Base-Backbone interact. energy: -0.516 local terms energy: -165.046569 where: bonds (distance) C4'-P energy: -38.150 bonds (distance) P-C4' energy: -38.724 flat angles C4'-P-C4' energy: -44.740 flat angles P-C4'-P energy: -17.833 tors. eta vs tors. theta energy: -25.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -429.968378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.968378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.050356 (E_RNA) where: Base-Base interactions energy: -252.014 where: short stacking energy: -125.480 Base-Backbone interact. energy: -1.646 local terms energy: -176.390561 where: bonds (distance) C4'-P energy: -40.055 bonds (distance) P-C4' energy: -43.843 flat angles C4'-P-C4' energy: -40.634 flat angles P-C4'-P energy: -22.721 tors. eta vs tors. theta energy: -29.138 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -308.363071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.363071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.366648 (E_RNA) where: Base-Base interactions energy: -166.013 where: short stacking energy: -100.207 Base-Backbone interact. energy: 0.458 local terms energy: -142.811421 where: bonds (distance) C4'-P energy: -28.473 bonds (distance) P-C4' energy: -39.460 flat angles C4'-P-C4' energy: -36.060 flat angles P-C4'-P energy: -27.931 tors. eta vs tors. theta energy: -10.887 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -376.702164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.702164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.983056 (E_RNA) where: Base-Base interactions energy: -220.401 where: short stacking energy: -107.317 Base-Backbone interact. energy: 0.622 local terms energy: -157.204496 where: bonds (distance) C4'-P energy: -28.104 bonds (distance) P-C4' energy: -38.878 flat angles C4'-P-C4' energy: -38.838 flat angles P-C4'-P energy: -26.669 tors. eta vs tors. theta energy: -24.715 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -268.965682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.965682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.430392 (E_RNA) where: Base-Base interactions energy: -142.664 where: short stacking energy: -85.877 Base-Backbone interact. energy: -0.916 local terms energy: -125.850214 where: bonds (distance) C4'-P energy: -34.569 bonds (distance) P-C4' energy: -33.744 flat angles C4'-P-C4' energy: -35.591 flat angles P-C4'-P energy: -20.031 tors. eta vs tors. theta energy: -1.915 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -282.834615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.834615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.030048 (E_RNA) where: Base-Base interactions energy: -157.773 where: short stacking energy: -92.191 Base-Backbone interact. energy: 0.351 local terms energy: -125.608697 where: bonds (distance) C4'-P energy: -34.388 bonds (distance) P-C4' energy: -45.090 flat angles C4'-P-C4' energy: -22.182 flat angles P-C4'-P energy: -19.454 tors. eta vs tors. theta energy: -4.495 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -231.546213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.546213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.800245 (E_RNA) where: Base-Base interactions energy: -113.692 where: short stacking energy: -67.798 Base-Backbone interact. energy: -1.245 local terms energy: -116.863768 where: bonds (distance) C4'-P energy: -31.539 bonds (distance) P-C4' energy: -32.377 flat angles C4'-P-C4' energy: -22.272 flat angles P-C4'-P energy: -19.694 tors. eta vs tors. theta energy: -10.982 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -521.545641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.545641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.480570 (E_RNA) where: Base-Base interactions energy: -336.803 where: short stacking energy: -167.635 Base-Backbone interact. energy: -0.829 local terms energy: -184.848486 where: bonds (distance) C4'-P energy: -34.873 bonds (distance) P-C4' energy: -34.240 flat angles C4'-P-C4' energy: -47.947 flat angles P-C4'-P energy: -28.092 tors. eta vs tors. theta energy: -39.697 Dist. restrs. and SS energy: 0.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -500.853991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.853991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.788928 (E_RNA) where: Base-Base interactions energy: -304.093 where: short stacking energy: -172.681 Base-Backbone interact. energy: 0.310 local terms energy: -198.005630 where: bonds (distance) C4'-P energy: -35.804 bonds (distance) P-C4' energy: -46.287 flat angles C4'-P-C4' energy: -42.281 flat angles P-C4'-P energy: -29.701 tors. eta vs tors. theta energy: -43.934 Dist. restrs. and SS energy: 0.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -485.180080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.180080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.319297 (E_RNA) where: Base-Base interactions energy: -305.168 where: short stacking energy: -156.328 Base-Backbone interact. energy: 3.043 local terms energy: -183.194277 where: bonds (distance) C4'-P energy: -37.998 bonds (distance) P-C4' energy: -35.238 flat angles C4'-P-C4' energy: -41.491 flat angles P-C4'-P energy: -25.022 tors. eta vs tors. theta energy: -43.447 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -437.925655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.925655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.636089 (E_RNA) where: Base-Base interactions energy: -274.275 where: short stacking energy: -131.582 Base-Backbone interact. energy: -0.898 local terms energy: -163.463426 where: bonds (distance) C4'-P energy: -42.438 bonds (distance) P-C4' energy: -35.070 flat angles C4'-P-C4' energy: -33.148 flat angles P-C4'-P energy: -22.042 tors. eta vs tors. theta energy: -30.765 Dist. restrs. and SS energy: 0.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -370.749389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.749389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.809786 (E_RNA) where: Base-Base interactions energy: -213.687 where: short stacking energy: -113.446 Base-Backbone interact. energy: -0.533 local terms energy: -156.589782 where: bonds (distance) C4'-P energy: -36.639 bonds (distance) P-C4' energy: -31.987 flat angles C4'-P-C4' energy: -41.575 flat angles P-C4'-P energy: -20.174 tors. eta vs tors. theta energy: -26.216 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -376.892004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.892004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.973355 (E_RNA) where: Base-Base interactions energy: -238.584 where: short stacking energy: -113.224 Base-Backbone interact. energy: -0.765 local terms energy: -137.624932 where: bonds (distance) C4'-P energy: -30.416 bonds (distance) P-C4' energy: -27.180 flat angles C4'-P-C4' energy: -40.854 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -22.510 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -305.165631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.165631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.167754 (E_RNA) where: Base-Base interactions energy: -156.477 where: short stacking energy: -92.125 Base-Backbone interact. energy: -0.011 local terms energy: -148.679829 where: bonds (distance) C4'-P energy: -33.130 bonds (distance) P-C4' energy: -37.162 flat angles C4'-P-C4' energy: -34.556 flat angles P-C4'-P energy: -28.441 tors. eta vs tors. theta energy: -15.392 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -240.882628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.882628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.762358 (E_RNA) where: Base-Base interactions energy: -119.980 where: short stacking energy: -65.227 Base-Backbone interact. energy: -0.007 local terms energy: -121.775443 where: bonds (distance) C4'-P energy: -39.684 bonds (distance) P-C4' energy: -34.262 flat angles C4'-P-C4' energy: -26.868 flat angles P-C4'-P energy: -24.170 tors. eta vs tors. theta energy: 3.210 Dist. restrs. and SS energy: 0.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -229.623425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.623425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.841853 (E_RNA) where: Base-Base interactions energy: -112.294 where: short stacking energy: -60.743 Base-Backbone interact. energy: -1.076 local terms energy: -116.471590 where: bonds (distance) C4'-P energy: -38.792 bonds (distance) P-C4' energy: -31.316 flat angles C4'-P-C4' energy: -24.946 flat angles P-C4'-P energy: -15.640 tors. eta vs tors. theta energy: -5.778 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -230.708609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.708609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.708609 (E_RNA) where: Base-Base interactions energy: -124.634 where: short stacking energy: -58.522 Base-Backbone interact. energy: -0.814 local terms energy: -105.261122 where: bonds (distance) C4'-P energy: -33.423 bonds (distance) P-C4' energy: -32.867 flat angles C4'-P-C4' energy: -24.558 flat angles P-C4'-P energy: -17.933 tors. eta vs tors. theta energy: 3.520 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -539.520288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.520288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.496805 (E_RNA) where: Base-Base interactions energy: -345.279 where: short stacking energy: -176.660 Base-Backbone interact. energy: -0.652 local terms energy: -194.565931 where: bonds (distance) C4'-P energy: -39.896 bonds (distance) P-C4' energy: -40.948 flat angles C4'-P-C4' energy: -38.122 flat angles P-C4'-P energy: -29.302 tors. eta vs tors. theta energy: -46.298 Dist. restrs. and SS energy: 0.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -483.825945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.825945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.124897 (E_RNA) where: Base-Base interactions energy: -293.908 where: short stacking energy: -160.401 Base-Backbone interact. energy: -0.684 local terms energy: -190.532909 where: bonds (distance) C4'-P energy: -35.138 bonds (distance) P-C4' energy: -42.209 flat angles C4'-P-C4' energy: -41.168 flat angles P-C4'-P energy: -33.878 tors. eta vs tors. theta energy: -38.140 Dist. restrs. and SS energy: 1.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -502.209271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.209271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.245213 (E_RNA) where: Base-Base interactions energy: -316.624 where: short stacking energy: -180.059 Base-Backbone interact. energy: -0.802 local terms energy: -184.819546 where: bonds (distance) C4'-P energy: -31.760 bonds (distance) P-C4' energy: -34.059 flat angles C4'-P-C4' energy: -42.460 flat angles P-C4'-P energy: -25.260 tors. eta vs tors. theta energy: -51.281 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -476.076981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.076981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.505785 (E_RNA) where: Base-Base interactions energy: -298.543 where: short stacking energy: -160.012 Base-Backbone interact. energy: 0.070 local terms energy: -178.032797 where: bonds (distance) C4'-P energy: -34.696 bonds (distance) P-C4' energy: -39.436 flat angles C4'-P-C4' energy: -42.422 flat angles P-C4'-P energy: -23.651 tors. eta vs tors. theta energy: -37.828 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -382.154340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.154340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.269712 (E_RNA) where: Base-Base interactions energy: -223.079 where: short stacking energy: -119.923 Base-Backbone interact. energy: -0.985 local terms energy: -158.205448 where: bonds (distance) C4'-P energy: -36.487 bonds (distance) P-C4' energy: -46.871 flat angles C4'-P-C4' energy: -29.588 flat angles P-C4'-P energy: -17.552 tors. eta vs tors. theta energy: -27.706 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -352.402853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.402853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.409244 (E_RNA) where: Base-Base interactions energy: -204.746 where: short stacking energy: -110.880 Base-Backbone interact. energy: -1.331 local terms energy: -146.332512 where: bonds (distance) C4'-P energy: -31.830 bonds (distance) P-C4' energy: -42.602 flat angles C4'-P-C4' energy: -35.748 flat angles P-C4'-P energy: -18.029 tors. eta vs tors. theta energy: -18.124 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -274.629100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.629100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.651421 (E_RNA) where: Base-Base interactions energy: -150.935 where: short stacking energy: -95.359 Base-Backbone interact. energy: -0.820 local terms energy: -122.896610 where: bonds (distance) C4'-P energy: -28.603 bonds (distance) P-C4' energy: -22.718 flat angles C4'-P-C4' energy: -33.869 flat angles P-C4'-P energy: -24.392 tors. eta vs tors. theta energy: -13.314 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -311.025870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.025870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.057481 (E_RNA) where: Base-Base interactions energy: -171.397 where: short stacking energy: -103.089 Base-Backbone interact. energy: -1.401 local terms energy: -138.259002 where: bonds (distance) C4'-P energy: -34.165 bonds (distance) P-C4' energy: -27.582 flat angles C4'-P-C4' energy: -31.491 flat angles P-C4'-P energy: -20.657 tors. eta vs tors. theta energy: -24.364 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -237.423603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.423603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.764936 (E_RNA) where: Base-Base interactions energy: -118.878 where: short stacking energy: -48.643 Base-Backbone interact. energy: 1.998 local terms energy: -120.884817 where: bonds (distance) C4'-P energy: -36.860 bonds (distance) P-C4' energy: -38.230 flat angles C4'-P-C4' energy: -33.225 flat angles P-C4'-P energy: -6.851 tors. eta vs tors. theta energy: -5.718 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -236.099347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.099347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.431403 (E_RNA) where: Base-Base interactions energy: -115.951 where: short stacking energy: -63.344 Base-Backbone interact. energy: 0.027 local terms energy: -120.507474 where: bonds (distance) C4'-P energy: -36.593 bonds (distance) P-C4' energy: -24.801 flat angles C4'-P-C4' energy: -37.134 flat angles P-C4'-P energy: -23.396 tors. eta vs tors. theta energy: 1.416 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -526.206953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.206953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.146574 (E_RNA) where: Base-Base interactions energy: -333.556 where: short stacking energy: -160.709 Base-Backbone interact. energy: 0.145 local terms energy: -193.734790 where: bonds (distance) C4'-P energy: -37.894 bonds (distance) P-C4' energy: -32.919 flat angles C4'-P-C4' energy: -42.238 flat angles P-C4'-P energy: -32.198 tors. eta vs tors. theta energy: -48.485 Dist. restrs. and SS energy: 0.940 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -464.499984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.499984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.261017 (E_RNA) where: Base-Base interactions energy: -274.477 where: short stacking energy: -147.785 Base-Backbone interact. energy: -1.034 local terms energy: -189.749852 where: bonds (distance) C4'-P energy: -41.810 bonds (distance) P-C4' energy: -37.611 flat angles C4'-P-C4' energy: -42.823 flat angles P-C4'-P energy: -29.289 tors. eta vs tors. theta energy: -38.217 Dist. restrs. and SS energy: 0.761 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -473.931860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.931860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.104398 (E_RNA) where: Base-Base interactions energy: -293.950 where: short stacking energy: -156.173 Base-Backbone interact. energy: -0.175 local terms energy: -179.979656 where: bonds (distance) C4'-P energy: -28.775 bonds (distance) P-C4' energy: -35.496 flat angles C4'-P-C4' energy: -38.150 flat angles P-C4'-P energy: -30.830 tors. eta vs tors. theta energy: -46.729 Dist. restrs. and SS energy: 0.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -430.520795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.520795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.970806 (E_RNA) where: Base-Base interactions energy: -260.127 where: short stacking energy: -139.782 Base-Backbone interact. energy: -2.708 local terms energy: -168.135827 where: bonds (distance) C4'-P energy: -32.331 bonds (distance) P-C4' energy: -30.433 flat angles C4'-P-C4' energy: -42.963 flat angles P-C4'-P energy: -31.247 tors. eta vs tors. theta energy: -31.162 Dist. restrs. and SS energy: 0.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -379.566586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.566586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.635651 (E_RNA) where: Base-Base interactions energy: -214.237 where: short stacking energy: -116.398 Base-Backbone interact. energy: -0.554 local terms energy: -164.844579 where: bonds (distance) C4'-P energy: -39.856 bonds (distance) P-C4' energy: -43.173 flat angles C4'-P-C4' energy: -29.329 flat angles P-C4'-P energy: -22.701 tors. eta vs tors. theta energy: -29.786 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -375.574214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.574214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.604056 (E_RNA) where: Base-Base interactions energy: -220.783 where: short stacking energy: -124.381 Base-Backbone interact. energy: -1.003 local terms energy: -153.817547 where: bonds (distance) C4'-P energy: -41.124 bonds (distance) P-C4' energy: -31.353 flat angles C4'-P-C4' energy: -30.717 flat angles P-C4'-P energy: -25.467 tors. eta vs tors. theta energy: -25.156 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -296.666043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.666043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.706017 (E_RNA) where: Base-Base interactions energy: -145.372 where: short stacking energy: -85.882 Base-Backbone interact. energy: -0.746 local terms energy: -150.587280 where: bonds (distance) C4'-P energy: -39.026 bonds (distance) P-C4' energy: -41.944 flat angles C4'-P-C4' energy: -33.384 flat angles P-C4'-P energy: -24.637 tors. eta vs tors. theta energy: -11.596 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -266.967093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.967093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.980050 (E_RNA) where: Base-Base interactions energy: -134.972 where: short stacking energy: -89.121 Base-Backbone interact. energy: 0.890 local terms energy: -132.898349 where: bonds (distance) C4'-P energy: -30.562 bonds (distance) P-C4' energy: -35.778 flat angles C4'-P-C4' energy: -30.698 flat angles P-C4'-P energy: -26.888 tors. eta vs tors. theta energy: -8.972 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -222.986065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.986065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.395810 (E_RNA) where: Base-Base interactions energy: -103.604 where: short stacking energy: -58.528 Base-Backbone interact. energy: -1.493 local terms energy: -118.298432 where: bonds (distance) C4'-P energy: -27.870 bonds (distance) P-C4' energy: -35.862 flat angles C4'-P-C4' energy: -28.827 flat angles P-C4'-P energy: -22.261 tors. eta vs tors. theta energy: -3.479 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -268.172553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.172553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.528967 (E_RNA) where: Base-Base interactions energy: -127.064 where: short stacking energy: -59.918 Base-Backbone interact. energy: -1.147 local terms energy: -140.318082 where: bonds (distance) C4'-P energy: -31.093 bonds (distance) P-C4' energy: -39.854 flat angles C4'-P-C4' energy: -36.795 flat angles P-C4'-P energy: -22.613 tors. eta vs tors. theta energy: -9.962 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -538.614463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.614463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.521057 (E_RNA) where: Base-Base interactions energy: -340.662 where: short stacking energy: -182.621 Base-Backbone interact. energy: -0.614 local terms energy: -198.245694 where: bonds (distance) C4'-P energy: -44.774 bonds (distance) P-C4' energy: -37.060 flat angles C4'-P-C4' energy: -37.344 flat angles P-C4'-P energy: -29.964 tors. eta vs tors. theta energy: -49.104 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -497.529184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.529184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.910837 (E_RNA) where: Base-Base interactions energy: -311.267 where: short stacking energy: -173.905 Base-Backbone interact. energy: -0.415 local terms energy: -186.229312 where: bonds (distance) C4'-P energy: -28.668 bonds (distance) P-C4' energy: -45.723 flat angles C4'-P-C4' energy: -40.308 flat angles P-C4'-P energy: -25.462 tors. eta vs tors. theta energy: -46.069 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -461.389413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.389413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.517152 (E_RNA) where: Base-Base interactions energy: -279.397 where: short stacking energy: -128.690 Base-Backbone interact. energy: -1.066 local terms energy: -181.054006 where: bonds (distance) C4'-P energy: -44.445 bonds (distance) P-C4' energy: -31.331 flat angles C4'-P-C4' energy: -39.604 flat angles P-C4'-P energy: -32.698 tors. eta vs tors. theta energy: -32.975 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -455.899461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.899461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.952894 (E_RNA) where: Base-Base interactions energy: -270.536 where: short stacking energy: -142.365 Base-Backbone interact. energy: -0.799 local terms energy: -184.617751 where: bonds (distance) C4'-P energy: -36.030 bonds (distance) P-C4' energy: -36.894 flat angles C4'-P-C4' energy: -36.910 flat angles P-C4'-P energy: -28.810 tors. eta vs tors. theta energy: -45.974 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -439.604803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.604803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.163932 (E_RNA) where: Base-Base interactions energy: -262.749 where: short stacking energy: -123.250 Base-Backbone interact. energy: -0.541 local terms energy: -177.873623 where: bonds (distance) C4'-P energy: -40.472 bonds (distance) P-C4' energy: -39.157 flat angles C4'-P-C4' energy: -37.167 flat angles P-C4'-P energy: -32.860 tors. eta vs tors. theta energy: -28.218 Dist. restrs. and SS energy: 1.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -338.625277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.625277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.634212 (E_RNA) where: Base-Base interactions energy: -208.420 where: short stacking energy: -94.138 Base-Backbone interact. energy: -0.690 local terms energy: -129.523953 where: bonds (distance) C4'-P energy: -36.036 bonds (distance) P-C4' energy: -33.013 flat angles C4'-P-C4' energy: -30.170 flat angles P-C4'-P energy: -15.914 tors. eta vs tors. theta energy: -14.392 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -295.464126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.464126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.557443 (E_RNA) where: Base-Base interactions energy: -170.484 where: short stacking energy: -96.257 Base-Backbone interact. energy: -0.408 local terms energy: -124.665121 where: bonds (distance) C4'-P energy: -25.459 bonds (distance) P-C4' energy: -28.178 flat angles C4'-P-C4' energy: -41.744 flat angles P-C4'-P energy: -19.387 tors. eta vs tors. theta energy: -9.897 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -285.785606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.785606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.929877 (E_RNA) where: Base-Base interactions energy: -145.752 where: short stacking energy: -89.494 Base-Backbone interact. energy: 0.313 local terms energy: -140.490445 where: bonds (distance) C4'-P energy: -39.998 bonds (distance) P-C4' energy: -33.959 flat angles C4'-P-C4' energy: -29.032 flat angles P-C4'-P energy: -19.162 tors. eta vs tors. theta energy: -18.339 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -251.343833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.343833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.429541 (E_RNA) where: Base-Base interactions energy: -135.625 where: short stacking energy: -73.824 Base-Backbone interact. energy: -0.934 local terms energy: -114.871355 where: bonds (distance) C4'-P energy: -31.818 bonds (distance) P-C4' energy: -34.476 flat angles C4'-P-C4' energy: -19.786 flat angles P-C4'-P energy: -20.099 tors. eta vs tors. theta energy: -8.692 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -221.501280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.501280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.923191 (E_RNA) where: Base-Base interactions energy: -119.023 where: short stacking energy: -66.930 Base-Backbone interact. energy: 0.061 local terms energy: -105.961048 where: bonds (distance) C4'-P energy: -28.469 bonds (distance) P-C4' energy: -27.862 flat angles C4'-P-C4' energy: -26.115 flat angles P-C4'-P energy: -15.694 tors. eta vs tors. theta energy: -7.822 Dist. restrs. and SS energy: 3.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -548.904263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.904263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.356314 (E_RNA) where: Base-Base interactions energy: -359.186 where: short stacking energy: -177.326 Base-Backbone interact. energy: 2.356 local terms energy: -193.526138 where: bonds (distance) C4'-P energy: -40.764 bonds (distance) P-C4' energy: -36.769 flat angles C4'-P-C4' energy: -43.510 flat angles P-C4'-P energy: -27.343 tors. eta vs tors. theta energy: -45.140 Dist. restrs. and SS energy: 1.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -478.967616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.967616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.158211 (E_RNA) where: Base-Base interactions energy: -276.650 where: short stacking energy: -148.499 Base-Backbone interact. energy: -0.892 local terms energy: -201.616149 where: bonds (distance) C4'-P energy: -38.582 bonds (distance) P-C4' energy: -45.065 flat angles C4'-P-C4' energy: -42.797 flat angles P-C4'-P energy: -30.913 tors. eta vs tors. theta energy: -44.259 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -460.447506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.447506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.488514 (E_RNA) where: Base-Base interactions energy: -272.289 where: short stacking energy: -144.234 Base-Backbone interact. energy: -0.982 local terms energy: -187.216659 where: bonds (distance) C4'-P energy: -44.601 bonds (distance) P-C4' energy: -43.337 flat angles C4'-P-C4' energy: -43.147 flat angles P-C4'-P energy: -20.769 tors. eta vs tors. theta energy: -35.362 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -473.717300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.717300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.772565 (E_RNA) where: Base-Base interactions energy: -281.950 where: short stacking energy: -165.550 Base-Backbone interact. energy: 1.049 local terms energy: -192.871149 where: bonds (distance) C4'-P energy: -36.904 bonds (distance) P-C4' energy: -38.181 flat angles C4'-P-C4' energy: -45.080 flat angles P-C4'-P energy: -24.415 tors. eta vs tors. theta energy: -48.291 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -443.182193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.182193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.233937 (E_RNA) where: Base-Base interactions energy: -271.609 where: short stacking energy: -131.816 Base-Backbone interact. energy: -1.252 local terms energy: -173.373391 where: bonds (distance) C4'-P energy: -34.049 bonds (distance) P-C4' energy: -44.411 flat angles C4'-P-C4' energy: -42.294 flat angles P-C4'-P energy: -22.062 tors. eta vs tors. theta energy: -30.557 Dist. restrs. and SS energy: 3.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -364.028331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.028331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.233215 (E_RNA) where: Base-Base interactions energy: -196.089 where: short stacking energy: -107.834 Base-Backbone interact. energy: -0.287 local terms energy: -167.857391 where: bonds (distance) C4'-P energy: -39.019 bonds (distance) P-C4' energy: -39.569 flat angles C4'-P-C4' energy: -31.223 flat angles P-C4'-P energy: -27.157 tors. eta vs tors. theta energy: -30.889 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -265.950730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.950730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.983091 (E_RNA) where: Base-Base interactions energy: -144.740 where: short stacking energy: -84.096 Base-Backbone interact. energy: 2.026 local terms energy: -123.269179 where: bonds (distance) C4'-P energy: -38.224 bonds (distance) P-C4' energy: -31.574 flat angles C4'-P-C4' energy: -31.886 flat angles P-C4'-P energy: -14.669 tors. eta vs tors. theta energy: -6.916 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -293.278351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.278351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.294993 (E_RNA) where: Base-Base interactions energy: -153.146 where: short stacking energy: -98.368 Base-Backbone interact. energy: 3.036 local terms energy: -143.184918 where: bonds (distance) C4'-P energy: -30.369 bonds (distance) P-C4' energy: -39.509 flat angles C4'-P-C4' energy: -33.161 flat angles P-C4'-P energy: -21.520 tors. eta vs tors. theta energy: -18.626 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -264.431843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.431843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.507790 (E_RNA) where: Base-Base interactions energy: -132.339 where: short stacking energy: -72.332 Base-Backbone interact. energy: 0.089 local terms energy: -132.257722 where: bonds (distance) C4'-P energy: -30.504 bonds (distance) P-C4' energy: -42.660 flat angles C4'-P-C4' energy: -34.190 flat angles P-C4'-P energy: -16.831 tors. eta vs tors. theta energy: -8.073 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -209.934084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.934084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.796910 (E_RNA) where: Base-Base interactions energy: -88.204 where: short stacking energy: -54.652 Base-Backbone interact. energy: 0.915 local terms energy: -124.507842 where: bonds (distance) C4'-P energy: -33.615 bonds (distance) P-C4' energy: -39.253 flat angles C4'-P-C4' energy: -33.034 flat angles P-C4'-P energy: -26.581 tors. eta vs tors. theta energy: 7.975 Dist. restrs. and SS energy: 1.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -557.305852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.305852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.530837 (E_RNA) where: Base-Base interactions energy: -350.951 where: short stacking energy: -175.278 Base-Backbone interact. energy: -0.338 local terms energy: -207.242121 where: bonds (distance) C4'-P energy: -34.221 bonds (distance) P-C4' energy: -43.553 flat angles C4'-P-C4' energy: -45.488 flat angles P-C4'-P energy: -35.613 tors. eta vs tors. theta energy: -48.368 Dist. restrs. and SS energy: 1.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -468.701580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.701580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.178758 (E_RNA) where: Base-Base interactions energy: -300.321 where: short stacking energy: -139.551 Base-Backbone interact. energy: -1.349 local terms energy: -167.508484 where: bonds (distance) C4'-P energy: -26.338 bonds (distance) P-C4' energy: -45.336 flat angles C4'-P-C4' energy: -43.892 flat angles P-C4'-P energy: -24.131 tors. eta vs tors. theta energy: -27.811 Dist. restrs. and SS energy: 0.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -509.973726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.973726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.986755 (E_RNA) where: Base-Base interactions energy: -316.047 where: short stacking energy: -167.156 Base-Backbone interact. energy: -1.139 local terms energy: -192.801435 where: bonds (distance) C4'-P energy: -32.429 bonds (distance) P-C4' energy: -36.918 flat angles C4'-P-C4' energy: -43.242 flat angles P-C4'-P energy: -29.423 tors. eta vs tors. theta energy: -50.789 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -438.427739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.427739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.433829 (E_RNA) where: Base-Base interactions energy: -269.925 where: short stacking energy: -135.262 Base-Backbone interact. energy: 0.129 local terms energy: -168.637884 where: bonds (distance) C4'-P energy: -38.930 bonds (distance) P-C4' energy: -39.680 flat angles C4'-P-C4' energy: -38.213 flat angles P-C4'-P energy: -13.341 tors. eta vs tors. theta energy: -38.474 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -453.771283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.771283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.031408 (E_RNA) where: Base-Base interactions energy: -290.056 where: short stacking energy: -127.228 Base-Backbone interact. energy: -2.383 local terms energy: -161.593191 where: bonds (distance) C4'-P energy: -31.130 bonds (distance) P-C4' energy: -42.928 flat angles C4'-P-C4' energy: -38.599 flat angles P-C4'-P energy: -21.303 tors. eta vs tors. theta energy: -27.634 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -368.948854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.948854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.998113 (E_RNA) where: Base-Base interactions energy: -222.552 where: short stacking energy: -122.609 Base-Backbone interact. energy: -0.705 local terms energy: -145.741034 where: bonds (distance) C4'-P energy: -30.483 bonds (distance) P-C4' energy: -33.085 flat angles C4'-P-C4' energy: -34.292 flat angles P-C4'-P energy: -20.753 tors. eta vs tors. theta energy: -27.128 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -312.052585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.052585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.255068 (E_RNA) where: Base-Base interactions energy: -170.000 where: short stacking energy: -106.982 Base-Backbone interact. energy: 2.796 local terms energy: -145.050833 where: bonds (distance) C4'-P energy: -32.379 bonds (distance) P-C4' energy: -39.080 flat angles C4'-P-C4' energy: -36.303 flat angles P-C4'-P energy: -15.941 tors. eta vs tors. theta energy: -21.348 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -247.222513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.222513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.113821 (E_RNA) where: Base-Base interactions energy: -135.804 where: short stacking energy: -83.879 Base-Backbone interact. energy: 1.714 local terms energy: -119.024196 where: bonds (distance) C4'-P energy: -31.582 bonds (distance) P-C4' energy: -35.610 flat angles C4'-P-C4' energy: -24.272 flat angles P-C4'-P energy: -14.074 tors. eta vs tors. theta energy: -13.486 Dist. restrs. and SS energy: 5.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -238.005551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.005551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.005551 (E_RNA) where: Base-Base interactions energy: -124.378 where: short stacking energy: -71.274 Base-Backbone interact. energy: -0.732 local terms energy: -112.895341 where: bonds (distance) C4'-P energy: -39.791 bonds (distance) P-C4' energy: -24.532 flat angles C4'-P-C4' energy: -26.660 flat angles P-C4'-P energy: -16.561 tors. eta vs tors. theta energy: -5.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -238.267673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.267673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.496480 (E_RNA) where: Base-Base interactions energy: -117.527 where: short stacking energy: -66.453 Base-Backbone interact. energy: -0.109 local terms energy: -120.860326 where: bonds (distance) C4'-P energy: -23.029 bonds (distance) P-C4' energy: -35.561 flat angles C4'-P-C4' energy: -26.198 flat angles P-C4'-P energy: -30.119 tors. eta vs tors. theta energy: -5.953 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -551.260345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.260345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.290631 (E_RNA) where: Base-Base interactions energy: -351.284 where: short stacking energy: -168.422 Base-Backbone interact. energy: -0.508 local terms energy: -200.498718 where: bonds (distance) C4'-P energy: -35.882 bonds (distance) P-C4' energy: -46.183 flat angles C4'-P-C4' energy: -42.657 flat angles P-C4'-P energy: -33.180 tors. eta vs tors. theta energy: -42.596 Dist. restrs. and SS energy: 1.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -529.125443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.125443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.204457 (E_RNA) where: Base-Base interactions energy: -327.097 where: short stacking energy: -179.568 Base-Backbone interact. energy: -0.280 local terms energy: -201.826816 where: bonds (distance) C4'-P energy: -41.441 bonds (distance) P-C4' energy: -40.254 flat angles C4'-P-C4' energy: -38.244 flat angles P-C4'-P energy: -31.122 tors. eta vs tors. theta energy: -50.766 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -470.051515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.051515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.059148 (E_RNA) where: Base-Base interactions energy: -297.324 where: short stacking energy: -147.938 Base-Backbone interact. energy: 0.387 local terms energy: -173.121551 where: bonds (distance) C4'-P energy: -41.141 bonds (distance) P-C4' energy: -31.637 flat angles C4'-P-C4' energy: -40.803 flat angles P-C4'-P energy: -22.514 tors. eta vs tors. theta energy: -37.027 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -479.960208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.960208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.960208 (E_RNA) where: Base-Base interactions energy: -307.181 where: short stacking energy: -132.945 Base-Backbone interact. energy: -1.767 local terms energy: -171.012394 where: bonds (distance) C4'-P energy: -35.138 bonds (distance) P-C4' energy: -41.890 flat angles C4'-P-C4' energy: -41.238 flat angles P-C4'-P energy: -27.368 tors. eta vs tors. theta energy: -25.379 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -410.373065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.373065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.499940 (E_RNA) where: Base-Base interactions energy: -254.037 where: short stacking energy: -143.602 Base-Backbone interact. energy: -0.509 local terms energy: -155.953111 where: bonds (distance) C4'-P energy: -30.838 bonds (distance) P-C4' energy: -41.715 flat angles C4'-P-C4' energy: -37.218 flat angles P-C4'-P energy: -12.935 tors. eta vs tors. theta energy: -33.248 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -388.572910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.572910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.572910 (E_RNA) where: Base-Base interactions energy: -233.637 where: short stacking energy: -126.540 Base-Backbone interact. energy: -0.467 local terms energy: -154.469568 where: bonds (distance) C4'-P energy: -27.970 bonds (distance) P-C4' energy: -40.241 flat angles C4'-P-C4' energy: -37.254 flat angles P-C4'-P energy: -23.246 tors. eta vs tors. theta energy: -25.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -276.620232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.620232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.055774 (E_RNA) where: Base-Base interactions energy: -130.192 where: short stacking energy: -69.647 Base-Backbone interact. energy: -0.718 local terms energy: -146.146680 where: bonds (distance) C4'-P energy: -34.956 bonds (distance) P-C4' energy: -39.817 flat angles C4'-P-C4' energy: -36.808 flat angles P-C4'-P energy: -14.559 tors. eta vs tors. theta energy: -20.007 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -250.615253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.615253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.745321 (E_RNA) where: Base-Base interactions energy: -127.816 where: short stacking energy: -91.533 Base-Backbone interact. energy: -0.018 local terms energy: -124.910945 where: bonds (distance) C4'-P energy: -33.031 bonds (distance) P-C4' energy: -32.497 flat angles C4'-P-C4' energy: -29.947 flat angles P-C4'-P energy: -9.600 tors. eta vs tors. theta energy: -19.837 Dist. restrs. and SS energy: 2.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -219.663438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.663438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.733067 (E_RNA) where: Base-Base interactions energy: -100.643 where: short stacking energy: -61.142 Base-Backbone interact. energy: 2.157 local terms energy: -121.246528 where: bonds (distance) C4'-P energy: -32.622 bonds (distance) P-C4' energy: -35.769 flat angles C4'-P-C4' energy: -32.098 flat angles P-C4'-P energy: -22.440 tors. eta vs tors. theta energy: 1.683 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -235.733263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.733263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.733263 (E_RNA) where: Base-Base interactions energy: -132.082 where: short stacking energy: -68.673 Base-Backbone interact. energy: -1.287 local terms energy: -102.364117 where: bonds (distance) C4'-P energy: -27.544 bonds (distance) P-C4' energy: -30.968 flat angles C4'-P-C4' energy: -21.738 flat angles P-C4'-P energy: -25.290 tors. eta vs tors. theta energy: 3.176 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -542.838859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.838859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.405526 (E_RNA) where: Base-Base interactions energy: -340.985 where: short stacking energy: -161.340 Base-Backbone interact. energy: -0.043 local terms energy: -202.377122 where: bonds (distance) C4'-P energy: -40.793 bonds (distance) P-C4' energy: -37.613 flat angles C4'-P-C4' energy: -43.557 flat angles P-C4'-P energy: -34.710 tors. eta vs tors. theta energy: -45.704 Dist. restrs. and SS energy: 0.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -479.602377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.602377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.031843 (E_RNA) where: Base-Base interactions energy: -299.850 where: short stacking energy: -153.453 Base-Backbone interact. energy: -0.194 local terms energy: -179.987952 where: bonds (distance) C4'-P energy: -30.123 bonds (distance) P-C4' energy: -43.763 flat angles C4'-P-C4' energy: -37.957 flat angles P-C4'-P energy: -23.928 tors. eta vs tors. theta energy: -44.216 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -469.938263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.938263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.938263 (E_RNA) where: Base-Base interactions energy: -292.096 where: short stacking energy: -133.727 Base-Backbone interact. energy: -1.528 local terms energy: -176.315082 where: bonds (distance) C4'-P energy: -38.034 bonds (distance) P-C4' energy: -43.279 flat angles C4'-P-C4' energy: -36.776 flat angles P-C4'-P energy: -29.121 tors. eta vs tors. theta energy: -29.105 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -444.063769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.063769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.063769 (E_RNA) where: Base-Base interactions energy: -267.748 where: short stacking energy: -139.487 Base-Backbone interact. energy: -0.604 local terms energy: -175.711902 where: bonds (distance) C4'-P energy: -38.659 bonds (distance) P-C4' energy: -40.734 flat angles C4'-P-C4' energy: -36.873 flat angles P-C4'-P energy: -22.254 tors. eta vs tors. theta energy: -37.192 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -429.560112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.560112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.621821 (E_RNA) where: Base-Base interactions energy: -274.435 where: short stacking energy: -124.475 Base-Backbone interact. energy: -1.163 local terms energy: -154.024264 where: bonds (distance) C4'-P energy: -29.472 bonds (distance) P-C4' energy: -34.974 flat angles C4'-P-C4' energy: -38.012 flat angles P-C4'-P energy: -23.996 tors. eta vs tors. theta energy: -27.570 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -378.048015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.048015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.106812 (E_RNA) where: Base-Base interactions energy: -213.196 where: short stacking energy: -105.126 Base-Backbone interact. energy: -0.545 local terms energy: -164.365984 where: bonds (distance) C4'-P energy: -39.701 bonds (distance) P-C4' energy: -34.856 flat angles C4'-P-C4' energy: -39.526 flat angles P-C4'-P energy: -24.021 tors. eta vs tors. theta energy: -26.263 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -289.119960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.119960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.171996 (E_RNA) where: Base-Base interactions energy: -145.675 where: short stacking energy: -84.771 Base-Backbone interact. energy: -1.592 local terms energy: -141.905230 where: bonds (distance) C4'-P energy: -41.493 bonds (distance) P-C4' energy: -35.830 flat angles C4'-P-C4' energy: -38.780 flat angles P-C4'-P energy: -11.118 tors. eta vs tors. theta energy: -14.683 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -271.673335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.673335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.806886 (E_RNA) where: Base-Base interactions energy: -158.458 where: short stacking energy: -67.167 Base-Backbone interact. energy: 1.338 local terms energy: -114.686527 where: bonds (distance) C4'-P energy: -33.221 bonds (distance) P-C4' energy: -39.420 flat angles C4'-P-C4' energy: -21.394 flat angles P-C4'-P energy: -11.628 tors. eta vs tors. theta energy: -9.023 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -256.820948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.820948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.090247 (E_RNA) where: Base-Base interactions energy: -131.182 where: short stacking energy: -66.864 Base-Backbone interact. energy: -0.532 local terms energy: -125.376573 where: bonds (distance) C4'-P energy: -31.329 bonds (distance) P-C4' energy: -34.606 flat angles C4'-P-C4' energy: -31.425 flat angles P-C4'-P energy: -21.309 tors. eta vs tors. theta energy: -6.707 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -208.594019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.594019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.221717 (E_RNA) where: Base-Base interactions energy: -87.769 where: short stacking energy: -53.564 Base-Backbone interact. energy: -1.321 local terms energy: -124.131496 where: bonds (distance) C4'-P energy: -40.511 bonds (distance) P-C4' energy: -30.627 flat angles C4'-P-C4' energy: -27.320 flat angles P-C4'-P energy: -26.781 tors. eta vs tors. theta energy: 1.107 Dist. restrs. and SS energy: 4.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -563.604314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.604314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.921669 (E_RNA) where: Base-Base interactions energy: -363.110 where: short stacking energy: -188.815 Base-Backbone interact. energy: 0.242 local terms energy: -202.053098 where: bonds (distance) C4'-P energy: -43.475 bonds (distance) P-C4' energy: -39.767 flat angles C4'-P-C4' energy: -44.417 flat angles P-C4'-P energy: -26.207 tors. eta vs tors. theta energy: -48.187 Dist. restrs. and SS energy: 1.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -521.076194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.076194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.139831 (E_RNA) where: Base-Base interactions energy: -320.546 where: short stacking energy: -164.296 Base-Backbone interact. energy: 1.123 local terms energy: -201.716751 where: bonds (distance) C4'-P energy: -41.720 bonds (distance) P-C4' energy: -42.413 flat angles C4'-P-C4' energy: -37.940 flat angles P-C4'-P energy: -31.804 tors. eta vs tors. theta energy: -47.839 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -485.553806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.553806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.588229 (E_RNA) where: Base-Base interactions energy: -323.227 where: short stacking energy: -154.464 Base-Backbone interact. energy: 1.038 local terms energy: -163.399608 where: bonds (distance) C4'-P energy: -30.642 bonds (distance) P-C4' energy: -28.596 flat angles C4'-P-C4' energy: -41.220 flat angles P-C4'-P energy: -28.764 tors. eta vs tors. theta energy: -34.177 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -432.491803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.491803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.769114 (E_RNA) where: Base-Base interactions energy: -266.558 where: short stacking energy: -143.611 Base-Backbone interact. energy: -0.624 local terms energy: -165.586317 where: bonds (distance) C4'-P energy: -33.159 bonds (distance) P-C4' energy: -35.454 flat angles C4'-P-C4' energy: -42.064 flat angles P-C4'-P energy: -27.534 tors. eta vs tors. theta energy: -27.375 Dist. restrs. and SS energy: 0.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -396.343943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.343943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.370750 (E_RNA) where: Base-Base interactions energy: -235.405 where: short stacking energy: -119.428 Base-Backbone interact. energy: -0.450 local terms energy: -160.515267 where: bonds (distance) C4'-P energy: -31.035 bonds (distance) P-C4' energy: -41.533 flat angles C4'-P-C4' energy: -39.185 flat angles P-C4'-P energy: -24.977 tors. eta vs tors. theta energy: -23.786 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -376.251744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.251744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.289825 (E_RNA) where: Base-Base interactions energy: -206.301 where: short stacking energy: -103.277 Base-Backbone interact. energy: 0.692 local terms energy: -170.681127 where: bonds (distance) C4'-P energy: -39.724 bonds (distance) P-C4' energy: -47.923 flat angles C4'-P-C4' energy: -36.372 flat angles P-C4'-P energy: -24.462 tors. eta vs tors. theta energy: -22.201 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -339.031530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.031530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.237769 (E_RNA) where: Base-Base interactions energy: -195.675 where: short stacking energy: -112.723 Base-Backbone interact. energy: -0.566 local terms energy: -142.996743 where: bonds (distance) C4'-P energy: -33.265 bonds (distance) P-C4' energy: -37.066 flat angles C4'-P-C4' energy: -35.718 flat angles P-C4'-P energy: -17.390 tors. eta vs tors. theta energy: -19.557 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -266.912994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.912994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.990684 (E_RNA) where: Base-Base interactions energy: -135.876 where: short stacking energy: -79.095 Base-Backbone interact. energy: -0.389 local terms energy: -130.725269 where: bonds (distance) C4'-P energy: -40.051 bonds (distance) P-C4' energy: -35.950 flat angles C4'-P-C4' energy: -27.115 flat angles P-C4'-P energy: -16.469 tors. eta vs tors. theta energy: -11.140 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -240.328565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.328565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.967868 (E_RNA) where: Base-Base interactions energy: -125.131 where: short stacking energy: -83.920 Base-Backbone interact. energy: -1.302 local terms energy: -117.535695 where: bonds (distance) C4'-P energy: -29.199 bonds (distance) P-C4' energy: -27.892 flat angles C4'-P-C4' energy: -38.126 flat angles P-C4'-P energy: -12.402 tors. eta vs tors. theta energy: -9.917 Dist. restrs. and SS energy: 3.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -212.551475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.551475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.014139 (E_RNA) where: Base-Base interactions energy: -89.651 where: short stacking energy: -43.673 Base-Backbone interact. energy: 1.082 local terms energy: -125.445515 where: bonds (distance) C4'-P energy: -38.763 bonds (distance) P-C4' energy: -33.440 flat angles C4'-P-C4' energy: -34.457 flat angles P-C4'-P energy: -25.817 tors. eta vs tors. theta energy: 7.031 Dist. restrs. and SS energy: 1.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -570.438197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.438197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.449815 (E_RNA) where: Base-Base interactions energy: -364.432 where: short stacking energy: -182.419 Base-Backbone interact. energy: 3.631 local terms energy: -212.648861 where: bonds (distance) C4'-P energy: -43.690 bonds (distance) P-C4' energy: -44.259 flat angles C4'-P-C4' energy: -43.745 flat angles P-C4'-P energy: -35.616 tors. eta vs tors. theta energy: -45.339 Dist. restrs. and SS energy: 3.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -520.186169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.186169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.253037 (E_RNA) where: Base-Base interactions energy: -316.263 where: short stacking energy: -166.171 Base-Backbone interact. energy: 0.493 local terms energy: -204.482904 where: bonds (distance) C4'-P energy: -36.554 bonds (distance) P-C4' energy: -40.894 flat angles C4'-P-C4' energy: -43.061 flat angles P-C4'-P energy: -33.505 tors. eta vs tors. theta energy: -50.470 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -456.812647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.812647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.833687 (E_RNA) where: Base-Base interactions energy: -275.503 where: short stacking energy: -142.745 Base-Backbone interact. energy: -0.124 local terms energy: -182.206706 where: bonds (distance) C4'-P energy: -43.036 bonds (distance) P-C4' energy: -34.077 flat angles C4'-P-C4' energy: -45.295 flat angles P-C4'-P energy: -26.881 tors. eta vs tors. theta energy: -32.918 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -443.783337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.783337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.798146 (E_RNA) where: Base-Base interactions energy: -285.130 where: short stacking energy: -140.347 Base-Backbone interact. energy: 2.640 local terms energy: -161.307822 where: bonds (distance) C4'-P energy: -30.039 bonds (distance) P-C4' energy: -42.529 flat angles C4'-P-C4' energy: -37.515 flat angles P-C4'-P energy: -23.099 tors. eta vs tors. theta energy: -28.126 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -404.605711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.605711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.763447 (E_RNA) where: Base-Base interactions energy: -234.678 where: short stacking energy: -121.200 Base-Backbone interact. energy: -1.411 local terms energy: -168.675046 where: bonds (distance) C4'-P energy: -32.901 bonds (distance) P-C4' energy: -41.492 flat angles C4'-P-C4' energy: -42.407 flat angles P-C4'-P energy: -23.780 tors. eta vs tors. theta energy: -28.094 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -365.329724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.329724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.452826 (E_RNA) where: Base-Base interactions energy: -220.288 where: short stacking energy: -96.811 Base-Backbone interact. energy: -0.837 local terms energy: -144.327866 where: bonds (distance) C4'-P energy: -38.897 bonds (distance) P-C4' energy: -30.642 flat angles C4'-P-C4' energy: -30.334 flat angles P-C4'-P energy: -27.011 tors. eta vs tors. theta energy: -17.443 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -346.097496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.097496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.311553 (E_RNA) where: Base-Base interactions energy: -196.621 where: short stacking energy: -93.869 Base-Backbone interact. energy: -0.264 local terms energy: -149.426375 where: bonds (distance) C4'-P energy: -26.802 bonds (distance) P-C4' energy: -36.390 flat angles C4'-P-C4' energy: -40.232 flat angles P-C4'-P energy: -15.763 tors. eta vs tors. theta energy: -30.239 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -274.043894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.043894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.351420 (E_RNA) where: Base-Base interactions energy: -139.096 where: short stacking energy: -84.815 Base-Backbone interact. energy: -0.189 local terms energy: -135.066487 where: bonds (distance) C4'-P energy: -28.663 bonds (distance) P-C4' energy: -34.552 flat angles C4'-P-C4' energy: -29.110 flat angles P-C4'-P energy: -24.999 tors. eta vs tors. theta energy: -17.743 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -227.939595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.939595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.634914 (E_RNA) where: Base-Base interactions energy: -115.125 where: short stacking energy: -54.544 Base-Backbone interact. energy: 2.879 local terms energy: -116.388518 where: bonds (distance) C4'-P energy: -36.393 bonds (distance) P-C4' energy: -27.649 flat angles C4'-P-C4' energy: -26.597 flat angles P-C4'-P energy: -28.317 tors. eta vs tors. theta energy: 2.568 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -199.600551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.600551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.436975 (E_RNA) where: Base-Base interactions energy: -104.867 where: short stacking energy: -65.379 Base-Backbone interact. energy: -0.440 local terms energy: -95.130389 where: bonds (distance) C4'-P energy: -32.868 bonds (distance) P-C4' energy: -32.284 flat angles C4'-P-C4' energy: -21.146 flat angles P-C4'-P energy: -12.760 tors. eta vs tors. theta energy: 3.927 Dist. restrs. and SS energy: 0.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -578.335960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.335960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.348437 (E_RNA) where: Base-Base interactions energy: -371.628 where: short stacking energy: -184.321 Base-Backbone interact. energy: -0.854 local terms energy: -206.866767 where: bonds (distance) C4'-P energy: -41.297 bonds (distance) P-C4' energy: -41.566 flat angles C4'-P-C4' energy: -44.931 flat angles P-C4'-P energy: -28.110 tors. eta vs tors. theta energy: -50.963 Dist. restrs. and SS energy: 1.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -523.279200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.279200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.292198 (E_RNA) where: Base-Base interactions energy: -320.044 where: short stacking energy: -177.889 Base-Backbone interact. energy: 2.391 local terms energy: -205.639277 where: bonds (distance) C4'-P energy: -37.323 bonds (distance) P-C4' energy: -37.157 flat angles C4'-P-C4' energy: -45.033 flat angles P-C4'-P energy: -35.979 tors. eta vs tors. theta energy: -50.148 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -469.037078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.037078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.308649 (E_RNA) where: Base-Base interactions energy: -291.843 where: short stacking energy: -160.541 Base-Backbone interact. energy: -0.380 local terms energy: -178.085681 where: bonds (distance) C4'-P energy: -42.901 bonds (distance) P-C4' energy: -34.345 flat angles C4'-P-C4' energy: -43.137 flat angles P-C4'-P energy: -19.876 tors. eta vs tors. theta energy: -37.827 Dist. restrs. and SS energy: 1.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -476.850847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.850847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.855841 (E_RNA) where: Base-Base interactions energy: -307.783 where: short stacking energy: -160.268 Base-Backbone interact. energy: 0.273 local terms energy: -169.345966 where: bonds (distance) C4'-P energy: -39.798 bonds (distance) P-C4' energy: -29.392 flat angles C4'-P-C4' energy: -36.526 flat angles P-C4'-P energy: -23.357 tors. eta vs tors. theta energy: -40.273 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -408.672472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.672472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.688343 (E_RNA) where: Base-Base interactions energy: -252.263 where: short stacking energy: -108.576 Base-Backbone interact. energy: -0.764 local terms energy: -155.661959 where: bonds (distance) C4'-P energy: -35.722 bonds (distance) P-C4' energy: -38.011 flat angles C4'-P-C4' energy: -39.701 flat angles P-C4'-P energy: -21.748 tors. eta vs tors. theta energy: -20.480 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -354.547198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.547198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.848708 (E_RNA) where: Base-Base interactions energy: -187.199 where: short stacking energy: -108.134 Base-Backbone interact. energy: -0.231 local terms energy: -167.418279 where: bonds (distance) C4'-P energy: -39.586 bonds (distance) P-C4' energy: -41.185 flat angles C4'-P-C4' energy: -34.959 flat angles P-C4'-P energy: -26.982 tors. eta vs tors. theta energy: -24.706 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -347.852747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.852747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.877704 (E_RNA) where: Base-Base interactions energy: -189.043 where: short stacking energy: -92.204 Base-Backbone interact. energy: -0.459 local terms energy: -158.375414 where: bonds (distance) C4'-P energy: -35.912 bonds (distance) P-C4' energy: -41.773 flat angles C4'-P-C4' energy: -39.592 flat angles P-C4'-P energy: -19.252 tors. eta vs tors. theta energy: -21.847 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -278.577726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.577726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.642585 (E_RNA) where: Base-Base interactions energy: -146.383 where: short stacking energy: -78.132 Base-Backbone interact. energy: 0.317 local terms energy: -132.576417 where: bonds (distance) C4'-P energy: -39.052 bonds (distance) P-C4' energy: -39.554 flat angles C4'-P-C4' energy: -27.051 flat angles P-C4'-P energy: -19.391 tors. eta vs tors. theta energy: -7.530 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -223.545727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.545727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.577202 (E_RNA) where: Base-Base interactions energy: -101.984 where: short stacking energy: -56.012 Base-Backbone interact. energy: -0.485 local terms energy: -124.108001 where: bonds (distance) C4'-P energy: -32.659 bonds (distance) P-C4' energy: -42.268 flat angles C4'-P-C4' energy: -34.710 flat angles P-C4'-P energy: -13.873 tors. eta vs tors. theta energy: -0.599 Dist. restrs. and SS energy: 3.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -214.527532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.527532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.978744 (E_RNA) where: Base-Base interactions energy: -103.347 where: short stacking energy: -53.214 Base-Backbone interact. energy: -0.671 local terms energy: -113.960683 where: bonds (distance) C4'-P energy: -26.749 bonds (distance) P-C4' energy: -36.413 flat angles C4'-P-C4' energy: -28.652 flat angles P-C4'-P energy: -20.325 tors. eta vs tors. theta energy: -1.821 Dist. restrs. and SS energy: 3.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -575.373230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.373230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.687329 (E_RNA) where: Base-Base interactions energy: -379.291 where: short stacking energy: -183.396 Base-Backbone interact. energy: -1.113 local terms energy: -198.282520 where: bonds (distance) C4'-P energy: -35.597 bonds (distance) P-C4' energy: -44.573 flat angles C4'-P-C4' energy: -42.306 flat angles P-C4'-P energy: -26.187 tors. eta vs tors. theta energy: -49.620 Dist. restrs. and SS energy: 3.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -524.369554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.369554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.660688 (E_RNA) where: Base-Base interactions energy: -326.824 where: short stacking energy: -176.144 Base-Backbone interact. energy: -0.335 local terms energy: -197.502197 where: bonds (distance) C4'-P energy: -38.404 bonds (distance) P-C4' energy: -35.846 flat angles C4'-P-C4' energy: -46.022 flat angles P-C4'-P energy: -26.109 tors. eta vs tors. theta energy: -51.121 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -456.723512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.723512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.941170 (E_RNA) where: Base-Base interactions energy: -279.557 where: short stacking energy: -149.661 Base-Backbone interact. energy: -1.249 local terms energy: -176.135157 where: bonds (distance) C4'-P energy: -38.165 bonds (distance) P-C4' energy: -36.988 flat angles C4'-P-C4' energy: -42.300 flat angles P-C4'-P energy: -24.779 tors. eta vs tors. theta energy: -33.903 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -455.907677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.907677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.087823 (E_RNA) where: Base-Base interactions energy: -273.738 where: short stacking energy: -142.182 Base-Backbone interact. energy: -1.119 local terms energy: -181.230694 where: bonds (distance) C4'-P energy: -38.138 bonds (distance) P-C4' energy: -45.466 flat angles C4'-P-C4' energy: -44.694 flat angles P-C4'-P energy: -21.876 tors. eta vs tors. theta energy: -31.056 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -449.521928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.521928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.521928 (E_RNA) where: Base-Base interactions energy: -285.491 where: short stacking energy: -118.611 Base-Backbone interact. energy: -1.183 local terms energy: -162.848295 where: bonds (distance) C4'-P energy: -33.316 bonds (distance) P-C4' energy: -35.649 flat angles C4'-P-C4' energy: -39.438 flat angles P-C4'-P energy: -22.590 tors. eta vs tors. theta energy: -31.856 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -407.067967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.067967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.402571 (E_RNA) where: Base-Base interactions energy: -248.784 where: short stacking energy: -122.886 Base-Backbone interact. energy: -0.184 local terms energy: -158.434725 where: bonds (distance) C4'-P energy: -38.024 bonds (distance) P-C4' energy: -38.405 flat angles C4'-P-C4' energy: -40.548 flat angles P-C4'-P energy: -18.917 tors. eta vs tors. theta energy: -22.541 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -334.516200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.516200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.617835 (E_RNA) where: Base-Base interactions energy: -189.244 where: short stacking energy: -98.674 Base-Backbone interact. energy: -1.107 local terms energy: -144.267071 where: bonds (distance) C4'-P energy: -39.964 bonds (distance) P-C4' energy: -35.730 flat angles C4'-P-C4' energy: -30.095 flat angles P-C4'-P energy: -17.343 tors. eta vs tors. theta energy: -21.135 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -239.735967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.735967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.674793 (E_RNA) where: Base-Base interactions energy: -119.829 where: short stacking energy: -53.837 Base-Backbone interact. energy: 0.867 local terms energy: -122.712740 where: bonds (distance) C4'-P energy: -32.256 bonds (distance) P-C4' energy: -37.540 flat angles C4'-P-C4' energy: -29.572 flat angles P-C4'-P energy: -24.366 tors. eta vs tors. theta energy: 1.021 Dist. restrs. and SS energy: 1.939 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -265.966367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.966367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.110350 (E_RNA) where: Base-Base interactions energy: -136.091 where: short stacking energy: -75.192 Base-Backbone interact. energy: 0.225 local terms energy: -130.244954 where: bonds (distance) C4'-P energy: -28.057 bonds (distance) P-C4' energy: -30.161 flat angles C4'-P-C4' energy: -43.413 flat angles P-C4'-P energy: -13.766 tors. eta vs tors. theta energy: -14.848 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -219.839391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.839391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.026514 (E_RNA) where: Base-Base interactions energy: -103.699 where: short stacking energy: -55.809 Base-Backbone interact. energy: 2.665 local terms energy: -123.992556 where: bonds (distance) C4'-P energy: -41.102 bonds (distance) P-C4' energy: -41.846 flat angles C4'-P-C4' energy: -27.998 flat angles P-C4'-P energy: -15.069 tors. eta vs tors. theta energy: 2.022 Dist. restrs. and SS energy: 5.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -588.502170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.502170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.919071 (E_RNA) where: Base-Base interactions energy: -381.040 where: short stacking energy: -184.570 Base-Backbone interact. energy: 0.229 local terms energy: -208.107693 where: bonds (distance) C4'-P energy: -38.939 bonds (distance) P-C4' energy: -43.989 flat angles C4'-P-C4' energy: -43.428 flat angles P-C4'-P energy: -29.125 tors. eta vs tors. theta energy: -52.626 Dist. restrs. and SS energy: 0.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -523.072295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.072295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.073762 (E_RNA) where: Base-Base interactions energy: -320.804 where: short stacking energy: -182.004 Base-Backbone interact. energy: 1.713 local terms energy: -203.981918 where: bonds (distance) C4'-P energy: -43.172 bonds (distance) P-C4' energy: -44.571 flat angles C4'-P-C4' energy: -42.900 flat angles P-C4'-P energy: -28.927 tors. eta vs tors. theta energy: -44.412 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -467.226716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.226716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.251229 (E_RNA) where: Base-Base interactions energy: -287.260 where: short stacking energy: -145.160 Base-Backbone interact. energy: -0.432 local terms energy: -179.559037 where: bonds (distance) C4'-P energy: -32.954 bonds (distance) P-C4' energy: -39.818 flat angles C4'-P-C4' energy: -33.768 flat angles P-C4'-P energy: -37.116 tors. eta vs tors. theta energy: -35.903 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -470.931992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.931992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.097490 (E_RNA) where: Base-Base interactions energy: -302.212 where: short stacking energy: -137.866 Base-Backbone interact. energy: 0.222 local terms energy: -169.107500 where: bonds (distance) C4'-P energy: -39.886 bonds (distance) P-C4' energy: -36.238 flat angles C4'-P-C4' energy: -34.891 flat angles P-C4'-P energy: -25.843 tors. eta vs tors. theta energy: -32.250 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -443.327817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.327817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.567637 (E_RNA) where: Base-Base interactions energy: -288.128 where: short stacking energy: -152.036 Base-Backbone interact. energy: -1.464 local terms energy: -153.974939 where: bonds (distance) C4'-P energy: -30.238 bonds (distance) P-C4' energy: -26.784 flat angles C4'-P-C4' energy: -34.873 flat angles P-C4'-P energy: -25.235 tors. eta vs tors. theta energy: -36.845 Dist. restrs. and SS energy: 0.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -432.572381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.572381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.793316 (E_RNA) where: Base-Base interactions energy: -263.692 where: short stacking energy: -147.871 Base-Backbone interact. energy: -0.160 local terms energy: -168.940938 where: bonds (distance) C4'-P energy: -32.650 bonds (distance) P-C4' energy: -29.303 flat angles C4'-P-C4' energy: -45.747 flat angles P-C4'-P energy: -23.111 tors. eta vs tors. theta energy: -38.130 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -326.360922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.360922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.674983 (E_RNA) where: Base-Base interactions energy: -186.384 where: short stacking energy: -101.205 Base-Backbone interact. energy: -0.613 local terms energy: -139.678145 where: bonds (distance) C4'-P energy: -27.164 bonds (distance) P-C4' energy: -36.179 flat angles C4'-P-C4' energy: -36.635 flat angles P-C4'-P energy: -20.255 tors. eta vs tors. theta energy: -19.446 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -289.051647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.051647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.096020 (E_RNA) where: Base-Base interactions energy: -164.578 where: short stacking energy: -91.082 Base-Backbone interact. energy: -0.980 local terms energy: -123.538254 where: bonds (distance) C4'-P energy: -22.693 bonds (distance) P-C4' energy: -29.907 flat angles C4'-P-C4' energy: -36.824 flat angles P-C4'-P energy: -22.755 tors. eta vs tors. theta energy: -11.360 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -242.766800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.766800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.838697 (E_RNA) where: Base-Base interactions energy: -129.405 where: short stacking energy: -77.303 Base-Backbone interact. energy: -1.016 local terms energy: -112.417874 where: bonds (distance) C4'-P energy: -36.238 bonds (distance) P-C4' energy: -22.256 flat angles C4'-P-C4' energy: -32.429 flat angles P-C4'-P energy: -14.632 tors. eta vs tors. theta energy: -6.863 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -224.214718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.214718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.081511 (E_RNA) where: Base-Base interactions energy: -120.257 where: short stacking energy: -63.796 Base-Backbone interact. energy: 3.376 local terms energy: -109.200819 where: bonds (distance) C4'-P energy: -24.166 bonds (distance) P-C4' energy: -35.579 flat angles C4'-P-C4' energy: -31.161 flat angles P-C4'-P energy: -20.391 tors. eta vs tors. theta energy: 2.095 Dist. restrs. and SS energy: 1.867 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -593.115558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.115558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.476795 (E_RNA) where: Base-Base interactions energy: -387.195 where: short stacking energy: -198.360 Base-Backbone interact. energy: 2.225 local terms energy: -209.506891 where: bonds (distance) C4'-P energy: -38.308 bonds (distance) P-C4' energy: -36.250 flat angles C4'-P-C4' energy: -43.350 flat angles P-C4'-P energy: -34.098 tors. eta vs tors. theta energy: -57.500 Dist. restrs. and SS energy: 1.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -527.640136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.640136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.818578 (E_RNA) where: Base-Base interactions energy: -321.964 where: short stacking energy: -169.813 Base-Backbone interact. energy: -0.349 local terms energy: -205.505144 where: bonds (distance) C4'-P energy: -40.387 bonds (distance) P-C4' energy: -37.185 flat angles C4'-P-C4' energy: -43.034 flat angles P-C4'-P energy: -35.793 tors. eta vs tors. theta energy: -49.107 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -463.895784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.895784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.112216 (E_RNA) where: Base-Base interactions energy: -291.849 where: short stacking energy: -153.184 Base-Backbone interact. energy: -0.398 local terms energy: -171.864801 where: bonds (distance) C4'-P energy: -31.286 bonds (distance) P-C4' energy: -42.857 flat angles C4'-P-C4' energy: -40.406 flat angles P-C4'-P energy: -23.600 tors. eta vs tors. theta energy: -33.716 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -467.564050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.564050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.721418 (E_RNA) where: Base-Base interactions energy: -295.366 where: short stacking energy: -145.038 Base-Backbone interact. energy: 0.423 local terms energy: -172.778684 where: bonds (distance) C4'-P energy: -38.760 bonds (distance) P-C4' energy: -40.129 flat angles C4'-P-C4' energy: -41.648 flat angles P-C4'-P energy: -21.640 tors. eta vs tors. theta energy: -30.602 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -416.604140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.604140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.604140 (E_RNA) where: Base-Base interactions energy: -264.719 where: short stacking energy: -128.974 Base-Backbone interact. energy: -0.606 local terms energy: -151.278993 where: bonds (distance) C4'-P energy: -30.824 bonds (distance) P-C4' energy: -45.425 flat angles C4'-P-C4' energy: -35.624 flat angles P-C4'-P energy: -17.580 tors. eta vs tors. theta energy: -21.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -406.392770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.392770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.392770 (E_RNA) where: Base-Base interactions energy: -236.673 where: short stacking energy: -111.024 Base-Backbone interact. energy: -1.127 local terms energy: -168.592474 where: bonds (distance) C4'-P energy: -38.598 bonds (distance) P-C4' energy: -37.769 flat angles C4'-P-C4' energy: -42.494 flat angles P-C4'-P energy: -28.091 tors. eta vs tors. theta energy: -21.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -364.298515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.298515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.331297 (E_RNA) where: Base-Base interactions energy: -205.065 where: short stacking energy: -107.393 Base-Backbone interact. energy: -1.438 local terms energy: -157.827958 where: bonds (distance) C4'-P energy: -32.580 bonds (distance) P-C4' energy: -38.936 flat angles C4'-P-C4' energy: -39.526 flat angles P-C4'-P energy: -24.129 tors. eta vs tors. theta energy: -22.657 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -276.231622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.231622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.360796 (E_RNA) where: Base-Base interactions energy: -127.807 where: short stacking energy: -75.859 Base-Backbone interact. energy: 0.425 local terms energy: -148.978366 where: bonds (distance) C4'-P energy: -38.835 bonds (distance) P-C4' energy: -36.667 flat angles C4'-P-C4' energy: -36.323 flat angles P-C4'-P energy: -17.114 tors. eta vs tors. theta energy: -20.040 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -249.229498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.229498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.263675 (E_RNA) where: Base-Base interactions energy: -128.540 where: short stacking energy: -70.844 Base-Backbone interact. energy: -0.366 local terms energy: -120.357402 where: bonds (distance) C4'-P energy: -26.261 bonds (distance) P-C4' energy: -32.219 flat angles C4'-P-C4' energy: -32.391 flat angles P-C4'-P energy: -19.547 tors. eta vs tors. theta energy: -9.940 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -227.787773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.787773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.240361 (E_RNA) where: Base-Base interactions energy: -120.179 where: short stacking energy: -55.590 Base-Backbone interact. energy: 1.191 local terms energy: -109.253002 where: bonds (distance) C4'-P energy: -36.582 bonds (distance) P-C4' energy: -34.773 flat angles C4'-P-C4' energy: -24.285 flat angles P-C4'-P energy: -12.720 tors. eta vs tors. theta energy: -0.893 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -578.707815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.707815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.964842 (E_RNA) where: Base-Base interactions energy: -384.482 where: short stacking energy: -192.325 Base-Backbone interact. energy: 1.041 local terms energy: -197.523052 where: bonds (distance) C4'-P energy: -35.400 bonds (distance) P-C4' energy: -42.035 flat angles C4'-P-C4' energy: -35.403 flat angles P-C4'-P energy: -33.429 tors. eta vs tors. theta energy: -51.256 Dist. restrs. and SS energy: 2.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -515.584236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.584236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.746028 (E_RNA) where: Base-Base interactions energy: -314.693 where: short stacking energy: -166.283 Base-Backbone interact. energy: 0.094 local terms energy: -201.146689 where: bonds (distance) C4'-P energy: -41.788 bonds (distance) P-C4' energy: -32.499 flat angles C4'-P-C4' energy: -46.713 flat angles P-C4'-P energy: -26.623 tors. eta vs tors. theta energy: -53.523 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -456.000516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.000516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.003009 (E_RNA) where: Base-Base interactions energy: -278.599 where: short stacking energy: -148.598 Base-Backbone interact. energy: -0.267 local terms energy: -177.136644 where: bonds (distance) C4'-P energy: -35.079 bonds (distance) P-C4' energy: -38.754 flat angles C4'-P-C4' energy: -36.600 flat angles P-C4'-P energy: -30.309 tors. eta vs tors. theta energy: -36.395 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -468.203890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.203890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.277503 (E_RNA) where: Base-Base interactions energy: -299.037 where: short stacking energy: -125.446 Base-Backbone interact. energy: -0.341 local terms energy: -168.898708 where: bonds (distance) C4'-P energy: -32.192 bonds (distance) P-C4' energy: -36.767 flat angles C4'-P-C4' energy: -37.408 flat angles P-C4'-P energy: -27.580 tors. eta vs tors. theta energy: -34.952 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -412.429267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.429267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.441612 (E_RNA) where: Base-Base interactions energy: -247.113 where: short stacking energy: -133.556 Base-Backbone interact. energy: 1.152 local terms energy: -166.481451 where: bonds (distance) C4'-P energy: -31.988 bonds (distance) P-C4' energy: -42.131 flat angles C4'-P-C4' energy: -41.440 flat angles P-C4'-P energy: -22.239 tors. eta vs tors. theta energy: -28.684 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -437.737657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.737657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.789735 (E_RNA) where: Base-Base interactions energy: -262.187 where: short stacking energy: -135.672 Base-Backbone interact. energy: -0.549 local terms energy: -175.054275 where: bonds (distance) C4'-P energy: -33.794 bonds (distance) P-C4' energy: -41.514 flat angles C4'-P-C4' energy: -31.814 flat angles P-C4'-P energy: -28.174 tors. eta vs tors. theta energy: -39.758 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -326.411429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.411429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.457518 (E_RNA) where: Base-Base interactions energy: -183.643 where: short stacking energy: -96.955 Base-Backbone interact. energy: 0.468 local terms energy: -143.282465 where: bonds (distance) C4'-P energy: -27.395 bonds (distance) P-C4' energy: -39.827 flat angles C4'-P-C4' energy: -36.808 flat angles P-C4'-P energy: -18.134 tors. eta vs tors. theta energy: -21.118 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -255.982408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.982408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.009827 (E_RNA) where: Base-Base interactions energy: -129.588 where: short stacking energy: -72.487 Base-Backbone interact. energy: -0.115 local terms energy: -126.306303 where: bonds (distance) C4'-P energy: -31.084 bonds (distance) P-C4' energy: -41.969 flat angles C4'-P-C4' energy: -30.576 flat angles P-C4'-P energy: -22.328 tors. eta vs tors. theta energy: -0.350 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -259.291831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.291831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.732171 (E_RNA) where: Base-Base interactions energy: -120.887 where: short stacking energy: -69.093 Base-Backbone interact. energy: 0.139 local terms energy: -139.984362 where: bonds (distance) C4'-P energy: -29.827 bonds (distance) P-C4' energy: -34.422 flat angles C4'-P-C4' energy: -36.390 flat angles P-C4'-P energy: -27.986 tors. eta vs tors. theta energy: -11.359 Dist. restrs. and SS energy: 1.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -208.110414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.110414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.052811 (E_RNA) where: Base-Base interactions energy: -103.385 where: short stacking energy: -44.555 Base-Backbone interact. energy: -0.315 local terms energy: -106.352893 where: bonds (distance) C4'-P energy: -30.716 bonds (distance) P-C4' energy: -36.582 flat angles C4'-P-C4' energy: -29.555 flat angles P-C4'-P energy: -8.541 tors. eta vs tors. theta energy: -0.958 Dist. restrs. and SS energy: 1.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -588.615136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.615136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.508967 (E_RNA) where: Base-Base interactions energy: -381.871 where: short stacking energy: -194.207 Base-Backbone interact. energy: -0.055 local terms energy: -208.582713 where: bonds (distance) C4'-P energy: -37.435 bonds (distance) P-C4' energy: -42.870 flat angles C4'-P-C4' energy: -43.139 flat angles P-C4'-P energy: -32.582 tors. eta vs tors. theta energy: -52.557 Dist. restrs. and SS energy: 1.894 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -502.820584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.820584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.000779 (E_RNA) where: Base-Base interactions energy: -311.116 where: short stacking energy: -158.617 Base-Backbone interact. energy: -0.633 local terms energy: -191.251923 where: bonds (distance) C4'-P energy: -38.860 bonds (distance) P-C4' energy: -35.964 flat angles C4'-P-C4' energy: -45.364 flat angles P-C4'-P energy: -29.198 tors. eta vs tors. theta energy: -41.867 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -484.717393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.717393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.933844 (E_RNA) where: Base-Base interactions energy: -324.858 where: short stacking energy: -154.490 Base-Backbone interact. energy: -0.756 local terms energy: -159.319874 where: bonds (distance) C4'-P energy: -37.831 bonds (distance) P-C4' energy: -32.830 flat angles C4'-P-C4' energy: -40.381 flat angles P-C4'-P energy: -22.112 tors. eta vs tors. theta energy: -26.165 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -459.011660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.011660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.011660 (E_RNA) where: Base-Base interactions energy: -284.269 where: short stacking energy: -146.119 Base-Backbone interact. energy: -0.470 local terms energy: -174.272755 where: bonds (distance) C4'-P energy: -34.363 bonds (distance) P-C4' energy: -38.368 flat angles C4'-P-C4' energy: -35.201 flat angles P-C4'-P energy: -30.984 tors. eta vs tors. theta energy: -35.357 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -426.669640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.669640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.669640 (E_RNA) where: Base-Base interactions energy: -255.878 where: short stacking energy: -131.831 Base-Backbone interact. energy: -0.216 local terms energy: -170.576080 where: bonds (distance) C4'-P energy: -38.160 bonds (distance) P-C4' energy: -27.961 flat angles C4'-P-C4' energy: -43.302 flat angles P-C4'-P energy: -26.864 tors. eta vs tors. theta energy: -34.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -390.558782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.558782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.963902 (E_RNA) where: Base-Base interactions energy: -233.529 where: short stacking energy: -123.572 Base-Backbone interact. energy: -0.536 local terms energy: -156.899070 where: bonds (distance) C4'-P energy: -29.408 bonds (distance) P-C4' energy: -37.825 flat angles C4'-P-C4' energy: -42.664 flat angles P-C4'-P energy: -18.149 tors. eta vs tors. theta energy: -28.854 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -341.282804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.282804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.310669 (E_RNA) where: Base-Base interactions energy: -206.657 where: short stacking energy: -110.890 Base-Backbone interact. energy: -0.014 local terms energy: -134.639775 where: bonds (distance) C4'-P energy: -32.033 bonds (distance) P-C4' energy: -29.863 flat angles C4'-P-C4' energy: -29.884 flat angles P-C4'-P energy: -8.748 tors. eta vs tors. theta energy: -34.112 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -271.556108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.556108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.240871 (E_RNA) where: Base-Base interactions energy: -136.749 where: short stacking energy: -76.787 Base-Backbone interact. energy: -0.667 local terms energy: -134.824710 where: bonds (distance) C4'-P energy: -35.052 bonds (distance) P-C4' energy: -32.753 flat angles C4'-P-C4' energy: -39.850 flat angles P-C4'-P energy: -22.279 tors. eta vs tors. theta energy: -4.891 Dist. restrs. and SS energy: 0.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -250.210714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.210714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.252893 (E_RNA) where: Base-Base interactions energy: -118.852 where: short stacking energy: -73.813 Base-Backbone interact. energy: -0.876 local terms energy: -130.524862 where: bonds (distance) C4'-P energy: -35.062 bonds (distance) P-C4' energy: -30.468 flat angles C4'-P-C4' energy: -26.407 flat angles P-C4'-P energy: -21.856 tors. eta vs tors. theta energy: -16.732 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -225.936848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.936848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.416259 (E_RNA) where: Base-Base interactions energy: -133.333 where: short stacking energy: -69.572 Base-Backbone interact. energy: -0.642 local terms energy: -92.440886 where: bonds (distance) C4'-P energy: -35.501 bonds (distance) P-C4' energy: -16.576 flat angles C4'-P-C4' energy: -26.805 flat angles P-C4'-P energy: -10.351 tors. eta vs tors. theta energy: -3.208 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -584.390047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.390047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.598712 (E_RNA) where: Base-Base interactions energy: -378.370 where: short stacking energy: -190.124 Base-Backbone interact. energy: -0.444 local terms energy: -207.785120 where: bonds (distance) C4'-P energy: -41.003 bonds (distance) P-C4' energy: -41.113 flat angles C4'-P-C4' energy: -46.397 flat angles P-C4'-P energy: -29.456 tors. eta vs tors. theta energy: -49.816 Dist. restrs. and SS energy: 2.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -512.837952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.837952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.881533 (E_RNA) where: Base-Base interactions energy: -323.107 where: short stacking energy: -180.247 Base-Backbone interact. energy: -0.019 local terms energy: -189.755005 where: bonds (distance) C4'-P energy: -38.581 bonds (distance) P-C4' energy: -40.973 flat angles C4'-P-C4' energy: -33.866 flat angles P-C4'-P energy: -26.978 tors. eta vs tors. theta energy: -49.357 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -490.114832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.114832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.129802 (E_RNA) where: Base-Base interactions energy: -312.563 where: short stacking energy: -152.778 Base-Backbone interact. energy: -1.252 local terms energy: -176.315542 where: bonds (distance) C4'-P energy: -33.348 bonds (distance) P-C4' energy: -36.378 flat angles C4'-P-C4' energy: -43.469 flat angles P-C4'-P energy: -21.215 tors. eta vs tors. theta energy: -41.905 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -448.928726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.928726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.187056 (E_RNA) where: Base-Base interactions energy: -264.753 where: short stacking energy: -132.017 Base-Backbone interact. energy: -1.471 local terms energy: -182.962085 where: bonds (distance) C4'-P energy: -36.080 bonds (distance) P-C4' energy: -39.162 flat angles C4'-P-C4' energy: -36.849 flat angles P-C4'-P energy: -33.360 tors. eta vs tors. theta energy: -37.511 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -467.072084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.072084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.130538 (E_RNA) where: Base-Base interactions energy: -280.370 where: short stacking energy: -159.412 Base-Backbone interact. energy: -0.154 local terms energy: -186.606490 where: bonds (distance) C4'-P energy: -35.752 bonds (distance) P-C4' energy: -41.687 flat angles C4'-P-C4' energy: -35.140 flat angles P-C4'-P energy: -27.847 tors. eta vs tors. theta energy: -46.180 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -388.217381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.217381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.692785 (E_RNA) where: Base-Base interactions energy: -242.057 where: short stacking energy: -129.912 Base-Backbone interact. energy: -0.767 local terms energy: -150.868614 where: bonds (distance) C4'-P energy: -29.550 bonds (distance) P-C4' energy: -34.018 flat angles C4'-P-C4' energy: -32.234 flat angles P-C4'-P energy: -24.032 tors. eta vs tors. theta energy: -31.035 Dist. restrs. and SS energy: 5.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -296.090519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.090519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.090519 (E_RNA) where: Base-Base interactions energy: -154.731 where: short stacking energy: -92.359 Base-Backbone interact. energy: 0.493 local terms energy: -141.853179 where: bonds (distance) C4'-P energy: -33.512 bonds (distance) P-C4' energy: -34.884 flat angles C4'-P-C4' energy: -38.367 flat angles P-C4'-P energy: -17.141 tors. eta vs tors. theta energy: -17.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -273.941952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.941952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.025700 (E_RNA) where: Base-Base interactions energy: -140.919 where: short stacking energy: -73.591 Base-Backbone interact. energy: 1.997 local terms energy: -135.103226 where: bonds (distance) C4'-P energy: -36.871 bonds (distance) P-C4' energy: -39.669 flat angles C4'-P-C4' energy: -30.029 flat angles P-C4'-P energy: -22.565 tors. eta vs tors. theta energy: -5.969 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -245.275932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.275932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.275932 (E_RNA) where: Base-Base interactions energy: -133.218 where: short stacking energy: -51.990 Base-Backbone interact. energy: -0.776 local terms energy: -111.281968 where: bonds (distance) C4'-P energy: -27.851 bonds (distance) P-C4' energy: -41.071 flat angles C4'-P-C4' energy: -28.888 flat angles P-C4'-P energy: -7.606 tors. eta vs tors. theta energy: -5.866 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -240.951664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.951664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.446862 (E_RNA) where: Base-Base interactions energy: -112.455 where: short stacking energy: -73.475 Base-Backbone interact. energy: 1.467 local terms energy: -130.458746 where: bonds (distance) C4'-P energy: -35.781 bonds (distance) P-C4' energy: -38.099 flat angles C4'-P-C4' energy: -31.934 flat angles P-C4'-P energy: -13.587 tors. eta vs tors. theta energy: -11.059 Dist. restrs. and SS energy: 0.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -569.773088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.773088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.788030 (E_RNA) where: Base-Base interactions energy: -371.884 where: short stacking energy: -181.893 Base-Backbone interact. energy: -0.639 local terms energy: -200.264976 where: bonds (distance) C4'-P energy: -39.352 bonds (distance) P-C4' energy: -39.136 flat angles C4'-P-C4' energy: -40.155 flat angles P-C4'-P energy: -32.468 tors. eta vs tors. theta energy: -49.155 Dist. restrs. and SS energy: 3.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -513.903424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.903424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.286198 (E_RNA) where: Base-Base interactions energy: -323.174 where: short stacking energy: -173.858 Base-Backbone interact. energy: 2.677 local terms energy: -193.788345 where: bonds (distance) C4'-P energy: -39.492 bonds (distance) P-C4' energy: -43.378 flat angles C4'-P-C4' energy: -46.829 flat angles P-C4'-P energy: -21.936 tors. eta vs tors. theta energy: -42.153 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -494.543257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.543257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.608340 (E_RNA) where: Base-Base interactions energy: -309.027 where: short stacking energy: -154.788 Base-Backbone interact. energy: -0.741 local terms energy: -184.840275 where: bonds (distance) C4'-P energy: -37.885 bonds (distance) P-C4' energy: -41.966 flat angles C4'-P-C4' energy: -34.468 flat angles P-C4'-P energy: -33.493 tors. eta vs tors. theta energy: -37.029 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -451.263642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.263642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.295242 (E_RNA) where: Base-Base interactions energy: -281.759 where: short stacking energy: -144.384 Base-Backbone interact. energy: -1.077 local terms energy: -168.459082 where: bonds (distance) C4'-P energy: -27.875 bonds (distance) P-C4' energy: -45.800 flat angles C4'-P-C4' energy: -43.785 flat angles P-C4'-P energy: -18.246 tors. eta vs tors. theta energy: -32.753 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -448.015909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.015909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.206332 (E_RNA) where: Base-Base interactions energy: -270.840 where: short stacking energy: -142.833 Base-Backbone interact. energy: -2.030 local terms energy: -175.336923 where: bonds (distance) C4'-P energy: -33.287 bonds (distance) P-C4' energy: -33.701 flat angles C4'-P-C4' energy: -40.930 flat angles P-C4'-P energy: -26.105 tors. eta vs tors. theta energy: -41.313 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -354.443399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.443399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.754250 (E_RNA) where: Base-Base interactions energy: -203.876 where: short stacking energy: -118.130 Base-Backbone interact. energy: -0.358 local terms energy: -151.519429 where: bonds (distance) C4'-P energy: -33.991 bonds (distance) P-C4' energy: -35.525 flat angles C4'-P-C4' energy: -38.328 flat angles P-C4'-P energy: -21.728 tors. eta vs tors. theta energy: -21.948 Dist. restrs. and SS energy: 1.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -286.349894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.349894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.365837 (E_RNA) where: Base-Base interactions energy: -154.355 where: short stacking energy: -96.041 Base-Backbone interact. energy: -0.138 local terms energy: -131.872818 where: bonds (distance) C4'-P energy: -31.017 bonds (distance) P-C4' energy: -39.308 flat angles C4'-P-C4' energy: -37.083 flat angles P-C4'-P energy: -14.889 tors. eta vs tors. theta energy: -9.575 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -241.208976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.208976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.485217 (E_RNA) where: Base-Base interactions energy: -122.584 where: short stacking energy: -71.908 Base-Backbone interact. energy: -2.508 local terms energy: -119.393458 where: bonds (distance) C4'-P energy: -33.886 bonds (distance) P-C4' energy: -34.028 flat angles C4'-P-C4' energy: -28.179 flat angles P-C4'-P energy: -20.126 tors. eta vs tors. theta energy: -3.175 Dist. restrs. and SS energy: 3.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -228.656443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.656443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.622762 (E_RNA) where: Base-Base interactions energy: -111.731 where: short stacking energy: -65.986 Base-Backbone interact. energy: -0.441 local terms energy: -121.451192 where: bonds (distance) C4'-P energy: -30.661 bonds (distance) P-C4' energy: -45.455 flat angles C4'-P-C4' energy: -26.400 flat angles P-C4'-P energy: -16.805 tors. eta vs tors. theta energy: -2.129 Dist. restrs. and SS energy: 4.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -183.209885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.209885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.649153 (E_RNA) where: Base-Base interactions energy: -80.923 where: short stacking energy: -43.847 Base-Backbone interact. energy: -1.578 local terms energy: -104.149081 where: bonds (distance) C4'-P energy: -26.195 bonds (distance) P-C4' energy: -38.528 flat angles C4'-P-C4' energy: -24.202 flat angles P-C4'-P energy: -24.117 tors. eta vs tors. theta energy: 8.893 Dist. restrs. and SS energy: 3.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -581.452925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.452925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.113856 (E_RNA) where: Base-Base interactions energy: -384.640 where: short stacking energy: -192.500 Base-Backbone interact. energy: -0.324 local terms energy: -198.149696 where: bonds (distance) C4'-P energy: -38.182 bonds (distance) P-C4' energy: -40.205 flat angles C4'-P-C4' energy: -39.778 flat angles P-C4'-P energy: -25.690 tors. eta vs tors. theta energy: -54.294 Dist. restrs. and SS energy: 1.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -492.446784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.446784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.731684 (E_RNA) where: Base-Base interactions energy: -308.012 where: short stacking energy: -158.766 Base-Backbone interact. energy: -0.484 local terms energy: -184.235791 where: bonds (distance) C4'-P energy: -34.744 bonds (distance) P-C4' energy: -40.492 flat angles C4'-P-C4' energy: -44.222 flat angles P-C4'-P energy: -24.195 tors. eta vs tors. theta energy: -40.583 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -466.184978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.184978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.330868 (E_RNA) where: Base-Base interactions energy: -285.861 where: short stacking energy: -149.221 Base-Backbone interact. energy: 0.359 local terms energy: -180.828866 where: bonds (distance) C4'-P energy: -40.408 bonds (distance) P-C4' energy: -39.628 flat angles C4'-P-C4' energy: -40.133 flat angles P-C4'-P energy: -22.436 tors. eta vs tors. theta energy: -38.223 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -423.012579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.012579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.634960 (E_RNA) where: Base-Base interactions energy: -258.363 where: short stacking energy: -136.239 Base-Backbone interact. energy: -0.562 local terms energy: -164.709561 where: bonds (distance) C4'-P energy: -36.736 bonds (distance) P-C4' energy: -41.811 flat angles C4'-P-C4' energy: -34.940 flat angles P-C4'-P energy: -12.308 tors. eta vs tors. theta energy: -38.914 Dist. restrs. and SS energy: 0.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -404.957261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.957261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.014181 (E_RNA) where: Base-Base interactions energy: -251.853 where: short stacking energy: -127.636 Base-Backbone interact. energy: -0.274 local terms energy: -152.886556 where: bonds (distance) C4'-P energy: -33.623 bonds (distance) P-C4' energy: -33.617 flat angles C4'-P-C4' energy: -41.963 flat angles P-C4'-P energy: -19.355 tors. eta vs tors. theta energy: -24.328 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -313.095577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.095577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.119885 (E_RNA) where: Base-Base interactions energy: -164.789 where: short stacking energy: -101.746 Base-Backbone interact. energy: 1.080 local terms energy: -149.410958 where: bonds (distance) C4'-P energy: -37.123 bonds (distance) P-C4' energy: -35.051 flat angles C4'-P-C4' energy: -32.338 flat angles P-C4'-P energy: -20.148 tors. eta vs tors. theta energy: -24.751 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -353.372165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.372165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.428955 (E_RNA) where: Base-Base interactions energy: -199.583 where: short stacking energy: -102.048 Base-Backbone interact. energy: -0.146 local terms energy: -153.700832 where: bonds (distance) C4'-P energy: -34.847 bonds (distance) P-C4' energy: -37.443 flat angles C4'-P-C4' energy: -36.322 flat angles P-C4'-P energy: -28.139 tors. eta vs tors. theta energy: -16.950 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -248.195327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.195327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.544925 (E_RNA) where: Base-Base interactions energy: -132.212 where: short stacking energy: -64.300 Base-Backbone interact. energy: 0.308 local terms energy: -116.640835 where: bonds (distance) C4'-P energy: -34.058 bonds (distance) P-C4' energy: -30.526 flat angles C4'-P-C4' energy: -30.460 flat angles P-C4'-P energy: -11.626 tors. eta vs tors. theta energy: -9.971 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -243.846658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.846658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.379764 (E_RNA) where: Base-Base interactions energy: -124.694 where: short stacking energy: -81.596 Base-Backbone interact. energy: -1.361 local terms energy: -119.324640 where: bonds (distance) C4'-P energy: -27.290 bonds (distance) P-C4' energy: -37.457 flat angles C4'-P-C4' energy: -31.523 flat angles P-C4'-P energy: -16.519 tors. eta vs tors. theta energy: -6.536 Dist. restrs. and SS energy: 1.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -228.111683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.111683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.571127 (E_RNA) where: Base-Base interactions energy: -114.330 where: short stacking energy: -60.917 Base-Backbone interact. energy: -1.502 local terms energy: -117.738327 where: bonds (distance) C4'-P energy: -36.482 bonds (distance) P-C4' energy: -35.949 flat angles C4'-P-C4' energy: -31.726 flat angles P-C4'-P energy: -6.587 tors. eta vs tors. theta energy: -6.994 Dist. restrs. and SS energy: 5.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -586.733551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.733551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.226387 (E_RNA) where: Base-Base interactions energy: -386.640 where: short stacking energy: -190.342 Base-Backbone interact. energy: 3.018 local terms energy: -203.604358 where: bonds (distance) C4'-P energy: -36.415 bonds (distance) P-C4' energy: -43.639 flat angles C4'-P-C4' energy: -41.954 flat angles P-C4'-P energy: -29.153 tors. eta vs tors. theta energy: -52.445 Dist. restrs. and SS energy: 0.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -510.633349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.633349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.746362 (E_RNA) where: Base-Base interactions energy: -324.231 where: short stacking energy: -157.556 Base-Backbone interact. energy: -0.449 local terms energy: -186.065922 where: bonds (distance) C4'-P energy: -43.785 bonds (distance) P-C4' energy: -37.518 flat angles C4'-P-C4' energy: -42.417 flat angles P-C4'-P energy: -28.212 tors. eta vs tors. theta energy: -34.134 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -484.057620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.057620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.075526 (E_RNA) where: Base-Base interactions energy: -297.820 where: short stacking energy: -152.113 Base-Backbone interact. energy: 1.663 local terms energy: -187.918902 where: bonds (distance) C4'-P energy: -35.957 bonds (distance) P-C4' energy: -40.506 flat angles C4'-P-C4' energy: -43.834 flat angles P-C4'-P energy: -28.812 tors. eta vs tors. theta energy: -38.809 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -454.039407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.039407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.201015 (E_RNA) where: Base-Base interactions energy: -271.013 where: short stacking energy: -143.963 Base-Backbone interact. energy: 0.299 local terms energy: -183.487829 where: bonds (distance) C4'-P energy: -37.757 bonds (distance) P-C4' energy: -41.881 flat angles C4'-P-C4' energy: -47.038 flat angles P-C4'-P energy: -27.631 tors. eta vs tors. theta energy: -29.180 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -402.475979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.475979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.484167 (E_RNA) where: Base-Base interactions energy: -230.692 where: short stacking energy: -106.176 Base-Backbone interact. energy: -0.861 local terms energy: -170.931629 where: bonds (distance) C4'-P energy: -34.980 bonds (distance) P-C4' energy: -47.550 flat angles C4'-P-C4' energy: -37.865 flat angles P-C4'-P energy: -21.900 tors. eta vs tors. theta energy: -28.637 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -334.782642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.782642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.971603 (E_RNA) where: Base-Base interactions energy: -185.603 where: short stacking energy: -82.638 Base-Backbone interact. energy: -0.618 local terms energy: -148.750987 where: bonds (distance) C4'-P energy: -38.302 bonds (distance) P-C4' energy: -39.189 flat angles C4'-P-C4' energy: -36.683 flat angles P-C4'-P energy: -23.199 tors. eta vs tors. theta energy: -11.378 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -385.331594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.331594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.473461 (E_RNA) where: Base-Base interactions energy: -224.239 where: short stacking energy: -120.244 Base-Backbone interact. energy: -1.600 local terms energy: -159.635032 where: bonds (distance) C4'-P energy: -36.751 bonds (distance) P-C4' energy: -40.491 flat angles C4'-P-C4' energy: -33.232 flat angles P-C4'-P energy: -21.302 tors. eta vs tors. theta energy: -27.859 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -244.773236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.773236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.831306 (E_RNA) where: Base-Base interactions energy: -133.097 where: short stacking energy: -84.419 Base-Backbone interact. energy: 0.369 local terms energy: -117.103531 where: bonds (distance) C4'-P energy: -35.928 bonds (distance) P-C4' energy: -26.236 flat angles C4'-P-C4' energy: -33.791 flat angles P-C4'-P energy: -18.053 tors. eta vs tors. theta energy: -3.096 Dist. restrs. and SS energy: 5.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -252.062417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.062417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.593212 (E_RNA) where: Base-Base interactions energy: -135.565 where: short stacking energy: -85.479 Base-Backbone interact. energy: 0.610 local terms energy: -118.638832 where: bonds (distance) C4'-P energy: -28.690 bonds (distance) P-C4' energy: -29.657 flat angles C4'-P-C4' energy: -30.921 flat angles P-C4'-P energy: -21.518 tors. eta vs tors. theta energy: -7.854 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -198.362870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.362870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.131214 (E_RNA) where: Base-Base interactions energy: -76.746 where: short stacking energy: -45.843 Base-Backbone interact. energy: -0.954 local terms energy: -122.431145 where: bonds (distance) C4'-P energy: -37.605 bonds (distance) P-C4' energy: -39.848 flat angles C4'-P-C4' energy: -31.794 flat angles P-C4'-P energy: -18.864 tors. eta vs tors. theta energy: 5.679 Dist. restrs. and SS energy: 1.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -591.493793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.493793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.465692 (E_RNA) where: Base-Base interactions energy: -380.866 where: short stacking energy: -187.415 Base-Backbone interact. energy: -0.578 local terms energy: -211.022289 where: bonds (distance) C4'-P energy: -42.910 bonds (distance) P-C4' energy: -42.064 flat angles C4'-P-C4' energy: -44.716 flat angles P-C4'-P energy: -30.390 tors. eta vs tors. theta energy: -50.943 Dist. restrs. and SS energy: 0.972 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -526.617382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.617382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.745523 (E_RNA) where: Base-Base interactions energy: -327.243 where: short stacking energy: -157.345 Base-Backbone interact. energy: -0.834 local terms energy: -198.668473 where: bonds (distance) C4'-P energy: -44.656 bonds (distance) P-C4' energy: -42.207 flat angles C4'-P-C4' energy: -43.111 flat angles P-C4'-P energy: -25.709 tors. eta vs tors. theta energy: -42.985 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -470.933306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.933306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.002941 (E_RNA) where: Base-Base interactions energy: -278.962 where: short stacking energy: -152.933 Base-Backbone interact. energy: -0.700 local terms energy: -191.341444 where: bonds (distance) C4'-P energy: -41.264 bonds (distance) P-C4' energy: -36.739 flat angles C4'-P-C4' energy: -39.785 flat angles P-C4'-P energy: -29.497 tors. eta vs tors. theta energy: -44.056 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -431.158069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.158069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.223291 (E_RNA) where: Base-Base interactions energy: -276.064 where: short stacking energy: -144.244 Base-Backbone interact. energy: -0.323 local terms energy: -154.836774 where: bonds (distance) C4'-P energy: -33.380 bonds (distance) P-C4' energy: -34.007 flat angles C4'-P-C4' energy: -45.880 flat angles P-C4'-P energy: -15.398 tors. eta vs tors. theta energy: -26.172 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -361.569649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.569649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.624566 (E_RNA) where: Base-Base interactions energy: -207.048 where: short stacking energy: -101.672 Base-Backbone interact. energy: -0.466 local terms energy: -154.109753 where: bonds (distance) C4'-P energy: -34.492 bonds (distance) P-C4' energy: -39.185 flat angles C4'-P-C4' energy: -38.835 flat angles P-C4'-P energy: -26.041 tors. eta vs tors. theta energy: -15.556 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -408.597271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.597271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.873325 (E_RNA) where: Base-Base interactions energy: -249.536 where: short stacking energy: -126.035 Base-Backbone interact. energy: -1.172 local terms energy: -158.166215 where: bonds (distance) C4'-P energy: -35.590 bonds (distance) P-C4' energy: -35.667 flat angles C4'-P-C4' energy: -32.769 flat angles P-C4'-P energy: -24.519 tors. eta vs tors. theta energy: -29.621 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -298.282216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.282216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.282216 (E_RNA) where: Base-Base interactions energy: -154.364 where: short stacking energy: -97.258 Base-Backbone interact. energy: -0.653 local terms energy: -143.265273 where: bonds (distance) C4'-P energy: -41.090 bonds (distance) P-C4' energy: -38.960 flat angles C4'-P-C4' energy: -34.102 flat angles P-C4'-P energy: -15.612 tors. eta vs tors. theta energy: -13.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -275.663514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.663514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.230202 (E_RNA) where: Base-Base interactions energy: -130.718 where: short stacking energy: -74.710 Base-Backbone interact. energy: -0.705 local terms energy: -148.808050 where: bonds (distance) C4'-P energy: -34.263 bonds (distance) P-C4' energy: -31.675 flat angles C4'-P-C4' energy: -38.736 flat angles P-C4'-P energy: -20.846 tors. eta vs tors. theta energy: -23.288 Dist. restrs. and SS energy: 4.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -240.886987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.886987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.195794 (E_RNA) where: Base-Base interactions energy: -116.153 where: short stacking energy: -71.809 Base-Backbone interact. energy: -1.275 local terms energy: -124.767916 where: bonds (distance) C4'-P energy: -36.935 bonds (distance) P-C4' energy: -37.764 flat angles C4'-P-C4' energy: -28.408 flat angles P-C4'-P energy: -16.453 tors. eta vs tors. theta energy: -5.208 Dist. restrs. and SS energy: 1.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -196.034797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.034797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.736377 (E_RNA) where: Base-Base interactions energy: -91.406 where: short stacking energy: -49.047 Base-Backbone interact. energy: -0.864 local terms energy: -105.465892 where: bonds (distance) C4'-P energy: -39.162 bonds (distance) P-C4' energy: -30.686 flat angles C4'-P-C4' energy: -19.117 flat angles P-C4'-P energy: -17.798 tors. eta vs tors. theta energy: 1.297 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -603.872268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.872268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.511979 (E_RNA) where: Base-Base interactions energy: -396.699 where: short stacking energy: -203.782 Base-Backbone interact. energy: 0.526 local terms energy: -209.339065 where: bonds (distance) C4'-P energy: -37.740 bonds (distance) P-C4' energy: -40.738 flat angles C4'-P-C4' energy: -40.333 flat angles P-C4'-P energy: -34.088 tors. eta vs tors. theta energy: -56.441 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -511.852059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.852059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.856014 (E_RNA) where: Base-Base interactions energy: -328.112 where: short stacking energy: -153.021 Base-Backbone interact. energy: -0.705 local terms energy: -183.039274 where: bonds (distance) C4'-P energy: -28.086 bonds (distance) P-C4' energy: -37.608 flat angles C4'-P-C4' energy: -47.125 flat angles P-C4'-P energy: -33.105 tors. eta vs tors. theta energy: -37.116 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -483.718429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.718429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.879511 (E_RNA) where: Base-Base interactions energy: -291.864 where: short stacking energy: -153.341 Base-Backbone interact. energy: -0.421 local terms energy: -191.594696 where: bonds (distance) C4'-P energy: -38.684 bonds (distance) P-C4' energy: -37.178 flat angles C4'-P-C4' energy: -42.915 flat angles P-C4'-P energy: -32.089 tors. eta vs tors. theta energy: -40.729 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -448.527585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.527585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.563962 (E_RNA) where: Base-Base interactions energy: -273.652 where: short stacking energy: -150.640 Base-Backbone interact. energy: -0.368 local terms energy: -174.544509 where: bonds (distance) C4'-P energy: -32.687 bonds (distance) P-C4' energy: -32.787 flat angles C4'-P-C4' energy: -39.752 flat angles P-C4'-P energy: -29.455 tors. eta vs tors. theta energy: -39.863 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -402.942043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.942043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.956173 (E_RNA) where: Base-Base interactions energy: -258.420 where: short stacking energy: -129.638 Base-Backbone interact. energy: -0.563 local terms energy: -143.973701 where: bonds (distance) C4'-P energy: -28.444 bonds (distance) P-C4' energy: -32.307 flat angles C4'-P-C4' energy: -39.063 flat angles P-C4'-P energy: -19.455 tors. eta vs tors. theta energy: -24.704 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -300.138771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.138771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.250584 (E_RNA) where: Base-Base interactions energy: -168.193 where: short stacking energy: -82.753 Base-Backbone interact. energy: 1.255 local terms energy: -133.312537 where: bonds (distance) C4'-P energy: -35.956 bonds (distance) P-C4' energy: -38.334 flat angles C4'-P-C4' energy: -31.836 flat angles P-C4'-P energy: -15.826 tors. eta vs tors. theta energy: -11.360 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -298.973302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.973302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.442959 (E_RNA) where: Base-Base interactions energy: -165.997 where: short stacking energy: -90.506 Base-Backbone interact. energy: -1.389 local terms energy: -132.057361 where: bonds (distance) C4'-P energy: -33.194 bonds (distance) P-C4' energy: -28.816 flat angles C4'-P-C4' energy: -32.699 flat angles P-C4'-P energy: -19.879 tors. eta vs tors. theta energy: -17.470 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -273.627731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.627731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.913614 (E_RNA) where: Base-Base interactions energy: -138.074 where: short stacking energy: -83.612 Base-Backbone interact. energy: -0.256 local terms energy: -136.583535 where: bonds (distance) C4'-P energy: -28.534 bonds (distance) P-C4' energy: -41.322 flat angles C4'-P-C4' energy: -32.635 flat angles P-C4'-P energy: -24.686 tors. eta vs tors. theta energy: -9.405 Dist. restrs. and SS energy: 1.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -232.047012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.047012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.124685 (E_RNA) where: Base-Base interactions energy: -109.334 where: short stacking energy: -58.364 Base-Backbone interact. energy: -1.308 local terms energy: -125.482733 where: bonds (distance) C4'-P energy: -37.744 bonds (distance) P-C4' energy: -27.065 flat angles C4'-P-C4' energy: -37.949 flat angles P-C4'-P energy: -19.175 tors. eta vs tors. theta energy: -3.549 Dist. restrs. and SS energy: 4.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -237.616154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.616154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.892183 (E_RNA) where: Base-Base interactions energy: -130.584 where: short stacking energy: -59.366 Base-Backbone interact. energy: 0.597 local terms energy: -107.905634 where: bonds (distance) C4'-P energy: -30.078 bonds (distance) P-C4' energy: -27.941 flat angles C4'-P-C4' energy: -31.328 flat angles P-C4'-P energy: -8.792 tors. eta vs tors. theta energy: -9.767 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -585.874751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.874751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.233797 (E_RNA) where: Base-Base interactions energy: -376.374 where: short stacking energy: -181.274 Base-Backbone interact. energy: -0.647 local terms energy: -211.212549 where: bonds (distance) C4'-P energy: -43.106 bonds (distance) P-C4' energy: -44.118 flat angles C4'-P-C4' energy: -39.514 flat angles P-C4'-P energy: -29.250 tors. eta vs tors. theta energy: -55.224 Dist. restrs. and SS energy: 2.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -523.421561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.421561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.421561 (E_RNA) where: Base-Base interactions energy: -319.621 where: short stacking energy: -167.471 Base-Backbone interact. energy: -0.866 local terms energy: -202.934699 where: bonds (distance) C4'-P energy: -35.492 bonds (distance) P-C4' energy: -45.318 flat angles C4'-P-C4' energy: -44.461 flat angles P-C4'-P energy: -26.339 tors. eta vs tors. theta energy: -51.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -499.100162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.100162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.111417 (E_RNA) where: Base-Base interactions energy: -320.176 where: short stacking energy: -142.648 Base-Backbone interact. energy: -1.034 local terms energy: -177.901166 where: bonds (distance) C4'-P energy: -40.835 bonds (distance) P-C4' energy: -37.475 flat angles C4'-P-C4' energy: -42.262 flat angles P-C4'-P energy: -22.851 tors. eta vs tors. theta energy: -34.478 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -451.319499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.319499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.342372 (E_RNA) where: Base-Base interactions energy: -277.983 where: short stacking energy: -151.317 Base-Backbone interact. energy: -0.421 local terms energy: -172.938126 where: bonds (distance) C4'-P energy: -38.179 bonds (distance) P-C4' energy: -35.522 flat angles C4'-P-C4' energy: -41.822 flat angles P-C4'-P energy: -16.506 tors. eta vs tors. theta energy: -40.909 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -404.853455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.853455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.983035 (E_RNA) where: Base-Base interactions energy: -245.648 where: short stacking energy: -136.673 Base-Backbone interact. energy: -0.336 local terms energy: -158.999339 where: bonds (distance) C4'-P energy: -34.254 bonds (distance) P-C4' energy: -33.422 flat angles C4'-P-C4' energy: -44.091 flat angles P-C4'-P energy: -16.869 tors. eta vs tors. theta energy: -30.364 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -308.018430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.018430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.074252 (E_RNA) where: Base-Base interactions energy: -165.492 where: short stacking energy: -93.344 Base-Backbone interact. energy: -0.057 local terms energy: -142.525631 where: bonds (distance) C4'-P energy: -31.084 bonds (distance) P-C4' energy: -37.937 flat angles C4'-P-C4' energy: -33.959 flat angles P-C4'-P energy: -22.384 tors. eta vs tors. theta energy: -17.162 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -269.960030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.960030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.211550 (E_RNA) where: Base-Base interactions energy: -126.955 where: short stacking energy: -68.482 Base-Backbone interact. energy: -0.538 local terms energy: -142.719282 where: bonds (distance) C4'-P energy: -34.586 bonds (distance) P-C4' energy: -44.547 flat angles C4'-P-C4' energy: -33.824 flat angles P-C4'-P energy: -18.384 tors. eta vs tors. theta energy: -11.379 Dist. restrs. and SS energy: 0.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -256.511485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.511485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.271264 (E_RNA) where: Base-Base interactions energy: -132.734 where: short stacking energy: -75.305 Base-Backbone interact. energy: 2.630 local terms energy: -127.166657 where: bonds (distance) C4'-P energy: -27.321 bonds (distance) P-C4' energy: -41.335 flat angles C4'-P-C4' energy: -36.864 flat angles P-C4'-P energy: -18.313 tors. eta vs tors. theta energy: -3.333 Dist. restrs. and SS energy: 0.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -216.434707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.434707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.878922 (E_RNA) where: Base-Base interactions energy: -89.871 where: short stacking energy: -41.902 Base-Backbone interact. energy: -0.678 local terms energy: -126.330042 where: bonds (distance) C4'-P energy: -32.802 bonds (distance) P-C4' energy: -41.452 flat angles C4'-P-C4' energy: -31.122 flat angles P-C4'-P energy: -19.319 tors. eta vs tors. theta energy: -1.636 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -247.879674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.879674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.191644 (E_RNA) where: Base-Base interactions energy: -124.785 where: short stacking energy: -68.298 Base-Backbone interact. energy: 0.118 local terms energy: -123.524543 where: bonds (distance) C4'-P energy: -30.664 bonds (distance) P-C4' energy: -37.940 flat angles C4'-P-C4' energy: -34.046 flat angles P-C4'-P energy: -16.143 tors. eta vs tors. theta energy: -4.731 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -582.083763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.083763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.169270 (E_RNA) where: Base-Base interactions energy: -381.565 where: short stacking energy: -202.470 Base-Backbone interact. energy: 0.250 local terms energy: -203.854360 where: bonds (distance) C4'-P energy: -36.059 bonds (distance) P-C4' energy: -40.345 flat angles C4'-P-C4' energy: -45.376 flat angles P-C4'-P energy: -28.005 tors. eta vs tors. theta energy: -54.069 Dist. restrs. and SS energy: 3.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -527.970326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.970326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.112516 (E_RNA) where: Base-Base interactions energy: -326.697 where: short stacking energy: -180.886 Base-Backbone interact. energy: -0.568 local terms energy: -200.846788 where: bonds (distance) C4'-P energy: -40.166 bonds (distance) P-C4' energy: -40.087 flat angles C4'-P-C4' energy: -43.330 flat angles P-C4'-P energy: -29.383 tors. eta vs tors. theta energy: -47.881 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -507.631835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.631835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.631835 (E_RNA) where: Base-Base interactions energy: -328.587 where: short stacking energy: -152.962 Base-Backbone interact. energy: -0.838 local terms energy: -178.206887 where: bonds (distance) C4'-P energy: -30.547 bonds (distance) P-C4' energy: -39.087 flat angles C4'-P-C4' energy: -40.954 flat angles P-C4'-P energy: -30.124 tors. eta vs tors. theta energy: -37.494 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -439.333229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.333229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.336992 (E_RNA) where: Base-Base interactions energy: -268.201 where: short stacking energy: -144.934 Base-Backbone interact. energy: -0.174 local terms energy: -170.961933 where: bonds (distance) C4'-P energy: -33.195 bonds (distance) P-C4' energy: -34.989 flat angles C4'-P-C4' energy: -41.090 flat angles P-C4'-P energy: -26.109 tors. eta vs tors. theta energy: -35.578 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -420.412528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.412528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.432627 (E_RNA) where: Base-Base interactions energy: -245.752 where: short stacking energy: -131.438 Base-Backbone interact. energy: -0.505 local terms energy: -174.175774 where: bonds (distance) C4'-P energy: -39.663 bonds (distance) P-C4' energy: -42.377 flat angles C4'-P-C4' energy: -40.425 flat angles P-C4'-P energy: -16.787 tors. eta vs tors. theta energy: -34.925 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -319.321209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.321209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.609615 (E_RNA) where: Base-Base interactions energy: -177.385 where: short stacking energy: -118.749 Base-Backbone interact. energy: 1.290 local terms energy: -143.514395 where: bonds (distance) C4'-P energy: -32.596 bonds (distance) P-C4' energy: -38.736 flat angles C4'-P-C4' energy: -33.422 flat angles P-C4'-P energy: -14.336 tors. eta vs tors. theta energy: -24.424 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -295.327435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.327435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.412133 (E_RNA) where: Base-Base interactions energy: -149.571 where: short stacking energy: -77.068 Base-Backbone interact. energy: 0.453 local terms energy: -147.294446 where: bonds (distance) C4'-P energy: -31.283 bonds (distance) P-C4' energy: -42.358 flat angles C4'-P-C4' energy: -39.083 flat angles P-C4'-P energy: -30.174 tors. eta vs tors. theta energy: -4.396 Dist. restrs. and SS energy: 1.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -241.949214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.949214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.646587 (E_RNA) where: Base-Base interactions energy: -120.750 where: short stacking energy: -69.391 Base-Backbone interact. energy: -1.373 local terms energy: -121.524385 where: bonds (distance) C4'-P energy: -32.641 bonds (distance) P-C4' energy: -26.090 flat angles C4'-P-C4' energy: -22.139 flat angles P-C4'-P energy: -28.549 tors. eta vs tors. theta energy: -12.105 Dist. restrs. and SS energy: 1.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -268.643396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.643396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.664692 (E_RNA) where: Base-Base interactions energy: -148.169 where: short stacking energy: -74.162 Base-Backbone interact. energy: -0.253 local terms energy: -120.242500 where: bonds (distance) C4'-P energy: -39.624 bonds (distance) P-C4' energy: -27.934 flat angles C4'-P-C4' energy: -25.699 flat angles P-C4'-P energy: -25.132 tors. eta vs tors. theta energy: -1.854 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -220.427966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.427966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.441571 (E_RNA) where: Base-Base interactions energy: -104.434 where: short stacking energy: -57.350 Base-Backbone interact. energy: -0.605 local terms energy: -115.401813 where: bonds (distance) C4'-P energy: -22.380 bonds (distance) P-C4' energy: -28.531 flat angles C4'-P-C4' energy: -33.663 flat angles P-C4'-P energy: -20.769 tors. eta vs tors. theta energy: -10.059 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -580.364912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.364912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.993973 (E_RNA) where: Base-Base interactions energy: -371.663 where: short stacking energy: -185.803 Base-Backbone interact. energy: 0.552 local terms energy: -210.883220 where: bonds (distance) C4'-P energy: -37.939 bonds (distance) P-C4' energy: -39.810 flat angles C4'-P-C4' energy: -47.573 flat angles P-C4'-P energy: -31.616 tors. eta vs tors. theta energy: -53.945 Dist. restrs. and SS energy: 1.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -529.660825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.660825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.774725 (E_RNA) where: Base-Base interactions energy: -334.284 where: short stacking energy: -175.896 Base-Backbone interact. energy: -1.749 local terms energy: -193.741349 where: bonds (distance) C4'-P energy: -40.399 bonds (distance) P-C4' energy: -37.632 flat angles C4'-P-C4' energy: -38.938 flat angles P-C4'-P energy: -31.198 tors. eta vs tors. theta energy: -45.575 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -500.571326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.571326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.987051 (E_RNA) where: Base-Base interactions energy: -291.735 where: short stacking energy: -156.954 Base-Backbone interact. energy: -0.228 local terms energy: -209.023823 where: bonds (distance) C4'-P energy: -42.430 bonds (distance) P-C4' energy: -47.662 flat angles C4'-P-C4' energy: -45.475 flat angles P-C4'-P energy: -27.879 tors. eta vs tors. theta energy: -45.578 Dist. restrs. and SS energy: 0.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -422.763904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.763904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.763904 (E_RNA) where: Base-Base interactions energy: -250.136 where: short stacking energy: -124.863 Base-Backbone interact. energy: -0.474 local terms energy: -172.154469 where: bonds (distance) C4'-P energy: -33.407 bonds (distance) P-C4' energy: -35.538 flat angles C4'-P-C4' energy: -40.989 flat angles P-C4'-P energy: -22.612 tors. eta vs tors. theta energy: -39.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -438.852857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.852857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.032791 (E_RNA) where: Base-Base interactions energy: -256.177 where: short stacking energy: -137.474 Base-Backbone interact. energy: -0.088 local terms energy: -182.766883 where: bonds (distance) C4'-P energy: -35.762 bonds (distance) P-C4' energy: -39.159 flat angles C4'-P-C4' energy: -45.039 flat angles P-C4'-P energy: -30.959 tors. eta vs tors. theta energy: -31.848 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -341.416301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.416301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.426383 (E_RNA) where: Base-Base interactions energy: -197.171 where: short stacking energy: -106.856 Base-Backbone interact. energy: 1.168 local terms energy: -145.423313 where: bonds (distance) C4'-P energy: -33.855 bonds (distance) P-C4' energy: -41.956 flat angles C4'-P-C4' energy: -30.380 flat angles P-C4'-P energy: -19.037 tors. eta vs tors. theta energy: -20.195 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -313.110400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.110400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.330428 (E_RNA) where: Base-Base interactions energy: -183.545 where: short stacking energy: -82.697 Base-Backbone interact. energy: -0.984 local terms energy: -128.802053 where: bonds (distance) C4'-P energy: -34.178 bonds (distance) P-C4' energy: -29.895 flat angles C4'-P-C4' energy: -31.043 flat angles P-C4'-P energy: -22.187 tors. eta vs tors. theta energy: -11.499 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -278.807018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.807018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.821000 (E_RNA) where: Base-Base interactions energy: -144.709 where: short stacking energy: -89.912 Base-Backbone interact. energy: -1.824 local terms energy: -132.287938 where: bonds (distance) C4'-P energy: -34.924 bonds (distance) P-C4' energy: -35.629 flat angles C4'-P-C4' energy: -35.133 flat angles P-C4'-P energy: -16.817 tors. eta vs tors. theta energy: -9.786 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -217.590862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.590862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.110998 (E_RNA) where: Base-Base interactions energy: -99.863 where: short stacking energy: -56.733 Base-Backbone interact. energy: 1.832 local terms energy: -120.079933 where: bonds (distance) C4'-P energy: -35.488 bonds (distance) P-C4' energy: -35.366 flat angles C4'-P-C4' energy: -38.170 flat angles P-C4'-P energy: -9.760 tors. eta vs tors. theta energy: -1.296 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -203.201496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.201496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.845214 (E_RNA) where: Base-Base interactions energy: -97.700 where: short stacking energy: -54.948 Base-Backbone interact. energy: -0.521 local terms energy: -108.624076 where: bonds (distance) C4'-P energy: -24.731 bonds (distance) P-C4' energy: -34.429 flat angles C4'-P-C4' energy: -28.143 flat angles P-C4'-P energy: -22.991 tors. eta vs tors. theta energy: 1.670 Dist. restrs. and SS energy: 3.644 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -578.012502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.012502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.017129 (E_RNA) where: Base-Base interactions energy: -366.881 where: short stacking energy: -184.639 Base-Backbone interact. energy: -1.885 local terms energy: -210.251574 where: bonds (distance) C4'-P energy: -39.813 bonds (distance) P-C4' energy: -41.281 flat angles C4'-P-C4' energy: -48.580 flat angles P-C4'-P energy: -29.323 tors. eta vs tors. theta energy: -51.254 Dist. restrs. and SS energy: 1.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -541.731929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.731929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.731929 (E_RNA) where: Base-Base interactions energy: -347.654 where: short stacking energy: -176.493 Base-Backbone interact. energy: 0.352 local terms energy: -194.429509 where: bonds (distance) C4'-P energy: -32.853 bonds (distance) P-C4' energy: -41.713 flat angles C4'-P-C4' energy: -43.072 flat angles P-C4'-P energy: -32.365 tors. eta vs tors. theta energy: -44.427 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -498.866599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.866599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.973935 (E_RNA) where: Base-Base interactions energy: -305.159 where: short stacking energy: -143.227 Base-Backbone interact. energy: 0.001 local terms energy: -193.815609 where: bonds (distance) C4'-P energy: -38.896 bonds (distance) P-C4' energy: -34.607 flat angles C4'-P-C4' energy: -40.742 flat angles P-C4'-P energy: -35.271 tors. eta vs tors. theta energy: -44.300 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -426.169079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.169079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.260543 (E_RNA) where: Base-Base interactions energy: -254.277 where: short stacking energy: -128.078 Base-Backbone interact. energy: -0.288 local terms energy: -171.695070 where: bonds (distance) C4'-P energy: -37.961 bonds (distance) P-C4' energy: -35.651 flat angles C4'-P-C4' energy: -39.170 flat angles P-C4'-P energy: -28.504 tors. eta vs tors. theta energy: -30.409 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -419.714078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.714078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.714078 (E_RNA) where: Base-Base interactions energy: -241.646 where: short stacking energy: -127.535 Base-Backbone interact. energy: -1.234 local terms energy: -176.833225 where: bonds (distance) C4'-P energy: -37.961 bonds (distance) P-C4' energy: -46.423 flat angles C4'-P-C4' energy: -35.735 flat angles P-C4'-P energy: -25.638 tors. eta vs tors. theta energy: -31.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -328.605205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.605205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.367789 (E_RNA) where: Base-Base interactions energy: -188.446 where: short stacking energy: -102.779 Base-Backbone interact. energy: -0.743 local terms energy: -144.179059 where: bonds (distance) C4'-P energy: -32.777 bonds (distance) P-C4' energy: -32.915 flat angles C4'-P-C4' energy: -32.728 flat angles P-C4'-P energy: -17.610 tors. eta vs tors. theta energy: -28.149 Dist. restrs. and SS energy: 4.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -321.597525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.597525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.630420 (E_RNA) where: Base-Base interactions energy: -177.168 where: short stacking energy: -79.037 Base-Backbone interact. energy: -0.401 local terms energy: -144.062121 where: bonds (distance) C4'-P energy: -38.732 bonds (distance) P-C4' energy: -39.951 flat angles C4'-P-C4' energy: -35.249 flat angles P-C4'-P energy: -23.914 tors. eta vs tors. theta energy: -6.216 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -275.723053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.723053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.742737 (E_RNA) where: Base-Base interactions energy: -142.988 where: short stacking energy: -86.540 Base-Backbone interact. energy: 1.251 local terms energy: -134.005381 where: bonds (distance) C4'-P energy: -35.758 bonds (distance) P-C4' energy: -31.678 flat angles C4'-P-C4' energy: -31.789 flat angles P-C4'-P energy: -26.074 tors. eta vs tors. theta energy: -8.706 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -258.183204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.183204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.553467 (E_RNA) where: Base-Base interactions energy: -125.218 where: short stacking energy: -69.490 Base-Backbone interact. energy: -1.066 local terms energy: -132.269715 where: bonds (distance) C4'-P energy: -33.602 bonds (distance) P-C4' energy: -42.018 flat angles C4'-P-C4' energy: -31.760 flat angles P-C4'-P energy: -17.006 tors. eta vs tors. theta energy: -7.884 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -224.884005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.884005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.580767 (E_RNA) where: Base-Base interactions energy: -100.314 where: short stacking energy: -61.047 Base-Backbone interact. energy: -1.305 local terms energy: -131.961653 where: bonds (distance) C4'-P energy: -44.356 bonds (distance) P-C4' energy: -31.021 flat angles C4'-P-C4' energy: -19.742 flat angles P-C4'-P energy: -32.521 tors. eta vs tors. theta energy: -4.322 Dist. restrs. and SS energy: 8.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -575.681470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.681470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.835959 (E_RNA) where: Base-Base interactions energy: -370.916 where: short stacking energy: -181.113 Base-Backbone interact. energy: -0.813 local terms energy: -205.106419 where: bonds (distance) C4'-P energy: -37.050 bonds (distance) P-C4' energy: -43.829 flat angles C4'-P-C4' energy: -43.934 flat angles P-C4'-P energy: -32.904 tors. eta vs tors. theta energy: -47.389 Dist. restrs. and SS energy: 1.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -532.731755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.731755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.746051 (E_RNA) where: Base-Base interactions energy: -342.005 where: short stacking energy: -167.813 Base-Backbone interact. energy: -0.104 local terms energy: -190.636472 where: bonds (distance) C4'-P energy: -44.191 bonds (distance) P-C4' energy: -40.612 flat angles C4'-P-C4' energy: -37.263 flat angles P-C4'-P energy: -26.271 tors. eta vs tors. theta energy: -42.300 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -516.765032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.765032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.193061 (E_RNA) where: Base-Base interactions energy: -337.312 where: short stacking energy: -177.003 Base-Backbone interact. energy: 5.459 local terms energy: -186.340065 where: bonds (distance) C4'-P energy: -40.948 bonds (distance) P-C4' energy: -38.066 flat angles C4'-P-C4' energy: -39.091 flat angles P-C4'-P energy: -25.966 tors. eta vs tors. theta energy: -42.269 Dist. restrs. and SS energy: 1.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -431.333953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.333953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.367848 (E_RNA) where: Base-Base interactions energy: -257.011 where: short stacking energy: -123.844 Base-Backbone interact. energy: 0.245 local terms energy: -174.601791 where: bonds (distance) C4'-P energy: -36.293 bonds (distance) P-C4' energy: -33.715 flat angles C4'-P-C4' energy: -46.219 flat angles P-C4'-P energy: -26.581 tors. eta vs tors. theta energy: -31.795 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -397.247330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.247330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.288776 (E_RNA) where: Base-Base interactions energy: -232.968 where: short stacking energy: -117.285 Base-Backbone interact. energy: -0.818 local terms energy: -163.502822 where: bonds (distance) C4'-P energy: -39.774 bonds (distance) P-C4' energy: -34.556 flat angles C4'-P-C4' energy: -34.978 flat angles P-C4'-P energy: -22.292 tors. eta vs tors. theta energy: -31.903 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -351.541074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.541074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.548955 (E_RNA) where: Base-Base interactions energy: -196.091 where: short stacking energy: -105.539 Base-Backbone interact. energy: -1.174 local terms energy: -154.283600 where: bonds (distance) C4'-P energy: -39.393 bonds (distance) P-C4' energy: -33.602 flat angles C4'-P-C4' energy: -35.660 flat angles P-C4'-P energy: -19.759 tors. eta vs tors. theta energy: -25.869 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -328.126285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.126285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.250892 (E_RNA) where: Base-Base interactions energy: -200.282 where: short stacking energy: -98.107 Base-Backbone interact. energy: 0.670 local terms energy: -128.638761 where: bonds (distance) C4'-P energy: -28.536 bonds (distance) P-C4' energy: -33.996 flat angles C4'-P-C4' energy: -23.381 flat angles P-C4'-P energy: -17.596 tors. eta vs tors. theta energy: -25.129 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -266.981999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.981999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.319775 (E_RNA) where: Base-Base interactions energy: -128.759 where: short stacking energy: -78.309 Base-Backbone interact. energy: 1.983 local terms energy: -140.543593 where: bonds (distance) C4'-P energy: -40.453 bonds (distance) P-C4' energy: -43.679 flat angles C4'-P-C4' energy: -27.662 flat angles P-C4'-P energy: -18.817 tors. eta vs tors. theta energy: -9.933 Dist. restrs. and SS energy: 0.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -245.093377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.093377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.190013 (E_RNA) where: Base-Base interactions energy: -118.787 where: short stacking energy: -60.999 Base-Backbone interact. energy: 0.650 local terms energy: -127.053199 where: bonds (distance) C4'-P energy: -36.847 bonds (distance) P-C4' energy: -38.368 flat angles C4'-P-C4' energy: -31.574 flat angles P-C4'-P energy: -17.021 tors. eta vs tors. theta energy: -3.243 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -213.581111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.581111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.550728 (E_RNA) where: Base-Base interactions energy: -95.113 where: short stacking energy: -62.471 Base-Backbone interact. energy: -1.156 local terms energy: -123.281596 where: bonds (distance) C4'-P energy: -32.319 bonds (distance) P-C4' energy: -32.173 flat angles C4'-P-C4' energy: -30.150 flat angles P-C4'-P energy: -22.707 tors. eta vs tors. theta energy: -5.932 Dist. restrs. and SS energy: 5.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -573.070556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.070556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.382574 (E_RNA) where: Base-Base interactions energy: -373.445 where: short stacking energy: -189.651 Base-Backbone interact. energy: -1.244 local terms energy: -198.693764 where: bonds (distance) C4'-P energy: -35.005 bonds (distance) P-C4' energy: -35.783 flat angles C4'-P-C4' energy: -37.734 flat angles P-C4'-P energy: -32.745 tors. eta vs tors. theta energy: -57.426 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -571.097726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.097726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.068487 (E_RNA) where: Base-Base interactions energy: -381.732 where: short stacking energy: -183.024 Base-Backbone interact. energy: 1.917 local terms energy: -193.253439 where: bonds (distance) C4'-P energy: -40.641 bonds (distance) P-C4' energy: -42.438 flat angles C4'-P-C4' energy: -40.884 flat angles P-C4'-P energy: -22.049 tors. eta vs tors. theta energy: -47.241 Dist. restrs. and SS energy: 1.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -493.402505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.402505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.833697 (E_RNA) where: Base-Base interactions energy: -304.716 where: short stacking energy: -165.849 Base-Backbone interact. energy: -0.874 local terms energy: -188.243109 where: bonds (distance) C4'-P energy: -43.812 bonds (distance) P-C4' energy: -39.795 flat angles C4'-P-C4' energy: -41.896 flat angles P-C4'-P energy: -16.307 tors. eta vs tors. theta energy: -46.432 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -434.744435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.744435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.144649 (E_RNA) where: Base-Base interactions energy: -262.888 where: short stacking energy: -142.174 Base-Backbone interact. energy: 0.486 local terms energy: -172.743366 where: bonds (distance) C4'-P energy: -35.430 bonds (distance) P-C4' energy: -33.040 flat angles C4'-P-C4' energy: -41.024 flat angles P-C4'-P energy: -26.226 tors. eta vs tors. theta energy: -37.024 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -451.634121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.634121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.662713 (E_RNA) where: Base-Base interactions energy: -275.850 where: short stacking energy: -145.514 Base-Backbone interact. energy: 1.943 local terms energy: -177.755626 where: bonds (distance) C4'-P energy: -37.720 bonds (distance) P-C4' energy: -41.418 flat angles C4'-P-C4' energy: -37.461 flat angles P-C4'-P energy: -24.568 tors. eta vs tors. theta energy: -36.589 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -341.620759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.620759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.670419 (E_RNA) where: Base-Base interactions energy: -197.136 where: short stacking energy: -107.572 Base-Backbone interact. energy: 1.173 local terms energy: -145.707417 where: bonds (distance) C4'-P energy: -37.255 bonds (distance) P-C4' energy: -36.753 flat angles C4'-P-C4' energy: -30.149 flat angles P-C4'-P energy: -21.846 tors. eta vs tors. theta energy: -19.704 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -351.571021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.571021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.637261 (E_RNA) where: Base-Base interactions energy: -198.241 where: short stacking energy: -109.952 Base-Backbone interact. energy: -0.268 local terms energy: -153.127836 where: bonds (distance) C4'-P energy: -34.826 bonds (distance) P-C4' energy: -38.867 flat angles C4'-P-C4' energy: -27.031 flat angles P-C4'-P energy: -28.834 tors. eta vs tors. theta energy: -23.570 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -269.265574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.265574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.374078 (E_RNA) where: Base-Base interactions energy: -147.352 where: short stacking energy: -82.682 Base-Backbone interact. energy: -0.041 local terms energy: -121.980933 where: bonds (distance) C4'-P energy: -34.243 bonds (distance) P-C4' energy: -26.591 flat angles C4'-P-C4' energy: -32.919 flat angles P-C4'-P energy: -20.294 tors. eta vs tors. theta energy: -7.935 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -252.769647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.769647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.769647 (E_RNA) where: Base-Base interactions energy: -140.531 where: short stacking energy: -79.672 Base-Backbone interact. energy: -0.056 local terms energy: -112.182031 where: bonds (distance) C4'-P energy: -27.988 bonds (distance) P-C4' energy: -31.104 flat angles C4'-P-C4' energy: -31.923 flat angles P-C4'-P energy: -15.491 tors. eta vs tors. theta energy: -5.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -224.207781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.207781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.256029 (E_RNA) where: Base-Base interactions energy: -123.805 where: short stacking energy: -64.814 Base-Backbone interact. energy: 2.432 local terms energy: -102.883308 where: bonds (distance) C4'-P energy: -25.499 bonds (distance) P-C4' energy: -36.708 flat angles C4'-P-C4' energy: -23.966 flat angles P-C4'-P energy: -11.917 tors. eta vs tors. theta energy: -4.793 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -564.703980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.703980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.925336 (E_RNA) where: Base-Base interactions energy: -359.697 where: short stacking energy: -176.003 Base-Backbone interact. energy: -1.314 local terms energy: -203.914490 where: bonds (distance) C4'-P energy: -36.377 bonds (distance) P-C4' energy: -39.978 flat angles C4'-P-C4' energy: -46.087 flat angles P-C4'-P energy: -30.345 tors. eta vs tors. theta energy: -51.127 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -570.729324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.729324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.840723 (E_RNA) where: Base-Base interactions energy: -372.050 where: short stacking energy: -194.026 Base-Backbone interact. energy: 0.862 local terms energy: -200.652557 where: bonds (distance) C4'-P energy: -42.130 bonds (distance) P-C4' energy: -37.174 flat angles C4'-P-C4' energy: -42.690 flat angles P-C4'-P energy: -25.337 tors. eta vs tors. theta energy: -53.322 Dist. restrs. and SS energy: 1.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -476.376887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.376887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.490204 (E_RNA) where: Base-Base interactions energy: -289.026 where: short stacking energy: -152.570 Base-Backbone interact. energy: -0.437 local terms energy: -187.027153 where: bonds (distance) C4'-P energy: -38.957 bonds (distance) P-C4' energy: -38.752 flat angles C4'-P-C4' energy: -42.159 flat angles P-C4'-P energy: -27.035 tors. eta vs tors. theta energy: -40.123 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -437.128193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.128193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.153278 (E_RNA) where: Base-Base interactions energy: -271.685 where: short stacking energy: -147.512 Base-Backbone interact. energy: -0.682 local terms energy: -164.786346 where: bonds (distance) C4'-P energy: -35.919 bonds (distance) P-C4' energy: -37.291 flat angles C4'-P-C4' energy: -30.147 flat angles P-C4'-P energy: -22.094 tors. eta vs tors. theta energy: -39.335 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -443.109713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.109713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.210476 (E_RNA) where: Base-Base interactions energy: -265.161 where: short stacking energy: -130.692 Base-Backbone interact. energy: -1.650 local terms energy: -176.400080 where: bonds (distance) C4'-P energy: -44.440 bonds (distance) P-C4' energy: -29.991 flat angles C4'-P-C4' energy: -38.931 flat angles P-C4'-P energy: -24.266 tors. eta vs tors. theta energy: -38.772 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -309.185554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.185554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.258535 (E_RNA) where: Base-Base interactions energy: -178.767 where: short stacking energy: -101.337 Base-Backbone interact. energy: -0.398 local terms energy: -130.093525 where: bonds (distance) C4'-P energy: -30.711 bonds (distance) P-C4' energy: -40.541 flat angles C4'-P-C4' energy: -23.710 flat angles P-C4'-P energy: -24.424 tors. eta vs tors. theta energy: -10.707 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -339.594850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.594850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.179987 (E_RNA) where: Base-Base interactions energy: -201.832 where: short stacking energy: -97.035 Base-Backbone interact. energy: -0.414 local terms energy: -137.934053 where: bonds (distance) C4'-P energy: -27.098 bonds (distance) P-C4' energy: -31.633 flat angles C4'-P-C4' energy: -32.058 flat angles P-C4'-P energy: -26.283 tors. eta vs tors. theta energy: -20.863 Dist. restrs. and SS energy: 0.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -277.238564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.238564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.319445 (E_RNA) where: Base-Base interactions energy: -138.668 where: short stacking energy: -76.034 Base-Backbone interact. energy: -0.214 local terms energy: -138.437797 where: bonds (distance) C4'-P energy: -27.068 bonds (distance) P-C4' energy: -36.521 flat angles C4'-P-C4' energy: -34.867 flat angles P-C4'-P energy: -28.027 tors. eta vs tors. theta energy: -11.956 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -246.813551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.813551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.192233 (E_RNA) where: Base-Base interactions energy: -126.181 where: short stacking energy: -75.620 Base-Backbone interact. energy: -0.649 local terms energy: -120.361314 where: bonds (distance) C4'-P energy: -30.137 bonds (distance) P-C4' energy: -29.754 flat angles C4'-P-C4' energy: -36.346 flat angles P-C4'-P energy: -24.024 tors. eta vs tors. theta energy: -0.100 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -236.975593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.975593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.371097 (E_RNA) where: Base-Base interactions energy: -113.389 where: short stacking energy: -54.446 Base-Backbone interact. energy: -1.694 local terms energy: -122.287596 where: bonds (distance) C4'-P energy: -39.322 bonds (distance) P-C4' energy: -32.052 flat angles C4'-P-C4' energy: -23.721 flat angles P-C4'-P energy: -22.869 tors. eta vs tors. theta energy: -4.323 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -585.710845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.710845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.732233 (E_RNA) where: Base-Base interactions energy: -381.011 where: short stacking energy: -179.800 Base-Backbone interact. energy: -0.816 local terms energy: -206.905854 where: bonds (distance) C4'-P energy: -38.339 bonds (distance) P-C4' energy: -43.755 flat angles C4'-P-C4' energy: -40.556 flat angles P-C4'-P energy: -33.446 tors. eta vs tors. theta energy: -50.810 Dist. restrs. and SS energy: 3.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -550.051828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.051828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.051828 (E_RNA) where: Base-Base interactions energy: -354.033 where: short stacking energy: -163.247 Base-Backbone interact. energy: -1.002 local terms energy: -195.016641 where: bonds (distance) C4'-P energy: -34.849 bonds (distance) P-C4' energy: -38.720 flat angles C4'-P-C4' energy: -43.732 flat angles P-C4'-P energy: -36.255 tors. eta vs tors. theta energy: -41.461 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -473.253912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.253912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.253912 (E_RNA) where: Base-Base interactions energy: -279.822 where: short stacking energy: -145.240 Base-Backbone interact. energy: -1.065 local terms energy: -192.366852 where: bonds (distance) C4'-P energy: -42.619 bonds (distance) P-C4' energy: -39.054 flat angles C4'-P-C4' energy: -39.340 flat angles P-C4'-P energy: -32.355 tors. eta vs tors. theta energy: -38.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -447.448017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.448017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.002779 (E_RNA) where: Base-Base interactions energy: -288.720 where: short stacking energy: -148.736 Base-Backbone interact. energy: 1.894 local terms energy: -161.176657 where: bonds (distance) C4'-P energy: -40.020 bonds (distance) P-C4' energy: -34.100 flat angles C4'-P-C4' energy: -33.781 flat angles P-C4'-P energy: -20.313 tors. eta vs tors. theta energy: -32.963 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -431.047178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.047178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.047178 (E_RNA) where: Base-Base interactions energy: -254.478 where: short stacking energy: -128.344 Base-Backbone interact. energy: 0.608 local terms energy: -177.177089 where: bonds (distance) C4'-P energy: -36.723 bonds (distance) P-C4' energy: -41.209 flat angles C4'-P-C4' energy: -36.426 flat angles P-C4'-P energy: -27.366 tors. eta vs tors. theta energy: -35.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -318.609466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.609466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.809192 (E_RNA) where: Base-Base interactions energy: -179.113 where: short stacking energy: -113.035 Base-Backbone interact. energy: 1.518 local terms energy: -141.214914 where: bonds (distance) C4'-P energy: -39.698 bonds (distance) P-C4' energy: -31.698 flat angles C4'-P-C4' energy: -33.078 flat angles P-C4'-P energy: -20.339 tors. eta vs tors. theta energy: -16.402 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -352.411661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.411661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.477294 (E_RNA) where: Base-Base interactions energy: -211.562 where: short stacking energy: -124.553 Base-Backbone interact. energy: -0.821 local terms energy: -140.093843 where: bonds (distance) C4'-P energy: -31.493 bonds (distance) P-C4' energy: -21.999 flat angles C4'-P-C4' energy: -35.253 flat angles P-C4'-P energy: -24.657 tors. eta vs tors. theta energy: -26.694 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -236.045366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.045366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.092984 (E_RNA) where: Base-Base interactions energy: -94.080 where: short stacking energy: -50.887 Base-Backbone interact. energy: 1.059 local terms energy: -144.071799 where: bonds (distance) C4'-P energy: -32.952 bonds (distance) P-C4' energy: -42.357 flat angles C4'-P-C4' energy: -40.651 flat angles P-C4'-P energy: -25.888 tors. eta vs tors. theta energy: -2.223 Dist. restrs. and SS energy: 1.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -281.223116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.223116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.315472 (E_RNA) where: Base-Base interactions energy: -144.116 where: short stacking energy: -81.825 Base-Backbone interact. energy: -0.425 local terms energy: -136.774018 where: bonds (distance) C4'-P energy: -28.654 bonds (distance) P-C4' energy: -34.546 flat angles C4'-P-C4' energy: -40.030 flat angles P-C4'-P energy: -19.364 tors. eta vs tors. theta energy: -14.180 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -226.945545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.945545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.146157 (E_RNA) where: Base-Base interactions energy: -109.473 where: short stacking energy: -47.754 Base-Backbone interact. energy: -0.682 local terms energy: -116.990587 where: bonds (distance) C4'-P energy: -39.844 bonds (distance) P-C4' energy: -35.607 flat angles C4'-P-C4' energy: -24.809 flat angles P-C4'-P energy: -14.250 tors. eta vs tors. theta energy: -2.481 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -586.015801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.015801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.111637 (E_RNA) where: Base-Base interactions energy: -374.192 where: short stacking energy: -186.485 Base-Backbone interact. energy: -1.385 local terms energy: -214.534058 where: bonds (distance) C4'-P energy: -40.092 bonds (distance) P-C4' energy: -41.554 flat angles C4'-P-C4' energy: -45.586 flat angles P-C4'-P energy: -34.718 tors. eta vs tors. theta energy: -52.583 Dist. restrs. and SS energy: 4.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -568.584926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.584926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.650919 (E_RNA) where: Base-Base interactions energy: -371.020 where: short stacking energy: -182.777 Base-Backbone interact. energy: 1.920 local terms energy: -199.551044 where: bonds (distance) C4'-P energy: -41.071 bonds (distance) P-C4' energy: -39.159 flat angles C4'-P-C4' energy: -40.471 flat angles P-C4'-P energy: -25.171 tors. eta vs tors. theta energy: -53.679 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -466.687999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.687999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.687999 (E_RNA) where: Base-Base interactions energy: -281.710 where: short stacking energy: -162.825 Base-Backbone interact. energy: 0.357 local terms energy: -185.334770 where: bonds (distance) C4'-P energy: -31.276 bonds (distance) P-C4' energy: -35.267 flat angles C4'-P-C4' energy: -42.566 flat angles P-C4'-P energy: -31.294 tors. eta vs tors. theta energy: -44.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -458.977473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.977473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.126790 (E_RNA) where: Base-Base interactions energy: -286.359 where: short stacking energy: -145.726 Base-Backbone interact. energy: -0.647 local terms energy: -172.121757 where: bonds (distance) C4'-P energy: -37.711 bonds (distance) P-C4' energy: -41.430 flat angles C4'-P-C4' energy: -36.447 flat angles P-C4'-P energy: -22.557 tors. eta vs tors. theta energy: -33.977 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -428.688986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.688986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.176991 (E_RNA) where: Base-Base interactions energy: -271.559 where: short stacking energy: -132.597 Base-Backbone interact. energy: -0.315 local terms energy: -157.302602 where: bonds (distance) C4'-P energy: -35.792 bonds (distance) P-C4' energy: -31.575 flat angles C4'-P-C4' energy: -31.907 flat angles P-C4'-P energy: -20.407 tors. eta vs tors. theta energy: -37.621 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -333.440468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.440468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.444560 (E_RNA) where: Base-Base interactions energy: -197.240 where: short stacking energy: -96.922 Base-Backbone interact. energy: -0.919 local terms energy: -135.285283 where: bonds (distance) C4'-P energy: -34.111 bonds (distance) P-C4' energy: -42.200 flat angles C4'-P-C4' energy: -33.120 flat angles P-C4'-P energy: -12.131 tors. eta vs tors. theta energy: -13.724 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -327.087976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.087976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.177536 (E_RNA) where: Base-Base interactions energy: -173.558 where: short stacking energy: -105.211 Base-Backbone interact. energy: -0.646 local terms energy: -152.973936 where: bonds (distance) C4'-P energy: -32.600 bonds (distance) P-C4' energy: -36.502 flat angles C4'-P-C4' energy: -38.077 flat angles P-C4'-P energy: -26.130 tors. eta vs tors. theta energy: -19.664 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -254.753768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.753768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.184838 (E_RNA) where: Base-Base interactions energy: -129.474 where: short stacking energy: -66.975 Base-Backbone interact. energy: -0.869 local terms energy: -124.841828 where: bonds (distance) C4'-P energy: -27.810 bonds (distance) P-C4' energy: -41.584 flat angles C4'-P-C4' energy: -33.715 flat angles P-C4'-P energy: -14.249 tors. eta vs tors. theta energy: -7.485 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -275.954908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.954908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.409659 (E_RNA) where: Base-Base interactions energy: -148.931 where: short stacking energy: -86.187 Base-Backbone interact. energy: -0.216 local terms energy: -127.262454 where: bonds (distance) C4'-P energy: -29.408 bonds (distance) P-C4' energy: -32.610 flat angles C4'-P-C4' energy: -33.622 flat angles P-C4'-P energy: -17.379 tors. eta vs tors. theta energy: -14.244 Dist. restrs. and SS energy: 0.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -234.390633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.390633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.796316 (E_RNA) where: Base-Base interactions energy: -118.282 where: short stacking energy: -58.951 Base-Backbone interact. energy: -0.798 local terms energy: -115.715853 where: bonds (distance) C4'-P energy: -46.521 bonds (distance) P-C4' energy: -36.014 flat angles C4'-P-C4' energy: -20.234 flat angles P-C4'-P energy: -14.450 tors. eta vs tors. theta energy: 1.503 Dist. restrs. and SS energy: 0.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -570.101750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.101750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.101750 (E_RNA) where: Base-Base interactions energy: -367.856 where: short stacking energy: -175.167 Base-Backbone interact. energy: -1.465 local terms energy: -200.780530 where: bonds (distance) C4'-P energy: -38.865 bonds (distance) P-C4' energy: -44.355 flat angles C4'-P-C4' energy: -42.188 flat angles P-C4'-P energy: -28.150 tors. eta vs tors. theta energy: -47.223 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -577.695838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.695838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.362187 (E_RNA) where: Base-Base interactions energy: -383.607 where: short stacking energy: -185.881 Base-Backbone interact. energy: -1.457 local terms energy: -195.298064 where: bonds (distance) C4'-P energy: -33.778 bonds (distance) P-C4' energy: -44.406 flat angles C4'-P-C4' energy: -43.176 flat angles P-C4'-P energy: -26.603 tors. eta vs tors. theta energy: -47.335 Dist. restrs. and SS energy: 2.666 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -476.129873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.129873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.203407 (E_RNA) where: Base-Base interactions energy: -283.808 where: short stacking energy: -153.991 Base-Backbone interact. energy: -0.014 local terms energy: -192.381987 where: bonds (distance) C4'-P energy: -36.085 bonds (distance) P-C4' energy: -40.530 flat angles C4'-P-C4' energy: -44.274 flat angles P-C4'-P energy: -30.615 tors. eta vs tors. theta energy: -40.878 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -463.903662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.903662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.048796 (E_RNA) where: Base-Base interactions energy: -282.170 where: short stacking energy: -146.912 Base-Backbone interact. energy: -0.781 local terms energy: -181.098272 where: bonds (distance) C4'-P energy: -39.171 bonds (distance) P-C4' energy: -37.980 flat angles C4'-P-C4' energy: -41.065 flat angles P-C4'-P energy: -27.087 tors. eta vs tors. theta energy: -35.795 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -442.963571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.963571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.963571 (E_RNA) where: Base-Base interactions energy: -277.600 where: short stacking energy: -147.798 Base-Backbone interact. energy: 1.058 local terms energy: -166.421945 where: bonds (distance) C4'-P energy: -35.309 bonds (distance) P-C4' energy: -38.587 flat angles C4'-P-C4' energy: -26.032 flat angles P-C4'-P energy: -28.152 tors. eta vs tors. theta energy: -38.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -339.828184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.828184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.968154 (E_RNA) where: Base-Base interactions energy: -190.325 where: short stacking energy: -107.302 Base-Backbone interact. energy: 0.088 local terms energy: -149.731169 where: bonds (distance) C4'-P energy: -29.803 bonds (distance) P-C4' energy: -33.691 flat angles C4'-P-C4' energy: -33.617 flat angles P-C4'-P energy: -25.616 tors. eta vs tors. theta energy: -27.004 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -273.410597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.410597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.427370 (E_RNA) where: Base-Base interactions energy: -140.453 where: short stacking energy: -80.737 Base-Backbone interact. energy: 0.209 local terms energy: -133.183487 where: bonds (distance) C4'-P energy: -31.140 bonds (distance) P-C4' energy: -33.336 flat angles C4'-P-C4' energy: -35.475 flat angles P-C4'-P energy: -22.602 tors. eta vs tors. theta energy: -10.631 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -272.815683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.815683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.095767 (E_RNA) where: Base-Base interactions energy: -135.340 where: short stacking energy: -86.058 Base-Backbone interact. energy: 0.274 local terms energy: -138.029385 where: bonds (distance) C4'-P energy: -36.683 bonds (distance) P-C4' energy: -36.684 flat angles C4'-P-C4' energy: -34.918 flat angles P-C4'-P energy: -16.589 tors. eta vs tors. theta energy: -13.155 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -239.514340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.514340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.832263 (E_RNA) where: Base-Base interactions energy: -122.284 where: short stacking energy: -71.999 Base-Backbone interact. energy: 0.996 local terms energy: -120.543545 where: bonds (distance) C4'-P energy: -33.933 bonds (distance) P-C4' energy: -27.167 flat angles C4'-P-C4' energy: -29.538 flat angles P-C4'-P energy: -14.510 tors. eta vs tors. theta energy: -15.395 Dist. restrs. and SS energy: 2.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -207.545259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.545259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.498978 (E_RNA) where: Base-Base interactions energy: -96.179 where: short stacking energy: -61.289 Base-Backbone interact. energy: -0.307 local terms energy: -113.013525 where: bonds (distance) C4'-P energy: -28.939 bonds (distance) P-C4' energy: -38.842 flat angles C4'-P-C4' energy: -32.085 flat angles P-C4'-P energy: -13.133 tors. eta vs tors. theta energy: -0.015 Dist. restrs. and SS energy: 1.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -579.260764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.260764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.302019 (E_RNA) where: Base-Base interactions energy: -373.593 where: short stacking energy: -182.278 Base-Backbone interact. energy: -1.999 local terms energy: -203.710183 where: bonds (distance) C4'-P energy: -38.865 bonds (distance) P-C4' energy: -37.070 flat angles C4'-P-C4' energy: -44.582 flat angles P-C4'-P energy: -30.866 tors. eta vs tors. theta energy: -52.326 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -571.075043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.075043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.734023 (E_RNA) where: Base-Base interactions energy: -378.769 where: short stacking energy: -192.826 Base-Backbone interact. energy: 0.331 local terms energy: -203.295583 where: bonds (distance) C4'-P energy: -45.528 bonds (distance) P-C4' energy: -33.584 flat angles C4'-P-C4' energy: -42.609 flat angles P-C4'-P energy: -30.319 tors. eta vs tors. theta energy: -51.256 Dist. restrs. and SS energy: 10.659 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -455.843807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.843807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.015295 (E_RNA) where: Base-Base interactions energy: -276.048 where: short stacking energy: -157.465 Base-Backbone interact. energy: -0.411 local terms energy: -179.556367 where: bonds (distance) C4'-P energy: -38.549 bonds (distance) P-C4' energy: -37.458 flat angles C4'-P-C4' energy: -40.100 flat angles P-C4'-P energy: -27.862 tors. eta vs tors. theta energy: -35.587 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -441.918688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.918688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.969945 (E_RNA) where: Base-Base interactions energy: -269.809 where: short stacking energy: -146.897 Base-Backbone interact. energy: -0.154 local terms energy: -172.007536 where: bonds (distance) C4'-P energy: -35.241 bonds (distance) P-C4' energy: -41.131 flat angles C4'-P-C4' energy: -37.770 flat angles P-C4'-P energy: -25.744 tors. eta vs tors. theta energy: -32.122 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -434.445801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.445801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.464759 (E_RNA) where: Base-Base interactions energy: -273.414 where: short stacking energy: -160.537 Base-Backbone interact. energy: -1.474 local terms energy: -160.576365 where: bonds (distance) C4'-P energy: -26.205 bonds (distance) P-C4' energy: -35.248 flat angles C4'-P-C4' energy: -36.086 flat angles P-C4'-P energy: -23.446 tors. eta vs tors. theta energy: -39.592 Dist. restrs. and SS energy: 1.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -345.758589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.758589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.890467 (E_RNA) where: Base-Base interactions energy: -187.651 where: short stacking energy: -104.626 Base-Backbone interact. energy: -0.574 local terms energy: -157.665731 where: bonds (distance) C4'-P energy: -35.335 bonds (distance) P-C4' energy: -38.317 flat angles C4'-P-C4' energy: -42.254 flat angles P-C4'-P energy: -23.826 tors. eta vs tors. theta energy: -17.933 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -286.300013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.300013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.581261 (E_RNA) where: Base-Base interactions energy: -148.998 where: short stacking energy: -94.755 Base-Backbone interact. energy: 2.419 local terms energy: -140.002087 where: bonds (distance) C4'-P energy: -35.887 bonds (distance) P-C4' energy: -28.517 flat angles C4'-P-C4' energy: -39.719 flat angles P-C4'-P energy: -18.114 tors. eta vs tors. theta energy: -17.765 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -266.358265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.358265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.370929 (E_RNA) where: Base-Base interactions energy: -124.420 where: short stacking energy: -77.048 Base-Backbone interact. energy: 6.447 local terms energy: -148.398024 where: bonds (distance) C4'-P energy: -32.371 bonds (distance) P-C4' energy: -42.576 flat angles C4'-P-C4' energy: -36.831 flat angles P-C4'-P energy: -19.110 tors. eta vs tors. theta energy: -17.510 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -260.576090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.576090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.765059 (E_RNA) where: Base-Base interactions energy: -140.414 where: short stacking energy: -71.774 Base-Backbone interact. energy: -0.355 local terms energy: -119.996017 where: bonds (distance) C4'-P energy: -35.360 bonds (distance) P-C4' energy: -36.755 flat angles C4'-P-C4' energy: -32.375 flat angles P-C4'-P energy: -6.439 tors. eta vs tors. theta energy: -9.067 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -219.659384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.659384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.426759 (E_RNA) where: Base-Base interactions energy: -111.853 where: short stacking energy: -55.188 Base-Backbone interact. energy: -0.630 local terms energy: -109.943816 where: bonds (distance) C4'-P energy: -31.924 bonds (distance) P-C4' energy: -34.807 flat angles C4'-P-C4' energy: -30.267 flat angles P-C4'-P energy: -13.933 tors. eta vs tors. theta energy: 0.987 Dist. restrs. and SS energy: 2.767 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -582.438944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.438944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.550696 (E_RNA) where: Base-Base interactions energy: -386.675 where: short stacking energy: -181.623 Base-Backbone interact. energy: -1.565 local terms energy: -194.310293 where: bonds (distance) C4'-P energy: -37.024 bonds (distance) P-C4' energy: -39.460 flat angles C4'-P-C4' energy: -44.557 flat angles P-C4'-P energy: -26.793 tors. eta vs tors. theta energy: -46.476 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -579.488938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.488938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.866901 (E_RNA) where: Base-Base interactions energy: -380.149 where: short stacking energy: -182.427 Base-Backbone interact. energy: 1.068 local terms energy: -203.785609 where: bonds (distance) C4'-P energy: -35.877 bonds (distance) P-C4' energy: -40.966 flat angles C4'-P-C4' energy: -45.071 flat angles P-C4'-P energy: -26.681 tors. eta vs tors. theta energy: -55.192 Dist. restrs. and SS energy: 3.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -465.007893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.007893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.239553 (E_RNA) where: Base-Base interactions energy: -283.015 where: short stacking energy: -154.001 Base-Backbone interact. energy: -0.691 local terms energy: -181.532861 where: bonds (distance) C4'-P energy: -39.310 bonds (distance) P-C4' energy: -36.311 flat angles C4'-P-C4' energy: -43.265 flat angles P-C4'-P energy: -29.862 tors. eta vs tors. theta energy: -32.784 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -444.395840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.395840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.608514 (E_RNA) where: Base-Base interactions energy: -278.945 where: short stacking energy: -147.467 Base-Backbone interact. energy: -0.419 local terms energy: -165.244175 where: bonds (distance) C4'-P energy: -33.609 bonds (distance) P-C4' energy: -33.605 flat angles C4'-P-C4' energy: -37.686 flat angles P-C4'-P energy: -24.127 tors. eta vs tors. theta energy: -36.218 Dist. restrs. and SS energy: 0.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -379.650362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.650362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.947026 (E_RNA) where: Base-Base interactions energy: -213.165 where: short stacking energy: -114.072 Base-Backbone interact. energy: -0.355 local terms energy: -166.426376 where: bonds (distance) C4'-P energy: -40.553 bonds (distance) P-C4' energy: -42.221 flat angles C4'-P-C4' energy: -35.837 flat angles P-C4'-P energy: -25.844 tors. eta vs tors. theta energy: -21.970 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -395.789021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.789021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.366738 (E_RNA) where: Base-Base interactions energy: -243.785 where: short stacking energy: -114.401 Base-Backbone interact. energy: -0.893 local terms energy: -151.688442 where: bonds (distance) C4'-P energy: -37.893 bonds (distance) P-C4' energy: -37.643 flat angles C4'-P-C4' energy: -32.179 flat angles P-C4'-P energy: -23.023 tors. eta vs tors. theta energy: -20.950 Dist. restrs. and SS energy: 0.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -291.858127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.858127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.915916 (E_RNA) where: Base-Base interactions energy: -151.451 where: short stacking energy: -97.597 Base-Backbone interact. energy: 0.203 local terms energy: -140.668302 where: bonds (distance) C4'-P energy: -31.140 bonds (distance) P-C4' energy: -39.013 flat angles C4'-P-C4' energy: -32.526 flat angles P-C4'-P energy: -20.821 tors. eta vs tors. theta energy: -17.168 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -260.542071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.542071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.542071 (E_RNA) where: Base-Base interactions energy: -149.603 where: short stacking energy: -86.515 Base-Backbone interact. energy: -0.400 local terms energy: -110.539401 where: bonds (distance) C4'-P energy: -29.833 bonds (distance) P-C4' energy: -39.035 flat angles C4'-P-C4' energy: -22.602 flat angles P-C4'-P energy: -10.007 tors. eta vs tors. theta energy: -9.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -250.813276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.813276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.086307 (E_RNA) where: Base-Base interactions energy: -132.719 where: short stacking energy: -71.099 Base-Backbone interact. energy: 0.125 local terms energy: -118.492243 where: bonds (distance) C4'-P energy: -30.501 bonds (distance) P-C4' energy: -25.577 flat angles C4'-P-C4' energy: -38.025 flat angles P-C4'-P energy: -14.274 tors. eta vs tors. theta energy: -10.117 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -221.498967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.498967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.718264 (E_RNA) where: Base-Base interactions energy: -103.895 where: short stacking energy: -56.449 Base-Backbone interact. energy: 1.913 local terms energy: -120.736846 where: bonds (distance) C4'-P energy: -35.585 bonds (distance) P-C4' energy: -31.210 flat angles C4'-P-C4' energy: -31.518 flat angles P-C4'-P energy: -17.018 tors. eta vs tors. theta energy: -5.407 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -567.046960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.046960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.082354 (E_RNA) where: Base-Base interactions energy: -368.536 where: short stacking energy: -172.314 Base-Backbone interact. energy: -0.117 local terms energy: -198.429257 where: bonds (distance) C4'-P energy: -40.183 bonds (distance) P-C4' energy: -37.502 flat angles C4'-P-C4' energy: -38.581 flat angles P-C4'-P energy: -34.442 tors. eta vs tors. theta energy: -47.722 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -570.829334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.829334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.274438 (E_RNA) where: Base-Base interactions energy: -375.766 where: short stacking energy: -175.952 Base-Backbone interact. energy: -0.460 local terms energy: -200.047962 where: bonds (distance) C4'-P energy: -38.499 bonds (distance) P-C4' energy: -39.806 flat angles C4'-P-C4' energy: -44.032 flat angles P-C4'-P energy: -28.792 tors. eta vs tors. theta energy: -48.919 Dist. restrs. and SS energy: 5.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -448.749570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.749570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.765967 (E_RNA) where: Base-Base interactions energy: -273.972 where: short stacking energy: -134.232 Base-Backbone interact. energy: -0.915 local terms energy: -173.878475 where: bonds (distance) C4'-P energy: -33.484 bonds (distance) P-C4' energy: -39.193 flat angles C4'-P-C4' energy: -39.254 flat angles P-C4'-P energy: -24.070 tors. eta vs tors. theta energy: -37.877 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -423.471503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.471503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.471503 (E_RNA) where: Base-Base interactions energy: -261.761 where: short stacking energy: -133.833 Base-Backbone interact. energy: -0.188 local terms energy: -161.522500 where: bonds (distance) C4'-P energy: -34.674 bonds (distance) P-C4' energy: -37.249 flat angles C4'-P-C4' energy: -36.618 flat angles P-C4'-P energy: -22.090 tors. eta vs tors. theta energy: -30.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -386.404827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.404827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.607230 (E_RNA) where: Base-Base interactions energy: -233.621 where: short stacking energy: -138.710 Base-Backbone interact. energy: -0.453 local terms energy: -152.532976 where: bonds (distance) C4'-P energy: -30.419 bonds (distance) P-C4' energy: -35.130 flat angles C4'-P-C4' energy: -36.953 flat angles P-C4'-P energy: -21.941 tors. eta vs tors. theta energy: -28.089 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -380.455358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.455358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.531388 (E_RNA) where: Base-Base interactions energy: -242.242 where: short stacking energy: -130.552 Base-Backbone interact. energy: 3.441 local terms energy: -141.729849 where: bonds (distance) C4'-P energy: -27.176 bonds (distance) P-C4' energy: -43.531 flat angles C4'-P-C4' energy: -36.867 flat angles P-C4'-P energy: -12.026 tors. eta vs tors. theta energy: -22.131 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -288.867705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.867705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.013029 (E_RNA) where: Base-Base interactions energy: -131.362 where: short stacking energy: -79.457 Base-Backbone interact. energy: 0.721 local terms energy: -158.371905 where: bonds (distance) C4'-P energy: -38.255 bonds (distance) P-C4' energy: -38.747 flat angles C4'-P-C4' energy: -34.504 flat angles P-C4'-P energy: -28.909 tors. eta vs tors. theta energy: -17.957 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -236.949843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.949843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.541206 (E_RNA) where: Base-Base interactions energy: -120.941 where: short stacking energy: -73.913 Base-Backbone interact. energy: -1.279 local terms energy: -116.320441 where: bonds (distance) C4'-P energy: -26.410 bonds (distance) P-C4' energy: -36.334 flat angles C4'-P-C4' energy: -32.199 flat angles P-C4'-P energy: -17.941 tors. eta vs tors. theta energy: -3.436 Dist. restrs. and SS energy: 1.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -231.366844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.366844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.791739 (E_RNA) where: Base-Base interactions energy: -114.696 where: short stacking energy: -78.571 Base-Backbone interact. energy: -0.367 local terms energy: -120.728865 where: bonds (distance) C4'-P energy: -28.696 bonds (distance) P-C4' energy: -28.054 flat angles C4'-P-C4' energy: -45.669 flat angles P-C4'-P energy: -6.588 tors. eta vs tors. theta energy: -11.722 Dist. restrs. and SS energy: 4.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -204.933812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.933812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.719214 (E_RNA) where: Base-Base interactions energy: -96.366 where: short stacking energy: -58.385 Base-Backbone interact. energy: -1.280 local terms energy: -108.073420 where: bonds (distance) C4'-P energy: -33.650 bonds (distance) P-C4' energy: -29.753 flat angles C4'-P-C4' energy: -22.096 flat angles P-C4'-P energy: -20.389 tors. eta vs tors. theta energy: -2.185 Dist. restrs. and SS energy: 0.785 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -594.426756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.426756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.943170 (E_RNA) where: Base-Base interactions energy: -383.975 where: short stacking energy: -197.161 Base-Backbone interact. energy: -0.555 local terms energy: -214.413091 where: bonds (distance) C4'-P energy: -40.867 bonds (distance) P-C4' energy: -41.231 flat angles C4'-P-C4' energy: -41.963 flat angles P-C4'-P energy: -34.721 tors. eta vs tors. theta energy: -55.631 Dist. restrs. and SS energy: 4.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -560.654960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.654960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.741867 (E_RNA) where: Base-Base interactions energy: -360.758 where: short stacking energy: -157.952 Base-Backbone interact. energy: -1.285 local terms energy: -198.699609 where: bonds (distance) C4'-P energy: -33.626 bonds (distance) P-C4' energy: -44.122 flat angles C4'-P-C4' energy: -47.737 flat angles P-C4'-P energy: -27.779 tors. eta vs tors. theta energy: -45.436 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -471.748781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.748781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.748781 (E_RNA) where: Base-Base interactions energy: -290.030 where: short stacking energy: -151.469 Base-Backbone interact. energy: -0.178 local terms energy: -181.540961 where: bonds (distance) C4'-P energy: -38.618 bonds (distance) P-C4' energy: -41.079 flat angles C4'-P-C4' energy: -39.364 flat angles P-C4'-P energy: -25.619 tors. eta vs tors. theta energy: -36.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -438.630475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.630475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.816670 (E_RNA) where: Base-Base interactions energy: -253.629 where: short stacking energy: -139.871 Base-Backbone interact. energy: -0.365 local terms energy: -184.822425 where: bonds (distance) C4'-P energy: -33.607 bonds (distance) P-C4' energy: -40.757 flat angles C4'-P-C4' energy: -37.281 flat angles P-C4'-P energy: -27.615 tors. eta vs tors. theta energy: -45.563 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -403.818130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.818130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.331271 (E_RNA) where: Base-Base interactions energy: -242.757 where: short stacking energy: -134.167 Base-Backbone interact. energy: -0.930 local terms energy: -161.644174 where: bonds (distance) C4'-P energy: -31.745 bonds (distance) P-C4' energy: -33.585 flat angles C4'-P-C4' energy: -41.942 flat angles P-C4'-P energy: -23.854 tors. eta vs tors. theta energy: -30.519 Dist. restrs. and SS energy: 1.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -376.217024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.217024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.238271 (E_RNA) where: Base-Base interactions energy: -224.862 where: short stacking energy: -121.623 Base-Backbone interact. energy: -1.014 local terms energy: -150.362934 where: bonds (distance) C4'-P energy: -30.855 bonds (distance) P-C4' energy: -35.665 flat angles C4'-P-C4' energy: -41.807 flat angles P-C4'-P energy: -15.672 tors. eta vs tors. theta energy: -26.364 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -281.176002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.176002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.459910 (E_RNA) where: Base-Base interactions energy: -135.671 where: short stacking energy: -83.146 Base-Backbone interact. energy: -1.032 local terms energy: -144.756993 where: bonds (distance) C4'-P energy: -36.093 bonds (distance) P-C4' energy: -35.087 flat angles C4'-P-C4' energy: -36.709 flat angles P-C4'-P energy: -24.833 tors. eta vs tors. theta energy: -12.035 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -246.364458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.364458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.859484 (E_RNA) where: Base-Base interactions energy: -118.140 where: short stacking energy: -68.770 Base-Backbone interact. energy: 2.963 local terms energy: -137.682665 where: bonds (distance) C4'-P energy: -34.840 bonds (distance) P-C4' energy: -36.752 flat angles C4'-P-C4' energy: -34.763 flat angles P-C4'-P energy: -24.112 tors. eta vs tors. theta energy: -7.216 Dist. restrs. and SS energy: 6.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -241.886648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.886648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.122150 (E_RNA) where: Base-Base interactions energy: -124.105 where: short stacking energy: -81.604 Base-Backbone interact. energy: -0.483 local terms energy: -120.534271 where: bonds (distance) C4'-P energy: -37.111 bonds (distance) P-C4' energy: -29.377 flat angles C4'-P-C4' energy: -29.267 flat angles P-C4'-P energy: -19.235 tors. eta vs tors. theta energy: -5.544 Dist. restrs. and SS energy: 3.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -231.220692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.220692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.337159 (E_RNA) where: Base-Base interactions energy: -102.398 where: short stacking energy: -64.173 Base-Backbone interact. energy: 1.118 local terms energy: -130.057384 where: bonds (distance) C4'-P energy: -35.148 bonds (distance) P-C4' energy: -35.518 flat angles C4'-P-C4' energy: -26.016 flat angles P-C4'-P energy: -24.967 tors. eta vs tors. theta energy: -8.409 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -595.730477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.730477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.418767 (E_RNA) where: Base-Base interactions energy: -399.365 where: short stacking energy: -201.711 Base-Backbone interact. energy: -0.278 local terms energy: -200.775684 where: bonds (distance) C4'-P energy: -38.476 bonds (distance) P-C4' energy: -37.328 flat angles C4'-P-C4' energy: -44.986 flat angles P-C4'-P energy: -23.972 tors. eta vs tors. theta energy: -56.014 Dist. restrs. and SS energy: 4.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -558.349173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.349173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.366393 (E_RNA) where: Base-Base interactions energy: -365.248 where: short stacking energy: -178.218 Base-Backbone interact. energy: -1.547 local terms energy: -191.571838 where: bonds (distance) C4'-P energy: -40.097 bonds (distance) P-C4' energy: -38.141 flat angles C4'-P-C4' energy: -37.539 flat angles P-C4'-P energy: -25.928 tors. eta vs tors. theta energy: -49.868 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -482.435913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.435913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.513491 (E_RNA) where: Base-Base interactions energy: -294.543 where: short stacking energy: -160.974 Base-Backbone interact. energy: -0.430 local terms energy: -187.539942 where: bonds (distance) C4'-P energy: -37.620 bonds (distance) P-C4' energy: -38.392 flat angles C4'-P-C4' energy: -35.952 flat angles P-C4'-P energy: -29.069 tors. eta vs tors. theta energy: -46.506 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -456.545014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.545014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.545014 (E_RNA) where: Base-Base interactions energy: -270.104 where: short stacking energy: -149.922 Base-Backbone interact. energy: -0.060 local terms energy: -186.381471 where: bonds (distance) C4'-P energy: -45.809 bonds (distance) P-C4' energy: -34.532 flat angles C4'-P-C4' energy: -39.468 flat angles P-C4'-P energy: -25.889 tors. eta vs tors. theta energy: -40.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -395.981921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.981921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.627349 (E_RNA) where: Base-Base interactions energy: -246.409 where: short stacking energy: -123.038 Base-Backbone interact. energy: -0.758 local terms energy: -150.460739 where: bonds (distance) C4'-P energy: -35.254 bonds (distance) P-C4' energy: -30.904 flat angles C4'-P-C4' energy: -39.028 flat angles P-C4'-P energy: -15.376 tors. eta vs tors. theta energy: -29.898 Dist. restrs. and SS energy: 1.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -357.163146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.163146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.237471 (E_RNA) where: Base-Base interactions energy: -212.994 where: short stacking energy: -111.268 Base-Backbone interact. energy: -0.982 local terms energy: -143.261168 where: bonds (distance) C4'-P energy: -32.390 bonds (distance) P-C4' energy: -37.951 flat angles C4'-P-C4' energy: -32.393 flat angles P-C4'-P energy: -23.841 tors. eta vs tors. theta energy: -16.685 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -269.136928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.136928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.271785 (E_RNA) where: Base-Base interactions energy: -142.462 where: short stacking energy: -92.520 Base-Backbone interact. energy: 0.130 local terms energy: -126.939784 where: bonds (distance) C4'-P energy: -23.386 bonds (distance) P-C4' energy: -37.434 flat angles C4'-P-C4' energy: -28.240 flat angles P-C4'-P energy: -26.071 tors. eta vs tors. theta energy: -11.810 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -241.083947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.083947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.654734 (E_RNA) where: Base-Base interactions energy: -110.346 where: short stacking energy: -65.376 Base-Backbone interact. energy: 0.783 local terms energy: -132.091665 where: bonds (distance) C4'-P energy: -37.351 bonds (distance) P-C4' energy: -37.889 flat angles C4'-P-C4' energy: -29.748 flat angles P-C4'-P energy: -22.209 tors. eta vs tors. theta energy: -4.894 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -232.338651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.338651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.489120 (E_RNA) where: Base-Base interactions energy: -125.569 where: short stacking energy: -61.574 Base-Backbone interact. energy: -0.010 local terms energy: -106.909788 where: bonds (distance) C4'-P energy: -33.948 bonds (distance) P-C4' energy: -33.939 flat angles C4'-P-C4' energy: -35.723 flat angles P-C4'-P energy: -5.155 tors. eta vs tors. theta energy: 1.855 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -239.390875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.390875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.488030 (E_RNA) where: Base-Base interactions energy: -115.024 where: short stacking energy: -64.097 Base-Backbone interact. energy: 0.351 local terms energy: -124.814600 where: bonds (distance) C4'-P energy: -35.185 bonds (distance) P-C4' energy: -41.081 flat angles C4'-P-C4' energy: -26.207 flat angles P-C4'-P energy: -17.017 tors. eta vs tors. theta energy: -5.325 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -577.452421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.452421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.572878 (E_RNA) where: Base-Base interactions energy: -369.967 where: short stacking energy: -177.003 Base-Backbone interact. energy: 0.098 local terms energy: -211.704009 where: bonds (distance) C4'-P energy: -37.432 bonds (distance) P-C4' energy: -43.246 flat angles C4'-P-C4' energy: -44.608 flat angles P-C4'-P energy: -33.126 tors. eta vs tors. theta energy: -53.293 Dist. restrs. and SS energy: 4.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -543.406273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.406273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.412688 (E_RNA) where: Base-Base interactions energy: -359.727 where: short stacking energy: -165.792 Base-Backbone interact. energy: -1.639 local terms energy: -182.047281 where: bonds (distance) C4'-P energy: -39.406 bonds (distance) P-C4' energy: -38.595 flat angles C4'-P-C4' energy: -34.795 flat angles P-C4'-P energy: -26.265 tors. eta vs tors. theta energy: -42.986 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -467.399848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.399848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.399848 (E_RNA) where: Base-Base interactions energy: -279.212 where: short stacking energy: -149.636 Base-Backbone interact. energy: -0.221 local terms energy: -187.967259 where: bonds (distance) C4'-P energy: -37.589 bonds (distance) P-C4' energy: -42.898 flat angles C4'-P-C4' energy: -40.678 flat angles P-C4'-P energy: -26.383 tors. eta vs tors. theta energy: -40.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -443.702115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.702115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.729432 (E_RNA) where: Base-Base interactions energy: -260.634 where: short stacking energy: -136.999 Base-Backbone interact. energy: -0.634 local terms energy: -182.461466 where: bonds (distance) C4'-P energy: -40.377 bonds (distance) P-C4' energy: -43.626 flat angles C4'-P-C4' energy: -36.690 flat angles P-C4'-P energy: -29.147 tors. eta vs tors. theta energy: -32.622 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -388.087186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.087186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.879258 (E_RNA) where: Base-Base interactions energy: -228.265 where: short stacking energy: -124.162 Base-Backbone interact. energy: -1.586 local terms energy: -162.028877 where: bonds (distance) C4'-P energy: -35.647 bonds (distance) P-C4' energy: -36.038 flat angles C4'-P-C4' energy: -34.687 flat angles P-C4'-P energy: -24.261 tors. eta vs tors. theta energy: -31.396 Dist. restrs. and SS energy: 3.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -353.771115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.771115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.823874 (E_RNA) where: Base-Base interactions energy: -203.243 where: short stacking energy: -101.939 Base-Backbone interact. energy: -0.388 local terms energy: -150.192930 where: bonds (distance) C4'-P energy: -34.669 bonds (distance) P-C4' energy: -24.651 flat angles C4'-P-C4' energy: -39.018 flat angles P-C4'-P energy: -30.634 tors. eta vs tors. theta energy: -21.222 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -275.789327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.789327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.287249 (E_RNA) where: Base-Base interactions energy: -152.411 where: short stacking energy: -93.981 Base-Backbone interact. energy: 0.810 local terms energy: -124.686241 where: bonds (distance) C4'-P energy: -33.407 bonds (distance) P-C4' energy: -33.191 flat angles C4'-P-C4' energy: -25.942 flat angles P-C4'-P energy: -15.763 tors. eta vs tors. theta energy: -16.384 Dist. restrs. and SS energy: 0.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -259.879325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.879325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.879325 (E_RNA) where: Base-Base interactions energy: -127.681 where: short stacking energy: -74.211 Base-Backbone interact. energy: -1.284 local terms energy: -130.914295 where: bonds (distance) C4'-P energy: -39.812 bonds (distance) P-C4' energy: -40.378 flat angles C4'-P-C4' energy: -25.162 flat angles P-C4'-P energy: -18.712 tors. eta vs tors. theta energy: -6.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -222.765590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.765590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.054686 (E_RNA) where: Base-Base interactions energy: -111.296 where: short stacking energy: -65.537 Base-Backbone interact. energy: -0.995 local terms energy: -110.763167 where: bonds (distance) C4'-P energy: -33.634 bonds (distance) P-C4' energy: -19.592 flat angles C4'-P-C4' energy: -33.844 flat angles P-C4'-P energy: -20.654 tors. eta vs tors. theta energy: -3.040 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -226.685131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.685131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.468939 (E_RNA) where: Base-Base interactions energy: -92.744 where: short stacking energy: -60.384 Base-Backbone interact. energy: -0.857 local terms energy: -133.867944 where: bonds (distance) C4'-P energy: -37.860 bonds (distance) P-C4' energy: -37.894 flat angles C4'-P-C4' energy: -39.584 flat angles P-C4'-P energy: -12.259 tors. eta vs tors. theta energy: -6.270 Dist. restrs. and SS energy: 0.784 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -589.908318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.908318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.080166 (E_RNA) where: Base-Base interactions energy: -391.272 where: short stacking energy: -202.190 Base-Backbone interact. energy: -1.012 local terms energy: -201.795678 where: bonds (distance) C4'-P energy: -38.949 bonds (distance) P-C4' energy: -38.411 flat angles C4'-P-C4' energy: -37.482 flat angles P-C4'-P energy: -35.120 tors. eta vs tors. theta energy: -51.833 Dist. restrs. and SS energy: 4.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -568.875406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.875406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.887487 (E_RNA) where: Base-Base interactions energy: -366.938 where: short stacking energy: -177.697 Base-Backbone interact. energy: -1.146 local terms energy: -200.804108 where: bonds (distance) C4'-P energy: -36.019 bonds (distance) P-C4' energy: -36.999 flat angles C4'-P-C4' energy: -42.071 flat angles P-C4'-P energy: -30.840 tors. eta vs tors. theta energy: -54.874 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -488.142083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.142083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.151477 (E_RNA) where: Base-Base interactions energy: -305.260 where: short stacking energy: -165.830 Base-Backbone interact. energy: -0.417 local terms energy: -182.474474 where: bonds (distance) C4'-P energy: -34.883 bonds (distance) P-C4' energy: -38.991 flat angles C4'-P-C4' energy: -42.071 flat angles P-C4'-P energy: -21.717 tors. eta vs tors. theta energy: -44.813 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -443.620840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.620840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.698045 (E_RNA) where: Base-Base interactions energy: -268.234 where: short stacking energy: -150.777 Base-Backbone interact. energy: -0.250 local terms energy: -175.214541 where: bonds (distance) C4'-P energy: -30.452 bonds (distance) P-C4' energy: -33.172 flat angles C4'-P-C4' energy: -41.873 flat angles P-C4'-P energy: -27.974 tors. eta vs tors. theta energy: -41.743 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -401.548156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.548156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.055862 (E_RNA) where: Base-Base interactions energy: -240.399 where: short stacking energy: -125.694 Base-Backbone interact. energy: -1.373 local terms energy: -161.283831 where: bonds (distance) C4'-P energy: -35.318 bonds (distance) P-C4' energy: -37.932 flat angles C4'-P-C4' energy: -40.877 flat angles P-C4'-P energy: -19.087 tors. eta vs tors. theta energy: -28.069 Dist. restrs. and SS energy: 1.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -332.066247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.066247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.090916 (E_RNA) where: Base-Base interactions energy: -180.078 where: short stacking energy: -110.278 Base-Backbone interact. energy: 0.477 local terms energy: -152.489788 where: bonds (distance) C4'-P energy: -28.816 bonds (distance) P-C4' energy: -45.085 flat angles C4'-P-C4' energy: -25.458 flat angles P-C4'-P energy: -33.530 tors. eta vs tors. theta energy: -19.601 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -280.080188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.080188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.089077 (E_RNA) where: Base-Base interactions energy: -130.509 where: short stacking energy: -74.498 Base-Backbone interact. energy: 0.021 local terms energy: -149.600792 where: bonds (distance) C4'-P energy: -41.242 bonds (distance) P-C4' energy: -35.717 flat angles C4'-P-C4' energy: -33.246 flat angles P-C4'-P energy: -25.377 tors. eta vs tors. theta energy: -14.018 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -257.342600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.342600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.460415 (E_RNA) where: Base-Base interactions energy: -127.182 where: short stacking energy: -76.233 Base-Backbone interact. energy: -0.345 local terms energy: -129.934042 where: bonds (distance) C4'-P energy: -28.023 bonds (distance) P-C4' energy: -38.860 flat angles C4'-P-C4' energy: -37.097 flat angles P-C4'-P energy: -10.580 tors. eta vs tors. theta energy: -15.373 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -231.743495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.743495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.205929 (E_RNA) where: Base-Base interactions energy: -112.973 where: short stacking energy: -73.485 Base-Backbone interact. energy: -0.845 local terms energy: -118.387178 where: bonds (distance) C4'-P energy: -31.664 bonds (distance) P-C4' energy: -35.073 flat angles C4'-P-C4' energy: -36.819 flat angles P-C4'-P energy: -11.153 tors. eta vs tors. theta energy: -3.679 Dist. restrs. and SS energy: 0.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -223.194864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.194864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.878704 (E_RNA) where: Base-Base interactions energy: -101.579 where: short stacking energy: -66.044 Base-Backbone interact. energy: -1.095 local terms energy: -122.204733 where: bonds (distance) C4'-P energy: -38.756 bonds (distance) P-C4' energy: -30.016 flat angles C4'-P-C4' energy: -27.113 flat angles P-C4'-P energy: -19.998 tors. eta vs tors. theta energy: -6.321 Dist. restrs. and SS energy: 1.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -585.033845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.033845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.411458 (E_RNA) where: Base-Base interactions energy: -377.634 where: short stacking energy: -200.446 Base-Backbone interact. energy: -0.773 local terms energy: -209.004951 where: bonds (distance) C4'-P energy: -36.724 bonds (distance) P-C4' energy: -36.283 flat angles C4'-P-C4' energy: -47.077 flat angles P-C4'-P energy: -32.591 tors. eta vs tors. theta energy: -56.329 Dist. restrs. and SS energy: 2.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -555.422511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.422511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.560971 (E_RNA) where: Base-Base interactions energy: -352.234 where: short stacking energy: -149.094 Base-Backbone interact. energy: -1.502 local terms energy: -201.824641 where: bonds (distance) C4'-P energy: -42.159 bonds (distance) P-C4' energy: -44.127 flat angles C4'-P-C4' energy: -47.247 flat angles P-C4'-P energy: -30.474 tors. eta vs tors. theta energy: -37.818 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -467.589906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.589906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.612208 (E_RNA) where: Base-Base interactions energy: -284.608 where: short stacking energy: -152.903 Base-Backbone interact. energy: -0.408 local terms energy: -182.595491 where: bonds (distance) C4'-P energy: -33.467 bonds (distance) P-C4' energy: -42.175 flat angles C4'-P-C4' energy: -44.631 flat angles P-C4'-P energy: -28.435 tors. eta vs tors. theta energy: -33.888 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -446.950466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.950466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.170464 (E_RNA) where: Base-Base interactions energy: -276.015 where: short stacking energy: -139.786 Base-Backbone interact. energy: 1.468 local terms energy: -172.622696 where: bonds (distance) C4'-P energy: -39.861 bonds (distance) P-C4' energy: -28.555 flat angles C4'-P-C4' energy: -43.704 flat angles P-C4'-P energy: -29.676 tors. eta vs tors. theta energy: -30.827 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -404.004029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.004029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.872633 (E_RNA) where: Base-Base interactions energy: -248.902 where: short stacking energy: -137.020 Base-Backbone interact. energy: -0.021 local terms energy: -155.948821 where: bonds (distance) C4'-P energy: -30.855 bonds (distance) P-C4' energy: -36.823 flat angles C4'-P-C4' energy: -34.917 flat angles P-C4'-P energy: -22.497 tors. eta vs tors. theta energy: -30.856 Dist. restrs. and SS energy: 0.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -328.970701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.970701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.027466 (E_RNA) where: Base-Base interactions energy: -169.783 where: short stacking energy: -89.368 Base-Backbone interact. energy: -0.150 local terms energy: -159.093905 where: bonds (distance) C4'-P energy: -34.385 bonds (distance) P-C4' energy: -36.602 flat angles C4'-P-C4' energy: -39.723 flat angles P-C4'-P energy: -29.095 tors. eta vs tors. theta energy: -19.289 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -285.295272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.295272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.915689 (E_RNA) where: Base-Base interactions energy: -165.819 where: short stacking energy: -94.284 Base-Backbone interact. energy: 0.075 local terms energy: -120.171987 where: bonds (distance) C4'-P energy: -34.909 bonds (distance) P-C4' energy: -25.881 flat angles C4'-P-C4' energy: -31.128 flat angles P-C4'-P energy: -14.075 tors. eta vs tors. theta energy: -14.178 Dist. restrs. and SS energy: 0.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -231.554547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.554547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.834192 (E_RNA) where: Base-Base interactions energy: -102.875 where: short stacking energy: -56.354 Base-Backbone interact. energy: -0.342 local terms energy: -128.616429 where: bonds (distance) C4'-P energy: -37.014 bonds (distance) P-C4' energy: -41.392 flat angles C4'-P-C4' energy: -31.305 flat angles P-C4'-P energy: -21.817 tors. eta vs tors. theta energy: 2.913 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -233.878193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.878193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.764439 (E_RNA) where: Base-Base interactions energy: -114.023 where: short stacking energy: -61.152 Base-Backbone interact. energy: 4.393 local terms energy: -127.134745 where: bonds (distance) C4'-P energy: -36.815 bonds (distance) P-C4' energy: -37.971 flat angles C4'-P-C4' energy: -35.516 flat angles P-C4'-P energy: -10.456 tors. eta vs tors. theta energy: -6.376 Dist. restrs. and SS energy: 2.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -210.575206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.575206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.700112 (E_RNA) where: Base-Base interactions energy: -101.105 where: short stacking energy: -55.837 Base-Backbone interact. energy: -0.264 local terms energy: -111.330693 where: bonds (distance) C4'-P energy: -41.013 bonds (distance) P-C4' energy: -34.743 flat angles C4'-P-C4' energy: -29.041 flat angles P-C4'-P energy: -5.261 tors. eta vs tors. theta energy: -1.273 Dist. restrs. and SS energy: 2.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -579.809879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.809879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.801692 (E_RNA) where: Base-Base interactions energy: -364.423 where: short stacking energy: -187.380 Base-Backbone interact. energy: 0.042 local terms energy: -217.420644 where: bonds (distance) C4'-P energy: -40.878 bonds (distance) P-C4' energy: -37.671 flat angles C4'-P-C4' energy: -47.842 flat angles P-C4'-P energy: -33.861 tors. eta vs tors. theta energy: -57.169 Dist. restrs. and SS energy: 1.992 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -556.987941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.987941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.987941 (E_RNA) where: Base-Base interactions energy: -348.204 where: short stacking energy: -160.331 Base-Backbone interact. energy: -0.272 local terms energy: -208.512152 where: bonds (distance) C4'-P energy: -41.434 bonds (distance) P-C4' energy: -42.953 flat angles C4'-P-C4' energy: -45.788 flat angles P-C4'-P energy: -24.628 tors. eta vs tors. theta energy: -53.710 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -479.530472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.530472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.534969 (E_RNA) where: Base-Base interactions energy: -291.349 where: short stacking energy: -168.962 Base-Backbone interact. energy: -0.526 local terms energy: -187.659738 where: bonds (distance) C4'-P energy: -36.638 bonds (distance) P-C4' energy: -46.881 flat angles C4'-P-C4' energy: -35.109 flat angles P-C4'-P energy: -25.876 tors. eta vs tors. theta energy: -43.156 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -477.024203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.024203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.024203 (E_RNA) where: Base-Base interactions energy: -302.704 where: short stacking energy: -142.364 Base-Backbone interact. energy: -0.763 local terms energy: -173.557158 where: bonds (distance) C4'-P energy: -33.606 bonds (distance) P-C4' energy: -30.449 flat angles C4'-P-C4' energy: -43.592 flat angles P-C4'-P energy: -27.171 tors. eta vs tors. theta energy: -38.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -433.940638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.940638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.165365 (E_RNA) where: Base-Base interactions energy: -269.096 where: short stacking energy: -148.261 Base-Backbone interact. energy: 1.821 local terms energy: -167.890580 where: bonds (distance) C4'-P energy: -31.373 bonds (distance) P-C4' energy: -33.326 flat angles C4'-P-C4' energy: -38.207 flat angles P-C4'-P energy: -24.263 tors. eta vs tors. theta energy: -40.721 Dist. restrs. and SS energy: 1.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -322.847902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.847902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.585807 (E_RNA) where: Base-Base interactions energy: -177.309 where: short stacking energy: -94.502 Base-Backbone interact. energy: -0.473 local terms energy: -145.803382 where: bonds (distance) C4'-P energy: -38.719 bonds (distance) P-C4' energy: -32.594 flat angles C4'-P-C4' energy: -37.650 flat angles P-C4'-P energy: -20.138 tors. eta vs tors. theta energy: -16.702 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -299.099636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.099636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.237776 (E_RNA) where: Base-Base interactions energy: -164.673 where: short stacking energy: -83.889 Base-Backbone interact. energy: -0.682 local terms energy: -133.882563 where: bonds (distance) C4'-P energy: -33.112 bonds (distance) P-C4' energy: -40.934 flat angles C4'-P-C4' energy: -28.283 flat angles P-C4'-P energy: -18.382 tors. eta vs tors. theta energy: -13.171 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -265.768627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.768627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.031532 (E_RNA) where: Base-Base interactions energy: -123.315 where: short stacking energy: -66.712 Base-Backbone interact. energy: 0.297 local terms energy: -143.013675 where: bonds (distance) C4'-P energy: -35.792 bonds (distance) P-C4' energy: -42.898 flat angles C4'-P-C4' energy: -34.875 flat angles P-C4'-P energy: -25.737 tors. eta vs tors. theta energy: -3.711 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -254.689629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.689629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.049152 (E_RNA) where: Base-Base interactions energy: -123.880 where: short stacking energy: -67.092 Base-Backbone interact. energy: 1.806 local terms energy: -132.975288 where: bonds (distance) C4'-P energy: -39.084 bonds (distance) P-C4' energy: -40.314 flat angles C4'-P-C4' energy: -33.164 flat angles P-C4'-P energy: -17.072 tors. eta vs tors. theta energy: -3.342 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -225.399348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.399348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.805948 (E_RNA) where: Base-Base interactions energy: -119.560 where: short stacking energy: -77.796 Base-Backbone interact. energy: -0.198 local terms energy: -108.048611 where: bonds (distance) C4'-P energy: -29.884 bonds (distance) P-C4' energy: -32.392 flat angles C4'-P-C4' energy: -20.547 flat angles P-C4'-P energy: -19.312 tors. eta vs tors. theta energy: -5.914 Dist. restrs. and SS energy: 2.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -588.250718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.250718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.610958 (E_RNA) where: Base-Base interactions energy: -389.332 where: short stacking energy: -190.275 Base-Backbone interact. energy: -0.141 local terms energy: -201.138092 where: bonds (distance) C4'-P energy: -40.491 bonds (distance) P-C4' energy: -39.085 flat angles C4'-P-C4' energy: -44.931 flat angles P-C4'-P energy: -24.741 tors. eta vs tors. theta energy: -51.891 Dist. restrs. and SS energy: 2.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -577.896844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.896844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.063721 (E_RNA) where: Base-Base interactions energy: -376.677 where: short stacking energy: -172.583 Base-Backbone interact. energy: -1.265 local terms energy: -200.120998 where: bonds (distance) C4'-P energy: -33.392 bonds (distance) P-C4' energy: -39.979 flat angles C4'-P-C4' energy: -41.470 flat angles P-C4'-P energy: -33.284 tors. eta vs tors. theta energy: -51.997 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -458.357344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.357344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.258399 (E_RNA) where: Base-Base interactions energy: -273.764 where: short stacking energy: -158.117 Base-Backbone interact. energy: -0.117 local terms energy: -185.377376 where: bonds (distance) C4'-P energy: -30.715 bonds (distance) P-C4' energy: -40.605 flat angles C4'-P-C4' energy: -39.529 flat angles P-C4'-P energy: -34.540 tors. eta vs tors. theta energy: -39.989 Dist. restrs. and SS energy: 0.901 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -476.497198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.497198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.497198 (E_RNA) where: Base-Base interactions energy: -301.365 where: short stacking energy: -149.595 Base-Backbone interact. energy: -1.595 local terms energy: -173.537307 where: bonds (distance) C4'-P energy: -27.100 bonds (distance) P-C4' energy: -45.618 flat angles C4'-P-C4' energy: -38.405 flat angles P-C4'-P energy: -28.730 tors. eta vs tors. theta energy: -33.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -434.901541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.901541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.785610 (E_RNA) where: Base-Base interactions energy: -276.747 where: short stacking energy: -122.977 Base-Backbone interact. energy: -0.948 local terms energy: -159.089878 where: bonds (distance) C4'-P energy: -34.079 bonds (distance) P-C4' energy: -29.952 flat angles C4'-P-C4' energy: -31.421 flat angles P-C4'-P energy: -27.132 tors. eta vs tors. theta energy: -36.507 Dist. restrs. and SS energy: 1.884 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -352.588543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.588543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.588543 (E_RNA) where: Base-Base interactions energy: -213.242 where: short stacking energy: -107.830 Base-Backbone interact. energy: -1.598 local terms energy: -137.748856 where: bonds (distance) C4'-P energy: -32.066 bonds (distance) P-C4' energy: -39.126 flat angles C4'-P-C4' energy: -34.871 flat angles P-C4'-P energy: -20.913 tors. eta vs tors. theta energy: -10.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -312.501748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.501748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.556266 (E_RNA) where: Base-Base interactions energy: -170.266 where: short stacking energy: -90.928 Base-Backbone interact. energy: -0.836 local terms energy: -141.454831 where: bonds (distance) C4'-P energy: -33.833 bonds (distance) P-C4' energy: -36.953 flat angles C4'-P-C4' energy: -36.620 flat angles P-C4'-P energy: -15.924 tors. eta vs tors. theta energy: -18.125 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -289.132332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.132332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.186875 (E_RNA) where: Base-Base interactions energy: -142.597 where: short stacking energy: -80.523 Base-Backbone interact. energy: 1.935 local terms energy: -148.525611 where: bonds (distance) C4'-P energy: -38.664 bonds (distance) P-C4' energy: -42.013 flat angles C4'-P-C4' energy: -33.658 flat angles P-C4'-P energy: -27.053 tors. eta vs tors. theta energy: -7.138 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -259.805746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.805746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.833465 (E_RNA) where: Base-Base interactions energy: -131.223 where: short stacking energy: -79.574 Base-Backbone interact. energy: -0.986 local terms energy: -127.624261 where: bonds (distance) C4'-P energy: -36.152 bonds (distance) P-C4' energy: -22.784 flat angles C4'-P-C4' energy: -35.996 flat angles P-C4'-P energy: -23.816 tors. eta vs tors. theta energy: -8.876 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -217.858710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.858710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.694721 (E_RNA) where: Base-Base interactions energy: -108.786 where: short stacking energy: -64.012 Base-Backbone interact. energy: -2.158 local terms energy: -108.750339 where: bonds (distance) C4'-P energy: -41.590 bonds (distance) P-C4' energy: -25.771 flat angles C4'-P-C4' energy: -27.205 flat angles P-C4'-P energy: -17.967 tors. eta vs tors. theta energy: 3.782 Dist. restrs. and SS energy: 1.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -605.490357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.490357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.560588 (E_RNA) where: Base-Base interactions energy: -400.461 where: short stacking energy: -200.261 Base-Backbone interact. energy: 0.138 local terms energy: -209.237975 where: bonds (distance) C4'-P energy: -37.709 bonds (distance) P-C4' energy: -39.822 flat angles C4'-P-C4' energy: -43.045 flat angles P-C4'-P energy: -31.048 tors. eta vs tors. theta energy: -57.613 Dist. restrs. and SS energy: 4.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -573.088354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.088354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.108750 (E_RNA) where: Base-Base interactions energy: -373.446 where: short stacking energy: -169.517 Base-Backbone interact. energy: -0.846 local terms energy: -198.817066 where: bonds (distance) C4'-P energy: -40.676 bonds (distance) P-C4' energy: -43.686 flat angles C4'-P-C4' energy: -34.567 flat angles P-C4'-P energy: -28.770 tors. eta vs tors. theta energy: -51.119 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -467.356430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.356430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.373514 (E_RNA) where: Base-Base interactions energy: -286.346 where: short stacking energy: -157.953 Base-Backbone interact. energy: -1.351 local terms energy: -179.676687 where: bonds (distance) C4'-P energy: -35.382 bonds (distance) P-C4' energy: -40.806 flat angles C4'-P-C4' energy: -43.682 flat angles P-C4'-P energy: -22.193 tors. eta vs tors. theta energy: -37.614 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -469.465866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.465866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.469548 (E_RNA) where: Base-Base interactions energy: -286.869 where: short stacking energy: -146.226 Base-Backbone interact. energy: -0.010 local terms energy: -182.590604 where: bonds (distance) C4'-P energy: -33.744 bonds (distance) P-C4' energy: -39.801 flat angles C4'-P-C4' energy: -40.618 flat angles P-C4'-P energy: -29.562 tors. eta vs tors. theta energy: -38.865 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -418.248128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.248128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.899369 (E_RNA) where: Base-Base interactions energy: -254.276 where: short stacking energy: -139.254 Base-Backbone interact. energy: -0.344 local terms energy: -164.280114 where: bonds (distance) C4'-P energy: -28.680 bonds (distance) P-C4' energy: -34.503 flat angles C4'-P-C4' energy: -37.354 flat angles P-C4'-P energy: -23.707 tors. eta vs tors. theta energy: -40.036 Dist. restrs. and SS energy: 0.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -312.216164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.216164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.679037 (E_RNA) where: Base-Base interactions energy: -174.739 where: short stacking energy: -110.391 Base-Backbone interact. energy: 0.968 local terms energy: -138.908808 where: bonds (distance) C4'-P energy: -38.693 bonds (distance) P-C4' energy: -29.160 flat angles C4'-P-C4' energy: -36.741 flat angles P-C4'-P energy: -16.260 tors. eta vs tors. theta energy: -18.055 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -287.783018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.783018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.020623 (E_RNA) where: Base-Base interactions energy: -165.867 where: short stacking energy: -79.899 Base-Backbone interact. energy: 0.479 local terms energy: -122.632975 where: bonds (distance) C4'-P energy: -29.012 bonds (distance) P-C4' energy: -28.751 flat angles C4'-P-C4' energy: -32.801 flat angles P-C4'-P energy: -24.568 tors. eta vs tors. theta energy: -7.500 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -282.522011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.522011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.780708 (E_RNA) where: Base-Base interactions energy: -149.826 where: short stacking energy: -67.955 Base-Backbone interact. energy: -0.273 local terms energy: -132.682374 where: bonds (distance) C4'-P energy: -34.404 bonds (distance) P-C4' energy: -30.095 flat angles C4'-P-C4' energy: -31.875 flat angles P-C4'-P energy: -22.255 tors. eta vs tors. theta energy: -14.054 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -261.197238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.197238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.216289 (E_RNA) where: Base-Base interactions energy: -125.762 where: short stacking energy: -70.989 Base-Backbone interact. energy: -0.893 local terms energy: -134.561405 where: bonds (distance) C4'-P energy: -36.731 bonds (distance) P-C4' energy: -29.642 flat angles C4'-P-C4' energy: -34.541 flat angles P-C4'-P energy: -22.203 tors. eta vs tors. theta energy: -11.445 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -213.607403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.607403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.497953 (E_RNA) where: Base-Base interactions energy: -99.992 where: short stacking energy: -51.187 Base-Backbone interact. energy: -0.310 local terms energy: -114.196149 where: bonds (distance) C4'-P energy: -34.703 bonds (distance) P-C4' energy: -30.076 flat angles C4'-P-C4' energy: -35.282 flat angles P-C4'-P energy: -16.162 tors. eta vs tors. theta energy: 2.027 Dist. restrs. and SS energy: 0.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -611.147660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.147660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.557712 (E_RNA) where: Base-Base interactions energy: -402.173 where: short stacking energy: -203.511 Base-Backbone interact. energy: -0.410 local terms energy: -213.974735 where: bonds (distance) C4'-P energy: -39.720 bonds (distance) P-C4' energy: -43.795 flat angles C4'-P-C4' energy: -43.207 flat angles P-C4'-P energy: -28.142 tors. eta vs tors. theta energy: -59.110 Dist. restrs. and SS energy: 5.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -567.601891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.601891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.612670 (E_RNA) where: Base-Base interactions energy: -367.248 where: short stacking energy: -166.867 Base-Backbone interact. energy: -1.616 local terms energy: -198.748732 where: bonds (distance) C4'-P energy: -39.060 bonds (distance) P-C4' energy: -37.938 flat angles C4'-P-C4' energy: -43.302 flat angles P-C4'-P energy: -29.894 tors. eta vs tors. theta energy: -48.555 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -492.153491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.153491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.197366 (E_RNA) where: Base-Base interactions energy: -313.999 where: short stacking energy: -155.501 Base-Backbone interact. energy: -0.103 local terms energy: -178.095084 where: bonds (distance) C4'-P energy: -33.153 bonds (distance) P-C4' energy: -40.769 flat angles C4'-P-C4' energy: -38.791 flat angles P-C4'-P energy: -24.139 tors. eta vs tors. theta energy: -41.244 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -439.610409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.610409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.784626 (E_RNA) where: Base-Base interactions energy: -269.085 where: short stacking energy: -124.794 Base-Backbone interact. energy: -0.150 local terms energy: -170.549298 where: bonds (distance) C4'-P energy: -28.351 bonds (distance) P-C4' energy: -37.661 flat angles C4'-P-C4' energy: -43.979 flat angles P-C4'-P energy: -25.408 tors. eta vs tors. theta energy: -35.151 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -408.635816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.635816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.679374 (E_RNA) where: Base-Base interactions energy: -248.641 where: short stacking energy: -126.761 Base-Backbone interact. energy: -1.671 local terms energy: -159.368005 where: bonds (distance) C4'-P energy: -31.993 bonds (distance) P-C4' energy: -39.351 flat angles C4'-P-C4' energy: -36.458 flat angles P-C4'-P energy: -14.592 tors. eta vs tors. theta energy: -36.974 Dist. restrs. and SS energy: 1.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -322.368127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.368127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.375773 (E_RNA) where: Base-Base interactions energy: -187.619 where: short stacking energy: -106.548 Base-Backbone interact. energy: -0.574 local terms energy: -134.182818 where: bonds (distance) C4'-P energy: -31.887 bonds (distance) P-C4' energy: -35.373 flat angles C4'-P-C4' energy: -32.057 flat angles P-C4'-P energy: -20.276 tors. eta vs tors. theta energy: -14.591 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -288.417685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.417685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.506053 (E_RNA) where: Base-Base interactions energy: -154.059 where: short stacking energy: -91.504 Base-Backbone interact. energy: -0.502 local terms energy: -133.945667 where: bonds (distance) C4'-P energy: -37.087 bonds (distance) P-C4' energy: -40.270 flat angles C4'-P-C4' energy: -22.950 flat angles P-C4'-P energy: -18.420 tors. eta vs tors. theta energy: -15.219 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -261.993511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.993511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.023836 (E_RNA) where: Base-Base interactions energy: -125.458 where: short stacking energy: -65.686 Base-Backbone interact. energy: -0.762 local terms energy: -135.803906 where: bonds (distance) C4'-P energy: -37.183 bonds (distance) P-C4' energy: -34.962 flat angles C4'-P-C4' energy: -30.141 flat angles P-C4'-P energy: -18.286 tors. eta vs tors. theta energy: -15.232 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -278.709476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.709476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.906044 (E_RNA) where: Base-Base interactions energy: -144.619 where: short stacking energy: -92.338 Base-Backbone interact. energy: 1.526 local terms energy: -135.813435 where: bonds (distance) C4'-P energy: -30.822 bonds (distance) P-C4' energy: -33.019 flat angles C4'-P-C4' energy: -42.173 flat angles P-C4'-P energy: -8.865 tors. eta vs tors. theta energy: -20.934 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -211.980707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.980707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.067004 (E_RNA) where: Base-Base interactions energy: -101.298 where: short stacking energy: -55.505 Base-Backbone interact. energy: -1.331 local terms energy: -109.437531 where: bonds (distance) C4'-P energy: -29.559 bonds (distance) P-C4' energy: -33.314 flat angles C4'-P-C4' energy: -30.153 flat angles P-C4'-P energy: -18.042 tors. eta vs tors. theta energy: 1.630 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -581.548060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.548060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.733768 (E_RNA) where: Base-Base interactions energy: -385.826 where: short stacking energy: -182.158 Base-Backbone interact. energy: -0.362 local terms energy: -200.546268 where: bonds (distance) C4'-P energy: -42.785 bonds (distance) P-C4' energy: -32.787 flat angles C4'-P-C4' energy: -45.802 flat angles P-C4'-P energy: -27.068 tors. eta vs tors. theta energy: -52.105 Dist. restrs. and SS energy: 5.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -573.160360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.160360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.190472 (E_RNA) where: Base-Base interactions energy: -370.343 where: short stacking energy: -174.322 Base-Backbone interact. energy: -1.405 local terms energy: -201.442471 where: bonds (distance) C4'-P energy: -37.617 bonds (distance) P-C4' energy: -40.163 flat angles C4'-P-C4' energy: -43.181 flat angles P-C4'-P energy: -26.981 tors. eta vs tors. theta energy: -53.500 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -523.980154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.980154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.329438 (E_RNA) where: Base-Base interactions energy: -329.657 where: short stacking energy: -156.094 Base-Backbone interact. energy: 0.022 local terms energy: -194.693945 where: bonds (distance) C4'-P energy: -38.404 bonds (distance) P-C4' energy: -46.296 flat angles C4'-P-C4' energy: -41.444 flat angles P-C4'-P energy: -22.581 tors. eta vs tors. theta energy: -45.969 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -447.062459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.062459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.059495 (E_RNA) where: Base-Base interactions energy: -266.776 where: short stacking energy: -141.098 Base-Backbone interact. energy: -0.244 local terms energy: -182.039012 where: bonds (distance) C4'-P energy: -38.919 bonds (distance) P-C4' energy: -39.730 flat angles C4'-P-C4' energy: -47.204 flat angles P-C4'-P energy: -20.444 tors. eta vs tors. theta energy: -35.742 Dist. restrs. and SS energy: 1.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -450.866471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.866471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.876946 (E_RNA) where: Base-Base interactions energy: -284.609 where: short stacking energy: -147.385 Base-Backbone interact. energy: -0.734 local terms energy: -165.533358 where: bonds (distance) C4'-P energy: -34.158 bonds (distance) P-C4' energy: -31.115 flat angles C4'-P-C4' energy: -39.372 flat angles P-C4'-P energy: -22.741 tors. eta vs tors. theta energy: -38.147 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -307.143991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.143991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.231527 (E_RNA) where: Base-Base interactions energy: -172.035 where: short stacking energy: -99.781 Base-Backbone interact. energy: 0.087 local terms energy: -135.284038 where: bonds (distance) C4'-P energy: -35.596 bonds (distance) P-C4' energy: -32.897 flat angles C4'-P-C4' energy: -33.097 flat angles P-C4'-P energy: -16.801 tors. eta vs tors. theta energy: -16.893 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -303.133586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.133586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.133586 (E_RNA) where: Base-Base interactions energy: -152.539 where: short stacking energy: -88.108 Base-Backbone interact. energy: 0.995 local terms energy: -151.589102 where: bonds (distance) C4'-P energy: -36.813 bonds (distance) P-C4' energy: -32.380 flat angles C4'-P-C4' energy: -36.308 flat angles P-C4'-P energy: -24.882 tors. eta vs tors. theta energy: -21.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -284.751753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.751753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.751753 (E_RNA) where: Base-Base interactions energy: -151.478 where: short stacking energy: -86.794 Base-Backbone interact. energy: -0.492 local terms energy: -132.782442 where: bonds (distance) C4'-P energy: -41.468 bonds (distance) P-C4' energy: -31.459 flat angles C4'-P-C4' energy: -34.486 flat angles P-C4'-P energy: -13.343 tors. eta vs tors. theta energy: -12.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -231.560010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.560010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.560010 (E_RNA) where: Base-Base interactions energy: -112.569 where: short stacking energy: -63.739 Base-Backbone interact. energy: -0.158 local terms energy: -118.833779 where: bonds (distance) C4'-P energy: -43.897 bonds (distance) P-C4' energy: -34.559 flat angles C4'-P-C4' energy: -22.783 flat angles P-C4'-P energy: -11.029 tors. eta vs tors. theta energy: -6.566 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -239.616736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.616736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.773447 (E_RNA) where: Base-Base interactions energy: -129.659 where: short stacking energy: -58.306 Base-Backbone interact. energy: 1.390 local terms energy: -115.504419 where: bonds (distance) C4'-P energy: -33.216 bonds (distance) P-C4' energy: -26.053 flat angles C4'-P-C4' energy: -34.490 flat angles P-C4'-P energy: -24.158 tors. eta vs tors. theta energy: 2.413 Dist. restrs. and SS energy: 4.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -604.429393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.429393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.772640 (E_RNA) where: Base-Base interactions energy: -397.004 where: short stacking energy: -199.133 Base-Backbone interact. energy: 0.764 local terms energy: -210.532573 where: bonds (distance) C4'-P energy: -40.749 bonds (distance) P-C4' energy: -36.977 flat angles C4'-P-C4' energy: -40.936 flat angles P-C4'-P energy: -34.067 tors. eta vs tors. theta energy: -57.805 Dist. restrs. and SS energy: 2.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -583.507059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.507059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.516271 (E_RNA) where: Base-Base interactions energy: -381.141 where: short stacking energy: -171.976 Base-Backbone interact. energy: -1.583 local terms energy: -200.791806 where: bonds (distance) C4'-P energy: -41.036 bonds (distance) P-C4' energy: -40.660 flat angles C4'-P-C4' energy: -42.706 flat angles P-C4'-P energy: -30.146 tors. eta vs tors. theta energy: -46.244 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -500.216706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.216706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.233362 (E_RNA) where: Base-Base interactions energy: -311.347 where: short stacking energy: -146.538 Base-Backbone interact. energy: 1.685 local terms energy: -190.571385 where: bonds (distance) C4'-P energy: -40.982 bonds (distance) P-C4' energy: -43.661 flat angles C4'-P-C4' energy: -35.347 flat angles P-C4'-P energy: -27.712 tors. eta vs tors. theta energy: -42.869 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -465.796910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.796910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.080623 (E_RNA) where: Base-Base interactions energy: -289.775 where: short stacking energy: -152.638 Base-Backbone interact. energy: 1.199 local terms energy: -181.504408 where: bonds (distance) C4'-P energy: -29.648 bonds (distance) P-C4' energy: -44.210 flat angles C4'-P-C4' energy: -37.509 flat angles P-C4'-P energy: -25.742 tors. eta vs tors. theta energy: -44.395 Dist. restrs. and SS energy: 4.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -420.254583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.254583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.254583 (E_RNA) where: Base-Base interactions energy: -263.870 where: short stacking energy: -137.530 Base-Backbone interact. energy: -0.401 local terms energy: -155.983257 where: bonds (distance) C4'-P energy: -28.170 bonds (distance) P-C4' energy: -37.167 flat angles C4'-P-C4' energy: -33.395 flat angles P-C4'-P energy: -22.637 tors. eta vs tors. theta energy: -34.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -324.390709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.390709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.412815 (E_RNA) where: Base-Base interactions energy: -180.814 where: short stacking energy: -112.281 Base-Backbone interact. energy: 5.619 local terms energy: -149.217438 where: bonds (distance) C4'-P energy: -37.486 bonds (distance) P-C4' energy: -41.620 flat angles C4'-P-C4' energy: -31.595 flat angles P-C4'-P energy: -21.129 tors. eta vs tors. theta energy: -17.388 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -303.623861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.623861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.492878 (E_RNA) where: Base-Base interactions energy: -167.584 where: short stacking energy: -91.904 Base-Backbone interact. energy: -0.264 local terms energy: -136.645251 where: bonds (distance) C4'-P energy: -33.823 bonds (distance) P-C4' energy: -24.637 flat angles C4'-P-C4' energy: -35.754 flat angles P-C4'-P energy: -22.981 tors. eta vs tors. theta energy: -19.450 Dist. restrs. and SS energy: 0.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -270.698124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.698124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.691953 (E_RNA) where: Base-Base interactions energy: -139.481 where: short stacking energy: -63.745 Base-Backbone interact. energy: -0.546 local terms energy: -131.665446 where: bonds (distance) C4'-P energy: -31.096 bonds (distance) P-C4' energy: -37.834 flat angles C4'-P-C4' energy: -33.627 flat angles P-C4'-P energy: -22.660 tors. eta vs tors. theta energy: -6.449 Dist. restrs. and SS energy: 0.994 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -265.718306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.718306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.358055 (E_RNA) where: Base-Base interactions energy: -129.386 where: short stacking energy: -68.245 Base-Backbone interact. energy: -0.624 local terms energy: -138.347570 where: bonds (distance) C4'-P energy: -39.679 bonds (distance) P-C4' energy: -31.316 flat angles C4'-P-C4' energy: -40.601 flat angles P-C4'-P energy: -24.568 tors. eta vs tors. theta energy: -2.183 Dist. restrs. and SS energy: 2.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -231.701519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.701519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.864162 (E_RNA) where: Base-Base interactions energy: -116.345 where: short stacking energy: -60.308 Base-Backbone interact. energy: -0.429 local terms energy: -115.090184 where: bonds (distance) C4'-P energy: -32.337 bonds (distance) P-C4' energy: -31.395 flat angles C4'-P-C4' energy: -28.237 flat angles P-C4'-P energy: -20.646 tors. eta vs tors. theta energy: -2.476 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -596.424694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.424694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.348687 (E_RNA) where: Base-Base interactions energy: -401.367 where: short stacking energy: -184.881 Base-Backbone interact. energy: -0.777 local terms energy: -198.205328 where: bonds (distance) C4'-P energy: -32.722 bonds (distance) P-C4' energy: -39.970 flat angles C4'-P-C4' energy: -40.944 flat angles P-C4'-P energy: -29.832 tors. eta vs tors. theta energy: -54.737 Dist. restrs. and SS energy: 3.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -562.641658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.641658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.691137 (E_RNA) where: Base-Base interactions energy: -378.145 where: short stacking energy: -173.532 Base-Backbone interact. energy: -0.998 local terms energy: -183.547983 where: bonds (distance) C4'-P energy: -25.880 bonds (distance) P-C4' energy: -39.794 flat angles C4'-P-C4' energy: -42.380 flat angles P-C4'-P energy: -30.265 tors. eta vs tors. theta energy: -45.229 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -478.038240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.038240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.286525 (E_RNA) where: Base-Base interactions energy: -293.701 where: short stacking energy: -149.946 Base-Backbone interact. energy: -0.023 local terms energy: -184.563111 where: bonds (distance) C4'-P energy: -37.781 bonds (distance) P-C4' energy: -39.249 flat angles C4'-P-C4' energy: -43.666 flat angles P-C4'-P energy: -24.776 tors. eta vs tors. theta energy: -39.090 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -440.655948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.655948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.040146 (E_RNA) where: Base-Base interactions energy: -268.542 where: short stacking energy: -155.985 Base-Backbone interact. energy: -0.420 local terms energy: -176.078692 where: bonds (distance) C4'-P energy: -28.218 bonds (distance) P-C4' energy: -35.950 flat angles C4'-P-C4' energy: -38.090 flat angles P-C4'-P energy: -31.369 tors. eta vs tors. theta energy: -42.452 Dist. restrs. and SS energy: 4.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -423.952040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.952040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.952040 (E_RNA) where: Base-Base interactions energy: -250.624 where: short stacking energy: -130.288 Base-Backbone interact. energy: 0.135 local terms energy: -173.462807 where: bonds (distance) C4'-P energy: -35.954 bonds (distance) P-C4' energy: -34.835 flat angles C4'-P-C4' energy: -41.352 flat angles P-C4'-P energy: -22.869 tors. eta vs tors. theta energy: -38.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -310.949220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.949220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.234855 (E_RNA) where: Base-Base interactions energy: -165.112 where: short stacking energy: -83.301 Base-Backbone interact. energy: -0.711 local terms energy: -145.412021 where: bonds (distance) C4'-P energy: -36.338 bonds (distance) P-C4' energy: -38.331 flat angles C4'-P-C4' energy: -26.152 flat angles P-C4'-P energy: -27.338 tors. eta vs tors. theta energy: -17.252 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -281.147406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.147406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.319875 (E_RNA) where: Base-Base interactions energy: -127.804 where: short stacking energy: -82.395 Base-Backbone interact. energy: 0.030 local terms energy: -153.546014 where: bonds (distance) C4'-P energy: -34.761 bonds (distance) P-C4' energy: -40.478 flat angles C4'-P-C4' energy: -32.706 flat angles P-C4'-P energy: -22.992 tors. eta vs tors. theta energy: -22.610 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -240.454251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.454251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.933315 (E_RNA) where: Base-Base interactions energy: -112.464 where: short stacking energy: -65.623 Base-Backbone interact. energy: 0.406 local terms energy: -128.874944 where: bonds (distance) C4'-P energy: -34.344 bonds (distance) P-C4' energy: -34.573 flat angles C4'-P-C4' energy: -38.418 flat angles P-C4'-P energy: -18.400 tors. eta vs tors. theta energy: -3.140 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -243.133435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.133435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.744358 (E_RNA) where: Base-Base interactions energy: -130.357 where: short stacking energy: -68.087 Base-Backbone interact. energy: -1.123 local terms energy: -112.264259 where: bonds (distance) C4'-P energy: -24.534 bonds (distance) P-C4' energy: -33.330 flat angles C4'-P-C4' energy: -31.176 flat angles P-C4'-P energy: -19.428 tors. eta vs tors. theta energy: -3.797 Dist. restrs. and SS energy: 0.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -226.270520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.270520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.549408 (E_RNA) where: Base-Base interactions energy: -103.071 where: short stacking energy: -59.916 Base-Backbone interact. energy: 2.757 local terms energy: -129.235087 where: bonds (distance) C4'-P energy: -39.836 bonds (distance) P-C4' energy: -31.203 flat angles C4'-P-C4' energy: -34.104 flat angles P-C4'-P energy: -19.625 tors. eta vs tors. theta energy: -4.468 Dist. restrs. and SS energy: 3.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -611.402144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.402144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.316829 (E_RNA) where: Base-Base interactions energy: -395.794 where: short stacking energy: -185.657 Base-Backbone interact. energy: 0.345 local terms energy: -219.867664 where: bonds (distance) C4'-P energy: -43.365 bonds (distance) P-C4' energy: -42.597 flat angles C4'-P-C4' energy: -45.759 flat angles P-C4'-P energy: -33.268 tors. eta vs tors. theta energy: -54.878 Dist. restrs. and SS energy: 3.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -569.723393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.723393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.885060 (E_RNA) where: Base-Base interactions energy: -378.752 where: short stacking energy: -183.344 Base-Backbone interact. energy: -0.155 local terms energy: -190.977999 where: bonds (distance) C4'-P energy: -35.790 bonds (distance) P-C4' energy: -38.781 flat angles C4'-P-C4' energy: -39.519 flat angles P-C4'-P energy: -24.898 tors. eta vs tors. theta energy: -51.991 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -499.630406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.630406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.728447 (E_RNA) where: Base-Base interactions energy: -309.425 where: short stacking energy: -160.517 Base-Backbone interact. energy: 0.017 local terms energy: -190.320147 where: bonds (distance) C4'-P energy: -39.041 bonds (distance) P-C4' energy: -40.985 flat angles C4'-P-C4' energy: -39.829 flat angles P-C4'-P energy: -24.118 tors. eta vs tors. theta energy: -46.347 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -465.708515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.708515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.963145 (E_RNA) where: Base-Base interactions energy: -286.882 where: short stacking energy: -153.893 Base-Backbone interact. energy: 0.087 local terms energy: -179.168359 where: bonds (distance) C4'-P energy: -37.092 bonds (distance) P-C4' energy: -32.471 flat angles C4'-P-C4' energy: -43.853 flat angles P-C4'-P energy: -20.726 tors. eta vs tors. theta energy: -45.027 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -455.491215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.491215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.931266 (E_RNA) where: Base-Base interactions energy: -274.190 where: short stacking energy: -141.691 Base-Backbone interact. energy: -0.228 local terms energy: -182.513133 where: bonds (distance) C4'-P energy: -38.687 bonds (distance) P-C4' energy: -37.917 flat angles C4'-P-C4' energy: -43.271 flat angles P-C4'-P energy: -25.732 tors. eta vs tors. theta energy: -36.906 Dist. restrs. and SS energy: 1.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -294.789137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.789137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.160242 (E_RNA) where: Base-Base interactions energy: -152.548 where: short stacking energy: -92.850 Base-Backbone interact. energy: 1.328 local terms energy: -143.939873 where: bonds (distance) C4'-P energy: -34.944 bonds (distance) P-C4' energy: -36.733 flat angles C4'-P-C4' energy: -35.376 flat angles P-C4'-P energy: -20.726 tors. eta vs tors. theta energy: -16.161 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -301.643575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.643575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.739950 (E_RNA) where: Base-Base interactions energy: -167.075 where: short stacking energy: -98.371 Base-Backbone interact. energy: 0.015 local terms energy: -134.680104 where: bonds (distance) C4'-P energy: -30.474 bonds (distance) P-C4' energy: -40.954 flat angles C4'-P-C4' energy: -34.361 flat angles P-C4'-P energy: -14.667 tors. eta vs tors. theta energy: -14.224 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -266.684031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.684031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.779054 (E_RNA) where: Base-Base interactions energy: -138.610 where: short stacking energy: -82.885 Base-Backbone interact. energy: -1.150 local terms energy: -127.018660 where: bonds (distance) C4'-P energy: -33.600 bonds (distance) P-C4' energy: -23.276 flat angles C4'-P-C4' energy: -42.099 flat angles P-C4'-P energy: -10.912 tors. eta vs tors. theta energy: -17.132 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -250.068810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.068810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.151385 (E_RNA) where: Base-Base interactions energy: -125.850 where: short stacking energy: -60.325 Base-Backbone interact. energy: -0.873 local terms energy: -123.428987 where: bonds (distance) C4'-P energy: -34.467 bonds (distance) P-C4' energy: -31.762 flat angles C4'-P-C4' energy: -30.935 flat angles P-C4'-P energy: -24.152 tors. eta vs tors. theta energy: -2.113 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -235.058647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.058647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.723933 (E_RNA) where: Base-Base interactions energy: -118.480 where: short stacking energy: -76.454 Base-Backbone interact. energy: 1.375 local terms energy: -118.618802 where: bonds (distance) C4'-P energy: -31.171 bonds (distance) P-C4' energy: -39.482 flat angles C4'-P-C4' energy: -19.045 flat angles P-C4'-P energy: -26.172 tors. eta vs tors. theta energy: -2.749 Dist. restrs. and SS energy: 0.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -613.000465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.000465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.880637 (E_RNA) where: Base-Base interactions energy: -404.765 where: short stacking energy: -196.360 Base-Backbone interact. energy: -0.543 local terms energy: -210.573014 where: bonds (distance) C4'-P energy: -43.893 bonds (distance) P-C4' energy: -35.417 flat angles C4'-P-C4' energy: -44.815 flat angles P-C4'-P energy: -34.799 tors. eta vs tors. theta energy: -51.649 Dist. restrs. and SS energy: 2.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -565.637310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.637310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.691287 (E_RNA) where: Base-Base interactions energy: -395.484 where: short stacking energy: -189.631 Base-Backbone interact. energy: -1.145 local terms energy: -169.062166 where: bonds (distance) C4'-P energy: -27.734 bonds (distance) P-C4' energy: -31.692 flat angles C4'-P-C4' energy: -38.194 flat angles P-C4'-P energy: -25.424 tors. eta vs tors. theta energy: -46.019 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -511.995123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.995123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.434428 (E_RNA) where: Base-Base interactions energy: -312.755 where: short stacking energy: -160.547 Base-Backbone interact. energy: -1.105 local terms energy: -198.574725 where: bonds (distance) C4'-P energy: -43.861 bonds (distance) P-C4' energy: -38.446 flat angles C4'-P-C4' energy: -45.929 flat angles P-C4'-P energy: -19.189 tors. eta vs tors. theta energy: -51.149 Dist. restrs. and SS energy: 0.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -445.632282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.632282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.688682 (E_RNA) where: Base-Base interactions energy: -268.634 where: short stacking energy: -142.070 Base-Backbone interact. energy: -0.694 local terms energy: -176.360713 where: bonds (distance) C4'-P energy: -35.134 bonds (distance) P-C4' energy: -36.274 flat angles C4'-P-C4' energy: -36.630 flat angles P-C4'-P energy: -29.296 tors. eta vs tors. theta energy: -39.026 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -404.830098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.830098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.947430 (E_RNA) where: Base-Base interactions energy: -236.514 where: short stacking energy: -113.665 Base-Backbone interact. energy: 0.152 local terms energy: -169.586052 where: bonds (distance) C4'-P energy: -33.220 bonds (distance) P-C4' energy: -37.236 flat angles C4'-P-C4' energy: -42.982 flat angles P-C4'-P energy: -31.272 tors. eta vs tors. theta energy: -24.875 Dist. restrs. and SS energy: 1.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -287.720269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.720269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.720269 (E_RNA) where: Base-Base interactions energy: -149.847 where: short stacking energy: -86.554 Base-Backbone interact. energy: 0.953 local terms energy: -138.825987 where: bonds (distance) C4'-P energy: -35.948 bonds (distance) P-C4' energy: -38.267 flat angles C4'-P-C4' energy: -28.899 flat angles P-C4'-P energy: -19.608 tors. eta vs tors. theta energy: -16.104 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -301.563736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.563736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.849656 (E_RNA) where: Base-Base interactions energy: -156.024 where: short stacking energy: -90.628 Base-Backbone interact. energy: 1.667 local terms energy: -147.492847 where: bonds (distance) C4'-P energy: -39.313 bonds (distance) P-C4' energy: -33.268 flat angles C4'-P-C4' energy: -38.250 flat angles P-C4'-P energy: -19.491 tors. eta vs tors. theta energy: -17.171 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -269.764402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.764402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.168798 (E_RNA) where: Base-Base interactions energy: -144.913 where: short stacking energy: -93.300 Base-Backbone interact. energy: -1.101 local terms energy: -124.154751 where: bonds (distance) C4'-P energy: -32.277 bonds (distance) P-C4' energy: -32.820 flat angles C4'-P-C4' energy: -33.733 flat angles P-C4'-P energy: -11.373 tors. eta vs tors. theta energy: -13.951 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -255.755230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.755230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.758325 (E_RNA) where: Base-Base interactions energy: -141.902 where: short stacking energy: -82.319 Base-Backbone interact. energy: 0.906 local terms energy: -114.761969 where: bonds (distance) C4'-P energy: -35.614 bonds (distance) P-C4' energy: -32.190 flat angles C4'-P-C4' energy: -29.176 flat angles P-C4'-P energy: -14.405 tors. eta vs tors. theta energy: -3.377 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -257.349477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.349477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.834432 (E_RNA) where: Base-Base interactions energy: -128.357 where: short stacking energy: -74.573 Base-Backbone interact. energy: -0.771 local terms energy: -128.706914 where: bonds (distance) C4'-P energy: -35.662 bonds (distance) P-C4' energy: -30.220 flat angles C4'-P-C4' energy: -32.950 flat angles P-C4'-P energy: -17.487 tors. eta vs tors. theta energy: -12.388 Dist. restrs. and SS energy: 0.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -619.177767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.177767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.421311 (E_RNA) where: Base-Base interactions energy: -401.063 where: short stacking energy: -197.886 Base-Backbone interact. energy: -0.565 local terms energy: -219.793170 where: bonds (distance) C4'-P energy: -34.356 bonds (distance) P-C4' energy: -45.243 flat angles C4'-P-C4' energy: -48.950 flat angles P-C4'-P energy: -33.519 tors. eta vs tors. theta energy: -57.724 Dist. restrs. and SS energy: 2.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -588.054315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.054315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.054315 (E_RNA) where: Base-Base interactions energy: -378.852 where: short stacking energy: -171.754 Base-Backbone interact. energy: -1.477 local terms energy: -207.725669 where: bonds (distance) C4'-P energy: -41.728 bonds (distance) P-C4' energy: -42.670 flat angles C4'-P-C4' energy: -44.132 flat angles P-C4'-P energy: -33.528 tors. eta vs tors. theta energy: -45.667 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -464.786388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.786388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.786388 (E_RNA) where: Base-Base interactions energy: -282.829 where: short stacking energy: -152.872 Base-Backbone interact. energy: -0.186 local terms energy: -181.771912 where: bonds (distance) C4'-P energy: -38.167 bonds (distance) P-C4' energy: -37.536 flat angles C4'-P-C4' energy: -39.027 flat angles P-C4'-P energy: -28.129 tors. eta vs tors. theta energy: -38.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -471.747435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.747435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.793402 (E_RNA) where: Base-Base interactions energy: -298.352 where: short stacking energy: -140.605 Base-Backbone interact. energy: -0.243 local terms energy: -173.198081 where: bonds (distance) C4'-P energy: -33.018 bonds (distance) P-C4' energy: -35.090 flat angles C4'-P-C4' energy: -39.677 flat angles P-C4'-P energy: -32.244 tors. eta vs tors. theta energy: -33.169 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -402.089112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.089112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.366664 (E_RNA) where: Base-Base interactions energy: -234.655 where: short stacking energy: -133.886 Base-Backbone interact. energy: -0.143 local terms energy: -168.569412 where: bonds (distance) C4'-P energy: -38.388 bonds (distance) P-C4' energy: -33.411 flat angles C4'-P-C4' energy: -39.244 flat angles P-C4'-P energy: -23.578 tors. eta vs tors. theta energy: -33.948 Dist. restrs. and SS energy: 1.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -297.729981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.729981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.067338 (E_RNA) where: Base-Base interactions energy: -158.145 where: short stacking energy: -83.262 Base-Backbone interact. energy: -0.990 local terms energy: -138.931936 where: bonds (distance) C4'-P energy: -35.941 bonds (distance) P-C4' energy: -37.523 flat angles C4'-P-C4' energy: -26.914 flat angles P-C4'-P energy: -25.011 tors. eta vs tors. theta energy: -13.544 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -284.623268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.623268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.632978 (E_RNA) where: Base-Base interactions energy: -144.947 where: short stacking energy: -84.507 Base-Backbone interact. energy: 0.140 local terms energy: -139.826487 where: bonds (distance) C4'-P energy: -40.649 bonds (distance) P-C4' energy: -40.424 flat angles C4'-P-C4' energy: -29.807 flat angles P-C4'-P energy: -10.242 tors. eta vs tors. theta energy: -18.704 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -278.046024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.046024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.162227 (E_RNA) where: Base-Base interactions energy: -149.055 where: short stacking energy: -78.546 Base-Backbone interact. energy: -0.408 local terms energy: -128.698802 where: bonds (distance) C4'-P energy: -35.170 bonds (distance) P-C4' energy: -34.837 flat angles C4'-P-C4' energy: -34.886 flat angles P-C4'-P energy: -15.062 tors. eta vs tors. theta energy: -8.744 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -272.763372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.763372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.801117 (E_RNA) where: Base-Base interactions energy: -143.493 where: short stacking energy: -94.574 Base-Backbone interact. energy: 1.141 local terms energy: -130.449008 where: bonds (distance) C4'-P energy: -36.124 bonds (distance) P-C4' energy: -33.692 flat angles C4'-P-C4' energy: -22.057 flat angles P-C4'-P energy: -25.265 tors. eta vs tors. theta energy: -13.311 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -230.212956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.212956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.032749 (E_RNA) where: Base-Base interactions energy: -113.541 where: short stacking energy: -65.570 Base-Backbone interact. energy: -0.674 local terms energy: -120.817470 where: bonds (distance) C4'-P energy: -34.732 bonds (distance) P-C4' energy: -29.787 flat angles C4'-P-C4' energy: -35.598 flat angles P-C4'-P energy: -16.469 tors. eta vs tors. theta energy: -4.232 Dist. restrs. and SS energy: 4.820 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -613.464804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.464804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.103463 (E_RNA) where: Base-Base interactions energy: -401.425 where: short stacking energy: -196.107 Base-Backbone interact. energy: -0.341 local terms energy: -214.337544 where: bonds (distance) C4'-P energy: -37.182 bonds (distance) P-C4' energy: -44.032 flat angles C4'-P-C4' energy: -40.945 flat angles P-C4'-P energy: -31.610 tors. eta vs tors. theta energy: -60.569 Dist. restrs. and SS energy: 2.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -551.490452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.490452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.542848 (E_RNA) where: Base-Base interactions energy: -355.975 where: short stacking energy: -149.175 Base-Backbone interact. energy: -1.721 local terms energy: -193.847574 where: bonds (distance) C4'-P energy: -35.738 bonds (distance) P-C4' energy: -41.253 flat angles C4'-P-C4' energy: -39.952 flat angles P-C4'-P energy: -36.868 tors. eta vs tors. theta energy: -40.037 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -491.558685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.558685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.800472 (E_RNA) where: Base-Base interactions energy: -296.430 where: short stacking energy: -171.526 Base-Backbone interact. energy: -0.156 local terms energy: -195.213724 where: bonds (distance) C4'-P energy: -38.845 bonds (distance) P-C4' energy: -37.780 flat angles C4'-P-C4' energy: -43.302 flat angles P-C4'-P energy: -28.747 tors. eta vs tors. theta energy: -46.539 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -473.571931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.571931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.574944 (E_RNA) where: Base-Base interactions energy: -291.027 where: short stacking energy: -142.083 Base-Backbone interact. energy: -0.987 local terms energy: -181.560891 where: bonds (distance) C4'-P energy: -39.753 bonds (distance) P-C4' energy: -39.083 flat angles C4'-P-C4' energy: -37.743 flat angles P-C4'-P energy: -26.761 tors. eta vs tors. theta energy: -38.222 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -389.010488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.010488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.398232 (E_RNA) where: Base-Base interactions energy: -231.255 where: short stacking energy: -122.704 Base-Backbone interact. energy: -0.661 local terms energy: -157.483177 where: bonds (distance) C4'-P energy: -38.199 bonds (distance) P-C4' energy: -31.720 flat angles C4'-P-C4' energy: -41.008 flat angles P-C4'-P energy: -23.167 tors. eta vs tors. theta energy: -23.389 Dist. restrs. and SS energy: 0.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -300.864305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.864305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.964396 (E_RNA) where: Base-Base interactions energy: -162.642 where: short stacking energy: -103.647 Base-Backbone interact. energy: 2.990 local terms energy: -141.313140 where: bonds (distance) C4'-P energy: -34.370 bonds (distance) P-C4' energy: -27.982 flat angles C4'-P-C4' energy: -37.495 flat angles P-C4'-P energy: -17.702 tors. eta vs tors. theta energy: -23.765 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -260.740537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.740537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.977593 (E_RNA) where: Base-Base interactions energy: -130.409 where: short stacking energy: -85.684 Base-Backbone interact. energy: -0.980 local terms energy: -131.588161 where: bonds (distance) C4'-P energy: -26.983 bonds (distance) P-C4' energy: -40.962 flat angles C4'-P-C4' energy: -28.410 flat angles P-C4'-P energy: -23.152 tors. eta vs tors. theta energy: -12.081 Dist. restrs. and SS energy: 2.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -265.800100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.800100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.869179 (E_RNA) where: Base-Base interactions energy: -138.672 where: short stacking energy: -74.748 Base-Backbone interact. energy: 0.129 local terms energy: -127.326685 where: bonds (distance) C4'-P energy: -34.324 bonds (distance) P-C4' energy: -35.047 flat angles C4'-P-C4' energy: -26.452 flat angles P-C4'-P energy: -24.650 tors. eta vs tors. theta energy: -6.854 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -249.393391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.393391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.696231 (E_RNA) where: Base-Base interactions energy: -122.956 where: short stacking energy: -72.161 Base-Backbone interact. energy: 1.137 local terms energy: -127.877729 where: bonds (distance) C4'-P energy: -40.079 bonds (distance) P-C4' energy: -34.079 flat angles C4'-P-C4' energy: -34.513 flat angles P-C4'-P energy: -16.490 tors. eta vs tors. theta energy: -2.716 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -203.260096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.260096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.837288 (E_RNA) where: Base-Base interactions energy: -104.404 where: short stacking energy: -68.175 Base-Backbone interact. energy: 2.207 local terms energy: -105.640256 where: bonds (distance) C4'-P energy: -32.247 bonds (distance) P-C4' energy: -25.565 flat angles C4'-P-C4' energy: -29.919 flat angles P-C4'-P energy: -16.626 tors. eta vs tors. theta energy: -1.282 Dist. restrs. and SS energy: 4.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -613.219077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.219077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.369328 (E_RNA) where: Base-Base interactions energy: -406.261 where: short stacking energy: -198.044 Base-Backbone interact. energy: 1.313 local terms energy: -211.421293 where: bonds (distance) C4'-P energy: -37.655 bonds (distance) P-C4' energy: -43.486 flat angles C4'-P-C4' energy: -42.261 flat angles P-C4'-P energy: -36.981 tors. eta vs tors. theta energy: -51.037 Dist. restrs. and SS energy: 3.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -558.729041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.729041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.916264 (E_RNA) where: Base-Base interactions energy: -379.475 where: short stacking energy: -166.194 Base-Backbone interact. energy: -2.019 local terms energy: -177.422010 where: bonds (distance) C4'-P energy: -41.954 bonds (distance) P-C4' energy: -36.199 flat angles C4'-P-C4' energy: -33.455 flat angles P-C4'-P energy: -26.283 tors. eta vs tors. theta energy: -39.531 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -480.923759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.923759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.180436 (E_RNA) where: Base-Base interactions energy: -293.837 where: short stacking energy: -167.388 Base-Backbone interact. energy: -0.985 local terms energy: -186.359365 where: bonds (distance) C4'-P energy: -39.950 bonds (distance) P-C4' energy: -41.558 flat angles C4'-P-C4' energy: -37.015 flat angles P-C4'-P energy: -19.841 tors. eta vs tors. theta energy: -47.995 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -477.424659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.424659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.480523 (E_RNA) where: Base-Base interactions energy: -298.660 where: short stacking energy: -140.367 Base-Backbone interact. energy: -0.941 local terms energy: -177.878680 where: bonds (distance) C4'-P energy: -33.027 bonds (distance) P-C4' energy: -39.127 flat angles C4'-P-C4' energy: -41.052 flat angles P-C4'-P energy: -30.212 tors. eta vs tors. theta energy: -34.460 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -389.555042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.555042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.707578 (E_RNA) where: Base-Base interactions energy: -240.563 where: short stacking energy: -128.978 Base-Backbone interact. energy: -0.939 local terms energy: -148.205594 where: bonds (distance) C4'-P energy: -37.772 bonds (distance) P-C4' energy: -34.744 flat angles C4'-P-C4' energy: -27.438 flat angles P-C4'-P energy: -25.572 tors. eta vs tors. theta energy: -22.679 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -292.186646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.186646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.238766 (E_RNA) where: Base-Base interactions energy: -150.939 where: short stacking energy: -91.193 Base-Backbone interact. energy: -0.349 local terms energy: -140.951238 where: bonds (distance) C4'-P energy: -36.607 bonds (distance) P-C4' energy: -35.008 flat angles C4'-P-C4' energy: -39.310 flat angles P-C4'-P energy: -17.832 tors. eta vs tors. theta energy: -12.194 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -280.490080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.490080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.624113 (E_RNA) where: Base-Base interactions energy: -142.383 where: short stacking energy: -76.343 Base-Backbone interact. energy: 0.263 local terms energy: -138.503715 where: bonds (distance) C4'-P energy: -24.355 bonds (distance) P-C4' energy: -39.601 flat angles C4'-P-C4' energy: -32.411 flat angles P-C4'-P energy: -25.038 tors. eta vs tors. theta energy: -17.099 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -270.507543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.507543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.903181 (E_RNA) where: Base-Base interactions energy: -144.099 where: short stacking energy: -78.826 Base-Backbone interact. energy: 1.449 local terms energy: -128.252617 where: bonds (distance) C4'-P energy: -32.587 bonds (distance) P-C4' energy: -37.175 flat angles C4'-P-C4' energy: -31.877 flat angles P-C4'-P energy: -18.506 tors. eta vs tors. theta energy: -8.108 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -235.554383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.554383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.774093 (E_RNA) where: Base-Base interactions energy: -108.816 where: short stacking energy: -65.849 Base-Backbone interact. energy: -0.596 local terms energy: -127.362254 where: bonds (distance) C4'-P energy: -23.758 bonds (distance) P-C4' energy: -38.027 flat angles C4'-P-C4' energy: -34.328 flat angles P-C4'-P energy: -24.358 tors. eta vs tors. theta energy: -6.891 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -241.460917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.460917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.775829 (E_RNA) where: Base-Base interactions energy: -132.912 where: short stacking energy: -80.337 Base-Backbone interact. energy: -0.308 local terms energy: -108.555836 where: bonds (distance) C4'-P energy: -17.761 bonds (distance) P-C4' energy: -42.105 flat angles C4'-P-C4' energy: -37.916 flat angles P-C4'-P energy: -7.665 tors. eta vs tors. theta energy: -3.109 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -597.187680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.187680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.955363 (E_RNA) where: Base-Base interactions energy: -396.404 where: short stacking energy: -195.068 Base-Backbone interact. energy: -0.530 local terms energy: -203.020778 where: bonds (distance) C4'-P energy: -35.526 bonds (distance) P-C4' energy: -41.184 flat angles C4'-P-C4' energy: -46.238 flat angles P-C4'-P energy: -30.431 tors. eta vs tors. theta energy: -49.642 Dist. restrs. and SS energy: 2.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -553.423760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.423760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.782523 (E_RNA) where: Base-Base interactions energy: -355.058 where: short stacking energy: -155.155 Base-Backbone interact. energy: -1.096 local terms energy: -197.628733 where: bonds (distance) C4'-P energy: -37.110 bonds (distance) P-C4' energy: -42.179 flat angles C4'-P-C4' energy: -45.386 flat angles P-C4'-P energy: -24.698 tors. eta vs tors. theta energy: -48.256 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -476.517840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.517840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.517840 (E_RNA) where: Base-Base interactions energy: -288.508 where: short stacking energy: -168.118 Base-Backbone interact. energy: -0.201 local terms energy: -187.809026 where: bonds (distance) C4'-P energy: -35.454 bonds (distance) P-C4' energy: -36.768 flat angles C4'-P-C4' energy: -45.513 flat angles P-C4'-P energy: -25.120 tors. eta vs tors. theta energy: -44.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -496.464350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.464350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.680313 (E_RNA) where: Base-Base interactions energy: -329.960 where: short stacking energy: -160.151 Base-Backbone interact. energy: -1.103 local terms energy: -165.617354 where: bonds (distance) C4'-P energy: -40.670 bonds (distance) P-C4' energy: -34.445 flat angles C4'-P-C4' energy: -36.744 flat angles P-C4'-P energy: -18.392 tors. eta vs tors. theta energy: -35.367 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -409.119141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.119141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.503175 (E_RNA) where: Base-Base interactions energy: -235.484 where: short stacking energy: -133.908 Base-Backbone interact. energy: -0.274 local terms energy: -173.744868 where: bonds (distance) C4'-P energy: -39.727 bonds (distance) P-C4' energy: -39.543 flat angles C4'-P-C4' energy: -35.792 flat angles P-C4'-P energy: -25.517 tors. eta vs tors. theta energy: -33.165 Dist. restrs. and SS energy: 0.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -301.128600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.128600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.490988 (E_RNA) where: Base-Base interactions energy: -156.033 where: short stacking energy: -99.627 Base-Backbone interact. energy: -0.895 local terms energy: -144.563335 where: bonds (distance) C4'-P energy: -33.482 bonds (distance) P-C4' energy: -27.182 flat angles C4'-P-C4' energy: -41.486 flat angles P-C4'-P energy: -20.716 tors. eta vs tors. theta energy: -21.697 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -289.949345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.949345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.059000 (E_RNA) where: Base-Base interactions energy: -153.391 where: short stacking energy: -79.664 Base-Backbone interact. energy: -0.431 local terms energy: -136.236917 where: bonds (distance) C4'-P energy: -34.321 bonds (distance) P-C4' energy: -38.899 flat angles C4'-P-C4' energy: -37.653 flat angles P-C4'-P energy: -20.494 tors. eta vs tors. theta energy: -4.871 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -245.663160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.663160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.973914 (E_RNA) where: Base-Base interactions energy: -113.236 where: short stacking energy: -70.144 Base-Backbone interact. energy: 1.292 local terms energy: -135.030121 where: bonds (distance) C4'-P energy: -25.937 bonds (distance) P-C4' energy: -39.440 flat angles C4'-P-C4' energy: -38.344 flat angles P-C4'-P energy: -27.082 tors. eta vs tors. theta energy: -4.226 Dist. restrs. and SS energy: 1.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -267.668913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.668913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.876772 (E_RNA) where: Base-Base interactions energy: -135.308 where: short stacking energy: -76.391 Base-Backbone interact. energy: 0.051 local terms energy: -132.619956 where: bonds (distance) C4'-P energy: -34.417 bonds (distance) P-C4' energy: -29.255 flat angles C4'-P-C4' energy: -34.756 flat angles P-C4'-P energy: -24.279 tors. eta vs tors. theta energy: -9.914 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -207.350487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.350487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.104399 (E_RNA) where: Base-Base interactions energy: -82.387 where: short stacking energy: -64.926 Base-Backbone interact. energy: -0.468 local terms energy: -129.249230 where: bonds (distance) C4'-P energy: -27.996 bonds (distance) P-C4' energy: -33.637 flat angles C4'-P-C4' energy: -28.222 flat angles P-C4'-P energy: -28.453 tors. eta vs tors. theta energy: -10.941 Dist. restrs. and SS energy: 4.754 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -585.077782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.077782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.194897 (E_RNA) where: Base-Base interactions energy: -383.586 where: short stacking energy: -181.234 Base-Backbone interact. energy: 1.126 local terms energy: -204.735251 where: bonds (distance) C4'-P energy: -38.798 bonds (distance) P-C4' energy: -44.711 flat angles C4'-P-C4' energy: -40.423 flat angles P-C4'-P energy: -31.414 tors. eta vs tors. theta energy: -49.389 Dist. restrs. and SS energy: 2.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -556.674324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.674324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.753084 (E_RNA) where: Base-Base interactions energy: -354.350 where: short stacking energy: -164.776 Base-Backbone interact. energy: -1.494 local terms energy: -200.909403 where: bonds (distance) C4'-P energy: -39.015 bonds (distance) P-C4' energy: -42.747 flat angles C4'-P-C4' energy: -40.118 flat angles P-C4'-P energy: -32.459 tors. eta vs tors. theta energy: -46.569 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -556.405770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.405770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.425847 (E_RNA) where: Base-Base interactions energy: -364.157 where: short stacking energy: -167.888 Base-Backbone interact. energy: -0.548 local terms energy: -191.721716 where: bonds (distance) C4'-P energy: -40.880 bonds (distance) P-C4' energy: -39.013 flat angles C4'-P-C4' energy: -43.347 flat angles P-C4'-P energy: -19.916 tors. eta vs tors. theta energy: -48.566 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -459.896066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.896066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.148689 (E_RNA) where: Base-Base interactions energy: -271.455 where: short stacking energy: -143.728 Base-Backbone interact. energy: -0.267 local terms energy: -188.426741 where: bonds (distance) C4'-P energy: -42.153 bonds (distance) P-C4' energy: -42.178 flat angles C4'-P-C4' energy: -43.083 flat angles P-C4'-P energy: -28.666 tors. eta vs tors. theta energy: -32.346 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -427.069081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.069081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.128028 (E_RNA) where: Base-Base interactions energy: -270.327 where: short stacking energy: -132.047 Base-Backbone interact. energy: 0.465 local terms energy: -157.265779 where: bonds (distance) C4'-P energy: -32.735 bonds (distance) P-C4' energy: -34.616 flat angles C4'-P-C4' energy: -34.844 flat angles P-C4'-P energy: -25.799 tors. eta vs tors. theta energy: -29.272 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -290.242301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.242301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.521332 (E_RNA) where: Base-Base interactions energy: -147.950 where: short stacking energy: -90.477 Base-Backbone interact. energy: 0.113 local terms energy: -142.684533 where: bonds (distance) C4'-P energy: -36.996 bonds (distance) P-C4' energy: -40.285 flat angles C4'-P-C4' energy: -29.890 flat angles P-C4'-P energy: -18.263 tors. eta vs tors. theta energy: -17.251 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -307.728255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.728255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.728255 (E_RNA) where: Base-Base interactions energy: -163.814 where: short stacking energy: -107.787 Base-Backbone interact. energy: -0.773 local terms energy: -143.141050 where: bonds (distance) C4'-P energy: -35.224 bonds (distance) P-C4' energy: -39.478 flat angles C4'-P-C4' energy: -28.759 flat angles P-C4'-P energy: -18.153 tors. eta vs tors. theta energy: -21.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -233.440246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.440246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.969279 (E_RNA) where: Base-Base interactions energy: -122.796 where: short stacking energy: -74.774 Base-Backbone interact. energy: 0.850 local terms energy: -115.024013 where: bonds (distance) C4'-P energy: -30.586 bonds (distance) P-C4' energy: -33.547 flat angles C4'-P-C4' energy: -26.679 flat angles P-C4'-P energy: -21.252 tors. eta vs tors. theta energy: -2.959 Dist. restrs. and SS energy: 3.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -254.972429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.972429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.139808 (E_RNA) where: Base-Base interactions energy: -126.456 where: short stacking energy: -69.364 Base-Backbone interact. energy: 1.193 local terms energy: -129.877165 where: bonds (distance) C4'-P energy: -31.340 bonds (distance) P-C4' energy: -35.911 flat angles C4'-P-C4' energy: -34.379 flat angles P-C4'-P energy: -24.329 tors. eta vs tors. theta energy: -3.918 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -238.027383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.027383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.207666 (E_RNA) where: Base-Base interactions energy: -120.697 where: short stacking energy: -69.795 Base-Backbone interact. energy: -0.713 local terms energy: -116.797762 where: bonds (distance) C4'-P energy: -28.952 bonds (distance) P-C4' energy: -34.502 flat angles C4'-P-C4' energy: -31.630 flat angles P-C4'-P energy: -19.695 tors. eta vs tors. theta energy: -2.018 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -584.271393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.271393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.026223 (E_RNA) where: Base-Base interactions energy: -377.221 where: short stacking energy: -185.669 Base-Backbone interact. energy: -0.647 local terms energy: -209.158383 where: bonds (distance) C4'-P energy: -40.040 bonds (distance) P-C4' energy: -42.537 flat angles C4'-P-C4' energy: -44.374 flat angles P-C4'-P energy: -33.918 tors. eta vs tors. theta energy: -48.289 Dist. restrs. and SS energy: 2.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -571.011769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.011769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.017825 (E_RNA) where: Base-Base interactions energy: -376.459 where: short stacking energy: -174.074 Base-Backbone interact. energy: 0.657 local terms energy: -195.215706 where: bonds (distance) C4'-P energy: -36.367 bonds (distance) P-C4' energy: -45.514 flat angles C4'-P-C4' energy: -38.571 flat angles P-C4'-P energy: -23.746 tors. eta vs tors. theta energy: -51.018 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -550.344506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.344506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.363656 (E_RNA) where: Base-Base interactions energy: -378.970 where: short stacking energy: -173.906 Base-Backbone interact. energy: -0.677 local terms energy: -170.717262 where: bonds (distance) C4'-P energy: -33.762 bonds (distance) P-C4' energy: -34.881 flat angles C4'-P-C4' energy: -38.372 flat angles P-C4'-P energy: -16.417 tors. eta vs tors. theta energy: -47.285 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -459.133985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.133985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.776332 (E_RNA) where: Base-Base interactions energy: -278.554 where: short stacking energy: -142.714 Base-Backbone interact. energy: -0.921 local terms energy: -180.301747 where: bonds (distance) C4'-P energy: -27.699 bonds (distance) P-C4' energy: -42.996 flat angles C4'-P-C4' energy: -41.149 flat angles P-C4'-P energy: -21.514 tors. eta vs tors. theta energy: -46.943 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -439.600616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.600616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.600616 (E_RNA) where: Base-Base interactions energy: -266.868 where: short stacking energy: -141.789 Base-Backbone interact. energy: -0.397 local terms energy: -172.336355 where: bonds (distance) C4'-P energy: -35.362 bonds (distance) P-C4' energy: -36.912 flat angles C4'-P-C4' energy: -34.073 flat angles P-C4'-P energy: -29.358 tors. eta vs tors. theta energy: -36.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -316.706587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.706587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.772565 (E_RNA) where: Base-Base interactions energy: -167.631 where: short stacking energy: -91.429 Base-Backbone interact. energy: -0.660 local terms energy: -148.481970 where: bonds (distance) C4'-P energy: -41.852 bonds (distance) P-C4' energy: -45.458 flat angles C4'-P-C4' energy: -28.901 flat angles P-C4'-P energy: -20.975 tors. eta vs tors. theta energy: -11.296 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -263.081445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.081445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.482209 (E_RNA) where: Base-Base interactions energy: -116.279 where: short stacking energy: -70.982 Base-Backbone interact. energy: 0.065 local terms energy: -147.268198 where: bonds (distance) C4'-P energy: -41.583 bonds (distance) P-C4' energy: -40.348 flat angles C4'-P-C4' energy: -37.119 flat angles P-C4'-P energy: -18.991 tors. eta vs tors. theta energy: -9.227 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -246.783310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.783310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.189690 (E_RNA) where: Base-Base interactions energy: -125.383 where: short stacking energy: -70.665 Base-Backbone interact. energy: 0.989 local terms energy: -122.795770 where: bonds (distance) C4'-P energy: -33.305 bonds (distance) P-C4' energy: -43.235 flat angles C4'-P-C4' energy: -27.115 flat angles P-C4'-P energy: -16.376 tors. eta vs tors. theta energy: -2.765 Dist. restrs. and SS energy: 0.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -211.655272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.655272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.731017 (E_RNA) where: Base-Base interactions energy: -97.042 where: short stacking energy: -36.723 Base-Backbone interact. energy: 1.049 local terms energy: -115.738501 where: bonds (distance) C4'-P energy: -28.508 bonds (distance) P-C4' energy: -38.898 flat angles C4'-P-C4' energy: -31.258 flat angles P-C4'-P energy: -23.414 tors. eta vs tors. theta energy: 6.340 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -211.121735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.121735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.645166 (E_RNA) where: Base-Base interactions energy: -84.985 where: short stacking energy: -49.096 Base-Backbone interact. energy: -1.121 local terms energy: -129.539135 where: bonds (distance) C4'-P energy: -28.569 bonds (distance) P-C4' energy: -36.322 flat angles C4'-P-C4' energy: -35.714 flat angles P-C4'-P energy: -24.694 tors. eta vs tors. theta energy: -4.240 Dist. restrs. and SS energy: 4.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -592.093478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.093478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.886417 (E_RNA) where: Base-Base interactions energy: -380.311 where: short stacking energy: -187.181 Base-Backbone interact. energy: -1.375 local terms energy: -212.200220 where: bonds (distance) C4'-P energy: -41.632 bonds (distance) P-C4' energy: -40.433 flat angles C4'-P-C4' energy: -40.582 flat angles P-C4'-P energy: -36.761 tors. eta vs tors. theta energy: -52.792 Dist. restrs. and SS energy: 1.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -558.248051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.248051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.289379 (E_RNA) where: Base-Base interactions energy: -371.645 where: short stacking energy: -169.311 Base-Backbone interact. energy: 0.783 local terms energy: -187.427342 where: bonds (distance) C4'-P energy: -39.762 bonds (distance) P-C4' energy: -42.325 flat angles C4'-P-C4' energy: -30.861 flat angles P-C4'-P energy: -29.476 tors. eta vs tors. theta energy: -45.003 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -498.234011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.234011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.419317 (E_RNA) where: Base-Base interactions energy: -313.292 where: short stacking energy: -160.423 Base-Backbone interact. energy: -0.423 local terms energy: -184.703895 where: bonds (distance) C4'-P energy: -37.473 bonds (distance) P-C4' energy: -45.364 flat angles C4'-P-C4' energy: -39.116 flat angles P-C4'-P energy: -18.441 tors. eta vs tors. theta energy: -44.309 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -448.792535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.792535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.836130 (E_RNA) where: Base-Base interactions energy: -275.481 where: short stacking energy: -139.646 Base-Backbone interact. energy: -0.419 local terms energy: -172.936518 where: bonds (distance) C4'-P energy: -25.255 bonds (distance) P-C4' energy: -39.233 flat angles C4'-P-C4' energy: -40.735 flat angles P-C4'-P energy: -29.108 tors. eta vs tors. theta energy: -38.605 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -444.252756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.252756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.252756 (E_RNA) where: Base-Base interactions energy: -272.250 where: short stacking energy: -141.498 Base-Backbone interact. energy: -0.694 local terms energy: -171.309020 where: bonds (distance) C4'-P energy: -43.877 bonds (distance) P-C4' energy: -30.650 flat angles C4'-P-C4' energy: -34.426 flat angles P-C4'-P energy: -21.609 tors. eta vs tors. theta energy: -40.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -313.307645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.307645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.337525 (E_RNA) where: Base-Base interactions energy: -161.285 where: short stacking energy: -106.953 Base-Backbone interact. energy: 1.270 local terms energy: -153.322693 where: bonds (distance) C4'-P energy: -39.409 bonds (distance) P-C4' energy: -33.742 flat angles C4'-P-C4' energy: -40.083 flat angles P-C4'-P energy: -20.719 tors. eta vs tors. theta energy: -19.369 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -281.248647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.248647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.640940 (E_RNA) where: Base-Base interactions energy: -140.806 where: short stacking energy: -91.271 Base-Backbone interact. energy: -0.477 local terms energy: -140.357685 where: bonds (distance) C4'-P energy: -32.654 bonds (distance) P-C4' energy: -39.719 flat angles C4'-P-C4' energy: -31.321 flat angles P-C4'-P energy: -23.702 tors. eta vs tors. theta energy: -12.963 Dist. restrs. and SS energy: 0.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -278.108623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.108623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.177206 (E_RNA) where: Base-Base interactions energy: -143.462 where: short stacking energy: -87.359 Base-Backbone interact. energy: -0.886 local terms energy: -133.828884 where: bonds (distance) C4'-P energy: -30.255 bonds (distance) P-C4' energy: -36.492 flat angles C4'-P-C4' energy: -32.797 flat angles P-C4'-P energy: -24.523 tors. eta vs tors. theta energy: -9.762 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -249.147918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.147918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.506174 (E_RNA) where: Base-Base interactions energy: -134.934 where: short stacking energy: -80.731 Base-Backbone interact. energy: -0.341 local terms energy: -114.231254 where: bonds (distance) C4'-P energy: -28.918 bonds (distance) P-C4' energy: -26.500 flat angles C4'-P-C4' energy: -31.699 flat angles P-C4'-P energy: -24.599 tors. eta vs tors. theta energy: -2.515 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -209.523476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.523476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.951321 (E_RNA) where: Base-Base interactions energy: -94.596 where: short stacking energy: -52.182 Base-Backbone interact. energy: -1.233 local terms energy: -119.123163 where: bonds (distance) C4'-P energy: -34.634 bonds (distance) P-C4' energy: -34.759 flat angles C4'-P-C4' energy: -34.865 flat angles P-C4'-P energy: -18.045 tors. eta vs tors. theta energy: 3.179 Dist. restrs. and SS energy: 5.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -596.930126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.930126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.224693 (E_RNA) where: Base-Base interactions energy: -399.726 where: short stacking energy: -194.007 Base-Backbone interact. energy: -0.096 local terms energy: -199.403073 where: bonds (distance) C4'-P energy: -31.655 bonds (distance) P-C4' energy: -35.752 flat angles C4'-P-C4' energy: -44.480 flat angles P-C4'-P energy: -30.416 tors. eta vs tors. theta energy: -57.101 Dist. restrs. and SS energy: 2.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -567.279306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.279306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.317485 (E_RNA) where: Base-Base interactions energy: -375.026 where: short stacking energy: -165.845 Base-Backbone interact. energy: -1.797 local terms energy: -190.494809 where: bonds (distance) C4'-P energy: -42.279 bonds (distance) P-C4' energy: -40.316 flat angles C4'-P-C4' energy: -40.736 flat angles P-C4'-P energy: -24.043 tors. eta vs tors. theta energy: -43.121 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -480.549236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.549236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.564462 (E_RNA) where: Base-Base interactions energy: -299.153 where: short stacking energy: -144.982 Base-Backbone interact. energy: 1.163 local terms energy: -182.574914 where: bonds (distance) C4'-P energy: -41.987 bonds (distance) P-C4' energy: -34.667 flat angles C4'-P-C4' energy: -43.291 flat angles P-C4'-P energy: -25.398 tors. eta vs tors. theta energy: -37.232 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -425.207304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.207304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.215586 (E_RNA) where: Base-Base interactions energy: -255.225 where: short stacking energy: -129.493 Base-Backbone interact. energy: -0.760 local terms energy: -169.230542 where: bonds (distance) C4'-P energy: -40.096 bonds (distance) P-C4' energy: -36.941 flat angles C4'-P-C4' energy: -42.028 flat angles P-C4'-P energy: -28.187 tors. eta vs tors. theta energy: -21.978 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -450.797591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.797591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.867365 (E_RNA) where: Base-Base interactions energy: -283.836 where: short stacking energy: -159.547 Base-Backbone interact. energy: -0.458 local terms energy: -166.573598 where: bonds (distance) C4'-P energy: -33.158 bonds (distance) P-C4' energy: -37.227 flat angles C4'-P-C4' energy: -33.859 flat angles P-C4'-P energy: -23.344 tors. eta vs tors. theta energy: -38.986 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -310.022275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.022275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.116324 (E_RNA) where: Base-Base interactions energy: -171.050 where: short stacking energy: -103.113 Base-Backbone interact. energy: -0.249 local terms energy: -138.817971 where: bonds (distance) C4'-P energy: -36.903 bonds (distance) P-C4' energy: -40.881 flat angles C4'-P-C4' energy: -29.784 flat angles P-C4'-P energy: -19.807 tors. eta vs tors. theta energy: -11.443 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -250.491327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.491327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.747361 (E_RNA) where: Base-Base interactions energy: -118.101 where: short stacking energy: -67.275 Base-Backbone interact. energy: -0.477 local terms energy: -135.169170 where: bonds (distance) C4'-P energy: -37.701 bonds (distance) P-C4' energy: -34.494 flat angles C4'-P-C4' energy: -32.658 flat angles P-C4'-P energy: -22.521 tors. eta vs tors. theta energy: -7.794 Dist. restrs. and SS energy: 3.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -263.487346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.487346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.638528 (E_RNA) where: Base-Base interactions energy: -153.276 where: short stacking energy: -75.682 Base-Backbone interact. energy: 0.057 local terms energy: -110.419666 where: bonds (distance) C4'-P energy: -24.021 bonds (distance) P-C4' energy: -33.675 flat angles C4'-P-C4' energy: -34.125 flat angles P-C4'-P energy: -15.511 tors. eta vs tors. theta energy: -3.088 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -257.208830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.208830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.606378 (E_RNA) where: Base-Base interactions energy: -139.913 where: short stacking energy: -81.628 Base-Backbone interact. energy: -1.138 local terms energy: -116.555715 where: bonds (distance) C4'-P energy: -25.986 bonds (distance) P-C4' energy: -27.222 flat angles C4'-P-C4' energy: -37.685 flat angles P-C4'-P energy: -16.491 tors. eta vs tors. theta energy: -9.172 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -229.819480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.819480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.066980 (E_RNA) where: Base-Base interactions energy: -133.053 where: short stacking energy: -76.932 Base-Backbone interact. energy: 1.386 local terms energy: -102.399825 where: bonds (distance) C4'-P energy: -36.978 bonds (distance) P-C4' energy: -32.563 flat angles C4'-P-C4' energy: -23.134 flat angles P-C4'-P energy: -7.890 tors. eta vs tors. theta energy: -1.836 Dist. restrs. and SS energy: 4.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -569.405981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.405981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.971323 (E_RNA) where: Base-Base interactions energy: -375.602 where: short stacking energy: -184.066 Base-Backbone interact. energy: 0.396 local terms energy: -195.765580 where: bonds (distance) C4'-P energy: -32.337 bonds (distance) P-C4' energy: -39.359 flat angles C4'-P-C4' energy: -44.260 flat angles P-C4'-P energy: -27.097 tors. eta vs tors. theta energy: -52.712 Dist. restrs. and SS energy: 1.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -566.926174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.926174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.926174 (E_RNA) where: Base-Base interactions energy: -363.068 where: short stacking energy: -172.226 Base-Backbone interact. energy: -2.232 local terms energy: -201.626339 where: bonds (distance) C4'-P energy: -39.223 bonds (distance) P-C4' energy: -42.435 flat angles C4'-P-C4' energy: -40.620 flat angles P-C4'-P energy: -29.336 tors. eta vs tors. theta energy: -50.012 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -498.757680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.757680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.810139 (E_RNA) where: Base-Base interactions energy: -320.914 where: short stacking energy: -159.188 Base-Backbone interact. energy: -0.136 local terms energy: -177.760031 where: bonds (distance) C4'-P energy: -36.776 bonds (distance) P-C4' energy: -40.042 flat angles C4'-P-C4' energy: -39.329 flat angles P-C4'-P energy: -19.928 tors. eta vs tors. theta energy: -41.685 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -428.459059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.459059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.471589 (E_RNA) where: Base-Base interactions energy: -256.787 where: short stacking energy: -129.212 Base-Backbone interact. energy: -0.943 local terms energy: -170.741351 where: bonds (distance) C4'-P energy: -32.958 bonds (distance) P-C4' energy: -36.423 flat angles C4'-P-C4' energy: -48.044 flat angles P-C4'-P energy: -22.199 tors. eta vs tors. theta energy: -31.117 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -431.452486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.452486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.706366 (E_RNA) where: Base-Base interactions energy: -255.276 where: short stacking energy: -138.478 Base-Backbone interact. energy: -0.188 local terms energy: -176.242124 where: bonds (distance) C4'-P energy: -41.272 bonds (distance) P-C4' energy: -31.426 flat angles C4'-P-C4' energy: -35.325 flat angles P-C4'-P energy: -33.471 tors. eta vs tors. theta energy: -34.749 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -308.496144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.496144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.793275 (E_RNA) where: Base-Base interactions energy: -172.745 where: short stacking energy: -93.848 Base-Backbone interact. energy: -0.458 local terms energy: -135.590107 where: bonds (distance) C4'-P energy: -37.638 bonds (distance) P-C4' energy: -35.796 flat angles C4'-P-C4' energy: -33.965 flat angles P-C4'-P energy: -19.053 tors. eta vs tors. theta energy: -9.138 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -294.297209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.297209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.039329 (E_RNA) where: Base-Base interactions energy: -148.843 where: short stacking energy: -95.717 Base-Backbone interact. energy: 0.182 local terms energy: -146.378038 where: bonds (distance) C4'-P energy: -40.858 bonds (distance) P-C4' energy: -33.512 flat angles C4'-P-C4' energy: -34.019 flat angles P-C4'-P energy: -20.404 tors. eta vs tors. theta energy: -17.586 Dist. restrs. and SS energy: 0.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -276.331969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.331969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.331969 (E_RNA) where: Base-Base interactions energy: -149.198 where: short stacking energy: -79.235 Base-Backbone interact. energy: 2.499 local terms energy: -129.632382 where: bonds (distance) C4'-P energy: -27.134 bonds (distance) P-C4' energy: -39.156 flat angles C4'-P-C4' energy: -32.557 flat angles P-C4'-P energy: -20.986 tors. eta vs tors. theta energy: -9.800 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -251.767838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.767838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.767838 (E_RNA) where: Base-Base interactions energy: -143.725 where: short stacking energy: -87.533 Base-Backbone interact. energy: 1.233 local terms energy: -109.275550 where: bonds (distance) C4'-P energy: -23.770 bonds (distance) P-C4' energy: -33.870 flat angles C4'-P-C4' energy: -30.125 flat angles P-C4'-P energy: -14.436 tors. eta vs tors. theta energy: -7.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -234.583905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.583905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.583905 (E_RNA) where: Base-Base interactions energy: -124.455 where: short stacking energy: -80.232 Base-Backbone interact. energy: -0.955 local terms energy: -109.174866 where: bonds (distance) C4'-P energy: -23.732 bonds (distance) P-C4' energy: -32.953 flat angles C4'-P-C4' energy: -35.210 flat angles P-C4'-P energy: -10.968 tors. eta vs tors. theta energy: -6.313 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -565.084614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.084614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.181061 (E_RNA) where: Base-Base interactions energy: -377.799 where: short stacking energy: -178.132 Base-Backbone interact. energy: 0.617 local terms energy: -190.999811 where: bonds (distance) C4'-P energy: -34.240 bonds (distance) P-C4' energy: -42.747 flat angles C4'-P-C4' energy: -40.479 flat angles P-C4'-P energy: -24.765 tors. eta vs tors. theta energy: -48.769 Dist. restrs. and SS energy: 3.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -562.178151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.178151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.292259 (E_RNA) where: Base-Base interactions energy: -367.187 where: short stacking energy: -167.712 Base-Backbone interact. energy: -2.418 local terms energy: -192.687341 where: bonds (distance) C4'-P energy: -38.286 bonds (distance) P-C4' energy: -35.460 flat angles C4'-P-C4' energy: -44.243 flat angles P-C4'-P energy: -27.324 tors. eta vs tors. theta energy: -47.375 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -496.181626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.181626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.184600 (E_RNA) where: Base-Base interactions energy: -322.142 where: short stacking energy: -161.032 Base-Backbone interact. energy: -0.340 local terms energy: -173.702224 where: bonds (distance) C4'-P energy: -37.358 bonds (distance) P-C4' energy: -38.276 flat angles C4'-P-C4' energy: -42.480 flat angles P-C4'-P energy: -18.704 tors. eta vs tors. theta energy: -36.884 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -423.734802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.734802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.734802 (E_RNA) where: Base-Base interactions energy: -250.865 where: short stacking energy: -115.340 Base-Backbone interact. energy: -0.572 local terms energy: -172.297592 where: bonds (distance) C4'-P energy: -31.477 bonds (distance) P-C4' energy: -44.951 flat angles C4'-P-C4' energy: -38.531 flat angles P-C4'-P energy: -26.896 tors. eta vs tors. theta energy: -30.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -377.444706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.444706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.737055 (E_RNA) where: Base-Base interactions energy: -212.242 where: short stacking energy: -113.778 Base-Backbone interact. energy: -1.832 local terms energy: -163.662346 where: bonds (distance) C4'-P energy: -40.992 bonds (distance) P-C4' energy: -37.155 flat angles C4'-P-C4' energy: -30.675 flat angles P-C4'-P energy: -26.556 tors. eta vs tors. theta energy: -28.285 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -303.319519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.319519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.437017 (E_RNA) where: Base-Base interactions energy: -163.845 where: short stacking energy: -82.243 Base-Backbone interact. energy: 0.344 local terms energy: -139.936368 where: bonds (distance) C4'-P energy: -40.498 bonds (distance) P-C4' energy: -39.913 flat angles C4'-P-C4' energy: -39.794 flat angles P-C4'-P energy: -12.340 tors. eta vs tors. theta energy: -7.392 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -250.957436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.957436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.348982 (E_RNA) where: Base-Base interactions energy: -130.185 where: short stacking energy: -77.279 Base-Backbone interact. energy: 1.672 local terms energy: -125.835115 where: bonds (distance) C4'-P energy: -32.070 bonds (distance) P-C4' energy: -35.140 flat angles C4'-P-C4' energy: -31.589 flat angles P-C4'-P energy: -18.795 tors. eta vs tors. theta energy: -8.241 Dist. restrs. and SS energy: 3.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -254.134394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.134394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.181685 (E_RNA) where: Base-Base interactions energy: -140.913 where: short stacking energy: -74.738 Base-Backbone interact. energy: -1.110 local terms energy: -112.158037 where: bonds (distance) C4'-P energy: -33.582 bonds (distance) P-C4' energy: -32.319 flat angles C4'-P-C4' energy: -27.719 flat angles P-C4'-P energy: -9.807 tors. eta vs tors. theta energy: -8.731 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -266.626682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.626682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.772713 (E_RNA) where: Base-Base interactions energy: -120.184 where: short stacking energy: -72.104 Base-Backbone interact. energy: 1.161 local terms energy: -147.749662 where: bonds (distance) C4'-P energy: -39.303 bonds (distance) P-C4' energy: -36.388 flat angles C4'-P-C4' energy: -38.415 flat angles P-C4'-P energy: -20.238 tors. eta vs tors. theta energy: -13.407 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -206.181409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.181409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.537595 (E_RNA) where: Base-Base interactions energy: -95.070 where: short stacking energy: -62.900 Base-Backbone interact. energy: -1.032 local terms energy: -112.435528 where: bonds (distance) C4'-P energy: -27.697 bonds (distance) P-C4' energy: -28.418 flat angles C4'-P-C4' energy: -27.820 flat angles P-C4'-P energy: -24.806 tors. eta vs tors. theta energy: -3.695 Dist. restrs. and SS energy: 2.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -573.661809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.661809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.908029 (E_RNA) where: Base-Base interactions energy: -379.691 where: short stacking energy: -185.192 Base-Backbone interact. energy: -0.322 local terms energy: -196.895022 where: bonds (distance) C4'-P energy: -38.838 bonds (distance) P-C4' energy: -40.084 flat angles C4'-P-C4' energy: -46.239 flat angles P-C4'-P energy: -25.679 tors. eta vs tors. theta energy: -46.054 Dist. restrs. and SS energy: 3.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -573.810764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.810764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.146759 (E_RNA) where: Base-Base interactions energy: -372.394 where: short stacking energy: -165.106 Base-Backbone interact. energy: -1.316 local terms energy: -200.437098 where: bonds (distance) C4'-P energy: -40.349 bonds (distance) P-C4' energy: -41.484 flat angles C4'-P-C4' energy: -42.045 flat angles P-C4'-P energy: -31.156 tors. eta vs tors. theta energy: -45.403 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -497.205565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.205565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.236088 (E_RNA) where: Base-Base interactions energy: -311.013 where: short stacking energy: -161.338 Base-Backbone interact. energy: -0.446 local terms energy: -185.776871 where: bonds (distance) C4'-P energy: -46.272 bonds (distance) P-C4' energy: -38.106 flat angles C4'-P-C4' energy: -41.097 flat angles P-C4'-P energy: -20.902 tors. eta vs tors. theta energy: -39.399 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -435.370976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.370976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.487409 (E_RNA) where: Base-Base interactions energy: -260.687 where: short stacking energy: -141.661 Base-Backbone interact. energy: -1.221 local terms energy: -173.578984 where: bonds (distance) C4'-P energy: -36.142 bonds (distance) P-C4' energy: -38.618 flat angles C4'-P-C4' energy: -41.153 flat angles P-C4'-P energy: -25.765 tors. eta vs tors. theta energy: -31.902 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -423.355171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.355171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.436613 (E_RNA) where: Base-Base interactions energy: -254.434 where: short stacking energy: -135.474 Base-Backbone interact. energy: -0.743 local terms energy: -168.259286 where: bonds (distance) C4'-P energy: -39.454 bonds (distance) P-C4' energy: -34.151 flat angles C4'-P-C4' energy: -38.819 flat angles P-C4'-P energy: -23.310 tors. eta vs tors. theta energy: -32.526 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -287.620179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.620179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.810258 (E_RNA) where: Base-Base interactions energy: -150.100 where: short stacking energy: -92.885 Base-Backbone interact. energy: 1.207 local terms energy: -138.917048 where: bonds (distance) C4'-P energy: -32.576 bonds (distance) P-C4' energy: -40.027 flat angles C4'-P-C4' energy: -24.735 flat angles P-C4'-P energy: -24.997 tors. eta vs tors. theta energy: -16.582 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -266.711096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.711096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.834615 (E_RNA) where: Base-Base interactions energy: -130.781 where: short stacking energy: -69.768 Base-Backbone interact. energy: -1.007 local terms energy: -135.046786 where: bonds (distance) C4'-P energy: -41.789 bonds (distance) P-C4' energy: -38.690 flat angles C4'-P-C4' energy: -37.249 flat angles P-C4'-P energy: -9.290 tors. eta vs tors. theta energy: -8.029 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -269.306895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.306895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.916936 (E_RNA) where: Base-Base interactions energy: -155.762 where: short stacking energy: -90.542 Base-Backbone interact. energy: -1.435 local terms energy: -113.719955 where: bonds (distance) C4'-P energy: -26.003 bonds (distance) P-C4' energy: -28.530 flat angles C4'-P-C4' energy: -35.741 flat angles P-C4'-P energy: -11.314 tors. eta vs tors. theta energy: -12.132 Dist. restrs. and SS energy: 1.610 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -240.996285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.996285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.924857 (E_RNA) where: Base-Base interactions energy: -122.227 where: short stacking energy: -65.925 Base-Backbone interact. energy: -0.991 local terms energy: -119.705941 where: bonds (distance) C4'-P energy: -33.745 bonds (distance) P-C4' energy: -33.518 flat angles C4'-P-C4' energy: -33.522 flat angles P-C4'-P energy: -22.267 tors. eta vs tors. theta energy: 3.346 Dist. restrs. and SS energy: 1.929 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -213.250544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.250544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.963398 (E_RNA) where: Base-Base interactions energy: -109.479 where: short stacking energy: -70.544 Base-Backbone interact. energy: 1.671 local terms energy: -106.154541 where: bonds (distance) C4'-P energy: -21.323 bonds (distance) P-C4' energy: -23.891 flat angles C4'-P-C4' energy: -35.698 flat angles P-C4'-P energy: -16.391 tors. eta vs tors. theta energy: -8.851 Dist. restrs. and SS energy: 0.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -579.243578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.243578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.759185 (E_RNA) where: Base-Base interactions energy: -382.095 where: short stacking energy: -191.487 Base-Backbone interact. energy: -0.853 local terms energy: -200.811352 where: bonds (distance) C4'-P energy: -39.815 bonds (distance) P-C4' energy: -40.778 flat angles C4'-P-C4' energy: -40.631 flat angles P-C4'-P energy: -28.836 tors. eta vs tors. theta energy: -50.752 Dist. restrs. and SS energy: 4.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -568.067180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.067180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.067180 (E_RNA) where: Base-Base interactions energy: -367.175 where: short stacking energy: -158.301 Base-Backbone interact. energy: -2.534 local terms energy: -198.357932 where: bonds (distance) C4'-P energy: -35.200 bonds (distance) P-C4' energy: -42.529 flat angles C4'-P-C4' energy: -42.917 flat angles P-C4'-P energy: -27.619 tors. eta vs tors. theta energy: -50.094 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -496.483894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.483894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.483894 (E_RNA) where: Base-Base interactions energy: -314.425 where: short stacking energy: -149.479 Base-Backbone interact. energy: 0.219 local terms energy: -182.278534 where: bonds (distance) C4'-P energy: -45.205 bonds (distance) P-C4' energy: -36.608 flat angles C4'-P-C4' energy: -36.325 flat angles P-C4'-P energy: -32.500 tors. eta vs tors. theta energy: -31.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -433.366105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.366105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.480260 (E_RNA) where: Base-Base interactions energy: -277.359 where: short stacking energy: -118.492 Base-Backbone interact. energy: 0.778 local terms energy: -156.899757 where: bonds (distance) C4'-P energy: -35.823 bonds (distance) P-C4' energy: -37.273 flat angles C4'-P-C4' energy: -34.497 flat angles P-C4'-P energy: -22.976 tors. eta vs tors. theta energy: -26.331 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -388.592778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.592778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.732328 (E_RNA) where: Base-Base interactions energy: -231.387 where: short stacking energy: -130.965 Base-Backbone interact. energy: -0.750 local terms energy: -156.595032 where: bonds (distance) C4'-P energy: -34.572 bonds (distance) P-C4' energy: -39.889 flat angles C4'-P-C4' energy: -35.084 flat angles P-C4'-P energy: -16.406 tors. eta vs tors. theta energy: -30.643 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -315.631687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.631687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.641021 (E_RNA) where: Base-Base interactions energy: -175.810 where: short stacking energy: -107.633 Base-Backbone interact. energy: -1.479 local terms energy: -138.351969 where: bonds (distance) C4'-P energy: -29.565 bonds (distance) P-C4' energy: -22.979 flat angles C4'-P-C4' energy: -37.352 flat angles P-C4'-P energy: -27.756 tors. eta vs tors. theta energy: -20.699 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -275.540792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.540792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.674845 (E_RNA) where: Base-Base interactions energy: -145.411 where: short stacking energy: -73.525 Base-Backbone interact. energy: -0.442 local terms energy: -129.821630 where: bonds (distance) C4'-P energy: -33.145 bonds (distance) P-C4' energy: -39.164 flat angles C4'-P-C4' energy: -28.467 flat angles P-C4'-P energy: -22.674 tors. eta vs tors. theta energy: -6.372 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -262.212413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.212413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.687125 (E_RNA) where: Base-Base interactions energy: -127.870 where: short stacking energy: -70.942 Base-Backbone interact. energy: -0.378 local terms energy: -134.438178 where: bonds (distance) C4'-P energy: -33.244 bonds (distance) P-C4' energy: -37.463 flat angles C4'-P-C4' energy: -33.256 flat angles P-C4'-P energy: -24.675 tors. eta vs tors. theta energy: -5.801 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -232.892530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.892530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.083506 (E_RNA) where: Base-Base interactions energy: -125.985 where: short stacking energy: -61.134 Base-Backbone interact. energy: -0.286 local terms energy: -106.812393 where: bonds (distance) C4'-P energy: -25.288 bonds (distance) P-C4' energy: -25.371 flat angles C4'-P-C4' energy: -34.351 flat angles P-C4'-P energy: -18.630 tors. eta vs tors. theta energy: -3.173 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -210.946986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.946986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.561677 (E_RNA) where: Base-Base interactions energy: -95.768 where: short stacking energy: -53.468 Base-Backbone interact. energy: 2.058 local terms energy: -118.851065 where: bonds (distance) C4'-P energy: -31.000 bonds (distance) P-C4' energy: -35.463 flat angles C4'-P-C4' energy: -31.675 flat angles P-C4'-P energy: -22.048 tors. eta vs tors. theta energy: 1.336 Dist. restrs. and SS energy: 1.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -572.934960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.934960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.264627 (E_RNA) where: Base-Base interactions energy: -378.798 where: short stacking energy: -200.468 Base-Backbone interact. energy: 2.294 local terms energy: -199.760385 where: bonds (distance) C4'-P energy: -41.536 bonds (distance) P-C4' energy: -35.008 flat angles C4'-P-C4' energy: -43.557 flat angles P-C4'-P energy: -28.586 tors. eta vs tors. theta energy: -51.073 Dist. restrs. and SS energy: 3.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -568.745973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.745973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.771766 (E_RNA) where: Base-Base interactions energy: -376.260 where: short stacking energy: -165.040 Base-Backbone interact. energy: -0.880 local terms energy: -191.630971 where: bonds (distance) C4'-P energy: -35.972 bonds (distance) P-C4' energy: -39.597 flat angles C4'-P-C4' energy: -42.395 flat angles P-C4'-P energy: -27.663 tors. eta vs tors. theta energy: -46.004 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -500.980425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.980425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.052576 (E_RNA) where: Base-Base interactions energy: -329.020 where: short stacking energy: -151.009 Base-Backbone interact. energy: -0.412 local terms energy: -171.620910 where: bonds (distance) C4'-P energy: -36.739 bonds (distance) P-C4' energy: -42.424 flat angles C4'-P-C4' energy: -38.636 flat angles P-C4'-P energy: -21.315 tors. eta vs tors. theta energy: -32.507 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -430.009346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.009346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.424382 (E_RNA) where: Base-Base interactions energy: -262.175 where: short stacking energy: -137.824 Base-Backbone interact. energy: -0.591 local terms energy: -167.658713 where: bonds (distance) C4'-P energy: -33.327 bonds (distance) P-C4' energy: -40.191 flat angles C4'-P-C4' energy: -36.167 flat angles P-C4'-P energy: -24.207 tors. eta vs tors. theta energy: -33.768 Dist. restrs. and SS energy: 0.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -413.125939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.125939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.203708 (E_RNA) where: Base-Base interactions energy: -253.590 where: short stacking energy: -121.613 Base-Backbone interact. energy: 0.157 local terms energy: -159.770805 where: bonds (distance) C4'-P energy: -40.847 bonds (distance) P-C4' energy: -35.000 flat angles C4'-P-C4' energy: -36.919 flat angles P-C4'-P energy: -20.773 tors. eta vs tors. theta energy: -26.232 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -319.139458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.139458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.255947 (E_RNA) where: Base-Base interactions energy: -172.831 where: short stacking energy: -91.576 Base-Backbone interact. energy: -0.260 local terms energy: -146.165082 where: bonds (distance) C4'-P energy: -33.306 bonds (distance) P-C4' energy: -38.633 flat angles C4'-P-C4' energy: -40.423 flat angles P-C4'-P energy: -14.038 tors. eta vs tors. theta energy: -19.765 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -285.654149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.654149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.842955 (E_RNA) where: Base-Base interactions energy: -147.755 where: short stacking energy: -86.001 Base-Backbone interact. energy: -0.538 local terms energy: -137.550164 where: bonds (distance) C4'-P energy: -33.569 bonds (distance) P-C4' energy: -40.250 flat angles C4'-P-C4' energy: -40.368 flat angles P-C4'-P energy: -9.815 tors. eta vs tors. theta energy: -13.548 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -239.235231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.235231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.821046 (E_RNA) where: Base-Base interactions energy: -120.244 where: short stacking energy: -64.459 Base-Backbone interact. energy: 2.144 local terms energy: -123.720822 where: bonds (distance) C4'-P energy: -38.896 bonds (distance) P-C4' energy: -30.911 flat angles C4'-P-C4' energy: -37.727 flat angles P-C4'-P energy: -21.254 tors. eta vs tors. theta energy: 5.067 Dist. restrs. and SS energy: 2.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -230.517017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.517017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.614681 (E_RNA) where: Base-Base interactions energy: -100.276 where: short stacking energy: -65.336 Base-Backbone interact. energy: 0.344 local terms energy: -133.682305 where: bonds (distance) C4'-P energy: -40.079 bonds (distance) P-C4' energy: -35.622 flat angles C4'-P-C4' energy: -34.240 flat angles P-C4'-P energy: -21.255 tors. eta vs tors. theta energy: -2.487 Dist. restrs. and SS energy: 3.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -212.661152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.661152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.439799 (E_RNA) where: Base-Base interactions energy: -98.548 where: short stacking energy: -53.426 Base-Backbone interact. energy: 1.917 local terms energy: -117.808502 where: bonds (distance) C4'-P energy: -31.003 bonds (distance) P-C4' energy: -30.115 flat angles C4'-P-C4' energy: -33.699 flat angles P-C4'-P energy: -29.382 tors. eta vs tors. theta energy: 6.391 Dist. restrs. and SS energy: 1.779 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -575.702126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.702126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.183542 (E_RNA) where: Base-Base interactions energy: -374.072 where: short stacking energy: -172.944 Base-Backbone interact. energy: -0.478 local terms energy: -207.633231 where: bonds (distance) C4'-P energy: -44.792 bonds (distance) P-C4' energy: -42.994 flat angles C4'-P-C4' energy: -44.831 flat angles P-C4'-P energy: -28.825 tors. eta vs tors. theta energy: -46.192 Dist. restrs. and SS energy: 6.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -562.447382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.447382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.526748 (E_RNA) where: Base-Base interactions energy: -370.032 where: short stacking energy: -169.247 Base-Backbone interact. energy: -2.270 local terms energy: -190.224393 where: bonds (distance) C4'-P energy: -35.543 bonds (distance) P-C4' energy: -36.398 flat angles C4'-P-C4' energy: -43.205 flat angles P-C4'-P energy: -34.196 tors. eta vs tors. theta energy: -40.882 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -508.343918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.343918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.354189 (E_RNA) where: Base-Base interactions energy: -321.707 where: short stacking energy: -164.609 Base-Backbone interact. energy: -0.558 local terms energy: -186.088649 where: bonds (distance) C4'-P energy: -33.363 bonds (distance) P-C4' energy: -41.399 flat angles C4'-P-C4' energy: -39.718 flat angles P-C4'-P energy: -30.088 tors. eta vs tors. theta energy: -41.521 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -424.714650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.714650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.758366 (E_RNA) where: Base-Base interactions energy: -262.553 where: short stacking energy: -136.397 Base-Backbone interact. energy: 1.873 local terms energy: -164.078634 where: bonds (distance) C4'-P energy: -42.736 bonds (distance) P-C4' energy: -39.578 flat angles C4'-P-C4' energy: -30.459 flat angles P-C4'-P energy: -19.483 tors. eta vs tors. theta energy: -31.823 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -425.441767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.441767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.469626 (E_RNA) where: Base-Base interactions energy: -243.648 where: short stacking energy: -113.699 Base-Backbone interact. energy: -0.058 local terms energy: -181.763537 where: bonds (distance) C4'-P energy: -36.710 bonds (distance) P-C4' energy: -42.727 flat angles C4'-P-C4' energy: -34.143 flat angles P-C4'-P energy: -27.673 tors. eta vs tors. theta energy: -40.510 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -307.719946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.719946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.736528 (E_RNA) where: Base-Base interactions energy: -163.981 where: short stacking energy: -113.153 Base-Backbone interact. energy: -0.624 local terms energy: -143.131534 where: bonds (distance) C4'-P energy: -29.121 bonds (distance) P-C4' energy: -31.375 flat angles C4'-P-C4' energy: -41.746 flat angles P-C4'-P energy: -18.250 tors. eta vs tors. theta energy: -22.640 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -311.567613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.567613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.624838 (E_RNA) where: Base-Base interactions energy: -157.945 where: short stacking energy: -107.306 Base-Backbone interact. energy: -1.022 local terms energy: -152.657892 where: bonds (distance) C4'-P energy: -34.806 bonds (distance) P-C4' energy: -31.393 flat angles C4'-P-C4' energy: -32.208 flat angles P-C4'-P energy: -27.674 tors. eta vs tors. theta energy: -26.576 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -274.679671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.679671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.022455 (E_RNA) where: Base-Base interactions energy: -152.386 where: short stacking energy: -89.357 Base-Backbone interact. energy: -0.483 local terms energy: -122.153275 where: bonds (distance) C4'-P energy: -32.339 bonds (distance) P-C4' energy: -31.760 flat angles C4'-P-C4' energy: -34.047 flat angles P-C4'-P energy: -10.490 tors. eta vs tors. theta energy: -13.517 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -214.497914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.497914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.862875 (E_RNA) where: Base-Base interactions energy: -91.825 where: short stacking energy: -51.500 Base-Backbone interact. energy: -0.343 local terms energy: -122.694615 where: bonds (distance) C4'-P energy: -34.128 bonds (distance) P-C4' energy: -38.302 flat angles C4'-P-C4' energy: -31.377 flat angles P-C4'-P energy: -20.710 tors. eta vs tors. theta energy: 1.823 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -256.448193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.448193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.592402 (E_RNA) where: Base-Base interactions energy: -126.946 where: short stacking energy: -73.496 Base-Backbone interact. energy: 1.872 local terms energy: -131.518406 where: bonds (distance) C4'-P energy: -30.250 bonds (distance) P-C4' energy: -38.179 flat angles C4'-P-C4' energy: -33.710 flat angles P-C4'-P energy: -20.918 tors. eta vs tors. theta energy: -8.462 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -565.007967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.007967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.701140 (E_RNA) where: Base-Base interactions energy: -364.441 where: short stacking energy: -181.922 Base-Backbone interact. energy: -0.693 local terms energy: -202.567244 where: bonds (distance) C4'-P energy: -42.101 bonds (distance) P-C4' energy: -44.869 flat angles C4'-P-C4' energy: -42.280 flat angles P-C4'-P energy: -27.811 tors. eta vs tors. theta energy: -45.507 Dist. restrs. and SS energy: 2.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -574.764674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.764674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.764674 (E_RNA) where: Base-Base interactions energy: -373.709 where: short stacking energy: -168.494 Base-Backbone interact. energy: -1.355 local terms energy: -199.700857 where: bonds (distance) C4'-P energy: -37.474 bonds (distance) P-C4' energy: -41.972 flat angles C4'-P-C4' energy: -43.552 flat angles P-C4'-P energy: -23.008 tors. eta vs tors. theta energy: -53.695 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -504.373885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.373885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.406122 (E_RNA) where: Base-Base interactions energy: -309.338 where: short stacking energy: -149.494 Base-Backbone interact. energy: -0.562 local terms energy: -194.507041 where: bonds (distance) C4'-P energy: -39.122 bonds (distance) P-C4' energy: -38.128 flat angles C4'-P-C4' energy: -45.665 flat angles P-C4'-P energy: -30.613 tors. eta vs tors. theta energy: -40.979 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -430.167727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.167727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.167727 (E_RNA) where: Base-Base interactions energy: -262.521 where: short stacking energy: -140.509 Base-Backbone interact. energy: -0.627 local terms energy: -167.019869 where: bonds (distance) C4'-P energy: -36.885 bonds (distance) P-C4' energy: -38.528 flat angles C4'-P-C4' energy: -37.712 flat angles P-C4'-P energy: -25.236 tors. eta vs tors. theta energy: -28.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -439.000444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.000444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.172434 (E_RNA) where: Base-Base interactions energy: -256.562 where: short stacking energy: -128.698 Base-Backbone interact. energy: -0.339 local terms energy: -182.271514 where: bonds (distance) C4'-P energy: -38.551 bonds (distance) P-C4' energy: -35.316 flat angles C4'-P-C4' energy: -37.368 flat angles P-C4'-P energy: -30.127 tors. eta vs tors. theta energy: -40.909 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -311.711869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.711869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.946826 (E_RNA) where: Base-Base interactions energy: -153.627 where: short stacking energy: -96.516 Base-Backbone interact. energy: -0.601 local terms energy: -157.718634 where: bonds (distance) C4'-P energy: -36.342 bonds (distance) P-C4' energy: -41.941 flat angles C4'-P-C4' energy: -37.192 flat angles P-C4'-P energy: -21.832 tors. eta vs tors. theta energy: -20.412 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -317.206744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.206744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.375177 (E_RNA) where: Base-Base interactions energy: -168.326 where: short stacking energy: -78.849 Base-Backbone interact. energy: -0.502 local terms energy: -148.547592 where: bonds (distance) C4'-P energy: -37.806 bonds (distance) P-C4' energy: -40.791 flat angles C4'-P-C4' energy: -28.250 flat angles P-C4'-P energy: -26.869 tors. eta vs tors. theta energy: -14.832 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -238.315526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.315526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.321402 (E_RNA) where: Base-Base interactions energy: -112.676 where: short stacking energy: -70.421 Base-Backbone interact. energy: -0.762 local terms energy: -125.882785 where: bonds (distance) C4'-P energy: -34.956 bonds (distance) P-C4' energy: -32.087 flat angles C4'-P-C4' energy: -28.946 flat angles P-C4'-P energy: -23.243 tors. eta vs tors. theta energy: -6.651 Dist. restrs. and SS energy: 1.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -263.995001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.995001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.127155 (E_RNA) where: Base-Base interactions energy: -135.270 where: short stacking energy: -88.050 Base-Backbone interact. energy: 1.091 local terms energy: -129.948554 where: bonds (distance) C4'-P energy: -35.253 bonds (distance) P-C4' energy: -34.830 flat angles C4'-P-C4' energy: -28.469 flat angles P-C4'-P energy: -18.769 tors. eta vs tors. theta energy: -12.627 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -259.612889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.612889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.785326 (E_RNA) where: Base-Base interactions energy: -145.255 where: short stacking energy: -87.258 Base-Backbone interact. energy: -0.471 local terms energy: -114.059379 where: bonds (distance) C4'-P energy: -18.095 bonds (distance) P-C4' energy: -29.454 flat angles C4'-P-C4' energy: -29.457 flat angles P-C4'-P energy: -20.462 tors. eta vs tors. theta energy: -16.591 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -580.670217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.670217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.658084 (E_RNA) where: Base-Base interactions energy: -378.714 where: short stacking energy: -174.832 Base-Backbone interact. energy: -0.534 local terms energy: -204.410032 where: bonds (distance) C4'-P energy: -36.312 bonds (distance) P-C4' energy: -48.663 flat angles C4'-P-C4' energy: -48.809 flat angles P-C4'-P energy: -23.006 tors. eta vs tors. theta energy: -47.620 Dist. restrs. and SS energy: 2.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -562.457671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.457671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.471193 (E_RNA) where: Base-Base interactions energy: -366.151 where: short stacking energy: -158.639 Base-Backbone interact. energy: -1.466 local terms energy: -194.854696 where: bonds (distance) C4'-P energy: -42.431 bonds (distance) P-C4' energy: -43.786 flat angles C4'-P-C4' energy: -41.078 flat angles P-C4'-P energy: -27.519 tors. eta vs tors. theta energy: -40.041 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -502.960472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.960472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.042515 (E_RNA) where: Base-Base interactions energy: -328.905 where: short stacking energy: -148.039 Base-Backbone interact. energy: -0.067 local terms energy: -174.070542 where: bonds (distance) C4'-P energy: -36.520 bonds (distance) P-C4' energy: -39.833 flat angles C4'-P-C4' energy: -39.650 flat angles P-C4'-P energy: -21.440 tors. eta vs tors. theta energy: -36.627 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -488.379997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.379997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.381047 (E_RNA) where: Base-Base interactions energy: -304.743 where: short stacking energy: -148.167 Base-Backbone interact. energy: -0.683 local terms energy: -182.954806 where: bonds (distance) C4'-P energy: -35.199 bonds (distance) P-C4' energy: -33.473 flat angles C4'-P-C4' energy: -39.364 flat angles P-C4'-P energy: -31.005 tors. eta vs tors. theta energy: -43.915 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -423.959899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.959899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.034452 (E_RNA) where: Base-Base interactions energy: -254.443 where: short stacking energy: -138.428 Base-Backbone interact. energy: -0.527 local terms energy: -169.064672 where: bonds (distance) C4'-P energy: -45.818 bonds (distance) P-C4' energy: -41.597 flat angles C4'-P-C4' energy: -37.566 flat angles P-C4'-P energy: -21.052 tors. eta vs tors. theta energy: -23.031 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -359.569793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.569793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.931541 (E_RNA) where: Base-Base interactions energy: -201.862 where: short stacking energy: -118.151 Base-Backbone interact. energy: -0.910 local terms energy: -157.158895 where: bonds (distance) C4'-P energy: -32.527 bonds (distance) P-C4' energy: -34.385 flat angles C4'-P-C4' energy: -41.741 flat angles P-C4'-P energy: -23.572 tors. eta vs tors. theta energy: -24.934 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -277.467791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.467791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.489658 (E_RNA) where: Base-Base interactions energy: -141.940 where: short stacking energy: -87.450 Base-Backbone interact. energy: 0.338 local terms energy: -135.887227 where: bonds (distance) C4'-P energy: -31.808 bonds (distance) P-C4' energy: -36.244 flat angles C4'-P-C4' energy: -32.668 flat angles P-C4'-P energy: -22.632 tors. eta vs tors. theta energy: -12.535 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -265.451286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.451286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.654631 (E_RNA) where: Base-Base interactions energy: -121.132 where: short stacking energy: -71.579 Base-Backbone interact. energy: -0.422 local terms energy: -145.100812 where: bonds (distance) C4'-P energy: -37.952 bonds (distance) P-C4' energy: -39.370 flat angles C4'-P-C4' energy: -30.807 flat angles P-C4'-P energy: -25.762 tors. eta vs tors. theta energy: -11.210 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -234.056233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.056233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.580152 (E_RNA) where: Base-Base interactions energy: -109.726 where: short stacking energy: -66.699 Base-Backbone interact. energy: -0.985 local terms energy: -125.868851 where: bonds (distance) C4'-P energy: -34.806 bonds (distance) P-C4' energy: -39.736 flat angles C4'-P-C4' energy: -34.936 flat angles P-C4'-P energy: -20.373 tors. eta vs tors. theta energy: 3.983 Dist. restrs. and SS energy: 2.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -224.870690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.870690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.451051 (E_RNA) where: Base-Base interactions energy: -103.530 where: short stacking energy: -56.126 Base-Backbone interact. energy: -0.122 local terms energy: -121.799004 where: bonds (distance) C4'-P energy: -32.666 bonds (distance) P-C4' energy: -32.787 flat angles C4'-P-C4' energy: -34.131 flat angles P-C4'-P energy: -20.944 tors. eta vs tors. theta energy: -1.272 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -573.798389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.798389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.137159 (E_RNA) where: Base-Base interactions energy: -374.070 where: short stacking energy: -180.622 Base-Backbone interact. energy: -0.243 local terms energy: -200.824131 where: bonds (distance) C4'-P energy: -44.123 bonds (distance) P-C4' energy: -37.335 flat angles C4'-P-C4' energy: -37.089 flat angles P-C4'-P energy: -34.253 tors. eta vs tors. theta energy: -48.024 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -559.320113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.320113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.329380 (E_RNA) where: Base-Base interactions energy: -373.211 where: short stacking energy: -165.502 Base-Backbone interact. energy: -3.270 local terms energy: -182.847695 where: bonds (distance) C4'-P energy: -37.494 bonds (distance) P-C4' energy: -28.391 flat angles C4'-P-C4' energy: -40.913 flat angles P-C4'-P energy: -31.228 tors. eta vs tors. theta energy: -44.822 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -504.073067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.073067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.149377 (E_RNA) where: Base-Base interactions energy: -316.748 where: short stacking energy: -165.241 Base-Backbone interact. energy: 0.755 local terms energy: -188.155619 where: bonds (distance) C4'-P energy: -37.373 bonds (distance) P-C4' energy: -39.733 flat angles C4'-P-C4' energy: -43.505 flat angles P-C4'-P energy: -25.485 tors. eta vs tors. theta energy: -42.059 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -469.425126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.425126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.449774 (E_RNA) where: Base-Base interactions energy: -286.222 where: short stacking energy: -150.721 Base-Backbone interact. energy: -0.204 local terms energy: -183.024354 where: bonds (distance) C4'-P energy: -34.287 bonds (distance) P-C4' energy: -42.711 flat angles C4'-P-C4' energy: -46.377 flat angles P-C4'-P energy: -18.193 tors. eta vs tors. theta energy: -41.456 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -412.975326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.975326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.039175 (E_RNA) where: Base-Base interactions energy: -252.410 where: short stacking energy: -135.260 Base-Backbone interact. energy: -1.108 local terms energy: -159.521335 where: bonds (distance) C4'-P energy: -33.019 bonds (distance) P-C4' energy: -33.561 flat angles C4'-P-C4' energy: -41.693 flat angles P-C4'-P energy: -20.086 tors. eta vs tors. theta energy: -31.161 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -351.036058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.036058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.263678 (E_RNA) where: Base-Base interactions energy: -201.170 where: short stacking energy: -108.581 Base-Backbone interact. energy: -1.711 local terms energy: -148.383120 where: bonds (distance) C4'-P energy: -31.940 bonds (distance) P-C4' energy: -36.665 flat angles C4'-P-C4' energy: -39.399 flat angles P-C4'-P energy: -22.149 tors. eta vs tors. theta energy: -18.230 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -277.893974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.893974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.126924 (E_RNA) where: Base-Base interactions energy: -125.395 where: short stacking energy: -72.636 Base-Backbone interact. energy: -0.488 local terms energy: -152.243887 where: bonds (distance) C4'-P energy: -40.541 bonds (distance) P-C4' energy: -44.746 flat angles C4'-P-C4' energy: -37.024 flat angles P-C4'-P energy: -21.548 tors. eta vs tors. theta energy: -8.386 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -276.895447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.895447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.895447 (E_RNA) where: Base-Base interactions energy: -145.326 where: short stacking energy: -88.595 Base-Backbone interact. energy: -0.464 local terms energy: -131.105843 where: bonds (distance) C4'-P energy: -32.619 bonds (distance) P-C4' energy: -34.617 flat angles C4'-P-C4' energy: -38.651 flat angles P-C4'-P energy: -11.122 tors. eta vs tors. theta energy: -14.098 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -237.993013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.993013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.371229 (E_RNA) where: Base-Base interactions energy: -115.508 where: short stacking energy: -78.546 Base-Backbone interact. energy: 0.308 local terms energy: -123.171515 where: bonds (distance) C4'-P energy: -32.289 bonds (distance) P-C4' energy: -29.571 flat angles C4'-P-C4' energy: -27.289 flat angles P-C4'-P energy: -22.408 tors. eta vs tors. theta energy: -11.615 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -225.142663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.142663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.505219 (E_RNA) where: Base-Base interactions energy: -110.107 where: short stacking energy: -63.374 Base-Backbone interact. energy: 1.141 local terms energy: -117.539241 where: bonds (distance) C4'-P energy: -30.026 bonds (distance) P-C4' energy: -32.384 flat angles C4'-P-C4' energy: -27.104 flat angles P-C4'-P energy: -25.524 tors. eta vs tors. theta energy: -2.501 Dist. restrs. and SS energy: 1.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -585.838957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.838957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.120128 (E_RNA) where: Base-Base interactions energy: -384.595 where: short stacking energy: -192.068 Base-Backbone interact. energy: -0.203 local terms energy: -203.322113 where: bonds (distance) C4'-P energy: -35.316 bonds (distance) P-C4' energy: -46.526 flat angles C4'-P-C4' energy: -43.355 flat angles P-C4'-P energy: -24.571 tors. eta vs tors. theta energy: -53.554 Dist. restrs. and SS energy: 2.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -562.223797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.223797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.286003 (E_RNA) where: Base-Base interactions energy: -371.686 where: short stacking energy: -148.836 Base-Backbone interact. energy: -2.089 local terms energy: -188.511477 where: bonds (distance) C4'-P energy: -34.486 bonds (distance) P-C4' energy: -33.883 flat angles C4'-P-C4' energy: -42.708 flat angles P-C4'-P energy: -32.975 tors. eta vs tors. theta energy: -44.460 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -473.248292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.248292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.263431 (E_RNA) where: Base-Base interactions energy: -297.207 where: short stacking energy: -146.109 Base-Backbone interact. energy: -1.027 local terms energy: -175.028757 where: bonds (distance) C4'-P energy: -39.448 bonds (distance) P-C4' energy: -43.462 flat angles C4'-P-C4' energy: -32.097 flat angles P-C4'-P energy: -26.635 tors. eta vs tors. theta energy: -33.386 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -467.857431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.857431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.971164 (E_RNA) where: Base-Base interactions energy: -303.271 where: short stacking energy: -149.580 Base-Backbone interact. energy: -0.129 local terms energy: -164.570779 where: bonds (distance) C4'-P energy: -31.322 bonds (distance) P-C4' energy: -32.503 flat angles C4'-P-C4' energy: -36.486 flat angles P-C4'-P energy: -27.124 tors. eta vs tors. theta energy: -37.136 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -424.938737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.938737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.811895 (E_RNA) where: Base-Base interactions energy: -264.802 where: short stacking energy: -152.365 Base-Backbone interact. energy: 1.337 local terms energy: -164.346834 where: bonds (distance) C4'-P energy: -29.867 bonds (distance) P-C4' energy: -36.004 flat angles C4'-P-C4' energy: -38.967 flat angles P-C4'-P energy: -21.767 tors. eta vs tors. theta energy: -37.742 Dist. restrs. and SS energy: 2.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -343.540092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.540092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.540092 (E_RNA) where: Base-Base interactions energy: -187.737 where: short stacking energy: -95.749 Base-Backbone interact. energy: 1.222 local terms energy: -157.024966 where: bonds (distance) C4'-P energy: -36.514 bonds (distance) P-C4' energy: -30.082 flat angles C4'-P-C4' energy: -37.670 flat angles P-C4'-P energy: -28.877 tors. eta vs tors. theta energy: -23.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -296.271721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.271721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.345645 (E_RNA) where: Base-Base interactions energy: -156.264 where: short stacking energy: -76.835 Base-Backbone interact. energy: -1.630 local terms energy: -138.451437 where: bonds (distance) C4'-P energy: -29.219 bonds (distance) P-C4' energy: -35.732 flat angles C4'-P-C4' energy: -35.690 flat angles P-C4'-P energy: -27.806 tors. eta vs tors. theta energy: -10.005 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -278.233279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.233279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.378411 (E_RNA) where: Base-Base interactions energy: -152.255 where: short stacking energy: -95.561 Base-Backbone interact. energy: -0.504 local terms energy: -125.619974 where: bonds (distance) C4'-P energy: -28.717 bonds (distance) P-C4' energy: -37.139 flat angles C4'-P-C4' energy: -27.598 flat angles P-C4'-P energy: -19.212 tors. eta vs tors. theta energy: -12.954 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -243.315000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.315000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.113896 (E_RNA) where: Base-Base interactions energy: -125.212 where: short stacking energy: -75.791 Base-Backbone interact. energy: -1.677 local terms energy: -118.225367 where: bonds (distance) C4'-P energy: -29.478 bonds (distance) P-C4' energy: -36.080 flat angles C4'-P-C4' energy: -33.746 flat angles P-C4'-P energy: -16.836 tors. eta vs tors. theta energy: -2.085 Dist. restrs. and SS energy: 1.799 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -216.959386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.959386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.446855 (E_RNA) where: Base-Base interactions energy: -107.709 where: short stacking energy: -66.270 Base-Backbone interact. energy: 0.351 local terms energy: -114.089083 where: bonds (distance) C4'-P energy: -30.406 bonds (distance) P-C4' energy: -26.267 flat angles C4'-P-C4' energy: -26.888 flat angles P-C4'-P energy: -20.876 tors. eta vs tors. theta energy: -9.653 Dist. restrs. and SS energy: 4.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 1 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 6670858 moves confirmed later: 7179270 all moves confirmed: 13850128 percent of confirmed moves: 8.656330 current total energy: -545.897119 recalc. total energy: -545.897119 replica 10 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 8958252 moves confirmed later: 10314636 all moves confirmed: 19272888 percent of confirmed moves: 12.045555 current total energy: -506.925257 recalc. total energy: -506.925257 replica 3 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 10468700 moves confirmed later: 12302601 all moves confirmed: 22771301 percent of confirmed moves: 14.232063 current total energy: -386.210116 recalc. total energy: -386.210116 replica 8 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 9047888 moves confirmed later: 10366897 all moves confirmed: 19414785 percent of confirmed moves: 12.134241 current total energy: -392.669331 recalc. total energy: -392.669331 replica 2 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 9711516 moves confirmed later: 11208577 all moves confirmed: 20920093 percent of confirmed moves: 13.075058 current total energy: -368.543695 recalc. total energy: -368.543695 replica 4 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 11367334 moves confirmed later: 13545175 all moves confirmed: 24912509 percent of confirmed moves: 15.570318 current total energy: -259.224752 recalc. total energy: -259.224752 replica 7 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 13057543 moves confirmed later: 15791141 all moves confirmed: 28848684 percent of confirmed moves: 18.030427 current total energy: -224.303466 recalc. total energy: -224.303466 replica 5 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 9833445 moves confirmed later: 11431170 all moves confirmed: 21264615 percent of confirmed moves: 13.290384 current total energy: -171.444177 recalc. total energy: -171.444177 replica 6 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 12758413 moves confirmed later: 15388571 all moves confirmed: 28146984 percent of confirmed moves: 17.591865 current total energy: -186.825942 recalc. total energy: -186.825942 replica 9 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 13182578 moves confirmed later: 15933540 all moves confirmed: 29116118 percent of confirmed moves: 18.197574 current total energy: -159.288220 recalc. total energy: -159.288220 out arg RESULTS//1/Tetraloop_10_steps-95138c1a_01 Time of doing 1600000 iterations: 1529.615 seconds