SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-86350510/inputs/seq.fa: 1 curr_seq: _UGCGAGAGCGAAAAAUUUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGCGAGAGCGAAAAAUUUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 110 n_atoms_counter: 110 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 21.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -80.053211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.053211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.053211 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -78.182437 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -15.419 flat angles P-C4'-P energy: -17.637 tors. eta vs tors. theta energy: -5.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -127.265214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.265214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.265214 (E_RNA) where: Base-Base interactions energy: -67.384 where: short stacking energy: -47.277 Base-Backbone interact. energy: -0.017 local terms energy: -59.864714 where: bonds (distance) C4'-P energy: -15.535 bonds (distance) P-C4' energy: -14.927 flat angles C4'-P-C4' energy: -14.940 flat angles P-C4'-P energy: -5.066 tors. eta vs tors. theta energy: -9.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -127.204093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.204093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.204093 (E_RNA) where: Base-Base interactions energy: -75.099 where: short stacking energy: -38.062 Base-Backbone interact. energy: -0.628 local terms energy: -51.477269 where: bonds (distance) C4'-P energy: -13.117 bonds (distance) P-C4' energy: -12.966 flat angles C4'-P-C4' energy: -9.183 flat angles P-C4'-P energy: -9.513 tors. eta vs tors. theta energy: -6.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -143.594486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.594486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.594486 (E_RNA) where: Base-Base interactions energy: -80.097 where: short stacking energy: -33.144 Base-Backbone interact. energy: -0.984 local terms energy: -62.512856 where: bonds (distance) C4'-P energy: -17.087 bonds (distance) P-C4' energy: -14.663 flat angles C4'-P-C4' energy: -13.947 flat angles P-C4'-P energy: -8.426 tors. eta vs tors. theta energy: -8.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -105.164087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.164087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.164087 (E_RNA) where: Base-Base interactions energy: -46.307 where: short stacking energy: -27.995 Base-Backbone interact. energy: -0.214 local terms energy: -58.643505 where: bonds (distance) C4'-P energy: -6.638 bonds (distance) P-C4' energy: -18.647 flat angles C4'-P-C4' energy: -16.495 flat angles P-C4'-P energy: -11.250 tors. eta vs tors. theta energy: -5.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -104.863203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.863203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.863203 (E_RNA) where: Base-Base interactions energy: -47.339 where: short stacking energy: -32.547 Base-Backbone interact. energy: -0.475 local terms energy: -57.048875 where: bonds (distance) C4'-P energy: -14.269 bonds (distance) P-C4' energy: -14.399 flat angles C4'-P-C4' energy: -13.499 flat angles P-C4'-P energy: -9.738 tors. eta vs tors. theta energy: -5.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -102.497681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.497681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.497681 (E_RNA) where: Base-Base interactions energy: -45.799 where: short stacking energy: -34.502 Base-Backbone interact. energy: -0.199 local terms energy: -56.499213 where: bonds (distance) C4'-P energy: -14.604 bonds (distance) P-C4' energy: -15.261 flat angles C4'-P-C4' energy: -11.906 flat angles P-C4'-P energy: -5.775 tors. eta vs tors. theta energy: -8.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -86.398606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.398606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.398606 (E_RNA) where: Base-Base interactions energy: -32.776 where: short stacking energy: -32.401 Base-Backbone interact. energy: -0.044 local terms energy: -53.578480 where: bonds (distance) C4'-P energy: -13.713 bonds (distance) P-C4' energy: -14.135 flat angles C4'-P-C4' energy: -16.392 flat angles P-C4'-P energy: -6.378 tors. eta vs tors. theta energy: -2.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -91.044899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.044899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.044899 (E_RNA) where: Base-Base interactions energy: -36.072 where: short stacking energy: -25.523 Base-Backbone interact. energy: -0.376 local terms energy: -54.597412 where: bonds (distance) C4'-P energy: -16.661 bonds (distance) P-C4' energy: -13.599 flat angles C4'-P-C4' energy: -18.117 flat angles P-C4'-P energy: -7.158 tors. eta vs tors. theta energy: 0.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -78.937927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.937927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.937927 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -77.067151 where: bonds (distance) C4'-P energy: -20.287 bonds (distance) P-C4' energy: -19.676 flat angles C4'-P-C4' energy: -14.834 flat angles P-C4'-P energy: -17.478 tors. eta vs tors. theta energy: -4.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -78.937927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.937927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.937927 (E_RNA) where: Base-Base interactions energy: -1.871 where: short stacking energy: -1.871 Base-Backbone interact. energy: -0.000 local terms energy: -77.067151 where: bonds (distance) C4'-P energy: -20.287 bonds (distance) P-C4' energy: -19.676 flat angles C4'-P-C4' energy: -14.834 flat angles P-C4'-P energy: -17.478 tors. eta vs tors. theta energy: -4.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -135.255341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.255341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.255341 (E_RNA) where: Base-Base interactions energy: -68.494 where: short stacking energy: -48.640 Base-Backbone interact. energy: -0.433 local terms energy: -66.329153 where: bonds (distance) C4'-P energy: -13.100 bonds (distance) P-C4' energy: -15.524 flat angles C4'-P-C4' energy: -13.286 flat angles P-C4'-P energy: -11.623 tors. eta vs tors. theta energy: -12.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -180.828533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.828533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.828533 (E_RNA) where: Base-Base interactions energy: -113.832 where: short stacking energy: -62.068 Base-Backbone interact. energy: -0.243 local terms energy: -66.753809 where: bonds (distance) C4'-P energy: -9.587 bonds (distance) P-C4' energy: -17.389 flat angles C4'-P-C4' energy: -12.005 flat angles P-C4'-P energy: -11.109 tors. eta vs tors. theta energy: -16.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -163.208203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.208203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.208203 (E_RNA) where: Base-Base interactions energy: -98.187 where: short stacking energy: -48.762 Base-Backbone interact. energy: -0.013 local terms energy: -65.007949 where: bonds (distance) C4'-P energy: -14.815 bonds (distance) P-C4' energy: -12.984 flat angles C4'-P-C4' energy: -16.237 flat angles P-C4'-P energy: -9.652 tors. eta vs tors. theta energy: -11.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -152.054708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.054708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.054708 (E_RNA) where: Base-Base interactions energy: -91.584 where: short stacking energy: -40.817 Base-Backbone interact. energy: -0.212 local terms energy: -60.259159 where: bonds (distance) C4'-P energy: -16.430 bonds (distance) P-C4' energy: -14.610 flat angles C4'-P-C4' energy: -11.562 flat angles P-C4'-P energy: -7.935 tors. eta vs tors. theta energy: -9.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -113.995492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.995492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.995492 (E_RNA) where: Base-Base interactions energy: -61.362 where: short stacking energy: -29.917 Base-Backbone interact. energy: -0.409 local terms energy: -52.224108 where: bonds (distance) C4'-P energy: -16.164 bonds (distance) P-C4' energy: -13.926 flat angles C4'-P-C4' energy: -17.000 flat angles P-C4'-P energy: -5.897 tors. eta vs tors. theta energy: 0.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -122.346976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.346976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.346976 (E_RNA) where: Base-Base interactions energy: -66.141 where: short stacking energy: -37.743 Base-Backbone interact. energy: -0.182 local terms energy: -56.024442 where: bonds (distance) C4'-P energy: -10.564 bonds (distance) P-C4' energy: -13.981 flat angles C4'-P-C4' energy: -10.066 flat angles P-C4'-P energy: -7.007 tors. eta vs tors. theta energy: -14.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -93.408759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.408759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.408759 (E_RNA) where: Base-Base interactions energy: -33.623 where: short stacking energy: -33.410 Base-Backbone interact. energy: -0.223 local terms energy: -59.562628 where: bonds (distance) C4'-P energy: -15.854 bonds (distance) P-C4' energy: -10.167 flat angles C4'-P-C4' energy: -17.215 flat angles P-C4'-P energy: -9.898 tors. eta vs tors. theta energy: -6.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -88.429015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.429015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.429015 (E_RNA) where: Base-Base interactions energy: -28.460 where: short stacking energy: -25.976 Base-Backbone interact. energy: -0.702 local terms energy: -59.267075 where: bonds (distance) C4'-P energy: -14.690 bonds (distance) P-C4' energy: -16.421 flat angles C4'-P-C4' energy: -16.512 flat angles P-C4'-P energy: -5.805 tors. eta vs tors. theta energy: -5.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -88.846099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.846099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.846099 (E_RNA) where: Base-Base interactions energy: -40.245 where: short stacking energy: -16.851 Base-Backbone interact. energy: -0.134 local terms energy: -48.467011 where: bonds (distance) C4'-P energy: -11.444 bonds (distance) P-C4' energy: -15.286 flat angles C4'-P-C4' energy: -13.463 flat angles P-C4'-P energy: -6.621 tors. eta vs tors. theta energy: -1.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -76.562943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.562943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.562943 (E_RNA) where: Base-Base interactions energy: -29.006 where: short stacking energy: -27.159 Base-Backbone interact. energy: -0.008 local terms energy: -47.549175 where: bonds (distance) C4'-P energy: -15.142 bonds (distance) P-C4' energy: -10.196 flat angles C4'-P-C4' energy: -9.413 flat angles P-C4'-P energy: -5.422 tors. eta vs tors. theta energy: -7.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -197.619814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.619814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.619814 (E_RNA) where: Base-Base interactions energy: -120.755 where: short stacking energy: -63.268 Base-Backbone interact. energy: -0.771 local terms energy: -76.093874 where: bonds (distance) C4'-P energy: -14.033 bonds (distance) P-C4' energy: -16.001 flat angles C4'-P-C4' energy: -15.468 flat angles P-C4'-P energy: -10.696 tors. eta vs tors. theta energy: -19.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -161.964668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.964668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.964668 (E_RNA) where: Base-Base interactions energy: -94.230 where: short stacking energy: -50.282 Base-Backbone interact. energy: -0.609 local terms energy: -67.125280 where: bonds (distance) C4'-P energy: -15.085 bonds (distance) P-C4' energy: -12.923 flat angles C4'-P-C4' energy: -14.355 flat angles P-C4'-P energy: -8.408 tors. eta vs tors. theta energy: -16.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -165.795090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.795090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.795090 (E_RNA) where: Base-Base interactions energy: -100.923 where: short stacking energy: -50.790 Base-Backbone interact. energy: -0.105 local terms energy: -64.767579 where: bonds (distance) C4'-P energy: -11.096 bonds (distance) P-C4' energy: -15.298 flat angles C4'-P-C4' energy: -17.584 flat angles P-C4'-P energy: -7.178 tors. eta vs tors. theta energy: -13.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -149.159407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.159407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.159407 (E_RNA) where: Base-Base interactions energy: -91.043 where: short stacking energy: -49.206 Base-Backbone interact. energy: -0.112 local terms energy: -58.004090 where: bonds (distance) C4'-P energy: -11.564 bonds (distance) P-C4' energy: -10.531 flat angles C4'-P-C4' energy: -13.864 flat angles P-C4'-P energy: -9.093 tors. eta vs tors. theta energy: -12.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -124.943883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.943883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.943883 (E_RNA) where: Base-Base interactions energy: -72.102 where: short stacking energy: -34.383 Base-Backbone interact. energy: 0.635 local terms energy: -53.476418 where: bonds (distance) C4'-P energy: -14.090 bonds (distance) P-C4' energy: -12.060 flat angles C4'-P-C4' energy: -13.190 flat angles P-C4'-P energy: -7.443 tors. eta vs tors. theta energy: -6.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -148.056446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.056446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.056446 (E_RNA) where: Base-Base interactions energy: -87.020 where: short stacking energy: -45.854 Base-Backbone interact. energy: 0.143 local terms energy: -61.178714 where: bonds (distance) C4'-P energy: -12.132 bonds (distance) P-C4' energy: -15.976 flat angles C4'-P-C4' energy: -18.106 flat angles P-C4'-P energy: -4.913 tors. eta vs tors. theta energy: -10.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -122.750961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.750961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.750961 (E_RNA) where: Base-Base interactions energy: -66.938 where: short stacking energy: -29.006 Base-Backbone interact. energy: -0.089 local terms energy: -55.723843 where: bonds (distance) C4'-P energy: -14.111 bonds (distance) P-C4' energy: -16.114 flat angles C4'-P-C4' energy: -10.985 flat angles P-C4'-P energy: -10.166 tors. eta vs tors. theta energy: -4.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -75.546016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.546016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.546016 (E_RNA) where: Base-Base interactions energy: -27.820 where: short stacking energy: -18.463 Base-Backbone interact. energy: -0.440 local terms energy: -47.286243 where: bonds (distance) C4'-P energy: -15.196 bonds (distance) P-C4' energy: -15.296 flat angles C4'-P-C4' energy: -15.237 flat angles P-C4'-P energy: -4.283 tors. eta vs tors. theta energy: 2.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -80.297904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.297904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.297904 (E_RNA) where: Base-Base interactions energy: -34.914 where: short stacking energy: -33.068 Base-Backbone interact. energy: 1.283 local terms energy: -46.666678 where: bonds (distance) C4'-P energy: -8.435 bonds (distance) P-C4' energy: -15.467 flat angles C4'-P-C4' energy: -11.626 flat angles P-C4'-P energy: -5.229 tors. eta vs tors. theta energy: -5.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -73.324870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.324870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.324870 (E_RNA) where: Base-Base interactions energy: -25.234 where: short stacking energy: -17.020 Base-Backbone interact. energy: 1.080 local terms energy: -49.170492 where: bonds (distance) C4'-P energy: -7.072 bonds (distance) P-C4' energy: -16.213 flat angles C4'-P-C4' energy: -11.030 flat angles P-C4'-P energy: -8.815 tors. eta vs tors. theta energy: -6.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -203.713956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.713956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.713956 (E_RNA) where: Base-Base interactions energy: -127.923 where: short stacking energy: -67.657 Base-Backbone interact. energy: -0.001 local terms energy: -75.790031 where: bonds (distance) C4'-P energy: -17.319 bonds (distance) P-C4' energy: -14.749 flat angles C4'-P-C4' energy: -16.848 flat angles P-C4'-P energy: -6.907 tors. eta vs tors. theta energy: -19.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -161.254931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.254931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.254931 (E_RNA) where: Base-Base interactions energy: -101.094 where: short stacking energy: -41.268 Base-Backbone interact. energy: -1.157 local terms energy: -59.004265 where: bonds (distance) C4'-P energy: -16.599 bonds (distance) P-C4' energy: -11.257 flat angles C4'-P-C4' energy: -12.528 flat angles P-C4'-P energy: -6.089 tors. eta vs tors. theta energy: -12.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -184.381634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.381634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.381634 (E_RNA) where: Base-Base interactions energy: -113.665 where: short stacking energy: -54.529 Base-Backbone interact. energy: -1.000 local terms energy: -69.716561 where: bonds (distance) C4'-P energy: -14.077 bonds (distance) P-C4' energy: -14.102 flat angles C4'-P-C4' energy: -14.023 flat angles P-C4'-P energy: -10.310 tors. eta vs tors. theta energy: -17.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -139.346463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.346463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.346463 (E_RNA) where: Base-Base interactions energy: -85.380 where: short stacking energy: -48.799 Base-Backbone interact. energy: -0.060 local terms energy: -53.906840 where: bonds (distance) C4'-P energy: -16.508 bonds (distance) P-C4' energy: -13.129 flat angles C4'-P-C4' energy: -10.390 flat angles P-C4'-P energy: -4.453 tors. eta vs tors. theta energy: -9.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -142.533336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.533336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.533336 (E_RNA) where: Base-Base interactions energy: -79.200 where: short stacking energy: -47.084 Base-Backbone interact. energy: -1.021 local terms energy: -62.312138 where: bonds (distance) C4'-P energy: -11.508 bonds (distance) P-C4' energy: -18.132 flat angles C4'-P-C4' energy: -12.560 flat angles P-C4'-P energy: -8.735 tors. eta vs tors. theta energy: -11.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -131.722072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.722072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.722072 (E_RNA) where: Base-Base interactions energy: -78.078 where: short stacking energy: -29.187 Base-Backbone interact. energy: -0.030 local terms energy: -53.614175 where: bonds (distance) C4'-P energy: -12.533 bonds (distance) P-C4' energy: -14.476 flat angles C4'-P-C4' energy: -13.270 flat angles P-C4'-P energy: -9.409 tors. eta vs tors. theta energy: -3.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -126.617656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.617656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.617656 (E_RNA) where: Base-Base interactions energy: -70.033 where: short stacking energy: -36.436 Base-Backbone interact. energy: 0.929 local terms energy: -57.513628 where: bonds (distance) C4'-P energy: -15.888 bonds (distance) P-C4' energy: -10.481 flat angles C4'-P-C4' energy: -16.505 flat angles P-C4'-P energy: -7.935 tors. eta vs tors. theta energy: -6.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -107.689308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.689308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.689308 (E_RNA) where: Base-Base interactions energy: -60.051 where: short stacking energy: -32.011 Base-Backbone interact. energy: -0.192 local terms energy: -47.446023 where: bonds (distance) C4'-P energy: -8.932 bonds (distance) P-C4' energy: -15.018 flat angles C4'-P-C4' energy: -13.641 flat angles P-C4'-P energy: -8.082 tors. eta vs tors. theta energy: -1.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -71.359680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.359680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.359680 (E_RNA) where: Base-Base interactions energy: -25.611 where: short stacking energy: -13.520 Base-Backbone interact. energy: -0.795 local terms energy: -44.954331 where: bonds (distance) C4'-P energy: -12.007 bonds (distance) P-C4' energy: -14.384 flat angles C4'-P-C4' energy: -10.850 flat angles P-C4'-P energy: -11.674 tors. eta vs tors. theta energy: 3.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -68.843791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.843791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.843791 (E_RNA) where: Base-Base interactions energy: -21.510 where: short stacking energy: -20.091 Base-Backbone interact. energy: -1.014 local terms energy: -46.319976 where: bonds (distance) C4'-P energy: -12.791 bonds (distance) P-C4' energy: -9.391 flat angles C4'-P-C4' energy: -15.625 flat angles P-C4'-P energy: -7.689 tors. eta vs tors. theta energy: -0.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -209.183087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.183087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.183087 (E_RNA) where: Base-Base interactions energy: -128.657 where: short stacking energy: -70.004 Base-Backbone interact. energy: -0.897 local terms energy: -79.629238 where: bonds (distance) C4'-P energy: -13.324 bonds (distance) P-C4' energy: -15.123 flat angles C4'-P-C4' energy: -14.230 flat angles P-C4'-P energy: -14.460 tors. eta vs tors. theta energy: -22.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -165.422481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.422481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.422481 (E_RNA) where: Base-Base interactions energy: -99.635 where: short stacking energy: -45.370 Base-Backbone interact. energy: -0.202 local terms energy: -65.586453 where: bonds (distance) C4'-P energy: -16.037 bonds (distance) P-C4' energy: -14.598 flat angles C4'-P-C4' energy: -15.137 flat angles P-C4'-P energy: -9.786 tors. eta vs tors. theta energy: -10.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -199.727344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.727344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.727344 (E_RNA) where: Base-Base interactions energy: -125.908 where: short stacking energy: -64.294 Base-Backbone interact. energy: 0.474 local terms energy: -74.293041 where: bonds (distance) C4'-P energy: -13.415 bonds (distance) P-C4' energy: -12.070 flat angles C4'-P-C4' energy: -14.080 flat angles P-C4'-P energy: -12.797 tors. eta vs tors. theta energy: -21.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -138.033291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.033291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.033291 (E_RNA) where: Base-Base interactions energy: -73.531 where: short stacking energy: -43.265 Base-Backbone interact. energy: -0.007 local terms energy: -64.494703 where: bonds (distance) C4'-P energy: -16.607 bonds (distance) P-C4' energy: -11.493 flat angles C4'-P-C4' energy: -13.332 flat angles P-C4'-P energy: -11.859 tors. eta vs tors. theta energy: -11.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -152.507205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.507205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.507205 (E_RNA) where: Base-Base interactions energy: -88.647 where: short stacking energy: -36.733 Base-Backbone interact. energy: -0.590 local terms energy: -63.270156 where: bonds (distance) C4'-P energy: -11.623 bonds (distance) P-C4' energy: -17.939 flat angles C4'-P-C4' energy: -15.150 flat angles P-C4'-P energy: -8.845 tors. eta vs tors. theta energy: -9.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -120.243526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.243526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.243526 (E_RNA) where: Base-Base interactions energy: -57.197 where: short stacking energy: -30.259 Base-Backbone interact. energy: -0.431 local terms energy: -62.614941 where: bonds (distance) C4'-P energy: -15.950 bonds (distance) P-C4' energy: -17.069 flat angles C4'-P-C4' energy: -13.954 flat angles P-C4'-P energy: -8.900 tors. eta vs tors. theta energy: -6.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -139.554377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.554377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.554377 (E_RNA) where: Base-Base interactions energy: -81.570 where: short stacking energy: -44.665 Base-Backbone interact. energy: -0.462 local terms energy: -57.522513 where: bonds (distance) C4'-P energy: -14.186 bonds (distance) P-C4' energy: -10.894 flat angles C4'-P-C4' energy: -13.753 flat angles P-C4'-P energy: -7.549 tors. eta vs tors. theta energy: -11.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -77.281934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.281934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.281934 (E_RNA) where: Base-Base interactions energy: -23.763 where: short stacking energy: -20.341 Base-Backbone interact. energy: -0.218 local terms energy: -53.300927 where: bonds (distance) C4'-P energy: -13.491 bonds (distance) P-C4' energy: -14.345 flat angles C4'-P-C4' energy: -17.552 flat angles P-C4'-P energy: -6.258 tors. eta vs tors. theta energy: -1.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -75.208208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.208208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.208208 (E_RNA) where: Base-Base interactions energy: -29.059 where: short stacking energy: -29.059 Base-Backbone interact. energy: 0.211 local terms energy: -46.360355 where: bonds (distance) C4'-P energy: -14.620 bonds (distance) P-C4' energy: -16.291 flat angles C4'-P-C4' energy: -10.374 flat angles P-C4'-P energy: -0.253 tors. eta vs tors. theta energy: -4.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -65.009374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.009374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.009374 (E_RNA) where: Base-Base interactions energy: -27.633 where: short stacking energy: -20.021 Base-Backbone interact. energy: 2.411 local terms energy: -39.787509 where: bonds (distance) C4'-P energy: -10.811 bonds (distance) P-C4' energy: -10.697 flat angles C4'-P-C4' energy: -11.018 flat angles P-C4'-P energy: -8.923 tors. eta vs tors. theta energy: 1.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -202.829433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.829433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.829433 (E_RNA) where: Base-Base interactions energy: -133.054 where: short stacking energy: -62.514 Base-Backbone interact. energy: -0.781 local terms energy: -68.994545 where: bonds (distance) C4'-P energy: -10.861 bonds (distance) P-C4' energy: -14.341 flat angles C4'-P-C4' energy: -12.778 flat angles P-C4'-P energy: -13.101 tors. eta vs tors. theta energy: -17.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -199.730648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.730648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.730648 (E_RNA) where: Base-Base interactions energy: -123.150 where: short stacking energy: -65.181 Base-Backbone interact. energy: -1.000 local terms energy: -75.580854 where: bonds (distance) C4'-P energy: -14.115 bonds (distance) P-C4' energy: -14.952 flat angles C4'-P-C4' energy: -14.898 flat angles P-C4'-P energy: -12.200 tors. eta vs tors. theta energy: -19.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -167.449283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.449283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.449283 (E_RNA) where: Base-Base interactions energy: -99.457 where: short stacking energy: -49.559 Base-Backbone interact. energy: 0.189 local terms energy: -68.180888 where: bonds (distance) C4'-P energy: -15.208 bonds (distance) P-C4' energy: -13.905 flat angles C4'-P-C4' energy: -16.719 flat angles P-C4'-P energy: -10.071 tors. eta vs tors. theta energy: -12.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -138.444961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.444961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.444961 (E_RNA) where: Base-Base interactions energy: -80.202 where: short stacking energy: -44.280 Base-Backbone interact. energy: -0.914 local terms energy: -57.329621 where: bonds (distance) C4'-P energy: -16.119 bonds (distance) P-C4' energy: -12.672 flat angles C4'-P-C4' energy: -7.489 flat angles P-C4'-P energy: -9.301 tors. eta vs tors. theta energy: -11.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -177.364146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.364146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.364146 (E_RNA) where: Base-Base interactions energy: -117.302 where: short stacking energy: -42.442 Base-Backbone interact. energy: -0.350 local terms energy: -59.711998 where: bonds (distance) C4'-P energy: -13.423 bonds (distance) P-C4' energy: -18.225 flat angles C4'-P-C4' energy: -12.743 flat angles P-C4'-P energy: -6.697 tors. eta vs tors. theta energy: -8.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -147.872857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.872857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.872857 (E_RNA) where: Base-Base interactions energy: -85.226 where: short stacking energy: -47.226 Base-Backbone interact. energy: -0.014 local terms energy: -62.632783 where: bonds (distance) C4'-P energy: -14.024 bonds (distance) P-C4' energy: -15.523 flat angles C4'-P-C4' energy: -13.983 flat angles P-C4'-P energy: -6.380 tors. eta vs tors. theta energy: -12.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -105.387696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.387696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.387696 (E_RNA) where: Base-Base interactions energy: -52.322 where: short stacking energy: -31.577 Base-Backbone interact. energy: -0.025 local terms energy: -53.040478 where: bonds (distance) C4'-P energy: -13.923 bonds (distance) P-C4' energy: -13.575 flat angles C4'-P-C4' energy: -12.890 flat angles P-C4'-P energy: -8.592 tors. eta vs tors. theta energy: -4.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -84.972244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.972244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.972244 (E_RNA) where: Base-Base interactions energy: -40.434 where: short stacking energy: -16.110 Base-Backbone interact. energy: -0.305 local terms energy: -44.233057 where: bonds (distance) C4'-P energy: -14.029 bonds (distance) P-C4' energy: -8.434 flat angles C4'-P-C4' energy: -12.341 flat angles P-C4'-P energy: -9.155 tors. eta vs tors. theta energy: -0.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -82.579560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.579560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.579560 (E_RNA) where: Base-Base interactions energy: -34.074 where: short stacking energy: -23.596 Base-Backbone interact. energy: -0.015 local terms energy: -48.489953 where: bonds (distance) C4'-P energy: -13.395 bonds (distance) P-C4' energy: -12.235 flat angles C4'-P-C4' energy: -9.709 flat angles P-C4'-P energy: -6.902 tors. eta vs tors. theta energy: -6.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -75.294721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.294721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.294721 (E_RNA) where: Base-Base interactions energy: -31.739 where: short stacking energy: -26.016 Base-Backbone interact. energy: -0.454 local terms energy: -43.102235 where: bonds (distance) C4'-P energy: -12.940 bonds (distance) P-C4' energy: -13.292 flat angles C4'-P-C4' energy: -7.334 flat angles P-C4'-P energy: -5.684 tors. eta vs tors. theta energy: -3.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -198.910029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.910029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.910029 (E_RNA) where: Base-Base interactions energy: -121.533 where: short stacking energy: -67.403 Base-Backbone interact. energy: -0.042 local terms energy: -77.334562 where: bonds (distance) C4'-P energy: -12.939 bonds (distance) P-C4' energy: -15.626 flat angles C4'-P-C4' energy: -17.240 flat angles P-C4'-P energy: -12.182 tors. eta vs tors. theta energy: -19.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -193.343848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.343848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.343848 (E_RNA) where: Base-Base interactions energy: -113.281 where: short stacking energy: -59.953 Base-Backbone interact. energy: -0.473 local terms energy: -79.589788 where: bonds (distance) C4'-P energy: -15.755 bonds (distance) P-C4' energy: -14.819 flat angles C4'-P-C4' energy: -18.120 flat angles P-C4'-P energy: -9.280 tors. eta vs tors. theta energy: -21.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -168.569667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.569667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.569667 (E_RNA) where: Base-Base interactions energy: -100.622 where: short stacking energy: -48.959 Base-Backbone interact. energy: -0.155 local terms energy: -67.793301 where: bonds (distance) C4'-P energy: -15.565 bonds (distance) P-C4' energy: -14.038 flat angles C4'-P-C4' energy: -13.623 flat angles P-C4'-P energy: -7.211 tors. eta vs tors. theta energy: -17.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -140.483819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.483819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.483819 (E_RNA) where: Base-Base interactions energy: -81.245 where: short stacking energy: -46.163 Base-Backbone interact. energy: -0.174 local terms energy: -59.065217 where: bonds (distance) C4'-P energy: -14.869 bonds (distance) P-C4' energy: -12.150 flat angles C4'-P-C4' energy: -12.650 flat angles P-C4'-P energy: -7.614 tors. eta vs tors. theta energy: -11.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -192.346702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.346702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.346702 (E_RNA) where: Base-Base interactions energy: -128.787 where: short stacking energy: -50.465 Base-Backbone interact. energy: -0.196 local terms energy: -63.363247 where: bonds (distance) C4'-P energy: -12.596 bonds (distance) P-C4' energy: -12.554 flat angles C4'-P-C4' energy: -16.800 flat angles P-C4'-P energy: -8.246 tors. eta vs tors. theta energy: -13.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -147.144331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.144331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.144331 (E_RNA) where: Base-Base interactions energy: -77.898 where: short stacking energy: -47.024 Base-Backbone interact. energy: -0.018 local terms energy: -69.228746 where: bonds (distance) C4'-P energy: -13.287 bonds (distance) P-C4' energy: -17.438 flat angles C4'-P-C4' energy: -14.935 flat angles P-C4'-P energy: -8.425 tors. eta vs tors. theta energy: -15.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -92.347845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.347845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.347845 (E_RNA) where: Base-Base interactions energy: -35.734 where: short stacking energy: -29.995 Base-Backbone interact. energy: -0.101 local terms energy: -56.513476 where: bonds (distance) C4'-P energy: -13.680 bonds (distance) P-C4' energy: -14.662 flat angles C4'-P-C4' energy: -11.493 flat angles P-C4'-P energy: -7.007 tors. eta vs tors. theta energy: -9.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -146.050055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.050055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.050055 (E_RNA) where: Base-Base interactions energy: -89.803 where: short stacking energy: -42.014 Base-Backbone interact. energy: -0.782 local terms energy: -55.465118 where: bonds (distance) C4'-P energy: -14.028 bonds (distance) P-C4' energy: -18.246 flat angles C4'-P-C4' energy: -9.644 flat angles P-C4'-P energy: -3.602 tors. eta vs tors. theta energy: -9.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -99.673855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.673855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.673855 (E_RNA) where: Base-Base interactions energy: -48.717 where: short stacking energy: -30.321 Base-Backbone interact. energy: -0.353 local terms energy: -50.604695 where: bonds (distance) C4'-P energy: -12.400 bonds (distance) P-C4' energy: -11.668 flat angles C4'-P-C4' energy: -14.190 flat angles P-C4'-P energy: -10.242 tors. eta vs tors. theta energy: -2.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -76.101348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.101348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.101348 (E_RNA) where: Base-Base interactions energy: -28.202 where: short stacking energy: -28.202 Base-Backbone interact. energy: -0.107 local terms energy: -47.792375 where: bonds (distance) C4'-P energy: -10.409 bonds (distance) P-C4' energy: -15.509 flat angles C4'-P-C4' energy: -14.667 flat angles P-C4'-P energy: -8.408 tors. eta vs tors. theta energy: 1.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -205.960306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.960306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.960306 (E_RNA) where: Base-Base interactions energy: -123.661 where: short stacking energy: -66.932 Base-Backbone interact. energy: -0.421 local terms energy: -81.877940 where: bonds (distance) C4'-P energy: -17.684 bonds (distance) P-C4' energy: -15.334 flat angles C4'-P-C4' energy: -15.686 flat angles P-C4'-P energy: -12.766 tors. eta vs tors. theta energy: -20.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -174.128983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.128983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.128983 (E_RNA) where: Base-Base interactions energy: -105.514 where: short stacking energy: -50.333 Base-Backbone interact. energy: -0.188 local terms energy: -68.426545 where: bonds (distance) C4'-P energy: -13.780 bonds (distance) P-C4' energy: -15.416 flat angles C4'-P-C4' energy: -13.211 flat angles P-C4'-P energy: -9.974 tors. eta vs tors. theta energy: -16.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -189.705188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.705188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.705188 (E_RNA) where: Base-Base interactions energy: -118.652 where: short stacking energy: -62.567 Base-Backbone interact. energy: -0.988 local terms energy: -70.065219 where: bonds (distance) C4'-P energy: -9.886 bonds (distance) P-C4' energy: -16.122 flat angles C4'-P-C4' energy: -13.178 flat angles P-C4'-P energy: -13.408 tors. eta vs tors. theta energy: -17.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -190.679660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.679660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.679660 (E_RNA) where: Base-Base interactions energy: -126.402 where: short stacking energy: -44.301 Base-Backbone interact. energy: -0.204 local terms energy: -64.074162 where: bonds (distance) C4'-P energy: -11.365 bonds (distance) P-C4' energy: -15.968 flat angles C4'-P-C4' energy: -13.099 flat angles P-C4'-P energy: -9.051 tors. eta vs tors. theta energy: -14.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -133.270623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.270623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.270623 (E_RNA) where: Base-Base interactions energy: -68.732 where: short stacking energy: -30.837 Base-Backbone interact. energy: -0.150 local terms energy: -64.388114 where: bonds (distance) C4'-P energy: -15.585 bonds (distance) P-C4' energy: -15.902 flat angles C4'-P-C4' energy: -13.991 flat angles P-C4'-P energy: -10.493 tors. eta vs tors. theta energy: -8.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -145.437533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.437533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.437533 (E_RNA) where: Base-Base interactions energy: -83.662 where: short stacking energy: -40.566 Base-Backbone interact. energy: -0.821 local terms energy: -60.954959 where: bonds (distance) C4'-P energy: -13.814 bonds (distance) P-C4' energy: -14.769 flat angles C4'-P-C4' energy: -12.133 flat angles P-C4'-P energy: -10.314 tors. eta vs tors. theta energy: -9.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -79.297067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.297067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.297067 (E_RNA) where: Base-Base interactions energy: -25.974 where: short stacking energy: -25.811 Base-Backbone interact. energy: -0.182 local terms energy: -53.140591 where: bonds (distance) C4'-P energy: -13.617 bonds (distance) P-C4' energy: -12.758 flat angles C4'-P-C4' energy: -16.719 flat angles P-C4'-P energy: -10.167 tors. eta vs tors. theta energy: 0.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -121.190038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.190038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.190038 (E_RNA) where: Base-Base interactions energy: -63.817 where: short stacking energy: -32.210 Base-Backbone interact. energy: -0.071 local terms energy: -57.302314 where: bonds (distance) C4'-P energy: -13.979 bonds (distance) P-C4' energy: -15.178 flat angles C4'-P-C4' energy: -12.498 flat angles P-C4'-P energy: -10.082 tors. eta vs tors. theta energy: -5.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -73.883363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.883363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.883363 (E_RNA) where: Base-Base interactions energy: -24.492 where: short stacking energy: -23.950 Base-Backbone interact. energy: -0.054 local terms energy: -49.337656 where: bonds (distance) C4'-P energy: -10.578 bonds (distance) P-C4' energy: -15.579 flat angles C4'-P-C4' energy: -10.550 flat angles P-C4'-P energy: -8.624 tors. eta vs tors. theta energy: -4.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -78.122930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.122930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.122930 (E_RNA) where: Base-Base interactions energy: -30.283 where: short stacking energy: -19.228 Base-Backbone interact. energy: -0.179 local terms energy: -47.660030 where: bonds (distance) C4'-P energy: -14.466 bonds (distance) P-C4' energy: -12.596 flat angles C4'-P-C4' energy: -13.029 flat angles P-C4'-P energy: -8.449 tors. eta vs tors. theta energy: 0.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -207.022766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.022766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.022766 (E_RNA) where: Base-Base interactions energy: -130.529 where: short stacking energy: -71.660 Base-Backbone interact. energy: -0.436 local terms energy: -76.057408 where: bonds (distance) C4'-P energy: -14.104 bonds (distance) P-C4' energy: -14.821 flat angles C4'-P-C4' energy: -14.457 flat angles P-C4'-P energy: -11.414 tors. eta vs tors. theta energy: -21.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -165.440973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.440973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.440973 (E_RNA) where: Base-Base interactions energy: -99.144 where: short stacking energy: -41.877 Base-Backbone interact. energy: 0.395 local terms energy: -66.691731 where: bonds (distance) C4'-P energy: -16.074 bonds (distance) P-C4' energy: -14.683 flat angles C4'-P-C4' energy: -18.597 flat angles P-C4'-P energy: -9.455 tors. eta vs tors. theta energy: -7.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -205.920461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.920461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.920461 (E_RNA) where: Base-Base interactions energy: -135.364 where: short stacking energy: -56.570 Base-Backbone interact. energy: -0.038 local terms energy: -70.518451 where: bonds (distance) C4'-P energy: -17.469 bonds (distance) P-C4' energy: -13.827 flat angles C4'-P-C4' energy: -14.775 flat angles P-C4'-P energy: -5.950 tors. eta vs tors. theta energy: -18.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -186.671279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.671279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.671279 (E_RNA) where: Base-Base interactions energy: -115.874 where: short stacking energy: -62.781 Base-Backbone interact. energy: -0.108 local terms energy: -70.689317 where: bonds (distance) C4'-P energy: -12.446 bonds (distance) P-C4' energy: -13.452 flat angles C4'-P-C4' energy: -13.073 flat angles P-C4'-P energy: -11.955 tors. eta vs tors. theta energy: -19.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -139.319441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.319441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.319441 (E_RNA) where: Base-Base interactions energy: -77.621 where: short stacking energy: -35.374 Base-Backbone interact. energy: -0.160 local terms energy: -61.538967 where: bonds (distance) C4'-P energy: -13.304 bonds (distance) P-C4' energy: -16.080 flat angles C4'-P-C4' energy: -15.008 flat angles P-C4'-P energy: -4.827 tors. eta vs tors. theta energy: -12.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -136.508582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.508582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.508582 (E_RNA) where: Base-Base interactions energy: -88.088 where: short stacking energy: -39.239 Base-Backbone interact. energy: -0.342 local terms energy: -48.078677 where: bonds (distance) C4'-P energy: -10.227 bonds (distance) P-C4' energy: -12.150 flat angles C4'-P-C4' energy: -9.088 flat angles P-C4'-P energy: -5.470 tors. eta vs tors. theta energy: -11.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -132.685272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.685272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.685272 (E_RNA) where: Base-Base interactions energy: -69.159 where: short stacking energy: -29.495 Base-Backbone interact. energy: -0.570 local terms energy: -62.956098 where: bonds (distance) C4'-P energy: -16.279 bonds (distance) P-C4' energy: -14.219 flat angles C4'-P-C4' energy: -14.121 flat angles P-C4'-P energy: -10.724 tors. eta vs tors. theta energy: -7.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -81.862985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.862985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.862985 (E_RNA) where: Base-Base interactions energy: -33.466 where: short stacking energy: -23.031 Base-Backbone interact. energy: -0.490 local terms energy: -47.907560 where: bonds (distance) C4'-P energy: -12.194 bonds (distance) P-C4' energy: -15.002 flat angles C4'-P-C4' energy: -10.246 flat angles P-C4'-P energy: -9.008 tors. eta vs tors. theta energy: -1.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -83.291414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.291414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.291414 (E_RNA) where: Base-Base interactions energy: -42.766 where: short stacking energy: -19.581 Base-Backbone interact. energy: -0.548 local terms energy: -39.977499 where: bonds (distance) C4'-P energy: -7.190 bonds (distance) P-C4' energy: -14.061 flat angles C4'-P-C4' energy: -11.911 flat angles P-C4'-P energy: -6.924 tors. eta vs tors. theta energy: 0.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -78.331309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.331309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.331309 (E_RNA) where: Base-Base interactions energy: -33.947 where: short stacking energy: -20.346 Base-Backbone interact. energy: -0.273 local terms energy: -44.111026 where: bonds (distance) C4'-P energy: -10.373 bonds (distance) P-C4' energy: -14.753 flat angles C4'-P-C4' energy: -10.469 flat angles P-C4'-P energy: -10.379 tors. eta vs tors. theta energy: 1.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -206.962789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.962789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.962789 (E_RNA) where: Base-Base interactions energy: -126.582 where: short stacking energy: -69.551 Base-Backbone interact. energy: -0.038 local terms energy: -80.342899 where: bonds (distance) C4'-P energy: -17.033 bonds (distance) P-C4' energy: -14.666 flat angles C4'-P-C4' energy: -14.136 flat angles P-C4'-P energy: -12.878 tors. eta vs tors. theta energy: -21.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -210.660316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.660316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.660316 (E_RNA) where: Base-Base interactions energy: -140.144 where: short stacking energy: -58.898 Base-Backbone interact. energy: -0.421 local terms energy: -70.094870 where: bonds (distance) C4'-P energy: -16.433 bonds (distance) P-C4' energy: -11.435 flat angles C4'-P-C4' energy: -15.823 flat angles P-C4'-P energy: -7.215 tors. eta vs tors. theta energy: -19.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -156.676991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.676991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.676991 (E_RNA) where: Base-Base interactions energy: -107.754 where: short stacking energy: -41.959 Base-Backbone interact. energy: -0.197 local terms energy: -48.725252 where: bonds (distance) C4'-P energy: -11.700 bonds (distance) P-C4' energy: -10.642 flat angles C4'-P-C4' energy: -12.652 flat angles P-C4'-P energy: -8.986 tors. eta vs tors. theta energy: -4.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -192.581005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.581005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.581005 (E_RNA) where: Base-Base interactions energy: -123.423 where: short stacking energy: -63.247 Base-Backbone interact. energy: -0.002 local terms energy: -69.156282 where: bonds (distance) C4'-P energy: -11.912 bonds (distance) P-C4' energy: -14.317 flat angles C4'-P-C4' energy: -13.520 flat angles P-C4'-P energy: -12.354 tors. eta vs tors. theta energy: -17.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -155.485152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.485152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.485152 (E_RNA) where: Base-Base interactions energy: -89.903 where: short stacking energy: -47.052 Base-Backbone interact. energy: -0.155 local terms energy: -65.426843 where: bonds (distance) C4'-P energy: -13.681 bonds (distance) P-C4' energy: -15.844 flat angles C4'-P-C4' energy: -11.082 flat angles P-C4'-P energy: -9.994 tors. eta vs tors. theta energy: -14.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -140.948756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.948756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.948756 (E_RNA) where: Base-Base interactions energy: -80.937 where: short stacking energy: -37.903 Base-Backbone interact. energy: -1.235 local terms energy: -58.776663 where: bonds (distance) C4'-P energy: -13.485 bonds (distance) P-C4' energy: -10.567 flat angles C4'-P-C4' energy: -16.444 flat angles P-C4'-P energy: -9.853 tors. eta vs tors. theta energy: -8.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -109.727840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.727840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.727840 (E_RNA) where: Base-Base interactions energy: -51.627 where: short stacking energy: -31.156 Base-Backbone interact. energy: -0.115 local terms energy: -57.986720 where: bonds (distance) C4'-P energy: -13.495 bonds (distance) P-C4' energy: -17.595 flat angles C4'-P-C4' energy: -13.283 flat angles P-C4'-P energy: -6.201 tors. eta vs tors. theta energy: -7.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -81.335655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.335655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.335655 (E_RNA) where: Base-Base interactions energy: -27.635 where: short stacking energy: -21.736 Base-Backbone interact. energy: -0.249 local terms energy: -53.451656 where: bonds (distance) C4'-P energy: -13.174 bonds (distance) P-C4' energy: -16.125 flat angles C4'-P-C4' energy: -9.388 flat angles P-C4'-P energy: -9.763 tors. eta vs tors. theta energy: -5.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -77.958051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.958051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.958051 (E_RNA) where: Base-Base interactions energy: -28.935 where: short stacking energy: -24.662 Base-Backbone interact. energy: -0.084 local terms energy: -48.939045 where: bonds (distance) C4'-P energy: -14.839 bonds (distance) P-C4' energy: -13.003 flat angles C4'-P-C4' energy: -11.407 flat angles P-C4'-P energy: -9.225 tors. eta vs tors. theta energy: -0.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -82.774022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.774022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.774022 (E_RNA) where: Base-Base interactions energy: -36.358 where: short stacking energy: -26.357 Base-Backbone interact. energy: -1.538 local terms energy: -44.878121 where: bonds (distance) C4'-P energy: -10.760 bonds (distance) P-C4' energy: -12.163 flat angles C4'-P-C4' energy: -7.657 flat angles P-C4'-P energy: -11.640 tors. eta vs tors. theta energy: -2.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -216.434199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.434199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.434199 (E_RNA) where: Base-Base interactions energy: -146.215 where: short stacking energy: -61.640 Base-Backbone interact. energy: -0.156 local terms energy: -70.062710 where: bonds (distance) C4'-P energy: -16.019 bonds (distance) P-C4' energy: -13.259 flat angles C4'-P-C4' energy: -13.817 flat angles P-C4'-P energy: -8.089 tors. eta vs tors. theta energy: -18.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -203.319922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.319922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.319922 (E_RNA) where: Base-Base interactions energy: -125.553 where: short stacking energy: -66.913 Base-Backbone interact. energy: -0.017 local terms energy: -77.749965 where: bonds (distance) C4'-P energy: -12.626 bonds (distance) P-C4' energy: -16.786 flat angles C4'-P-C4' energy: -15.060 flat angles P-C4'-P energy: -12.179 tors. eta vs tors. theta energy: -21.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -187.954128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.954128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.954128 (E_RNA) where: Base-Base interactions energy: -113.751 where: short stacking energy: -60.123 Base-Backbone interact. energy: -1.486 local terms energy: -72.716388 where: bonds (distance) C4'-P energy: -14.112 bonds (distance) P-C4' energy: -13.898 flat angles C4'-P-C4' energy: -17.542 flat angles P-C4'-P energy: -9.401 tors. eta vs tors. theta energy: -17.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -163.452153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.452153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.452153 (E_RNA) where: Base-Base interactions energy: -100.374 where: short stacking energy: -49.402 Base-Backbone interact. energy: -0.647 local terms energy: -62.430646 where: bonds (distance) C4'-P energy: -13.328 bonds (distance) P-C4' energy: -14.318 flat angles C4'-P-C4' energy: -11.923 flat angles P-C4'-P energy: -9.705 tors. eta vs tors. theta energy: -13.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -128.594062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.594062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.594062 (E_RNA) where: Base-Base interactions energy: -63.121 where: short stacking energy: -32.144 Base-Backbone interact. energy: -0.803 local terms energy: -64.669458 where: bonds (distance) C4'-P energy: -14.119 bonds (distance) P-C4' energy: -14.794 flat angles C4'-P-C4' energy: -14.487 flat angles P-C4'-P energy: -11.514 tors. eta vs tors. theta energy: -9.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -140.341447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.341447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.341447 (E_RNA) where: Base-Base interactions energy: -76.045 where: short stacking energy: -34.776 Base-Backbone interact. energy: -0.765 local terms energy: -63.531867 where: bonds (distance) C4'-P energy: -15.718 bonds (distance) P-C4' energy: -15.090 flat angles C4'-P-C4' energy: -15.804 flat angles P-C4'-P energy: -7.817 tors. eta vs tors. theta energy: -9.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -92.547653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.547653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.547653 (E_RNA) where: Base-Base interactions energy: -48.003 where: short stacking energy: -30.941 Base-Backbone interact. energy: -0.761 local terms energy: -43.782775 where: bonds (distance) C4'-P energy: -13.473 bonds (distance) P-C4' energy: -15.578 flat angles C4'-P-C4' energy: -12.756 flat angles P-C4'-P energy: -3.246 tors. eta vs tors. theta energy: 1.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -96.655129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.655129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.655129 (E_RNA) where: Base-Base interactions energy: -48.175 where: short stacking energy: -19.452 Base-Backbone interact. energy: -0.386 local terms energy: -48.093528 where: bonds (distance) C4'-P energy: -15.374 bonds (distance) P-C4' energy: -15.251 flat angles C4'-P-C4' energy: -7.912 flat angles P-C4'-P energy: -6.580 tors. eta vs tors. theta energy: -2.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -83.279796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.279796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.279796 (E_RNA) where: Base-Base interactions energy: -39.073 where: short stacking energy: -17.578 Base-Backbone interact. energy: -0.054 local terms energy: -44.152846 where: bonds (distance) C4'-P energy: -13.135 bonds (distance) P-C4' energy: -11.747 flat angles C4'-P-C4' energy: -14.196 flat angles P-C4'-P energy: -3.167 tors. eta vs tors. theta energy: -1.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -87.325587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.325587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.325587 (E_RNA) where: Base-Base interactions energy: -36.849 where: short stacking energy: -36.849 Base-Backbone interact. energy: 0.663 local terms energy: -51.139178 where: bonds (distance) C4'-P energy: -7.125 bonds (distance) P-C4' energy: -17.678 flat angles C4'-P-C4' energy: -11.091 flat angles P-C4'-P energy: -9.188 tors. eta vs tors. theta energy: -6.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -218.999460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.999460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.999460 (E_RNA) where: Base-Base interactions energy: -143.172 where: short stacking energy: -57.800 Base-Backbone interact. energy: -0.702 local terms energy: -75.124838 where: bonds (distance) C4'-P energy: -15.801 bonds (distance) P-C4' energy: -14.237 flat angles C4'-P-C4' energy: -18.154 flat angles P-C4'-P energy: -10.725 tors. eta vs tors. theta energy: -16.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -198.269904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.269904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.269904 (E_RNA) where: Base-Base interactions energy: -135.615 where: short stacking energy: -63.807 Base-Backbone interact. energy: 0.372 local terms energy: -63.027117 where: bonds (distance) C4'-P energy: -8.173 bonds (distance) P-C4' energy: -16.179 flat angles C4'-P-C4' energy: -18.031 flat angles P-C4'-P energy: -4.776 tors. eta vs tors. theta energy: -15.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -197.191405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.191405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.191405 (E_RNA) where: Base-Base interactions energy: -117.956 where: short stacking energy: -60.745 Base-Backbone interact. energy: -0.857 local terms energy: -78.378559 where: bonds (distance) C4'-P energy: -15.345 bonds (distance) P-C4' energy: -17.022 flat angles C4'-P-C4' energy: -15.500 flat angles P-C4'-P energy: -11.991 tors. eta vs tors. theta energy: -18.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -154.665864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.665864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.665864 (E_RNA) where: Base-Base interactions energy: -88.775 where: short stacking energy: -41.674 Base-Backbone interact. energy: -1.502 local terms energy: -64.388610 where: bonds (distance) C4'-P energy: -14.380 bonds (distance) P-C4' energy: -16.534 flat angles C4'-P-C4' energy: -16.206 flat angles P-C4'-P energy: -6.495 tors. eta vs tors. theta energy: -10.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -172.985797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.985797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.985797 (E_RNA) where: Base-Base interactions energy: -113.909 where: short stacking energy: -45.397 Base-Backbone interact. energy: 0.461 local terms energy: -59.538467 where: bonds (distance) C4'-P energy: -17.444 bonds (distance) P-C4' energy: -12.193 flat angles C4'-P-C4' energy: -10.378 flat angles P-C4'-P energy: -6.050 tors. eta vs tors. theta energy: -13.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -156.005357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.005357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.005357 (E_RNA) where: Base-Base interactions energy: -91.131 where: short stacking energy: -41.496 Base-Backbone interact. energy: -0.315 local terms energy: -64.559459 where: bonds (distance) C4'-P energy: -12.274 bonds (distance) P-C4' energy: -12.994 flat angles C4'-P-C4' energy: -11.793 flat angles P-C4'-P energy: -10.205 tors. eta vs tors. theta energy: -17.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -97.245311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.245311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.245311 (E_RNA) where: Base-Base interactions energy: -42.155 where: short stacking energy: -31.765 Base-Backbone interact. energy: -0.089 local terms energy: -55.001651 where: bonds (distance) C4'-P energy: -12.028 bonds (distance) P-C4' energy: -14.600 flat angles C4'-P-C4' energy: -11.655 flat angles P-C4'-P energy: -6.429 tors. eta vs tors. theta energy: -10.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -109.279167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.279167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.279167 (E_RNA) where: Base-Base interactions energy: -61.689 where: short stacking energy: -27.668 Base-Backbone interact. energy: -0.248 local terms energy: -47.342188 where: bonds (distance) C4'-P energy: -11.644 bonds (distance) P-C4' energy: -13.475 flat angles C4'-P-C4' energy: -12.129 flat angles P-C4'-P energy: -9.031 tors. eta vs tors. theta energy: -1.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -71.491706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.491706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.491706 (E_RNA) where: Base-Base interactions energy: -39.730 where: short stacking energy: -15.045 Base-Backbone interact. energy: -0.188 local terms energy: -31.572928 where: bonds (distance) C4'-P energy: -10.331 bonds (distance) P-C4' energy: -8.563 flat angles C4'-P-C4' energy: -14.044 flat angles P-C4'-P energy: -6.967 tors. eta vs tors. theta energy: 8.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -81.342563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.342563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.342563 (E_RNA) where: Base-Base interactions energy: -33.171 where: short stacking energy: -24.504 Base-Backbone interact. energy: -0.741 local terms energy: -47.429713 where: bonds (distance) C4'-P energy: -14.848 bonds (distance) P-C4' energy: -10.063 flat angles C4'-P-C4' energy: -13.075 flat angles P-C4'-P energy: -7.675 tors. eta vs tors. theta energy: -1.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -221.670720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.670720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.670720 (E_RNA) where: Base-Base interactions energy: -141.201 where: short stacking energy: -55.465 Base-Backbone interact. energy: -1.265 local terms energy: -79.204196 where: bonds (distance) C4'-P energy: -16.723 bonds (distance) P-C4' energy: -17.267 flat angles C4'-P-C4' energy: -15.441 flat angles P-C4'-P energy: -8.982 tors. eta vs tors. theta energy: -20.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -203.171178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.171178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.171178 (E_RNA) where: Base-Base interactions energy: -142.426 where: short stacking energy: -64.530 Base-Backbone interact. energy: 0.890 local terms energy: -61.635186 where: bonds (distance) C4'-P energy: -14.091 bonds (distance) P-C4' energy: -9.402 flat angles C4'-P-C4' energy: -14.293 flat angles P-C4'-P energy: -7.568 tors. eta vs tors. theta energy: -16.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -176.802517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.802517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.802517 (E_RNA) where: Base-Base interactions energy: -104.340 where: short stacking energy: -55.313 Base-Backbone interact. energy: -0.273 local terms energy: -72.189566 where: bonds (distance) C4'-P energy: -11.664 bonds (distance) P-C4' energy: -16.868 flat angles C4'-P-C4' energy: -18.082 flat angles P-C4'-P energy: -11.196 tors. eta vs tors. theta energy: -14.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -147.843131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.843131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.843131 (E_RNA) where: Base-Base interactions energy: -88.818 where: short stacking energy: -40.273 Base-Backbone interact. energy: -1.362 local terms energy: -57.663394 where: bonds (distance) C4'-P energy: -14.371 bonds (distance) P-C4' energy: -14.592 flat angles C4'-P-C4' energy: -9.365 flat angles P-C4'-P energy: -10.102 tors. eta vs tors. theta energy: -9.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -155.505653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.505653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.505653 (E_RNA) where: Base-Base interactions energy: -103.343 where: short stacking energy: -43.960 Base-Backbone interact. energy: -0.012 local terms energy: -52.151533 where: bonds (distance) C4'-P energy: -11.829 bonds (distance) P-C4' energy: -12.077 flat angles C4'-P-C4' energy: -7.643 flat angles P-C4'-P energy: -4.301 tors. eta vs tors. theta energy: -16.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -148.476208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.476208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.476208 (E_RNA) where: Base-Base interactions energy: -89.048 where: short stacking energy: -46.023 Base-Backbone interact. energy: -0.076 local terms energy: -59.352456 where: bonds (distance) C4'-P energy: -12.620 bonds (distance) P-C4' energy: -14.613 flat angles C4'-P-C4' energy: -12.462 flat angles P-C4'-P energy: -6.682 tors. eta vs tors. theta energy: -12.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -150.242826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.242826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.242826 (E_RNA) where: Base-Base interactions energy: -91.965 where: short stacking energy: -35.155 Base-Backbone interact. energy: 0.523 local terms energy: -58.800119 where: bonds (distance) C4'-P energy: -14.944 bonds (distance) P-C4' energy: -14.135 flat angles C4'-P-C4' energy: -9.770 flat angles P-C4'-P energy: -9.557 tors. eta vs tors. theta energy: -10.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -128.799358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.799358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.799358 (E_RNA) where: Base-Base interactions energy: -67.226 where: short stacking energy: -36.792 Base-Backbone interact. energy: -0.767 local terms energy: -60.807245 where: bonds (distance) C4'-P energy: -14.977 bonds (distance) P-C4' energy: -13.277 flat angles C4'-P-C4' energy: -13.406 flat angles P-C4'-P energy: -8.660 tors. eta vs tors. theta energy: -10.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -80.631161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.631161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.631161 (E_RNA) where: Base-Base interactions energy: -33.829 where: short stacking energy: -9.645 Base-Backbone interact. energy: -0.253 local terms energy: -46.549659 where: bonds (distance) C4'-P energy: -13.270 bonds (distance) P-C4' energy: -16.397 flat angles C4'-P-C4' energy: -8.469 flat angles P-C4'-P energy: -11.238 tors. eta vs tors. theta energy: 2.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -70.880771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.880771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.880771 (E_RNA) where: Base-Base interactions energy: -29.489 where: short stacking energy: -16.077 Base-Backbone interact. energy: 0.452 local terms energy: -41.843443 where: bonds (distance) C4'-P energy: -13.767 bonds (distance) P-C4' energy: -14.784 flat angles C4'-P-C4' energy: -7.843 flat angles P-C4'-P energy: -6.928 tors. eta vs tors. theta energy: 1.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -224.966339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.966339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.966339 (E_RNA) where: Base-Base interactions energy: -146.970 where: short stacking energy: -61.943 Base-Backbone interact. energy: -0.782 local terms energy: -77.213826 where: bonds (distance) C4'-P energy: -17.013 bonds (distance) P-C4' energy: -16.681 flat angles C4'-P-C4' energy: -17.714 flat angles P-C4'-P energy: -10.214 tors. eta vs tors. theta energy: -15.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -192.104713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.104713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.104713 (E_RNA) where: Base-Base interactions energy: -122.213 where: short stacking energy: -53.413 Base-Backbone interact. energy: -0.013 local terms energy: -69.878859 where: bonds (distance) C4'-P energy: -12.778 bonds (distance) P-C4' energy: -17.114 flat angles C4'-P-C4' energy: -13.391 flat angles P-C4'-P energy: -9.380 tors. eta vs tors. theta energy: -17.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -193.561802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.561802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.561802 (E_RNA) where: Base-Base interactions energy: -121.896 where: short stacking energy: -63.730 Base-Backbone interact. energy: -0.751 local terms energy: -70.914963 where: bonds (distance) C4'-P energy: -12.699 bonds (distance) P-C4' energy: -10.843 flat angles C4'-P-C4' energy: -16.468 flat angles P-C4'-P energy: -10.371 tors. eta vs tors. theta energy: -20.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -170.781426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.781426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.781426 (E_RNA) where: Base-Base interactions energy: -110.450 where: short stacking energy: -33.218 Base-Backbone interact. energy: -0.130 local terms energy: -60.201469 where: bonds (distance) C4'-P energy: -17.567 bonds (distance) P-C4' energy: -15.808 flat angles C4'-P-C4' energy: -5.786 flat angles P-C4'-P energy: -9.703 tors. eta vs tors. theta energy: -11.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -155.125686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.125686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.125686 (E_RNA) where: Base-Base interactions energy: -89.182 where: short stacking energy: -35.954 Base-Backbone interact. energy: -0.540 local terms energy: -65.403627 where: bonds (distance) C4'-P energy: -16.686 bonds (distance) P-C4' energy: -11.641 flat angles C4'-P-C4' energy: -16.601 flat angles P-C4'-P energy: -8.890 tors. eta vs tors. theta energy: -11.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -177.452390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.452390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.452390 (E_RNA) where: Base-Base interactions energy: -117.151 where: short stacking energy: -45.026 Base-Backbone interact. energy: -0.140 local terms energy: -60.161321 where: bonds (distance) C4'-P energy: -14.724 bonds (distance) P-C4' energy: -9.561 flat angles C4'-P-C4' energy: -12.286 flat angles P-C4'-P energy: -9.179 tors. eta vs tors. theta energy: -14.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -147.117006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.117006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.117006 (E_RNA) where: Base-Base interactions energy: -87.522 where: short stacking energy: -40.784 Base-Backbone interact. energy: -0.100 local terms energy: -59.495049 where: bonds (distance) C4'-P energy: -14.243 bonds (distance) P-C4' energy: -14.250 flat angles C4'-P-C4' energy: -12.180 flat angles P-C4'-P energy: -14.100 tors. eta vs tors. theta energy: -4.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -138.428677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.428677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.428677 (E_RNA) where: Base-Base interactions energy: -81.448 where: short stacking energy: -36.744 Base-Backbone interact. energy: -0.184 local terms energy: -56.797198 where: bonds (distance) C4'-P energy: -14.774 bonds (distance) P-C4' energy: -13.729 flat angles C4'-P-C4' energy: -14.805 flat angles P-C4'-P energy: -6.035 tors. eta vs tors. theta energy: -7.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -102.495796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.495796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.495796 (E_RNA) where: Base-Base interactions energy: -62.699 where: short stacking energy: -28.576 Base-Backbone interact. energy: -0.258 local terms energy: -39.538842 where: bonds (distance) C4'-P energy: -12.931 bonds (distance) P-C4' energy: -10.021 flat angles C4'-P-C4' energy: -9.078 flat angles P-C4'-P energy: -5.010 tors. eta vs tors. theta energy: -2.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -74.027432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.027432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.027432 (E_RNA) where: Base-Base interactions energy: -26.531 where: short stacking energy: -25.000 Base-Backbone interact. energy: -0.668 local terms energy: -46.828739 where: bonds (distance) C4'-P energy: -13.353 bonds (distance) P-C4' energy: -13.224 flat angles C4'-P-C4' energy: -13.372 flat angles P-C4'-P energy: -4.799 tors. eta vs tors. theta energy: -2.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -219.825806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.825806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.825806 (E_RNA) where: Base-Base interactions energy: -149.855 where: short stacking energy: -59.422 Base-Backbone interact. energy: -0.297 local terms energy: -69.673948 where: bonds (distance) C4'-P energy: -16.744 bonds (distance) P-C4' energy: -15.182 flat angles C4'-P-C4' energy: -15.943 flat angles P-C4'-P energy: -5.711 tors. eta vs tors. theta energy: -16.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -194.039869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.039869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.039869 (E_RNA) where: Base-Base interactions energy: -129.611 where: short stacking energy: -55.461 Base-Backbone interact. energy: -0.159 local terms energy: -64.268943 where: bonds (distance) C4'-P energy: -9.702 bonds (distance) P-C4' energy: -17.939 flat angles C4'-P-C4' energy: -9.793 flat angles P-C4'-P energy: -8.964 tors. eta vs tors. theta energy: -17.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -196.389660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.389660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.389660 (E_RNA) where: Base-Base interactions energy: -119.743 where: short stacking energy: -61.738 Base-Backbone interact. energy: -1.455 local terms energy: -75.192153 where: bonds (distance) C4'-P energy: -14.192 bonds (distance) P-C4' energy: -14.327 flat angles C4'-P-C4' energy: -18.481 flat angles P-C4'-P energy: -9.925 tors. eta vs tors. theta energy: -18.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -164.317214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.317214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.317214 (E_RNA) where: Base-Base interactions energy: -104.230 where: short stacking energy: -42.656 Base-Backbone interact. energy: -0.076 local terms energy: -60.011175 where: bonds (distance) C4'-P energy: -15.593 bonds (distance) P-C4' energy: -11.670 flat angles C4'-P-C4' energy: -16.122 flat angles P-C4'-P energy: -4.920 tors. eta vs tors. theta energy: -11.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -173.710734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.710734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.710734 (E_RNA) where: Base-Base interactions energy: -110.615 where: short stacking energy: -40.257 Base-Backbone interact. energy: 0.053 local terms energy: -63.149085 where: bonds (distance) C4'-P energy: -15.725 bonds (distance) P-C4' energy: -17.397 flat angles C4'-P-C4' energy: -10.086 flat angles P-C4'-P energy: -6.716 tors. eta vs tors. theta energy: -13.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -127.203163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.203163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.203163 (E_RNA) where: Base-Base interactions energy: -80.772 where: short stacking energy: -30.899 Base-Backbone interact. energy: -0.681 local terms energy: -45.750458 where: bonds (distance) C4'-P energy: -6.543 bonds (distance) P-C4' energy: -11.674 flat angles C4'-P-C4' energy: -14.964 flat angles P-C4'-P energy: -8.547 tors. eta vs tors. theta energy: -4.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -85.840861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.840861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.840861 (E_RNA) where: Base-Base interactions energy: -38.133 where: short stacking energy: -22.100 Base-Backbone interact. energy: 0.047 local terms energy: -47.755290 where: bonds (distance) C4'-P energy: -9.387 bonds (distance) P-C4' energy: -14.854 flat angles C4'-P-C4' energy: -16.371 flat angles P-C4'-P energy: -7.984 tors. eta vs tors. theta energy: 0.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -123.404682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.404682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.404682 (E_RNA) where: Base-Base interactions energy: -73.624 where: short stacking energy: -35.491 Base-Backbone interact. energy: -0.064 local terms energy: -49.716295 where: bonds (distance) C4'-P energy: -8.191 bonds (distance) P-C4' energy: -12.115 flat angles C4'-P-C4' energy: -9.621 flat angles P-C4'-P energy: -9.367 tors. eta vs tors. theta energy: -10.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -91.953260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.953260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.953260 (E_RNA) where: Base-Base interactions energy: -45.639 where: short stacking energy: -26.288 Base-Backbone interact. energy: -0.080 local terms energy: -46.234499 where: bonds (distance) C4'-P energy: -14.149 bonds (distance) P-C4' energy: -16.612 flat angles C4'-P-C4' energy: -9.118 flat angles P-C4'-P energy: -1.360 tors. eta vs tors. theta energy: -4.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -100.790926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.790926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.790926 (E_RNA) where: Base-Base interactions energy: -49.993 where: short stacking energy: -17.796 Base-Backbone interact. energy: 1.940 local terms energy: -52.738695 where: bonds (distance) C4'-P energy: -12.373 bonds (distance) P-C4' energy: -14.940 flat angles C4'-P-C4' energy: -8.369 flat angles P-C4'-P energy: -9.917 tors. eta vs tors. theta energy: -7.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -213.501876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.501876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.501876 (E_RNA) where: Base-Base interactions energy: -148.613 where: short stacking energy: -55.622 Base-Backbone interact. energy: -0.804 local terms energy: -64.084619 where: bonds (distance) C4'-P energy: -12.546 bonds (distance) P-C4' energy: -11.291 flat angles C4'-P-C4' energy: -16.412 flat angles P-C4'-P energy: -6.484 tors. eta vs tors. theta energy: -17.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -184.387774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.387774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.387774 (E_RNA) where: Base-Base interactions energy: -117.729 where: short stacking energy: -54.572 Base-Backbone interact. energy: -0.486 local terms energy: -66.173434 where: bonds (distance) C4'-P energy: -16.777 bonds (distance) P-C4' energy: -17.267 flat angles C4'-P-C4' energy: -14.093 flat angles P-C4'-P energy: -5.868 tors. eta vs tors. theta energy: -12.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -184.813421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.813421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.813421 (E_RNA) where: Base-Base interactions energy: -106.181 where: short stacking energy: -58.356 Base-Backbone interact. energy: -0.460 local terms energy: -78.173126 where: bonds (distance) C4'-P energy: -16.020 bonds (distance) P-C4' energy: -18.208 flat angles C4'-P-C4' energy: -15.202 flat angles P-C4'-P energy: -9.764 tors. eta vs tors. theta energy: -18.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -187.846373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.846373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.846373 (E_RNA) where: Base-Base interactions energy: -116.839 where: short stacking energy: -43.505 Base-Backbone interact. energy: -0.676 local terms energy: -70.331901 where: bonds (distance) C4'-P energy: -12.832 bonds (distance) P-C4' energy: -17.559 flat angles C4'-P-C4' energy: -16.687 flat angles P-C4'-P energy: -8.498 tors. eta vs tors. theta energy: -14.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -144.609144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.609144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.609144 (E_RNA) where: Base-Base interactions energy: -90.479 where: short stacking energy: -31.645 Base-Backbone interact. energy: -0.115 local terms energy: -54.014890 where: bonds (distance) C4'-P energy: -10.963 bonds (distance) P-C4' energy: -12.387 flat angles C4'-P-C4' energy: -14.201 flat angles P-C4'-P energy: -8.373 tors. eta vs tors. theta energy: -8.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -93.544144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.544144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.544144 (E_RNA) where: Base-Base interactions energy: -46.585 where: short stacking energy: -23.055 Base-Backbone interact. energy: -0.174 local terms energy: -46.785268 where: bonds (distance) C4'-P energy: -12.393 bonds (distance) P-C4' energy: -15.589 flat angles C4'-P-C4' energy: -12.448 flat angles P-C4'-P energy: -7.352 tors. eta vs tors. theta energy: 0.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -132.907437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.907437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.907437 (E_RNA) where: Base-Base interactions energy: -84.856 where: short stacking energy: -35.270 Base-Backbone interact. energy: -0.177 local terms energy: -47.874770 where: bonds (distance) C4'-P energy: -10.454 bonds (distance) P-C4' energy: -12.295 flat angles C4'-P-C4' energy: -9.998 flat angles P-C4'-P energy: -11.962 tors. eta vs tors. theta energy: -3.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -99.695957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.695957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.695957 (E_RNA) where: Base-Base interactions energy: -47.962 where: short stacking energy: -20.403 Base-Backbone interact. energy: -0.323 local terms energy: -51.411513 where: bonds (distance) C4'-P energy: -13.437 bonds (distance) P-C4' energy: -8.829 flat angles C4'-P-C4' energy: -10.366 flat angles P-C4'-P energy: -8.886 tors. eta vs tors. theta energy: -9.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -73.826409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.826409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.826409 (E_RNA) where: Base-Base interactions energy: -30.316 where: short stacking energy: -22.783 Base-Backbone interact. energy: -0.666 local terms energy: -42.844368 where: bonds (distance) C4'-P energy: -11.659 bonds (distance) P-C4' energy: -14.711 flat angles C4'-P-C4' energy: -15.469 flat angles P-C4'-P energy: -5.161 tors. eta vs tors. theta energy: 4.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -79.648278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.648278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.648278 (E_RNA) where: Base-Base interactions energy: -30.710 where: short stacking energy: -29.396 Base-Backbone interact. energy: -0.071 local terms energy: -48.867060 where: bonds (distance) C4'-P energy: -14.380 bonds (distance) P-C4' energy: -13.531 flat angles C4'-P-C4' energy: -13.122 flat angles P-C4'-P energy: -6.860 tors. eta vs tors. theta energy: -0.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -221.694933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.694933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.694933 (E_RNA) where: Base-Base interactions energy: -148.155 where: short stacking energy: -62.047 Base-Backbone interact. energy: 0.265 local terms energy: -73.805331 where: bonds (distance) C4'-P energy: -16.666 bonds (distance) P-C4' energy: -14.034 flat angles C4'-P-C4' energy: -15.418 flat angles P-C4'-P energy: -8.693 tors. eta vs tors. theta energy: -18.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -196.008352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.008352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.008352 (E_RNA) where: Base-Base interactions energy: -126.155 where: short stacking energy: -51.575 Base-Backbone interact. energy: 0.664 local terms energy: -70.517591 where: bonds (distance) C4'-P energy: -13.022 bonds (distance) P-C4' energy: -14.142 flat angles C4'-P-C4' energy: -16.818 flat angles P-C4'-P energy: -13.676 tors. eta vs tors. theta energy: -12.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -205.909114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.909114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.909114 (E_RNA) where: Base-Base interactions energy: -136.757 where: short stacking energy: -58.806 Base-Backbone interact. energy: -0.135 local terms energy: -69.017861 where: bonds (distance) C4'-P energy: -14.164 bonds (distance) P-C4' energy: -16.287 flat angles C4'-P-C4' energy: -14.620 flat angles P-C4'-P energy: -5.986 tors. eta vs tors. theta energy: -17.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -194.812405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.812405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.812405 (E_RNA) where: Base-Base interactions energy: -115.699 where: short stacking energy: -60.042 Base-Backbone interact. energy: -0.957 local terms energy: -78.156755 where: bonds (distance) C4'-P energy: -15.179 bonds (distance) P-C4' energy: -15.052 flat angles C4'-P-C4' energy: -15.034 flat angles P-C4'-P energy: -11.868 tors. eta vs tors. theta energy: -21.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -167.041931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.041931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.041931 (E_RNA) where: Base-Base interactions energy: -106.451 where: short stacking energy: -34.435 Base-Backbone interact. energy: -0.138 local terms energy: -60.452490 where: bonds (distance) C4'-P energy: -11.627 bonds (distance) P-C4' energy: -16.302 flat angles C4'-P-C4' energy: -9.896 flat angles P-C4'-P energy: -8.767 tors. eta vs tors. theta energy: -13.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -121.110666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.110666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.110666 (E_RNA) where: Base-Base interactions energy: -59.328 where: short stacking energy: -34.491 Base-Backbone interact. energy: -0.109 local terms energy: -61.673792 where: bonds (distance) C4'-P energy: -13.188 bonds (distance) P-C4' energy: -18.175 flat angles C4'-P-C4' energy: -12.996 flat angles P-C4'-P energy: -10.508 tors. eta vs tors. theta energy: -6.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -169.867619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.867619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.867619 (E_RNA) where: Base-Base interactions energy: -106.457 where: short stacking energy: -36.633 Base-Backbone interact. energy: -0.101 local terms energy: -63.310297 where: bonds (distance) C4'-P energy: -11.209 bonds (distance) P-C4' energy: -13.633 flat angles C4'-P-C4' energy: -15.064 flat angles P-C4'-P energy: -11.353 tors. eta vs tors. theta energy: -12.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -73.063977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.063977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.063977 (E_RNA) where: Base-Base interactions energy: -29.518 where: short stacking energy: -16.041 Base-Backbone interact. energy: -0.381 local terms energy: -43.164649 where: bonds (distance) C4'-P energy: -13.180 bonds (distance) P-C4' energy: -11.101 flat angles C4'-P-C4' energy: -15.733 flat angles P-C4'-P energy: -9.596 tors. eta vs tors. theta energy: 6.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -80.888424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.888424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.888424 (E_RNA) where: Base-Base interactions energy: -27.370 where: short stacking energy: -22.553 Base-Backbone interact. energy: -0.413 local terms energy: -53.105618 where: bonds (distance) C4'-P energy: -16.057 bonds (distance) P-C4' energy: -15.113 flat angles C4'-P-C4' energy: -12.359 flat angles P-C4'-P energy: -5.222 tors. eta vs tors. theta energy: -4.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -65.801590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.801590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.801590 (E_RNA) where: Base-Base interactions energy: -17.879 where: short stacking energy: -17.118 Base-Backbone interact. energy: 0.053 local terms energy: -47.975221 where: bonds (distance) C4'-P energy: -15.266 bonds (distance) P-C4' energy: -18.433 flat angles C4'-P-C4' energy: -10.253 flat angles P-C4'-P energy: -8.540 tors. eta vs tors. theta energy: 4.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -224.238157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.238157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.238157 (E_RNA) where: Base-Base interactions energy: -145.187 where: short stacking energy: -61.874 Base-Backbone interact. energy: -1.845 local terms energy: -77.206237 where: bonds (distance) C4'-P energy: -16.052 bonds (distance) P-C4' energy: -15.649 flat angles C4'-P-C4' energy: -14.674 flat angles P-C4'-P energy: -12.164 tors. eta vs tors. theta energy: -18.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -189.982849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.982849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.982849 (E_RNA) where: Base-Base interactions energy: -121.562 where: short stacking energy: -56.041 Base-Backbone interact. energy: -0.567 local terms energy: -67.854098 where: bonds (distance) C4'-P energy: -12.215 bonds (distance) P-C4' energy: -16.863 flat angles C4'-P-C4' energy: -14.985 flat angles P-C4'-P energy: -11.231 tors. eta vs tors. theta energy: -12.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -214.498659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.498659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.498659 (E_RNA) where: Base-Base interactions energy: -143.055 where: short stacking energy: -60.303 Base-Backbone interact. energy: -0.167 local terms energy: -71.276867 where: bonds (distance) C4'-P energy: -14.060 bonds (distance) P-C4' energy: -17.495 flat angles C4'-P-C4' energy: -14.035 flat angles P-C4'-P energy: -8.591 tors. eta vs tors. theta energy: -17.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -190.034211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.034211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.034211 (E_RNA) where: Base-Base interactions energy: -111.969 where: short stacking energy: -64.625 Base-Backbone interact. energy: -0.086 local terms energy: -77.979051 where: bonds (distance) C4'-P energy: -14.802 bonds (distance) P-C4' energy: -14.588 flat angles C4'-P-C4' energy: -15.949 flat angles P-C4'-P energy: -9.996 tors. eta vs tors. theta energy: -22.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -180.344827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.344827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.344827 (E_RNA) where: Base-Base interactions energy: -124.963 where: short stacking energy: -43.164 Base-Backbone interact. energy: -0.971 local terms energy: -54.409949 where: bonds (distance) C4'-P energy: -16.615 bonds (distance) P-C4' energy: -9.390 flat angles C4'-P-C4' energy: -9.471 flat angles P-C4'-P energy: -5.606 tors. eta vs tors. theta energy: -13.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -137.541640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.541640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.541640 (E_RNA) where: Base-Base interactions energy: -77.846 where: short stacking energy: -39.861 Base-Backbone interact. energy: -0.197 local terms energy: -59.498643 where: bonds (distance) C4'-P energy: -14.951 bonds (distance) P-C4' energy: -15.480 flat angles C4'-P-C4' energy: -10.716 flat angles P-C4'-P energy: -11.029 tors. eta vs tors. theta energy: -7.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -92.990019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.990019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.990019 (E_RNA) where: Base-Base interactions energy: -42.431 where: short stacking energy: -21.657 Base-Backbone interact. energy: -0.172 local terms energy: -50.387391 where: bonds (distance) C4'-P energy: -10.187 bonds (distance) P-C4' energy: -15.506 flat angles C4'-P-C4' energy: -12.584 flat angles P-C4'-P energy: -7.008 tors. eta vs tors. theta energy: -5.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -77.842362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.842362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.842362 (E_RNA) where: Base-Base interactions energy: -22.001 where: short stacking energy: -19.360 Base-Backbone interact. energy: 0.587 local terms energy: -56.428444 where: bonds (distance) C4'-P energy: -14.439 bonds (distance) P-C4' energy: -14.794 flat angles C4'-P-C4' energy: -13.547 flat angles P-C4'-P energy: -8.520 tors. eta vs tors. theta energy: -5.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -75.447063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.447063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.447063 (E_RNA) where: Base-Base interactions energy: -27.293 where: short stacking energy: -17.194 Base-Backbone interact. energy: -0.645 local terms energy: -47.509495 where: bonds (distance) C4'-P energy: -13.817 bonds (distance) P-C4' energy: -13.394 flat angles C4'-P-C4' energy: -12.898 flat angles P-C4'-P energy: -9.504 tors. eta vs tors. theta energy: 2.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -79.687505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.687505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.687505 (E_RNA) where: Base-Base interactions energy: -35.515 where: short stacking energy: -12.467 Base-Backbone interact. energy: -0.738 local terms energy: -43.435160 where: bonds (distance) C4'-P energy: -12.189 bonds (distance) P-C4' energy: -18.641 flat angles C4'-P-C4' energy: -10.628 flat angles P-C4'-P energy: -3.744 tors. eta vs tors. theta energy: 1.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -222.554460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.554460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.554460 (E_RNA) where: Base-Base interactions energy: -149.712 where: short stacking energy: -61.794 Base-Backbone interact. energy: -0.570 local terms energy: -72.272292 where: bonds (distance) C4'-P energy: -14.777 bonds (distance) P-C4' energy: -18.178 flat angles C4'-P-C4' energy: -10.801 flat angles P-C4'-P energy: -11.547 tors. eta vs tors. theta energy: -16.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -200.765818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.765818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.765818 (E_RNA) where: Base-Base interactions energy: -126.230 where: short stacking energy: -53.639 Base-Backbone interact. energy: 0.547 local terms energy: -75.083037 where: bonds (distance) C4'-P energy: -15.879 bonds (distance) P-C4' energy: -15.586 flat angles C4'-P-C4' energy: -16.474 flat angles P-C4'-P energy: -11.892 tors. eta vs tors. theta energy: -15.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -212.736564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.736564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.736564 (E_RNA) where: Base-Base interactions energy: -145.802 where: short stacking energy: -54.075 Base-Backbone interact. energy: -0.462 local terms energy: -66.472375 where: bonds (distance) C4'-P energy: -15.033 bonds (distance) P-C4' energy: -16.001 flat angles C4'-P-C4' energy: -9.611 flat angles P-C4'-P energy: -10.406 tors. eta vs tors. theta energy: -15.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -189.303390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.303390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.303390 (E_RNA) where: Base-Base interactions energy: -113.769 where: short stacking energy: -62.639 Base-Backbone interact. energy: -0.730 local terms energy: -74.804215 where: bonds (distance) C4'-P energy: -7.950 bonds (distance) P-C4' energy: -17.122 flat angles C4'-P-C4' energy: -15.674 flat angles P-C4'-P energy: -11.519 tors. eta vs tors. theta energy: -22.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -171.613820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.613820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.613820 (E_RNA) where: Base-Base interactions energy: -108.331 where: short stacking energy: -43.661 Base-Backbone interact. energy: 1.142 local terms energy: -64.424558 where: bonds (distance) C4'-P energy: -13.738 bonds (distance) P-C4' energy: -12.615 flat angles C4'-P-C4' energy: -13.675 flat angles P-C4'-P energy: -12.566 tors. eta vs tors. theta energy: -11.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -153.182028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.182028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.182028 (E_RNA) where: Base-Base interactions energy: -89.085 where: short stacking energy: -42.546 Base-Backbone interact. energy: 0.324 local terms energy: -64.421014 where: bonds (distance) C4'-P energy: -14.549 bonds (distance) P-C4' energy: -17.463 flat angles C4'-P-C4' energy: -12.337 flat angles P-C4'-P energy: -7.229 tors. eta vs tors. theta energy: -12.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -92.661479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.661479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.661479 (E_RNA) where: Base-Base interactions energy: -42.922 where: short stacking energy: -31.275 Base-Backbone interact. energy: -0.019 local terms energy: -49.720711 where: bonds (distance) C4'-P energy: -12.671 bonds (distance) P-C4' energy: -13.877 flat angles C4'-P-C4' energy: -7.941 flat angles P-C4'-P energy: -9.148 tors. eta vs tors. theta energy: -6.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -94.278135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.278135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.278135 (E_RNA) where: Base-Base interactions energy: -39.958 where: short stacking energy: -15.794 Base-Backbone interact. energy: -0.222 local terms energy: -54.098158 where: bonds (distance) C4'-P energy: -14.928 bonds (distance) P-C4' energy: -14.743 flat angles C4'-P-C4' energy: -11.691 flat angles P-C4'-P energy: -9.411 tors. eta vs tors. theta energy: -3.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -77.066253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.066253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.066253 (E_RNA) where: Base-Base interactions energy: -25.923 where: short stacking energy: -22.152 Base-Backbone interact. energy: -0.236 local terms energy: -50.906790 where: bonds (distance) C4'-P energy: -14.591 bonds (distance) P-C4' energy: -14.081 flat angles C4'-P-C4' energy: -15.264 flat angles P-C4'-P energy: -5.742 tors. eta vs tors. theta energy: -1.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -80.273819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.273819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.273819 (E_RNA) where: Base-Base interactions energy: -45.845 where: short stacking energy: -19.998 Base-Backbone interact. energy: -0.137 local terms energy: -34.291400 where: bonds (distance) C4'-P energy: -13.614 bonds (distance) P-C4' energy: -11.866 flat angles C4'-P-C4' energy: -6.278 flat angles P-C4'-P energy: -4.568 tors. eta vs tors. theta energy: 2.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -212.446233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.446233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.446233 (E_RNA) where: Base-Base interactions energy: -145.789 where: short stacking energy: -60.806 Base-Backbone interact. energy: 0.804 local terms energy: -67.461116 where: bonds (distance) C4'-P energy: -13.917 bonds (distance) P-C4' energy: -14.298 flat angles C4'-P-C4' energy: -15.040 flat angles P-C4'-P energy: -6.407 tors. eta vs tors. theta energy: -17.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -204.301266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.301266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.301266 (E_RNA) where: Base-Base interactions energy: -136.221 where: short stacking energy: -56.901 Base-Backbone interact. energy: -1.221 local terms energy: -66.859430 where: bonds (distance) C4'-P energy: -15.287 bonds (distance) P-C4' energy: -12.208 flat angles C4'-P-C4' energy: -13.928 flat angles P-C4'-P energy: -8.131 tors. eta vs tors. theta energy: -17.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -183.205855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.205855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.205855 (E_RNA) where: Base-Base interactions energy: -119.431 where: short stacking energy: -61.375 Base-Backbone interact. energy: -0.260 local terms energy: -63.514597 where: bonds (distance) C4'-P energy: -13.878 bonds (distance) P-C4' energy: -14.955 flat angles C4'-P-C4' energy: -12.012 flat angles P-C4'-P energy: -9.494 tors. eta vs tors. theta energy: -13.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -176.470440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.470440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.470440 (E_RNA) where: Base-Base interactions energy: -111.581 where: short stacking energy: -58.306 Base-Backbone interact. energy: -0.570 local terms energy: -64.319057 where: bonds (distance) C4'-P energy: -14.457 bonds (distance) P-C4' energy: -11.415 flat angles C4'-P-C4' energy: -15.912 flat angles P-C4'-P energy: -6.461 tors. eta vs tors. theta energy: -16.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -173.558969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.558969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.558969 (E_RNA) where: Base-Base interactions energy: -109.748 where: short stacking energy: -41.396 Base-Backbone interact. energy: -1.404 local terms energy: -62.407413 where: bonds (distance) C4'-P energy: -11.126 bonds (distance) P-C4' energy: -16.175 flat angles C4'-P-C4' energy: -15.281 flat angles P-C4'-P energy: -11.144 tors. eta vs tors. theta energy: -8.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -147.296365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.296365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.296365 (E_RNA) where: Base-Base interactions energy: -90.602 where: short stacking energy: -36.804 Base-Backbone interact. energy: -0.113 local terms energy: -56.581452 where: bonds (distance) C4'-P energy: -14.495 bonds (distance) P-C4' energy: -10.031 flat angles C4'-P-C4' energy: -15.308 flat angles P-C4'-P energy: -6.058 tors. eta vs tors. theta energy: -10.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -86.842873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.842873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.842873 (E_RNA) where: Base-Base interactions energy: -34.298 where: short stacking energy: -24.898 Base-Backbone interact. energy: -1.000 local terms energy: -51.544487 where: bonds (distance) C4'-P energy: -14.124 bonds (distance) P-C4' energy: -13.780 flat angles C4'-P-C4' energy: -14.449 flat angles P-C4'-P energy: -2.864 tors. eta vs tors. theta energy: -6.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -77.712110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.712110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.712110 (E_RNA) where: Base-Base interactions energy: -27.719 where: short stacking energy: -22.801 Base-Backbone interact. energy: -0.114 local terms energy: -49.878531 where: bonds (distance) C4'-P energy: -13.013 bonds (distance) P-C4' energy: -17.157 flat angles C4'-P-C4' energy: -13.490 flat angles P-C4'-P energy: -3.363 tors. eta vs tors. theta energy: -2.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -77.491206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.491206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.491206 (E_RNA) where: Base-Base interactions energy: -34.905 where: short stacking energy: -21.198 Base-Backbone interact. energy: -0.200 local terms energy: -42.385507 where: bonds (distance) C4'-P energy: -13.981 bonds (distance) P-C4' energy: -15.772 flat angles C4'-P-C4' energy: -8.633 flat angles P-C4'-P energy: -2.953 tors. eta vs tors. theta energy: -1.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -75.814287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.814287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.814287 (E_RNA) where: Base-Base interactions energy: -18.225 where: short stacking energy: -18.225 Base-Backbone interact. energy: -1.213 local terms energy: -56.376274 where: bonds (distance) C4'-P energy: -15.249 bonds (distance) P-C4' energy: -17.358 flat angles C4'-P-C4' energy: -12.968 flat angles P-C4'-P energy: -6.126 tors. eta vs tors. theta energy: -4.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -222.407306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.407306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.407306 (E_RNA) where: Base-Base interactions energy: -149.766 where: short stacking energy: -53.514 Base-Backbone interact. energy: -1.010 local terms energy: -71.631229 where: bonds (distance) C4'-P energy: -15.623 bonds (distance) P-C4' energy: -16.859 flat angles C4'-P-C4' energy: -9.788 flat angles P-C4'-P energy: -10.329 tors. eta vs tors. theta energy: -19.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -220.037651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.037651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.037651 (E_RNA) where: Base-Base interactions energy: -141.560 where: short stacking energy: -56.785 Base-Backbone interact. energy: -0.724 local terms energy: -77.753881 where: bonds (distance) C4'-P energy: -14.915 bonds (distance) P-C4' energy: -17.234 flat angles C4'-P-C4' energy: -15.222 flat angles P-C4'-P energy: -13.854 tors. eta vs tors. theta energy: -16.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -183.212126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.212126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.212126 (E_RNA) where: Base-Base interactions energy: -113.797 where: short stacking energy: -59.392 Base-Backbone interact. energy: -0.115 local terms energy: -69.300801 where: bonds (distance) C4'-P energy: -10.927 bonds (distance) P-C4' energy: -12.739 flat angles C4'-P-C4' energy: -15.590 flat angles P-C4'-P energy: -12.119 tors. eta vs tors. theta energy: -17.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -167.556176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.556176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.556176 (E_RNA) where: Base-Base interactions energy: -110.052 where: short stacking energy: -40.554 Base-Backbone interact. energy: 0.829 local terms energy: -58.333401 where: bonds (distance) C4'-P energy: -15.606 bonds (distance) P-C4' energy: -13.927 flat angles C4'-P-C4' energy: -12.824 flat angles P-C4'-P energy: -7.293 tors. eta vs tors. theta energy: -8.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -183.104134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.104134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.104134 (E_RNA) where: Base-Base interactions energy: -125.235 where: short stacking energy: -54.326 Base-Backbone interact. energy: -0.474 local terms energy: -57.395311 where: bonds (distance) C4'-P energy: -9.777 bonds (distance) P-C4' energy: -13.627 flat angles C4'-P-C4' energy: -16.286 flat angles P-C4'-P energy: -4.314 tors. eta vs tors. theta energy: -13.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -146.021349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.021349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.021349 (E_RNA) where: Base-Base interactions energy: -94.046 where: short stacking energy: -33.278 Base-Backbone interact. energy: -0.495 local terms energy: -51.479748 where: bonds (distance) C4'-P energy: -12.761 bonds (distance) P-C4' energy: -9.330 flat angles C4'-P-C4' energy: -15.340 flat angles P-C4'-P energy: -7.186 tors. eta vs tors. theta energy: -6.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -80.198901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.198901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.198901 (E_RNA) where: Base-Base interactions energy: -34.847 where: short stacking energy: -26.297 Base-Backbone interact. energy: -0.573 local terms energy: -44.779175 where: bonds (distance) C4'-P energy: -6.365 bonds (distance) P-C4' energy: -14.605 flat angles C4'-P-C4' energy: -15.812 flat angles P-C4'-P energy: -6.300 tors. eta vs tors. theta energy: -1.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -74.562639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.562639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.562639 (E_RNA) where: Base-Base interactions energy: -30.335 where: short stacking energy: -28.827 Base-Backbone interact. energy: 0.056 local terms energy: -44.283999 where: bonds (distance) C4'-P energy: -10.658 bonds (distance) P-C4' energy: -16.166 flat angles C4'-P-C4' energy: -9.050 flat angles P-C4'-P energy: -6.031 tors. eta vs tors. theta energy: -2.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -100.255525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.255525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.255525 (E_RNA) where: Base-Base interactions energy: -36.058 where: short stacking energy: -33.621 Base-Backbone interact. energy: 0.266 local terms energy: -64.463961 where: bonds (distance) C4'-P energy: -11.044 bonds (distance) P-C4' energy: -15.344 flat angles C4'-P-C4' energy: -14.960 flat angles P-C4'-P energy: -11.133 tors. eta vs tors. theta energy: -11.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -69.714770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.714770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.714770 (E_RNA) where: Base-Base interactions energy: -24.490 where: short stacking energy: -17.690 Base-Backbone interact. energy: 1.329 local terms energy: -46.553683 where: bonds (distance) C4'-P energy: -12.443 bonds (distance) P-C4' energy: -14.372 flat angles C4'-P-C4' energy: -12.706 flat angles P-C4'-P energy: -7.190 tors. eta vs tors. theta energy: 0.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -222.980597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.980597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.980597 (E_RNA) where: Base-Base interactions energy: -148.779 where: short stacking energy: -57.307 Base-Backbone interact. energy: -0.254 local terms energy: -73.947914 where: bonds (distance) C4'-P energy: -15.473 bonds (distance) P-C4' energy: -15.497 flat angles C4'-P-C4' energy: -13.572 flat angles P-C4'-P energy: -9.286 tors. eta vs tors. theta energy: -20.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -217.121612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.121612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.121612 (E_RNA) where: Base-Base interactions energy: -144.474 where: short stacking energy: -60.385 Base-Backbone interact. energy: -0.076 local terms energy: -72.571763 where: bonds (distance) C4'-P energy: -11.445 bonds (distance) P-C4' energy: -14.158 flat angles C4'-P-C4' energy: -17.327 flat angles P-C4'-P energy: -9.135 tors. eta vs tors. theta energy: -20.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -188.557032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.557032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.557032 (E_RNA) where: Base-Base interactions energy: -118.435 where: short stacking energy: -61.349 Base-Backbone interact. energy: -0.573 local terms energy: -69.548252 where: bonds (distance) C4'-P energy: -13.698 bonds (distance) P-C4' energy: -14.051 flat angles C4'-P-C4' energy: -14.456 flat angles P-C4'-P energy: -7.711 tors. eta vs tors. theta energy: -19.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -191.238816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.238816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.238816 (E_RNA) where: Base-Base interactions energy: -132.368 where: short stacking energy: -41.483 Base-Backbone interact. energy: -0.685 local terms energy: -58.186172 where: bonds (distance) C4'-P energy: -10.111 bonds (distance) P-C4' energy: -14.497 flat angles C4'-P-C4' energy: -13.372 flat angles P-C4'-P energy: -7.679 tors. eta vs tors. theta energy: -12.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -149.022430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.022430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.022430 (E_RNA) where: Base-Base interactions energy: -91.557 where: short stacking energy: -41.649 Base-Backbone interact. energy: -0.109 local terms energy: -57.356419 where: bonds (distance) C4'-P energy: -14.831 bonds (distance) P-C4' energy: -15.357 flat angles C4'-P-C4' energy: -15.409 flat angles P-C4'-P energy: -3.948 tors. eta vs tors. theta energy: -7.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -131.438054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.438054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.438054 (E_RNA) where: Base-Base interactions energy: -74.247 where: short stacking energy: -39.210 Base-Backbone interact. energy: -0.007 local terms energy: -57.184002 where: bonds (distance) C4'-P energy: -8.001 bonds (distance) P-C4' energy: -15.113 flat angles C4'-P-C4' energy: -13.389 flat angles P-C4'-P energy: -10.064 tors. eta vs tors. theta energy: -10.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -115.820902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.820902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.820902 (E_RNA) where: Base-Base interactions energy: -46.064 where: short stacking energy: -37.567 Base-Backbone interact. energy: -0.890 local terms energy: -68.867504 where: bonds (distance) C4'-P energy: -15.360 bonds (distance) P-C4' energy: -13.319 flat angles C4'-P-C4' energy: -14.941 flat angles P-C4'-P energy: -9.427 tors. eta vs tors. theta energy: -15.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -78.523657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.523657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.523657 (E_RNA) where: Base-Base interactions energy: -27.624 where: short stacking energy: -27.624 Base-Backbone interact. energy: -0.007 local terms energy: -50.893354 where: bonds (distance) C4'-P energy: -9.197 bonds (distance) P-C4' energy: -15.710 flat angles C4'-P-C4' energy: -12.977 flat angles P-C4'-P energy: -7.073 tors. eta vs tors. theta energy: -5.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -85.106177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.106177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.106177 (E_RNA) where: Base-Base interactions energy: -36.107 where: short stacking energy: -25.729 Base-Backbone interact. energy: -0.079 local terms energy: -48.920060 where: bonds (distance) C4'-P energy: -10.355 bonds (distance) P-C4' energy: -12.523 flat angles C4'-P-C4' energy: -14.253 flat angles P-C4'-P energy: -8.027 tors. eta vs tors. theta energy: -3.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -75.571980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.571980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.571980 (E_RNA) where: Base-Base interactions energy: -25.105 where: short stacking energy: -25.105 Base-Backbone interact. energy: -0.310 local terms energy: -50.156488 where: bonds (distance) C4'-P energy: -11.764 bonds (distance) P-C4' energy: -13.862 flat angles C4'-P-C4' energy: -10.433 flat angles P-C4'-P energy: -5.920 tors. eta vs tors. theta energy: -8.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -218.309794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.309794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.309794 (E_RNA) where: Base-Base interactions energy: -141.548 where: short stacking energy: -56.073 Base-Backbone interact. energy: -1.548 local terms energy: -75.213724 where: bonds (distance) C4'-P energy: -16.148 bonds (distance) P-C4' energy: -14.796 flat angles C4'-P-C4' energy: -17.780 flat angles P-C4'-P energy: -6.796 tors. eta vs tors. theta energy: -19.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -213.218421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.218421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.218421 (E_RNA) where: Base-Base interactions energy: -143.167 where: short stacking energy: -54.910 Base-Backbone interact. energy: -0.704 local terms energy: -69.346997 where: bonds (distance) C4'-P energy: -15.105 bonds (distance) P-C4' energy: -13.470 flat angles C4'-P-C4' energy: -12.316 flat angles P-C4'-P energy: -12.551 tors. eta vs tors. theta energy: -15.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -208.405058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.405058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.405058 (E_RNA) where: Base-Base interactions energy: -140.660 where: short stacking energy: -49.306 Base-Backbone interact. energy: 0.809 local terms energy: -68.553756 where: bonds (distance) C4'-P energy: -16.123 bonds (distance) P-C4' energy: -17.252 flat angles C4'-P-C4' energy: -11.962 flat angles P-C4'-P energy: -7.694 tors. eta vs tors. theta energy: -15.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -177.410785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.410785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.410785 (E_RNA) where: Base-Base interactions energy: -108.345 where: short stacking energy: -53.320 Base-Backbone interact. energy: -0.313 local terms energy: -68.752474 where: bonds (distance) C4'-P energy: -13.668 bonds (distance) P-C4' energy: -15.071 flat angles C4'-P-C4' energy: -10.569 flat angles P-C4'-P energy: -11.715 tors. eta vs tors. theta energy: -17.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -154.923210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.923210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.923210 (E_RNA) where: Base-Base interactions energy: -90.159 where: short stacking energy: -44.247 Base-Backbone interact. energy: -0.040 local terms energy: -64.723956 where: bonds (distance) C4'-P energy: -12.898 bonds (distance) P-C4' energy: -17.308 flat angles C4'-P-C4' energy: -14.839 flat angles P-C4'-P energy: -6.609 tors. eta vs tors. theta energy: -13.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -125.593367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.593367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.593367 (E_RNA) where: Base-Base interactions energy: -72.196 where: short stacking energy: -39.326 Base-Backbone interact. energy: -0.077 local terms energy: -53.320627 where: bonds (distance) C4'-P energy: -17.345 bonds (distance) P-C4' energy: -8.459 flat angles C4'-P-C4' energy: -14.313 flat angles P-C4'-P energy: -6.581 tors. eta vs tors. theta energy: -6.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -77.753673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.753673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.753673 (E_RNA) where: Base-Base interactions energy: -28.489 where: short stacking energy: -24.516 Base-Backbone interact. energy: 0.270 local terms energy: -49.534470 where: bonds (distance) C4'-P energy: -13.916 bonds (distance) P-C4' energy: -11.628 flat angles C4'-P-C4' energy: -13.239 flat angles P-C4'-P energy: -9.944 tors. eta vs tors. theta energy: -0.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -93.341654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.341654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.341654 (E_RNA) where: Base-Base interactions energy: -40.556 where: short stacking energy: -26.089 Base-Backbone interact. energy: -0.536 local terms energy: -52.249689 where: bonds (distance) C4'-P energy: -11.984 bonds (distance) P-C4' energy: -17.443 flat angles C4'-P-C4' energy: -12.109 flat angles P-C4'-P energy: -6.220 tors. eta vs tors. theta energy: -4.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -84.250387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.250387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.250387 (E_RNA) where: Base-Base interactions energy: -37.138 where: short stacking energy: -31.252 Base-Backbone interact. energy: 2.117 local terms energy: -49.229670 where: bonds (distance) C4'-P energy: -9.897 bonds (distance) P-C4' energy: -14.409 flat angles C4'-P-C4' energy: -13.296 flat angles P-C4'-P energy: -4.617 tors. eta vs tors. theta energy: -7.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -88.423370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.423370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.423370 (E_RNA) where: Base-Base interactions energy: -38.702 where: short stacking energy: -34.637 Base-Backbone interact. energy: -0.001 local terms energy: -49.720454 where: bonds (distance) C4'-P energy: -10.637 bonds (distance) P-C4' energy: -15.655 flat angles C4'-P-C4' energy: -10.775 flat angles P-C4'-P energy: -5.116 tors. eta vs tors. theta energy: -7.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -208.647162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.647162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.647162 (E_RNA) where: Base-Base interactions energy: -135.791 where: short stacking energy: -54.838 Base-Backbone interact. energy: -0.653 local terms energy: -72.202785 where: bonds (distance) C4'-P energy: -16.173 bonds (distance) P-C4' energy: -16.129 flat angles C4'-P-C4' energy: -16.556 flat angles P-C4'-P energy: -8.272 tors. eta vs tors. theta energy: -15.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -206.990078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.990078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.990078 (E_RNA) where: Base-Base interactions energy: -143.810 where: short stacking energy: -55.471 Base-Backbone interact. energy: -0.611 local terms energy: -62.568858 where: bonds (distance) C4'-P energy: -15.428 bonds (distance) P-C4' energy: -14.917 flat angles C4'-P-C4' energy: -13.028 flat angles P-C4'-P energy: -9.616 tors. eta vs tors. theta energy: -9.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -215.940488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.940488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.940488 (E_RNA) where: Base-Base interactions energy: -138.838 where: short stacking energy: -58.583 Base-Backbone interact. energy: -1.136 local terms energy: -75.966167 where: bonds (distance) C4'-P energy: -15.246 bonds (distance) P-C4' energy: -14.868 flat angles C4'-P-C4' energy: -16.441 flat angles P-C4'-P energy: -11.839 tors. eta vs tors. theta energy: -17.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -156.494400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.494400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.494400 (E_RNA) where: Base-Base interactions energy: -101.911 where: short stacking energy: -44.463 Base-Backbone interact. energy: 0.650 local terms energy: -55.233709 where: bonds (distance) C4'-P energy: -13.333 bonds (distance) P-C4' energy: -10.837 flat angles C4'-P-C4' energy: -15.621 flat angles P-C4'-P energy: -1.960 tors. eta vs tors. theta energy: -13.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -177.813301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.813301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.813301 (E_RNA) where: Base-Base interactions energy: -114.502 where: short stacking energy: -55.218 Base-Backbone interact. energy: -1.336 local terms energy: -61.974523 where: bonds (distance) C4'-P energy: -8.878 bonds (distance) P-C4' energy: -12.267 flat angles C4'-P-C4' energy: -16.404 flat angles P-C4'-P energy: -6.662 tors. eta vs tors. theta energy: -17.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -116.112787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.112787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.112787 (E_RNA) where: Base-Base interactions energy: -59.821 where: short stacking energy: -33.787 Base-Backbone interact. energy: -0.437 local terms energy: -55.854835 where: bonds (distance) C4'-P energy: -15.968 bonds (distance) P-C4' energy: -15.533 flat angles C4'-P-C4' energy: -13.447 flat angles P-C4'-P energy: -5.528 tors. eta vs tors. theta energy: -5.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -82.521989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.521989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.521989 (E_RNA) where: Base-Base interactions energy: -26.470 where: short stacking energy: -23.208 Base-Backbone interact. energy: -0.790 local terms energy: -55.261583 where: bonds (distance) C4'-P energy: -7.819 bonds (distance) P-C4' energy: -15.371 flat angles C4'-P-C4' energy: -13.954 flat angles P-C4'-P energy: -8.180 tors. eta vs tors. theta energy: -9.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -81.692122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.692122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.692122 (E_RNA) where: Base-Base interactions energy: -31.944 where: short stacking energy: -19.948 Base-Backbone interact. energy: -0.147 local terms energy: -49.601309 where: bonds (distance) C4'-P energy: -15.816 bonds (distance) P-C4' energy: -15.319 flat angles C4'-P-C4' energy: -8.239 flat angles P-C4'-P energy: -7.415 tors. eta vs tors. theta energy: -2.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -103.644396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.644396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -103.644396 (E_RNA) where: Base-Base interactions energy: -57.919 where: short stacking energy: -29.407 Base-Backbone interact. energy: -1.167 local terms energy: -44.558151 where: bonds (distance) C4'-P energy: -7.349 bonds (distance) P-C4' energy: -15.910 flat angles C4'-P-C4' energy: -9.904 flat angles P-C4'-P energy: -6.237 tors. eta vs tors. theta energy: -5.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -76.407862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.407862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.407862 (E_RNA) where: Base-Base interactions energy: -24.459 where: short stacking energy: -24.459 Base-Backbone interact. energy: -0.221 local terms energy: -51.728391 where: bonds (distance) C4'-P energy: -12.885 bonds (distance) P-C4' energy: -12.783 flat angles C4'-P-C4' energy: -14.515 flat angles P-C4'-P energy: -9.499 tors. eta vs tors. theta energy: -2.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -212.022349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.022349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.022349 (E_RNA) where: Base-Base interactions energy: -139.957 where: short stacking energy: -57.536 Base-Backbone interact. energy: -0.033 local terms energy: -72.032287 where: bonds (distance) C4'-P energy: -13.581 bonds (distance) P-C4' energy: -15.920 flat angles C4'-P-C4' energy: -16.571 flat angles P-C4'-P energy: -9.149 tors. eta vs tors. theta energy: -16.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -188.294077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.294077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.294077 (E_RNA) where: Base-Base interactions energy: -126.955 where: short stacking energy: -47.369 Base-Backbone interact. energy: -0.060 local terms energy: -61.279616 where: bonds (distance) C4'-P energy: -13.565 bonds (distance) P-C4' energy: -10.033 flat angles C4'-P-C4' energy: -18.572 flat angles P-C4'-P energy: -6.383 tors. eta vs tors. theta energy: -12.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -218.533114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.533114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.533114 (E_RNA) where: Base-Base interactions energy: -149.908 where: short stacking energy: -61.410 Base-Backbone interact. energy: -0.146 local terms energy: -68.478560 where: bonds (distance) C4'-P energy: -12.463 bonds (distance) P-C4' energy: -14.429 flat angles C4'-P-C4' energy: -16.180 flat angles P-C4'-P energy: -7.209 tors. eta vs tors. theta energy: -18.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -165.317177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.317177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.317177 (E_RNA) where: Base-Base interactions energy: -118.789 where: short stacking energy: -48.191 Base-Backbone interact. energy: -0.374 local terms energy: -46.154020 where: bonds (distance) C4'-P energy: -6.419 bonds (distance) P-C4' energy: -10.144 flat angles C4'-P-C4' energy: -15.202 flat angles P-C4'-P energy: -5.041 tors. eta vs tors. theta energy: -9.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -163.719980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.719980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.719980 (E_RNA) where: Base-Base interactions energy: -94.066 where: short stacking energy: -48.716 Base-Backbone interact. energy: -0.043 local terms energy: -69.611101 where: bonds (distance) C4'-P energy: -16.209 bonds (distance) P-C4' energy: -14.880 flat angles C4'-P-C4' energy: -15.814 flat angles P-C4'-P energy: -11.086 tors. eta vs tors. theta energy: -11.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -88.777192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.777192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.777192 (E_RNA) where: Base-Base interactions energy: -33.624 where: short stacking energy: -33.624 Base-Backbone interact. energy: 0.568 local terms energy: -55.721131 where: bonds (distance) C4'-P energy: -15.428 bonds (distance) P-C4' energy: -15.868 flat angles C4'-P-C4' energy: -10.904 flat angles P-C4'-P energy: -4.584 tors. eta vs tors. theta energy: -8.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -82.096814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.096814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.096814 (E_RNA) where: Base-Base interactions energy: -21.947 where: short stacking energy: -21.801 Base-Backbone interact. energy: -0.131 local terms energy: -60.018953 where: bonds (distance) C4'-P energy: -16.625 bonds (distance) P-C4' energy: -17.760 flat angles C4'-P-C4' energy: -13.764 flat angles P-C4'-P energy: -10.015 tors. eta vs tors. theta energy: -1.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -79.385131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.385131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.385131 (E_RNA) where: Base-Base interactions energy: -28.317 where: short stacking energy: -24.019 Base-Backbone interact. energy: 1.609 local terms energy: -52.677212 where: bonds (distance) C4'-P energy: -14.641 bonds (distance) P-C4' energy: -17.340 flat angles C4'-P-C4' energy: -11.173 flat angles P-C4'-P energy: -7.454 tors. eta vs tors. theta energy: -2.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -81.292437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.292437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.292437 (E_RNA) where: Base-Base interactions energy: -32.441 where: short stacking energy: -10.019 Base-Backbone interact. energy: -0.179 local terms energy: -48.671996 where: bonds (distance) C4'-P energy: -15.134 bonds (distance) P-C4' energy: -14.395 flat angles C4'-P-C4' energy: -15.600 flat angles P-C4'-P energy: -5.322 tors. eta vs tors. theta energy: 1.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -76.127791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.127791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.127791 (E_RNA) where: Base-Base interactions energy: -25.561 where: short stacking energy: -23.737 Base-Backbone interact. energy: 2.640 local terms energy: -53.206562 where: bonds (distance) C4'-P energy: -15.676 bonds (distance) P-C4' energy: -18.454 flat angles C4'-P-C4' energy: -10.952 flat angles P-C4'-P energy: -6.602 tors. eta vs tors. theta energy: -1.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -226.776529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.776529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.776529 (E_RNA) where: Base-Base interactions energy: -151.594 where: short stacking energy: -60.854 Base-Backbone interact. energy: -0.836 local terms energy: -74.347178 where: bonds (distance) C4'-P energy: -15.581 bonds (distance) P-C4' energy: -14.990 flat angles C4'-P-C4' energy: -16.091 flat angles P-C4'-P energy: -8.900 tors. eta vs tors. theta energy: -18.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -213.007338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.007338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.007338 (E_RNA) where: Base-Base interactions energy: -143.824 where: short stacking energy: -60.822 Base-Backbone interact. energy: -1.088 local terms energy: -68.094826 where: bonds (distance) C4'-P energy: -16.246 bonds (distance) P-C4' energy: -12.992 flat angles C4'-P-C4' energy: -15.461 flat angles P-C4'-P energy: -6.819 tors. eta vs tors. theta energy: -16.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -188.290177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.290177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.290177 (E_RNA) where: Base-Base interactions energy: -118.681 where: short stacking energy: -49.007 Base-Backbone interact. energy: -0.521 local terms energy: -69.088620 where: bonds (distance) C4'-P energy: -15.606 bonds (distance) P-C4' energy: -16.593 flat angles C4'-P-C4' energy: -15.114 flat angles P-C4'-P energy: -6.411 tors. eta vs tors. theta energy: -15.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -192.199114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.199114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.199114 (E_RNA) where: Base-Base interactions energy: -114.051 where: short stacking energy: -58.720 Base-Backbone interact. energy: -0.782 local terms energy: -77.366624 where: bonds (distance) C4'-P energy: -15.933 bonds (distance) P-C4' energy: -15.342 flat angles C4'-P-C4' energy: -16.006 flat angles P-C4'-P energy: -11.084 tors. eta vs tors. theta energy: -19.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -155.719124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.719124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.719124 (E_RNA) where: Base-Base interactions energy: -90.084 where: short stacking energy: -42.059 Base-Backbone interact. energy: 0.192 local terms energy: -65.827116 where: bonds (distance) C4'-P energy: -12.798 bonds (distance) P-C4' energy: -16.911 flat angles C4'-P-C4' energy: -14.482 flat angles P-C4'-P energy: -8.277 tors. eta vs tors. theta energy: -13.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -93.142011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.142011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.142011 (E_RNA) where: Base-Base interactions energy: -39.121 where: short stacking energy: -36.075 Base-Backbone interact. energy: -0.105 local terms energy: -53.916171 where: bonds (distance) C4'-P energy: -15.886 bonds (distance) P-C4' energy: -9.909 flat angles C4'-P-C4' energy: -17.240 flat angles P-C4'-P energy: -4.306 tors. eta vs tors. theta energy: -6.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -122.966263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.966263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.966263 (E_RNA) where: Base-Base interactions energy: -62.229 where: short stacking energy: -28.625 Base-Backbone interact. energy: -0.281 local terms energy: -60.455859 where: bonds (distance) C4'-P energy: -13.138 bonds (distance) P-C4' energy: -17.910 flat angles C4'-P-C4' energy: -12.305 flat angles P-C4'-P energy: -10.284 tors. eta vs tors. theta energy: -6.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -86.093656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.093656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.093656 (E_RNA) where: Base-Base interactions energy: -34.486 where: short stacking energy: -33.015 Base-Backbone interact. energy: 0.674 local terms energy: -52.281816 where: bonds (distance) C4'-P energy: -14.812 bonds (distance) P-C4' energy: -14.924 flat angles C4'-P-C4' energy: -11.535 flat angles P-C4'-P energy: -2.197 tors. eta vs tors. theta energy: -8.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -92.686142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.686142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.686142 (E_RNA) where: Base-Base interactions energy: -39.325 where: short stacking energy: -13.263 Base-Backbone interact. energy: -0.255 local terms energy: -53.106108 where: bonds (distance) C4'-P energy: -15.361 bonds (distance) P-C4' energy: -13.658 flat angles C4'-P-C4' energy: -16.214 flat angles P-C4'-P energy: -10.557 tors. eta vs tors. theta energy: 2.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -72.331815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.331815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.331815 (E_RNA) where: Base-Base interactions energy: -28.389 where: short stacking energy: -28.100 Base-Backbone interact. energy: -0.104 local terms energy: -43.838380 where: bonds (distance) C4'-P energy: -10.976 bonds (distance) P-C4' energy: -13.952 flat angles C4'-P-C4' energy: -8.228 flat angles P-C4'-P energy: -5.967 tors. eta vs tors. theta energy: -4.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -218.014493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.014493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.014493 (E_RNA) where: Base-Base interactions energy: -143.073 where: short stacking energy: -56.818 Base-Backbone interact. energy: -0.447 local terms energy: -74.494320 where: bonds (distance) C4'-P energy: -16.119 bonds (distance) P-C4' energy: -15.084 flat angles C4'-P-C4' energy: -14.722 flat angles P-C4'-P energy: -10.715 tors. eta vs tors. theta energy: -17.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -203.795619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.795619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.795619 (E_RNA) where: Base-Base interactions energy: -131.873 where: short stacking energy: -50.919 Base-Backbone interact. energy: -0.509 local terms energy: -71.413580 where: bonds (distance) C4'-P energy: -16.971 bonds (distance) P-C4' energy: -14.057 flat angles C4'-P-C4' energy: -15.933 flat angles P-C4'-P energy: -8.700 tors. eta vs tors. theta energy: -15.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -181.377174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.377174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.377174 (E_RNA) where: Base-Base interactions energy: -110.651 where: short stacking energy: -56.643 Base-Backbone interact. energy: -1.339 local terms energy: -69.387587 where: bonds (distance) C4'-P energy: -13.829 bonds (distance) P-C4' energy: -9.466 flat angles C4'-P-C4' energy: -16.035 flat angles P-C4'-P energy: -12.612 tors. eta vs tors. theta energy: -17.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -180.830754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.830754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.830754 (E_RNA) where: Base-Base interactions energy: -120.849 where: short stacking energy: -46.577 Base-Backbone interact. energy: 0.250 local terms energy: -60.230933 where: bonds (distance) C4'-P energy: -15.383 bonds (distance) P-C4' energy: -15.560 flat angles C4'-P-C4' energy: -12.439 flat angles P-C4'-P energy: -9.378 tors. eta vs tors. theta energy: -7.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -143.460239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.460239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.460239 (E_RNA) where: Base-Base interactions energy: -86.322 where: short stacking energy: -45.278 Base-Backbone interact. energy: -0.013 local terms energy: -57.125176 where: bonds (distance) C4'-P energy: -15.455 bonds (distance) P-C4' energy: -17.383 flat angles C4'-P-C4' energy: -10.998 flat angles P-C4'-P energy: -9.610 tors. eta vs tors. theta energy: -3.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -86.955301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.955301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.955301 (E_RNA) where: Base-Base interactions energy: -31.764 where: short stacking energy: -29.179 Base-Backbone interact. energy: -0.211 local terms energy: -54.979991 where: bonds (distance) C4'-P energy: -11.536 bonds (distance) P-C4' energy: -13.651 flat angles C4'-P-C4' energy: -13.365 flat angles P-C4'-P energy: -8.669 tors. eta vs tors. theta energy: -7.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -91.604936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.604936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.604936 (E_RNA) where: Base-Base interactions energy: -42.188 where: short stacking energy: -25.747 Base-Backbone interact. energy: 0.890 local terms energy: -50.306849 where: bonds (distance) C4'-P energy: -9.594 bonds (distance) P-C4' energy: -15.881 flat angles C4'-P-C4' energy: -9.537 flat angles P-C4'-P energy: -10.258 tors. eta vs tors. theta energy: -5.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -85.607678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.607678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.607678 (E_RNA) where: Base-Base interactions energy: -37.998 where: short stacking energy: -15.864 Base-Backbone interact. energy: 0.320 local terms energy: -47.929575 where: bonds (distance) C4'-P energy: -15.831 bonds (distance) P-C4' energy: -12.647 flat angles C4'-P-C4' energy: -10.319 flat angles P-C4'-P energy: -9.326 tors. eta vs tors. theta energy: 0.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -88.394607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.394607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.394607 (E_RNA) where: Base-Base interactions energy: -31.607 where: short stacking energy: -28.754 Base-Backbone interact. energy: -0.047 local terms energy: -56.740557 where: bonds (distance) C4'-P energy: -17.083 bonds (distance) P-C4' energy: -12.463 flat angles C4'-P-C4' energy: -14.598 flat angles P-C4'-P energy: -8.184 tors. eta vs tors. theta energy: -4.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -72.243275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.243275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.243275 (E_RNA) where: Base-Base interactions energy: -23.788 where: short stacking energy: -23.788 Base-Backbone interact. energy: -0.059 local terms energy: -48.395927 where: bonds (distance) C4'-P energy: -11.193 bonds (distance) P-C4' energy: -11.090 flat angles C4'-P-C4' energy: -14.796 flat angles P-C4'-P energy: -8.717 tors. eta vs tors. theta energy: -2.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -217.866920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.866920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.866920 (E_RNA) where: Base-Base interactions energy: -144.129 where: short stacking energy: -63.840 Base-Backbone interact. energy: -0.520 local terms energy: -73.217227 where: bonds (distance) C4'-P energy: -13.967 bonds (distance) P-C4' energy: -15.042 flat angles C4'-P-C4' energy: -17.850 flat angles P-C4'-P energy: -6.360 tors. eta vs tors. theta energy: -19.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -201.735424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.735424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.735424 (E_RNA) where: Base-Base interactions energy: -127.244 where: short stacking energy: -67.464 Base-Backbone interact. energy: -0.464 local terms energy: -74.027400 where: bonds (distance) C4'-P energy: -15.487 bonds (distance) P-C4' energy: -15.717 flat angles C4'-P-C4' energy: -14.332 flat angles P-C4'-P energy: -9.613 tors. eta vs tors. theta energy: -18.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -201.272111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.272111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.272111 (E_RNA) where: Base-Base interactions energy: -129.744 where: short stacking energy: -47.352 Base-Backbone interact. energy: -1.007 local terms energy: -70.520911 where: bonds (distance) C4'-P energy: -13.545 bonds (distance) P-C4' energy: -16.311 flat angles C4'-P-C4' energy: -12.671 flat angles P-C4'-P energy: -9.486 tors. eta vs tors. theta energy: -18.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -184.602535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.602535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.602535 (E_RNA) where: Base-Base interactions energy: -115.744 where: short stacking energy: -48.437 Base-Backbone interact. energy: -0.404 local terms energy: -68.454876 where: bonds (distance) C4'-P energy: -16.243 bonds (distance) P-C4' energy: -16.526 flat angles C4'-P-C4' energy: -14.650 flat angles P-C4'-P energy: -8.160 tors. eta vs tors. theta energy: -12.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -127.984137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.984137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.984137 (E_RNA) where: Base-Base interactions energy: -64.077 where: short stacking energy: -40.078 Base-Backbone interact. energy: -0.561 local terms energy: -63.346380 where: bonds (distance) C4'-P energy: -14.699 bonds (distance) P-C4' energy: -11.684 flat angles C4'-P-C4' energy: -17.219 flat angles P-C4'-P energy: -11.109 tors. eta vs tors. theta energy: -8.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -90.191920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.191920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.191920 (E_RNA) where: Base-Base interactions energy: -39.226 where: short stacking energy: -29.196 Base-Backbone interact. energy: -0.028 local terms energy: -50.938022 where: bonds (distance) C4'-P energy: -12.859 bonds (distance) P-C4' energy: -17.420 flat angles C4'-P-C4' energy: -15.859 flat angles P-C4'-P energy: -6.926 tors. eta vs tors. theta energy: 2.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -117.350192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.350192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.350192 (E_RNA) where: Base-Base interactions energy: -62.619 where: short stacking energy: -37.993 Base-Backbone interact. energy: -0.162 local terms energy: -54.569895 where: bonds (distance) C4'-P energy: -13.710 bonds (distance) P-C4' energy: -13.060 flat angles C4'-P-C4' energy: -8.186 flat angles P-C4'-P energy: -6.826 tors. eta vs tors. theta energy: -12.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -82.503977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.503977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.503977 (E_RNA) where: Base-Base interactions energy: -31.543 where: short stacking energy: -29.718 Base-Backbone interact. energy: -0.036 local terms energy: -50.925490 where: bonds (distance) C4'-P energy: -9.759 bonds (distance) P-C4' energy: -13.845 flat angles C4'-P-C4' energy: -14.024 flat angles P-C4'-P energy: -8.482 tors. eta vs tors. theta energy: -4.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -71.040585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.040585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.040585 (E_RNA) where: Base-Base interactions energy: -25.158 where: short stacking energy: -16.006 Base-Backbone interact. energy: -0.532 local terms energy: -45.349875 where: bonds (distance) C4'-P energy: -10.517 bonds (distance) P-C4' energy: -16.020 flat angles C4'-P-C4' energy: -14.270 flat angles P-C4'-P energy: -9.963 tors. eta vs tors. theta energy: 5.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -73.068579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.068579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.068579 (E_RNA) where: Base-Base interactions energy: -30.295 where: short stacking energy: -30.295 Base-Backbone interact. energy: 0.619 local terms energy: -43.392521 where: bonds (distance) C4'-P energy: -12.318 bonds (distance) P-C4' energy: -13.346 flat angles C4'-P-C4' energy: -7.197 flat angles P-C4'-P energy: -7.475 tors. eta vs tors. theta energy: -3.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -207.234789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.234789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.234789 (E_RNA) where: Base-Base interactions energy: -126.658 where: short stacking energy: -65.142 Base-Backbone interact. energy: -0.945 local terms energy: -79.632421 where: bonds (distance) C4'-P energy: -13.541 bonds (distance) P-C4' energy: -16.811 flat angles C4'-P-C4' energy: -16.862 flat angles P-C4'-P energy: -11.506 tors. eta vs tors. theta energy: -20.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -199.161853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.161853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.161853 (E_RNA) where: Base-Base interactions energy: -125.406 where: short stacking energy: -52.096 Base-Backbone interact. energy: -1.606 local terms energy: -72.149623 where: bonds (distance) C4'-P energy: -15.676 bonds (distance) P-C4' energy: -15.586 flat angles C4'-P-C4' energy: -15.115 flat angles P-C4'-P energy: -9.994 tors. eta vs tors. theta energy: -15.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -204.689445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.689445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.689445 (E_RNA) where: Base-Base interactions energy: -134.674 where: short stacking energy: -55.551 Base-Backbone interact. energy: -0.961 local terms energy: -69.054152 where: bonds (distance) C4'-P energy: -16.640 bonds (distance) P-C4' energy: -15.255 flat angles C4'-P-C4' energy: -13.480 flat angles P-C4'-P energy: -7.448 tors. eta vs tors. theta energy: -16.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -185.111698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.111698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.111698 (E_RNA) where: Base-Base interactions energy: -119.614 where: short stacking energy: -49.800 Base-Backbone interact. energy: -0.604 local terms energy: -64.893261 where: bonds (distance) C4'-P energy: -16.720 bonds (distance) P-C4' energy: -10.755 flat angles C4'-P-C4' energy: -10.751 flat angles P-C4'-P energy: -12.822 tors. eta vs tors. theta energy: -13.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -131.570642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.570642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.570642 (E_RNA) where: Base-Base interactions energy: -69.532 where: short stacking energy: -32.396 Base-Backbone interact. energy: -1.484 local terms energy: -60.555199 where: bonds (distance) C4'-P energy: -16.570 bonds (distance) P-C4' energy: -11.912 flat angles C4'-P-C4' energy: -15.515 flat angles P-C4'-P energy: -7.622 tors. eta vs tors. theta energy: -8.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -96.378809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.378809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.378809 (E_RNA) where: Base-Base interactions energy: -41.925 where: short stacking energy: -28.196 Base-Backbone interact. energy: 0.517 local terms energy: -54.970350 where: bonds (distance) C4'-P energy: -14.257 bonds (distance) P-C4' energy: -16.901 flat angles C4'-P-C4' energy: -9.212 flat angles P-C4'-P energy: -10.548 tors. eta vs tors. theta energy: -4.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -83.440901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.440901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.440901 (E_RNA) where: Base-Base interactions energy: -32.460 where: short stacking energy: -31.551 Base-Backbone interact. energy: -0.101 local terms energy: -50.880495 where: bonds (distance) C4'-P energy: -9.931 bonds (distance) P-C4' energy: -15.240 flat angles C4'-P-C4' energy: -12.893 flat angles P-C4'-P energy: -6.363 tors. eta vs tors. theta energy: -6.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -82.911842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.911842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.911842 (E_RNA) where: Base-Base interactions energy: -37.422 where: short stacking energy: -25.309 Base-Backbone interact. energy: 3.236 local terms energy: -48.725911 where: bonds (distance) C4'-P energy: -13.138 bonds (distance) P-C4' energy: -14.660 flat angles C4'-P-C4' energy: -14.455 flat angles P-C4'-P energy: -4.684 tors. eta vs tors. theta energy: -1.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -75.689696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.689696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.689696 (E_RNA) where: Base-Base interactions energy: -20.616 where: short stacking energy: -18.964 Base-Backbone interact. energy: -0.136 local terms energy: -54.937697 where: bonds (distance) C4'-P energy: -9.733 bonds (distance) P-C4' energy: -14.879 flat angles C4'-P-C4' energy: -15.341 flat angles P-C4'-P energy: -8.820 tors. eta vs tors. theta energy: -6.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -69.948640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.948640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.948640 (E_RNA) where: Base-Base interactions energy: -25.737 where: short stacking energy: -18.095 Base-Backbone interact. energy: -0.046 local terms energy: -44.165235 where: bonds (distance) C4'-P energy: -11.661 bonds (distance) P-C4' energy: -15.958 flat angles C4'-P-C4' energy: -6.298 flat angles P-C4'-P energy: -7.075 tors. eta vs tors. theta energy: -3.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -211.927719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.927719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.927719 (E_RNA) where: Base-Base interactions energy: -131.530 where: short stacking energy: -68.245 Base-Backbone interact. energy: -0.010 local terms energy: -80.387184 where: bonds (distance) C4'-P energy: -14.961 bonds (distance) P-C4' energy: -14.978 flat angles C4'-P-C4' energy: -16.159 flat angles P-C4'-P energy: -12.123 tors. eta vs tors. theta energy: -22.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -215.435080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.435080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.435080 (E_RNA) where: Base-Base interactions energy: -139.611 where: short stacking energy: -56.448 Base-Backbone interact. energy: -0.564 local terms energy: -75.260455 where: bonds (distance) C4'-P energy: -16.972 bonds (distance) P-C4' energy: -12.427 flat angles C4'-P-C4' energy: -14.379 flat angles P-C4'-P energy: -12.297 tors. eta vs tors. theta energy: -19.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -204.057787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.057787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.057787 (E_RNA) where: Base-Base interactions energy: -124.527 where: short stacking energy: -45.882 Base-Backbone interact. energy: -1.038 local terms energy: -78.492857 where: bonds (distance) C4'-P energy: -16.372 bonds (distance) P-C4' energy: -17.136 flat angles C4'-P-C4' energy: -14.265 flat angles P-C4'-P energy: -15.230 tors. eta vs tors. theta energy: -15.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -201.990793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.990793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.990793 (E_RNA) where: Base-Base interactions energy: -131.247 where: short stacking energy: -52.791 Base-Backbone interact. energy: -0.541 local terms energy: -70.202821 where: bonds (distance) C4'-P energy: -13.449 bonds (distance) P-C4' energy: -16.424 flat angles C4'-P-C4' energy: -13.553 flat angles P-C4'-P energy: -9.787 tors. eta vs tors. theta energy: -16.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -135.967518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.967518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.967518 (E_RNA) where: Base-Base interactions energy: -71.718 where: short stacking energy: -43.601 Base-Backbone interact. energy: -0.727 local terms energy: -63.521833 where: bonds (distance) C4'-P energy: -13.155 bonds (distance) P-C4' energy: -12.203 flat angles C4'-P-C4' energy: -15.298 flat angles P-C4'-P energy: -9.962 tors. eta vs tors. theta energy: -12.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -114.132551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.132551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.132551 (E_RNA) where: Base-Base interactions energy: -75.462 where: short stacking energy: -31.290 Base-Backbone interact. energy: 0.863 local terms energy: -39.534001 where: bonds (distance) C4'-P energy: -10.348 bonds (distance) P-C4' energy: -9.909 flat angles C4'-P-C4' energy: -12.353 flat angles P-C4'-P energy: -5.261 tors. eta vs tors. theta energy: -1.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -102.771682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.771682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.771682 (E_RNA) where: Base-Base interactions energy: -51.973 where: short stacking energy: -33.473 Base-Backbone interact. energy: -0.258 local terms energy: -50.540936 where: bonds (distance) C4'-P energy: -15.249 bonds (distance) P-C4' energy: -6.597 flat angles C4'-P-C4' energy: -14.094 flat angles P-C4'-P energy: -11.845 tors. eta vs tors. theta energy: -2.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -80.145833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.145833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.145833 (E_RNA) where: Base-Base interactions energy: -37.645 where: short stacking energy: -18.562 Base-Backbone interact. energy: -0.173 local terms energy: -42.327417 where: bonds (distance) C4'-P energy: -14.081 bonds (distance) P-C4' energy: -15.123 flat angles C4'-P-C4' energy: -6.753 flat angles P-C4'-P energy: -7.243 tors. eta vs tors. theta energy: 0.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -96.877786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.877786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.877786 (E_RNA) where: Base-Base interactions energy: -47.485 where: short stacking energy: -21.604 Base-Backbone interact. energy: -0.438 local terms energy: -48.954404 where: bonds (distance) C4'-P energy: -14.492 bonds (distance) P-C4' energy: -14.930 flat angles C4'-P-C4' energy: -13.003 flat angles P-C4'-P energy: -6.341 tors. eta vs tors. theta energy: -0.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -72.181636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.181636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.181636 (E_RNA) where: Base-Base interactions energy: -32.776 where: short stacking energy: -31.818 Base-Backbone interact. energy: -0.083 local terms energy: -39.322080 where: bonds (distance) C4'-P energy: -8.964 bonds (distance) P-C4' energy: -9.653 flat angles C4'-P-C4' energy: -6.515 flat angles P-C4'-P energy: -7.572 tors. eta vs tors. theta energy: -6.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -230.050193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.050193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.050193 (E_RNA) where: Base-Base interactions energy: -154.146 where: short stacking energy: -60.922 Base-Backbone interact. energy: -0.196 local terms energy: -75.708216 where: bonds (distance) C4'-P energy: -16.550 bonds (distance) P-C4' energy: -17.087 flat angles C4'-P-C4' energy: -14.229 flat angles P-C4'-P energy: -6.489 tors. eta vs tors. theta energy: -21.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -204.027384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.027384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.027384 (E_RNA) where: Base-Base interactions energy: -127.148 where: short stacking energy: -63.913 Base-Backbone interact. energy: -0.151 local terms energy: -76.727820 where: bonds (distance) C4'-P energy: -14.425 bonds (distance) P-C4' energy: -13.784 flat angles C4'-P-C4' energy: -15.446 flat angles P-C4'-P energy: -10.015 tors. eta vs tors. theta energy: -23.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -209.215589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.215589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.215589 (E_RNA) where: Base-Base interactions energy: -143.371 where: short stacking energy: -60.626 Base-Backbone interact. energy: -1.427 local terms energy: -64.417679 where: bonds (distance) C4'-P energy: -11.747 bonds (distance) P-C4' energy: -15.117 flat angles C4'-P-C4' energy: -12.450 flat angles P-C4'-P energy: -9.179 tors. eta vs tors. theta energy: -15.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -207.642904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.642904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.642904 (E_RNA) where: Base-Base interactions energy: -145.886 where: short stacking energy: -54.319 Base-Backbone interact. energy: -0.590 local terms energy: -61.166164 where: bonds (distance) C4'-P energy: -16.272 bonds (distance) P-C4' energy: -13.775 flat angles C4'-P-C4' energy: -6.836 flat angles P-C4'-P energy: -6.971 tors. eta vs tors. theta energy: -17.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -155.050366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.050366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.050366 (E_RNA) where: Base-Base interactions energy: -102.194 where: short stacking energy: -35.742 Base-Backbone interact. energy: -0.111 local terms energy: -52.745044 where: bonds (distance) C4'-P energy: -12.522 bonds (distance) P-C4' energy: -12.345 flat angles C4'-P-C4' energy: -14.051 flat angles P-C4'-P energy: -8.097 tors. eta vs tors. theta energy: -5.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -136.849058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.849058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.849058 (E_RNA) where: Base-Base interactions energy: -81.126 where: short stacking energy: -38.662 Base-Backbone interact. energy: -0.193 local terms energy: -55.529798 where: bonds (distance) C4'-P energy: -13.287 bonds (distance) P-C4' energy: -14.905 flat angles C4'-P-C4' energy: -16.885 flat angles P-C4'-P energy: -8.102 tors. eta vs tors. theta energy: -2.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -94.911851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.911851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.911851 (E_RNA) where: Base-Base interactions energy: -40.584 where: short stacking energy: -27.458 Base-Backbone interact. energy: -0.891 local terms energy: -53.436714 where: bonds (distance) C4'-P energy: -12.886 bonds (distance) P-C4' energy: -13.873 flat angles C4'-P-C4' energy: -13.190 flat angles P-C4'-P energy: -9.330 tors. eta vs tors. theta energy: -4.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -81.429962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.429962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.429962 (E_RNA) where: Base-Base interactions energy: -28.290 where: short stacking energy: -28.290 Base-Backbone interact. energy: -0.157 local terms energy: -52.983078 where: bonds (distance) C4'-P energy: -12.605 bonds (distance) P-C4' energy: -10.827 flat angles C4'-P-C4' energy: -14.854 flat angles P-C4'-P energy: -8.233 tors. eta vs tors. theta energy: -6.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -72.001855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.001855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.001855 (E_RNA) where: Base-Base interactions energy: -28.984 where: short stacking energy: -26.753 Base-Backbone interact. energy: -0.043 local terms energy: -42.974970 where: bonds (distance) C4'-P energy: -9.496 bonds (distance) P-C4' energy: -16.409 flat angles C4'-P-C4' energy: -10.099 flat angles P-C4'-P energy: -3.379 tors. eta vs tors. theta energy: -3.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -68.605078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.605078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.605078 (E_RNA) where: Base-Base interactions energy: -29.382 where: short stacking energy: -16.303 Base-Backbone interact. energy: 0.042 local terms energy: -39.264530 where: bonds (distance) C4'-P energy: -11.213 bonds (distance) P-C4' energy: -15.231 flat angles C4'-P-C4' energy: -7.853 flat angles P-C4'-P energy: -4.577 tors. eta vs tors. theta energy: -0.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -219.950868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.950868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.950868 (E_RNA) where: Base-Base interactions energy: -149.881 where: short stacking energy: -57.729 Base-Backbone interact. energy: -0.918 local terms energy: -69.152534 where: bonds (distance) C4'-P energy: -15.373 bonds (distance) P-C4' energy: -14.933 flat angles C4'-P-C4' energy: -15.218 flat angles P-C4'-P energy: -11.465 tors. eta vs tors. theta energy: -12.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -185.602906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.602906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.602906 (E_RNA) where: Base-Base interactions energy: -123.214 where: short stacking energy: -47.092 Base-Backbone interact. energy: -0.044 local terms energy: -62.344846 where: bonds (distance) C4'-P energy: -15.502 bonds (distance) P-C4' energy: -15.449 flat angles C4'-P-C4' energy: -14.500 flat angles P-C4'-P energy: -5.068 tors. eta vs tors. theta energy: -11.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -195.432535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.432535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.432535 (E_RNA) where: Base-Base interactions energy: -117.940 where: short stacking energy: -66.063 Base-Backbone interact. energy: -0.016 local terms energy: -77.476860 where: bonds (distance) C4'-P energy: -13.560 bonds (distance) P-C4' energy: -13.082 flat angles C4'-P-C4' energy: -16.457 flat angles P-C4'-P energy: -12.008 tors. eta vs tors. theta energy: -22.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -195.007727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.007727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.007727 (E_RNA) where: Base-Base interactions energy: -125.362 where: short stacking energy: -54.660 Base-Backbone interact. energy: -0.075 local terms energy: -69.571130 where: bonds (distance) C4'-P energy: -14.227 bonds (distance) P-C4' energy: -15.130 flat angles C4'-P-C4' energy: -14.554 flat angles P-C4'-P energy: -9.785 tors. eta vs tors. theta energy: -15.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -130.960209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.960209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.960209 (E_RNA) where: Base-Base interactions energy: -79.466 where: short stacking energy: -31.423 Base-Backbone interact. energy: -0.237 local terms energy: -51.257583 where: bonds (distance) C4'-P energy: -10.530 bonds (distance) P-C4' energy: -15.289 flat angles C4'-P-C4' energy: -13.766 flat angles P-C4'-P energy: -7.051 tors. eta vs tors. theta energy: -4.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -130.401325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.401325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.401325 (E_RNA) where: Base-Base interactions energy: -85.380 where: short stacking energy: -38.171 Base-Backbone interact. energy: -0.325 local terms energy: -44.697054 where: bonds (distance) C4'-P energy: -9.927 bonds (distance) P-C4' energy: -11.901 flat angles C4'-P-C4' energy: -10.249 flat angles P-C4'-P energy: -8.847 tors. eta vs tors. theta energy: -3.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -85.680243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.680243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.680243 (E_RNA) where: Base-Base interactions energy: -39.174 where: short stacking energy: -30.263 Base-Backbone interact. energy: -0.199 local terms energy: -46.306812 where: bonds (distance) C4'-P energy: -7.583 bonds (distance) P-C4' energy: -16.973 flat angles C4'-P-C4' energy: -14.377 flat angles P-C4'-P energy: -7.953 tors. eta vs tors. theta energy: 0.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -77.726625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.726625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.726625 (E_RNA) where: Base-Base interactions energy: -32.585 where: short stacking energy: -23.366 Base-Backbone interact. energy: -0.122 local terms energy: -45.018830 where: bonds (distance) C4'-P energy: -9.446 bonds (distance) P-C4' energy: -10.548 flat angles C4'-P-C4' energy: -13.279 flat angles P-C4'-P energy: -11.955 tors. eta vs tors. theta energy: 0.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -72.407301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.407301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.407301 (E_RNA) where: Base-Base interactions energy: -33.283 where: short stacking energy: -26.684 Base-Backbone interact. energy: -0.180 local terms energy: -38.943532 where: bonds (distance) C4'-P energy: -10.919 bonds (distance) P-C4' energy: -13.418 flat angles C4'-P-C4' energy: -9.768 flat angles P-C4'-P energy: -4.531 tors. eta vs tors. theta energy: -0.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -71.650607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.650607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.650607 (E_RNA) where: Base-Base interactions energy: -26.667 where: short stacking energy: -23.214 Base-Backbone interact. energy: -0.417 local terms energy: -44.566243 where: bonds (distance) C4'-P energy: -10.208 bonds (distance) P-C4' energy: -14.416 flat angles C4'-P-C4' energy: -15.348 flat angles P-C4'-P energy: -8.526 tors. eta vs tors. theta energy: 3.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -203.650411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.650411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.650411 (E_RNA) where: Base-Base interactions energy: -130.943 where: short stacking energy: -51.605 Base-Backbone interact. energy: -1.192 local terms energy: -71.515400 where: bonds (distance) C4'-P energy: -12.496 bonds (distance) P-C4' energy: -15.710 flat angles C4'-P-C4' energy: -14.658 flat angles P-C4'-P energy: -12.743 tors. eta vs tors. theta energy: -15.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -217.564793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.564793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.564793 (E_RNA) where: Base-Base interactions energy: -151.510 where: short stacking energy: -51.217 Base-Backbone interact. energy: -0.438 local terms energy: -65.617063 where: bonds (distance) C4'-P energy: -10.682 bonds (distance) P-C4' energy: -16.354 flat angles C4'-P-C4' energy: -17.086 flat angles P-C4'-P energy: -8.011 tors. eta vs tors. theta energy: -13.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -196.733199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.733199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.733199 (E_RNA) where: Base-Base interactions energy: -130.883 where: short stacking energy: -54.542 Base-Backbone interact. energy: -0.180 local terms energy: -65.670339 where: bonds (distance) C4'-P energy: -12.808 bonds (distance) P-C4' energy: -14.705 flat angles C4'-P-C4' energy: -15.005 flat angles P-C4'-P energy: -11.651 tors. eta vs tors. theta energy: -11.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -186.615820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.615820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.615820 (E_RNA) where: Base-Base interactions energy: -111.833 where: short stacking energy: -57.068 Base-Backbone interact. energy: -0.043 local terms energy: -74.740329 where: bonds (distance) C4'-P energy: -15.340 bonds (distance) P-C4' energy: -17.932 flat angles C4'-P-C4' energy: -17.656 flat angles P-C4'-P energy: -4.663 tors. eta vs tors. theta energy: -19.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -148.468488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.468488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.468488 (E_RNA) where: Base-Base interactions energy: -96.221 where: short stacking energy: -43.341 Base-Backbone interact. energy: -0.536 local terms energy: -51.710947 where: bonds (distance) C4'-P energy: -14.607 bonds (distance) P-C4' energy: -15.311 flat angles C4'-P-C4' energy: -12.765 flat angles P-C4'-P energy: -2.659 tors. eta vs tors. theta energy: -6.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -140.190817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.190817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.190817 (E_RNA) where: Base-Base interactions energy: -77.996 where: short stacking energy: -41.506 Base-Backbone interact. energy: -0.435 local terms energy: -61.760210 where: bonds (distance) C4'-P energy: -17.021 bonds (distance) P-C4' energy: -13.795 flat angles C4'-P-C4' energy: -10.726 flat angles P-C4'-P energy: -9.957 tors. eta vs tors. theta energy: -10.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -84.261642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.261642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.261642 (E_RNA) where: Base-Base interactions energy: -30.343 where: short stacking energy: -29.094 Base-Backbone interact. energy: 1.291 local terms energy: -55.209371 where: bonds (distance) C4'-P energy: -11.197 bonds (distance) P-C4' energy: -15.093 flat angles C4'-P-C4' energy: -13.211 flat angles P-C4'-P energy: -8.420 tors. eta vs tors. theta energy: -7.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -80.919782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.919782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.919782 (E_RNA) where: Base-Base interactions energy: -21.513 where: short stacking energy: -20.881 Base-Backbone interact. energy: -0.072 local terms energy: -59.334286 where: bonds (distance) C4'-P energy: -16.090 bonds (distance) P-C4' energy: -11.337 flat angles C4'-P-C4' energy: -12.238 flat angles P-C4'-P energy: -13.843 tors. eta vs tors. theta energy: -5.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -75.601649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.601649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.601649 (E_RNA) where: Base-Base interactions energy: -30.847 where: short stacking energy: -22.965 Base-Backbone interact. energy: -0.130 local terms energy: -44.623759 where: bonds (distance) C4'-P energy: -11.851 bonds (distance) P-C4' energy: -13.106 flat angles C4'-P-C4' energy: -12.625 flat angles P-C4'-P energy: -8.889 tors. eta vs tors. theta energy: 1.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -73.851603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.851603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.851603 (E_RNA) where: Base-Base interactions energy: -23.249 where: short stacking energy: -23.249 Base-Backbone interact. energy: -0.070 local terms energy: -50.532500 where: bonds (distance) C4'-P energy: -6.271 bonds (distance) P-C4' energy: -14.395 flat angles C4'-P-C4' energy: -12.927 flat angles P-C4'-P energy: -12.404 tors. eta vs tors. theta energy: -4.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -207.417402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.417402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.417402 (E_RNA) where: Base-Base interactions energy: -139.839 where: short stacking energy: -59.567 Base-Backbone interact. energy: -0.128 local terms energy: -67.450786 where: bonds (distance) C4'-P energy: -6.061 bonds (distance) P-C4' energy: -17.883 flat angles C4'-P-C4' energy: -13.720 flat angles P-C4'-P energy: -11.086 tors. eta vs tors. theta energy: -18.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -214.399300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.399300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.399300 (E_RNA) where: Base-Base interactions energy: -138.737 where: short stacking energy: -53.186 Base-Backbone interact. energy: -0.207 local terms energy: -75.455700 where: bonds (distance) C4'-P energy: -15.921 bonds (distance) P-C4' energy: -17.135 flat angles C4'-P-C4' energy: -17.405 flat angles P-C4'-P energy: -4.492 tors. eta vs tors. theta energy: -20.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -215.727809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.727809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.727809 (E_RNA) where: Base-Base interactions energy: -145.270 where: short stacking energy: -53.313 Base-Backbone interact. energy: -2.000 local terms energy: -68.457318 where: bonds (distance) C4'-P energy: -15.356 bonds (distance) P-C4' energy: -17.541 flat angles C4'-P-C4' energy: -14.749 flat angles P-C4'-P energy: -4.795 tors. eta vs tors. theta energy: -16.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -169.239416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.239416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.239416 (E_RNA) where: Base-Base interactions energy: -110.835 where: short stacking energy: -45.711 Base-Backbone interact. energy: -0.968 local terms energy: -57.436479 where: bonds (distance) C4'-P energy: -9.197 bonds (distance) P-C4' energy: -14.901 flat angles C4'-P-C4' energy: -13.049 flat angles P-C4'-P energy: -9.576 tors. eta vs tors. theta energy: -10.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -176.414044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.414044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.414044 (E_RNA) where: Base-Base interactions energy: -109.886 where: short stacking energy: -54.941 Base-Backbone interact. energy: -0.963 local terms energy: -65.565540 where: bonds (distance) C4'-P energy: -15.560 bonds (distance) P-C4' energy: -14.440 flat angles C4'-P-C4' energy: -13.422 flat angles P-C4'-P energy: -7.728 tors. eta vs tors. theta energy: -14.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -94.776868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.776868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.776868 (E_RNA) where: Base-Base interactions energy: -39.923 where: short stacking energy: -37.029 Base-Backbone interact. energy: -0.016 local terms energy: -54.837160 where: bonds (distance) C4'-P energy: -7.428 bonds (distance) P-C4' energy: -16.908 flat angles C4'-P-C4' energy: -11.604 flat angles P-C4'-P energy: -9.930 tors. eta vs tors. theta energy: -8.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -147.538811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.538811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.538811 (E_RNA) where: Base-Base interactions energy: -81.712 where: short stacking energy: -41.567 Base-Backbone interact. energy: -0.552 local terms energy: -65.275442 where: bonds (distance) C4'-P energy: -15.300 bonds (distance) P-C4' energy: -16.008 flat angles C4'-P-C4' energy: -12.265 flat angles P-C4'-P energy: -9.729 tors. eta vs tors. theta energy: -11.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -86.713752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.713752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.713752 (E_RNA) where: Base-Base interactions energy: -28.265 where: short stacking energy: -28.265 Base-Backbone interact. energy: -0.137 local terms energy: -58.311352 where: bonds (distance) C4'-P energy: -14.627 bonds (distance) P-C4' energy: -16.918 flat angles C4'-P-C4' energy: -14.392 flat angles P-C4'-P energy: -5.567 tors. eta vs tors. theta energy: -6.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -75.242795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.242795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.242795 (E_RNA) where: Base-Base interactions energy: -26.152 where: short stacking energy: -18.372 Base-Backbone interact. energy: -0.286 local terms energy: -48.805313 where: bonds (distance) C4'-P energy: -17.327 bonds (distance) P-C4' energy: -11.828 flat angles C4'-P-C4' energy: -13.522 flat angles P-C4'-P energy: -8.741 tors. eta vs tors. theta energy: 2.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -67.189450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.189450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.189450 (E_RNA) where: Base-Base interactions energy: -19.083 where: short stacking energy: -19.083 Base-Backbone interact. energy: -0.945 local terms energy: -47.161118 where: bonds (distance) C4'-P energy: -7.688 bonds (distance) P-C4' energy: -14.657 flat angles C4'-P-C4' energy: -13.156 flat angles P-C4'-P energy: -8.749 tors. eta vs tors. theta energy: -2.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -217.429072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.429072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.429072 (E_RNA) where: Base-Base interactions energy: -142.697 where: short stacking energy: -57.320 Base-Backbone interact. energy: -0.316 local terms energy: -74.415617 where: bonds (distance) C4'-P energy: -17.708 bonds (distance) P-C4' energy: -16.523 flat angles C4'-P-C4' energy: -16.653 flat angles P-C4'-P energy: -6.091 tors. eta vs tors. theta energy: -17.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -210.071789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.071789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.071789 (E_RNA) where: Base-Base interactions energy: -141.276 where: short stacking energy: -58.978 Base-Backbone interact. energy: -0.070 local terms energy: -68.725896 where: bonds (distance) C4'-P energy: -14.528 bonds (distance) P-C4' energy: -16.600 flat angles C4'-P-C4' energy: -15.222 flat angles P-C4'-P energy: -6.688 tors. eta vs tors. theta energy: -15.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -177.357945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.357945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.357945 (E_RNA) where: Base-Base interactions energy: -118.614 where: short stacking energy: -50.193 Base-Backbone interact. energy: -0.209 local terms energy: -58.534881 where: bonds (distance) C4'-P energy: -13.712 bonds (distance) P-C4' energy: -14.993 flat angles C4'-P-C4' energy: -14.971 flat angles P-C4'-P energy: -4.760 tors. eta vs tors. theta energy: -10.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -207.126580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.126580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.126580 (E_RNA) where: Base-Base interactions energy: -136.743 where: short stacking energy: -53.786 Base-Backbone interact. energy: -0.689 local terms energy: -69.695166 where: bonds (distance) C4'-P energy: -11.490 bonds (distance) P-C4' energy: -15.111 flat angles C4'-P-C4' energy: -15.546 flat angles P-C4'-P energy: -10.471 tors. eta vs tors. theta energy: -17.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -163.758374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.758374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.758374 (E_RNA) where: Base-Base interactions energy: -97.483 where: short stacking energy: -51.244 Base-Backbone interact. energy: 0.516 local terms energy: -66.791431 where: bonds (distance) C4'-P energy: -12.857 bonds (distance) P-C4' energy: -14.370 flat angles C4'-P-C4' energy: -11.260 flat angles P-C4'-P energy: -9.629 tors. eta vs tors. theta energy: -18.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -96.253201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.253201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.253201 (E_RNA) where: Base-Base interactions energy: -43.849 where: short stacking energy: -20.410 Base-Backbone interact. energy: -0.593 local terms energy: -51.811411 where: bonds (distance) C4'-P energy: -9.284 bonds (distance) P-C4' energy: -13.531 flat angles C4'-P-C4' energy: -17.644 flat angles P-C4'-P energy: -5.800 tors. eta vs tors. theta energy: -5.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -122.986642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.986642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.986642 (E_RNA) where: Base-Base interactions energy: -63.167 where: short stacking energy: -27.322 Base-Backbone interact. energy: -1.236 local terms energy: -58.583713 where: bonds (distance) C4'-P energy: -16.198 bonds (distance) P-C4' energy: -15.519 flat angles C4'-P-C4' energy: -12.673 flat angles P-C4'-P energy: -10.676 tors. eta vs tors. theta energy: -3.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -126.037416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.037416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.037416 (E_RNA) where: Base-Base interactions energy: -76.112 where: short stacking energy: -27.679 Base-Backbone interact. energy: -0.310 local terms energy: -49.615464 where: bonds (distance) C4'-P energy: -14.478 bonds (distance) P-C4' energy: -14.889 flat angles C4'-P-C4' energy: -13.201 flat angles P-C4'-P energy: -3.248 tors. eta vs tors. theta energy: -3.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -85.811283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.811283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.811283 (E_RNA) where: Base-Base interactions energy: -48.941 where: short stacking energy: -30.277 Base-Backbone interact. energy: -0.181 local terms energy: -36.689782 where: bonds (distance) C4'-P energy: -7.723 bonds (distance) P-C4' energy: -17.144 flat angles C4'-P-C4' energy: -1.366 flat angles P-C4'-P energy: -8.905 tors. eta vs tors. theta energy: -1.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -79.858121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.858121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.858121 (E_RNA) where: Base-Base interactions energy: -31.073 where: short stacking energy: -26.738 Base-Backbone interact. energy: -0.340 local terms energy: -48.444857 where: bonds (distance) C4'-P energy: -16.140 bonds (distance) P-C4' energy: -13.645 flat angles C4'-P-C4' energy: -12.362 flat angles P-C4'-P energy: -3.967 tors. eta vs tors. theta energy: -2.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -214.778461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.778461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.778461 (E_RNA) where: Base-Base interactions energy: -143.972 where: short stacking energy: -63.562 Base-Backbone interact. energy: -0.240 local terms energy: -70.567072 where: bonds (distance) C4'-P energy: -15.490 bonds (distance) P-C4' energy: -15.998 flat angles C4'-P-C4' energy: -12.824 flat angles P-C4'-P energy: -6.468 tors. eta vs tors. theta energy: -19.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -205.886667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.886667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.886667 (E_RNA) where: Base-Base interactions energy: -136.495 where: short stacking energy: -53.460 Base-Backbone interact. energy: -0.251 local terms energy: -69.141394 where: bonds (distance) C4'-P energy: -10.439 bonds (distance) P-C4' energy: -18.352 flat angles C4'-P-C4' energy: -14.181 flat angles P-C4'-P energy: -10.597 tors. eta vs tors. theta energy: -15.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -181.801667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.801667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.801667 (E_RNA) where: Base-Base interactions energy: -119.579 where: short stacking energy: -44.089 Base-Backbone interact. energy: -0.264 local terms energy: -61.958834 where: bonds (distance) C4'-P energy: -13.615 bonds (distance) P-C4' energy: -14.037 flat angles C4'-P-C4' energy: -16.762 flat angles P-C4'-P energy: -6.800 tors. eta vs tors. theta energy: -10.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -202.457488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.457488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.457488 (E_RNA) where: Base-Base interactions energy: -130.817 where: short stacking energy: -47.282 Base-Backbone interact. energy: -0.699 local terms energy: -70.941732 where: bonds (distance) C4'-P energy: -13.217 bonds (distance) P-C4' energy: -17.074 flat angles C4'-P-C4' energy: -16.068 flat angles P-C4'-P energy: -9.806 tors. eta vs tors. theta energy: -14.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -176.383837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.383837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.383837 (E_RNA) where: Base-Base interactions energy: -102.940 where: short stacking energy: -55.221 Base-Backbone interact. energy: -0.607 local terms energy: -72.836207 where: bonds (distance) C4'-P energy: -14.509 bonds (distance) P-C4' energy: -13.721 flat angles C4'-P-C4' energy: -16.302 flat angles P-C4'-P energy: -10.620 tors. eta vs tors. theta energy: -17.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -154.118799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.118799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.118799 (E_RNA) where: Base-Base interactions energy: -95.258 where: short stacking energy: -52.605 Base-Backbone interact. energy: -0.009 local terms energy: -58.852189 where: bonds (distance) C4'-P energy: -10.857 bonds (distance) P-C4' energy: -12.387 flat angles C4'-P-C4' energy: -12.130 flat angles P-C4'-P energy: -7.213 tors. eta vs tors. theta energy: -16.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -88.707665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.707665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.707665 (E_RNA) where: Base-Base interactions energy: -31.599 where: short stacking energy: -21.579 Base-Backbone interact. energy: -0.942 local terms energy: -56.167347 where: bonds (distance) C4'-P energy: -15.201 bonds (distance) P-C4' energy: -16.851 flat angles C4'-P-C4' energy: -8.713 flat angles P-C4'-P energy: -12.484 tors. eta vs tors. theta energy: -2.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -97.570041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.570041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.570041 (E_RNA) where: Base-Base interactions energy: -54.286 where: short stacking energy: -29.601 Base-Backbone interact. energy: -0.295 local terms energy: -42.988747 where: bonds (distance) C4'-P energy: -15.514 bonds (distance) P-C4' energy: -16.790 flat angles C4'-P-C4' energy: -11.464 flat angles P-C4'-P energy: -4.028 tors. eta vs tors. theta energy: 4.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -84.523974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.523974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.523974 (E_RNA) where: Base-Base interactions energy: -33.680 where: short stacking energy: -28.482 Base-Backbone interact. energy: -0.090 local terms energy: -50.753914 where: bonds (distance) C4'-P energy: -15.749 bonds (distance) P-C4' energy: -13.353 flat angles C4'-P-C4' energy: -14.039 flat angles P-C4'-P energy: -3.943 tors. eta vs tors. theta energy: -3.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -73.073924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.073924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.073924 (E_RNA) where: Base-Base interactions energy: -27.658 where: short stacking energy: -27.658 Base-Backbone interact. energy: -0.033 local terms energy: -45.383304 where: bonds (distance) C4'-P energy: -10.413 bonds (distance) P-C4' energy: -12.585 flat angles C4'-P-C4' energy: -15.740 flat angles P-C4'-P energy: -4.054 tors. eta vs tors. theta energy: -2.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -221.444178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.444178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.444178 (E_RNA) where: Base-Base interactions energy: -148.909 where: short stacking energy: -58.868 Base-Backbone interact. energy: -0.350 local terms energy: -72.184769 where: bonds (distance) C4'-P energy: -13.345 bonds (distance) P-C4' energy: -13.137 flat angles C4'-P-C4' energy: -17.384 flat angles P-C4'-P energy: -9.412 tors. eta vs tors. theta energy: -18.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -203.695905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.695905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.695905 (E_RNA) where: Base-Base interactions energy: -136.022 where: short stacking energy: -52.962 Base-Backbone interact. energy: -0.525 local terms energy: -67.148352 where: bonds (distance) C4'-P energy: -13.064 bonds (distance) P-C4' energy: -13.047 flat angles C4'-P-C4' energy: -16.391 flat angles P-C4'-P energy: -8.195 tors. eta vs tors. theta energy: -16.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -189.282200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.282200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.282200 (E_RNA) where: Base-Base interactions energy: -123.887 where: short stacking energy: -46.569 Base-Backbone interact. energy: -1.192 local terms energy: -64.203354 where: bonds (distance) C4'-P energy: -14.873 bonds (distance) P-C4' energy: -16.206 flat angles C4'-P-C4' energy: -14.140 flat angles P-C4'-P energy: -7.874 tors. eta vs tors. theta energy: -11.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -198.820865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.820865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.820865 (E_RNA) where: Base-Base interactions energy: -133.791 where: short stacking energy: -57.572 Base-Backbone interact. energy: -1.223 local terms energy: -63.806525 where: bonds (distance) C4'-P energy: -15.263 bonds (distance) P-C4' energy: -16.193 flat angles C4'-P-C4' energy: -13.693 flat angles P-C4'-P energy: -6.846 tors. eta vs tors. theta energy: -11.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -182.308490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.308490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.308490 (E_RNA) where: Base-Base interactions energy: -109.457 where: short stacking energy: -59.660 Base-Backbone interact. energy: -0.010 local terms energy: -72.841596 where: bonds (distance) C4'-P energy: -12.596 bonds (distance) P-C4' energy: -16.714 flat angles C4'-P-C4' energy: -18.206 flat angles P-C4'-P energy: -8.898 tors. eta vs tors. theta energy: -16.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -154.193187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.193187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.193187 (E_RNA) where: Base-Base interactions energy: -93.374 where: short stacking energy: -47.490 Base-Backbone interact. energy: -0.465 local terms energy: -60.354325 where: bonds (distance) C4'-P energy: -15.535 bonds (distance) P-C4' energy: -10.741 flat angles C4'-P-C4' energy: -13.494 flat angles P-C4'-P energy: -9.327 tors. eta vs tors. theta energy: -11.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -98.128621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.128621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.128621 (E_RNA) where: Base-Base interactions energy: -43.803 where: short stacking energy: -23.624 Base-Backbone interact. energy: 0.016 local terms energy: -54.341804 where: bonds (distance) C4'-P energy: -11.172 bonds (distance) P-C4' energy: -16.252 flat angles C4'-P-C4' energy: -15.422 flat angles P-C4'-P energy: -11.629 tors. eta vs tors. theta energy: 0.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -77.057257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.057257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.057257 (E_RNA) where: Base-Base interactions energy: -32.920 where: short stacking energy: -20.325 Base-Backbone interact. energy: -0.330 local terms energy: -43.807432 where: bonds (distance) C4'-P energy: -15.178 bonds (distance) P-C4' energy: -16.364 flat angles C4'-P-C4' energy: -13.173 flat angles P-C4'-P energy: -1.065 tors. eta vs tors. theta energy: 1.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -78.456055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.456055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.456055 (E_RNA) where: Base-Base interactions energy: -27.188 where: short stacking energy: -25.652 Base-Backbone interact. energy: 0.219 local terms energy: -51.487660 where: bonds (distance) C4'-P energy: -15.642 bonds (distance) P-C4' energy: -13.825 flat angles C4'-P-C4' energy: -9.166 flat angles P-C4'-P energy: -11.070 tors. eta vs tors. theta energy: -1.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -65.849670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.849670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.849670 (E_RNA) where: Base-Base interactions energy: -18.920 where: short stacking energy: -15.112 Base-Backbone interact. energy: -0.523 local terms energy: -46.407124 where: bonds (distance) C4'-P energy: -13.071 bonds (distance) P-C4' energy: -14.621 flat angles C4'-P-C4' energy: -14.226 flat angles P-C4'-P energy: -8.099 tors. eta vs tors. theta energy: 3.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -222.689465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.689465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.689465 (E_RNA) where: Base-Base interactions energy: -146.946 where: short stacking energy: -62.264 Base-Backbone interact. energy: -0.933 local terms energy: -74.810394 where: bonds (distance) C4'-P energy: -15.596 bonds (distance) P-C4' energy: -17.945 flat angles C4'-P-C4' energy: -13.081 flat angles P-C4'-P energy: -11.103 tors. eta vs tors. theta energy: -17.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -186.083455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.083455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.083455 (E_RNA) where: Base-Base interactions energy: -128.509 where: short stacking energy: -43.443 Base-Backbone interact. energy: -0.234 local terms energy: -57.339832 where: bonds (distance) C4'-P energy: -12.663 bonds (distance) P-C4' energy: -15.930 flat angles C4'-P-C4' energy: -13.858 flat angles P-C4'-P energy: -5.673 tors. eta vs tors. theta energy: -9.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -204.495116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.495116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.495116 (E_RNA) where: Base-Base interactions energy: -132.490 where: short stacking energy: -47.532 Base-Backbone interact. energy: -0.854 local terms energy: -71.151671 where: bonds (distance) C4'-P energy: -15.480 bonds (distance) P-C4' energy: -14.659 flat angles C4'-P-C4' energy: -14.471 flat angles P-C4'-P energy: -10.500 tors. eta vs tors. theta energy: -16.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -200.607424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.607424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.607424 (E_RNA) where: Base-Base interactions energy: -122.366 where: short stacking energy: -51.885 Base-Backbone interact. energy: -1.455 local terms energy: -76.786600 where: bonds (distance) C4'-P energy: -15.299 bonds (distance) P-C4' energy: -13.090 flat angles C4'-P-C4' energy: -15.995 flat angles P-C4'-P energy: -11.586 tors. eta vs tors. theta energy: -20.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -165.821240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.821240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.821240 (E_RNA) where: Base-Base interactions energy: -101.386 where: short stacking energy: -54.392 Base-Backbone interact. energy: 0.251 local terms energy: -64.686171 where: bonds (distance) C4'-P energy: -11.096 bonds (distance) P-C4' energy: -14.764 flat angles C4'-P-C4' energy: -14.011 flat angles P-C4'-P energy: -8.981 tors. eta vs tors. theta energy: -15.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -145.205719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.205719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.205719 (E_RNA) where: Base-Base interactions energy: -81.679 where: short stacking energy: -40.426 Base-Backbone interact. energy: -0.310 local terms energy: -63.216276 where: bonds (distance) C4'-P energy: -14.606 bonds (distance) P-C4' energy: -17.178 flat angles C4'-P-C4' energy: -14.105 flat angles P-C4'-P energy: -5.022 tors. eta vs tors. theta energy: -12.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -88.066424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.066424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.066424 (E_RNA) where: Base-Base interactions energy: -28.662 where: short stacking energy: -28.662 Base-Backbone interact. energy: -0.491 local terms energy: -58.912810 where: bonds (distance) C4'-P energy: -13.543 bonds (distance) P-C4' energy: -15.034 flat angles C4'-P-C4' energy: -15.931 flat angles P-C4'-P energy: -6.781 tors. eta vs tors. theta energy: -7.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -93.111748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.111748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.111748 (E_RNA) where: Base-Base interactions energy: -40.409 where: short stacking energy: -36.057 Base-Backbone interact. energy: -0.151 local terms energy: -52.551775 where: bonds (distance) C4'-P energy: -9.673 bonds (distance) P-C4' energy: -9.614 flat angles C4'-P-C4' energy: -15.330 flat angles P-C4'-P energy: -9.251 tors. eta vs tors. theta energy: -8.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -77.614288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.614288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.614288 (E_RNA) where: Base-Base interactions energy: -26.544 where: short stacking energy: -26.091 Base-Backbone interact. energy: 2.118 local terms energy: -53.187544 where: bonds (distance) C4'-P energy: -12.439 bonds (distance) P-C4' energy: -12.135 flat angles C4'-P-C4' energy: -13.774 flat angles P-C4'-P energy: -8.262 tors. eta vs tors. theta energy: -6.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -84.741111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.741111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.741111 (E_RNA) where: Base-Base interactions energy: -26.006 where: short stacking energy: -26.006 Base-Backbone interact. energy: -0.128 local terms energy: -58.606913 where: bonds (distance) C4'-P energy: -12.448 bonds (distance) P-C4' energy: -14.892 flat angles C4'-P-C4' energy: -11.658 flat angles P-C4'-P energy: -11.756 tors. eta vs tors. theta energy: -7.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -222.810623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.810623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.810623 (E_RNA) where: Base-Base interactions energy: -148.752 where: short stacking energy: -64.534 Base-Backbone interact. energy: -0.191 local terms energy: -73.868059 where: bonds (distance) C4'-P energy: -14.509 bonds (distance) P-C4' energy: -15.057 flat angles C4'-P-C4' energy: -14.759 flat angles P-C4'-P energy: -8.038 tors. eta vs tors. theta energy: -21.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -182.086092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.086092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.086092 (E_RNA) where: Base-Base interactions energy: -116.779 where: short stacking energy: -46.224 Base-Backbone interact. energy: -0.031 local terms energy: -65.276313 where: bonds (distance) C4'-P energy: -15.378 bonds (distance) P-C4' energy: -15.679 flat angles C4'-P-C4' energy: -15.819 flat angles P-C4'-P energy: -7.089 tors. eta vs tors. theta energy: -11.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -208.338853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.338853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.338853 (E_RNA) where: Base-Base interactions energy: -141.031 where: short stacking energy: -54.487 Base-Backbone interact. energy: -0.773 local terms energy: -66.534864 where: bonds (distance) C4'-P energy: -10.953 bonds (distance) P-C4' energy: -15.470 flat angles C4'-P-C4' energy: -14.908 flat angles P-C4'-P energy: -8.811 tors. eta vs tors. theta energy: -16.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -181.483804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.483804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.483804 (E_RNA) where: Base-Base interactions energy: -118.344 where: short stacking energy: -49.746 Base-Backbone interact. energy: -0.092 local terms energy: -63.047430 where: bonds (distance) C4'-P energy: -13.250 bonds (distance) P-C4' energy: -13.170 flat angles C4'-P-C4' energy: -13.140 flat angles P-C4'-P energy: -10.777 tors. eta vs tors. theta energy: -12.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -154.430034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.430034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.430034 (E_RNA) where: Base-Base interactions energy: -87.441 where: short stacking energy: -37.055 Base-Backbone interact. energy: 1.170 local terms energy: -68.158243 where: bonds (distance) C4'-P energy: -17.178 bonds (distance) P-C4' energy: -16.809 flat angles C4'-P-C4' energy: -15.700 flat angles P-C4'-P energy: -7.896 tors. eta vs tors. theta energy: -10.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -145.236782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.236782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.236782 (E_RNA) where: Base-Base interactions energy: -88.143 where: short stacking energy: -49.315 Base-Backbone interact. energy: -0.179 local terms energy: -56.914475 where: bonds (distance) C4'-P energy: -12.462 bonds (distance) P-C4' energy: -11.869 flat angles C4'-P-C4' energy: -13.973 flat angles P-C4'-P energy: -6.253 tors. eta vs tors. theta energy: -12.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -106.662947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.662947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.662947 (E_RNA) where: Base-Base interactions energy: -55.280 where: short stacking energy: -22.641 Base-Backbone interact. energy: -0.554 local terms energy: -50.829127 where: bonds (distance) C4'-P energy: -12.738 bonds (distance) P-C4' energy: -11.045 flat angles C4'-P-C4' energy: -12.695 flat angles P-C4'-P energy: -8.304 tors. eta vs tors. theta energy: -6.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -81.125945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.125945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.125945 (E_RNA) where: Base-Base interactions energy: -34.521 where: short stacking energy: -24.433 Base-Backbone interact. energy: -0.564 local terms energy: -46.040832 where: bonds (distance) C4'-P energy: -12.720 bonds (distance) P-C4' energy: -10.807 flat angles C4'-P-C4' energy: -6.842 flat angles P-C4'-P energy: -8.670 tors. eta vs tors. theta energy: -7.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -84.296550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.296550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.296550 (E_RNA) where: Base-Base interactions energy: -41.582 where: short stacking energy: -25.316 Base-Backbone interact. energy: -0.042 local terms energy: -42.672688 where: bonds (distance) C4'-P energy: -11.122 bonds (distance) P-C4' energy: -15.120 flat angles C4'-P-C4' energy: -11.985 flat angles P-C4'-P energy: -6.254 tors. eta vs tors. theta energy: 1.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -96.590818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.590818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.590818 (E_RNA) where: Base-Base interactions energy: -48.689 where: short stacking energy: -29.105 Base-Backbone interact. energy: -0.651 local terms energy: -47.250800 where: bonds (distance) C4'-P energy: -10.481 bonds (distance) P-C4' energy: -10.849 flat angles C4'-P-C4' energy: -10.087 flat angles P-C4'-P energy: -10.099 tors. eta vs tors. theta energy: -5.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -224.200556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.200556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.200556 (E_RNA) where: Base-Base interactions energy: -153.741 where: short stacking energy: -59.700 Base-Backbone interact. energy: -0.050 local terms energy: -70.409643 where: bonds (distance) C4'-P energy: -11.146 bonds (distance) P-C4' energy: -18.172 flat angles C4'-P-C4' energy: -14.544 flat angles P-C4'-P energy: -10.752 tors. eta vs tors. theta energy: -15.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -216.098101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.098101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.098101 (E_RNA) where: Base-Base interactions energy: -154.413 where: short stacking energy: -66.995 Base-Backbone interact. energy: -0.531 local terms energy: -61.154888 where: bonds (distance) C4'-P energy: -11.383 bonds (distance) P-C4' energy: -13.654 flat angles C4'-P-C4' energy: -12.030 flat angles P-C4'-P energy: -6.834 tors. eta vs tors. theta energy: -17.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -179.899477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.899477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.899477 (E_RNA) where: Base-Base interactions energy: -111.626 where: short stacking energy: -46.057 Base-Backbone interact. energy: -0.857 local terms energy: -67.416593 where: bonds (distance) C4'-P energy: -13.704 bonds (distance) P-C4' energy: -16.452 flat angles C4'-P-C4' energy: -13.930 flat angles P-C4'-P energy: -11.628 tors. eta vs tors. theta energy: -11.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -194.316688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.316688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.316688 (E_RNA) where: Base-Base interactions energy: -124.475 where: short stacking energy: -50.366 Base-Backbone interact. energy: -0.097 local terms energy: -69.744535 where: bonds (distance) C4'-P energy: -14.144 bonds (distance) P-C4' energy: -14.403 flat angles C4'-P-C4' energy: -17.347 flat angles P-C4'-P energy: -10.621 tors. eta vs tors. theta energy: -13.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -153.167852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.167852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.167852 (E_RNA) where: Base-Base interactions energy: -95.462 where: short stacking energy: -35.573 Base-Backbone interact. energy: -0.252 local terms energy: -57.454116 where: bonds (distance) C4'-P energy: -15.651 bonds (distance) P-C4' energy: -14.924 flat angles C4'-P-C4' energy: -13.446 flat angles P-C4'-P energy: -5.226 tors. eta vs tors. theta energy: -8.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -127.649090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.649090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.649090 (E_RNA) where: Base-Base interactions energy: -68.914 where: short stacking energy: -42.151 Base-Backbone interact. energy: -0.975 local terms energy: -57.759877 where: bonds (distance) C4'-P energy: -14.582 bonds (distance) P-C4' energy: -16.368 flat angles C4'-P-C4' energy: -7.717 flat angles P-C4'-P energy: -9.021 tors. eta vs tors. theta energy: -10.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -98.428673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.428673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.428673 (E_RNA) where: Base-Base interactions energy: -49.178 where: short stacking energy: -36.772 Base-Backbone interact. energy: -0.299 local terms energy: -48.951209 where: bonds (distance) C4'-P energy: -13.093 bonds (distance) P-C4' energy: -12.524 flat angles C4'-P-C4' energy: -9.919 flat angles P-C4'-P energy: -5.917 tors. eta vs tors. theta energy: -7.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -79.206969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.206969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.206969 (E_RNA) where: Base-Base interactions energy: -22.218 where: short stacking energy: -22.218 Base-Backbone interact. energy: -0.552 local terms energy: -56.437163 where: bonds (distance) C4'-P energy: -15.783 bonds (distance) P-C4' energy: -14.543 flat angles C4'-P-C4' energy: -12.729 flat angles P-C4'-P energy: -8.888 tors. eta vs tors. theta energy: -4.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -80.698728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.698728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.698728 (E_RNA) where: Base-Base interactions energy: -29.072 where: short stacking energy: -27.301 Base-Backbone interact. energy: -0.094 local terms energy: -51.533556 where: bonds (distance) C4'-P energy: -13.622 bonds (distance) P-C4' energy: -12.515 flat angles C4'-P-C4' energy: -13.981 flat angles P-C4'-P energy: -7.034 tors. eta vs tors. theta energy: -4.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -80.957807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.957807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.957807 (E_RNA) where: Base-Base interactions energy: -30.260 where: short stacking energy: -17.352 Base-Backbone interact. energy: -0.068 local terms energy: -50.630450 where: bonds (distance) C4'-P energy: -13.018 bonds (distance) P-C4' energy: -10.730 flat angles C4'-P-C4' energy: -12.921 flat angles P-C4'-P energy: -10.376 tors. eta vs tors. theta energy: -3.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -217.879914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.879914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.879914 (E_RNA) where: Base-Base interactions energy: -148.688 where: short stacking energy: -56.834 Base-Backbone interact. energy: -0.120 local terms energy: -69.071929 where: bonds (distance) C4'-P energy: -14.075 bonds (distance) P-C4' energy: -13.776 flat angles C4'-P-C4' energy: -15.276 flat angles P-C4'-P energy: -8.033 tors. eta vs tors. theta energy: -17.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -216.043849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.043849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.043849 (E_RNA) where: Base-Base interactions energy: -144.572 where: short stacking energy: -55.118 Base-Backbone interact. energy: -0.964 local terms energy: -70.507313 where: bonds (distance) C4'-P energy: -11.855 bonds (distance) P-C4' energy: -13.041 flat angles C4'-P-C4' energy: -18.864 flat angles P-C4'-P energy: -10.831 tors. eta vs tors. theta energy: -15.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -205.029694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.029694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.029694 (E_RNA) where: Base-Base interactions energy: -137.097 where: short stacking energy: -46.749 Base-Backbone interact. energy: -0.119 local terms energy: -67.813747 where: bonds (distance) C4'-P energy: -10.186 bonds (distance) P-C4' energy: -18.243 flat angles C4'-P-C4' energy: -15.291 flat angles P-C4'-P energy: -10.176 tors. eta vs tors. theta energy: -13.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -194.813996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.813996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.813996 (E_RNA) where: Base-Base interactions energy: -129.817 where: short stacking energy: -47.807 Base-Backbone interact. energy: -0.153 local terms energy: -64.844023 where: bonds (distance) C4'-P energy: -13.234 bonds (distance) P-C4' energy: -14.167 flat angles C4'-P-C4' energy: -14.939 flat angles P-C4'-P energy: -8.481 tors. eta vs tors. theta energy: -14.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -137.423579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.423579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.423579 (E_RNA) where: Base-Base interactions energy: -74.236 where: short stacking energy: -36.968 Base-Backbone interact. energy: -0.140 local terms energy: -63.047009 where: bonds (distance) C4'-P energy: -16.181 bonds (distance) P-C4' energy: -17.563 flat angles C4'-P-C4' energy: -11.756 flat angles P-C4'-P energy: -10.308 tors. eta vs tors. theta energy: -7.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -89.652107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.652107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.652107 (E_RNA) where: Base-Base interactions energy: -42.397 where: short stacking energy: -40.456 Base-Backbone interact. energy: 1.705 local terms energy: -48.960140 where: bonds (distance) C4'-P energy: -12.489 bonds (distance) P-C4' energy: -9.795 flat angles C4'-P-C4' energy: -14.461 flat angles P-C4'-P energy: -7.317 tors. eta vs tors. theta energy: -4.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -87.105495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.105495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.105495 (E_RNA) where: Base-Base interactions energy: -22.612 where: short stacking energy: -20.093 Base-Backbone interact. energy: -0.113 local terms energy: -64.379911 where: bonds (distance) C4'-P energy: -16.699 bonds (distance) P-C4' energy: -17.562 flat angles C4'-P-C4' energy: -15.170 flat angles P-C4'-P energy: -10.824 tors. eta vs tors. theta energy: -4.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -81.418185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.418185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.418185 (E_RNA) where: Base-Base interactions energy: -34.889 where: short stacking energy: -29.560 Base-Backbone interact. energy: -0.211 local terms energy: -46.317587 where: bonds (distance) C4'-P energy: -14.152 bonds (distance) P-C4' energy: -9.163 flat angles C4'-P-C4' energy: -9.543 flat angles P-C4'-P energy: -9.326 tors. eta vs tors. theta energy: -4.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -113.256551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.256551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.256551 (E_RNA) where: Base-Base interactions energy: -65.059 where: short stacking energy: -22.216 Base-Backbone interact. energy: -0.567 local terms energy: -47.629954 where: bonds (distance) C4'-P energy: -14.168 bonds (distance) P-C4' energy: -9.365 flat angles C4'-P-C4' energy: -14.413 flat angles P-C4'-P energy: -9.489 tors. eta vs tors. theta energy: -0.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -72.907963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.907963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.907963 (E_RNA) where: Base-Base interactions energy: -21.598 where: short stacking energy: -21.356 Base-Backbone interact. energy: -0.101 local terms energy: -51.209120 where: bonds (distance) C4'-P energy: -9.648 bonds (distance) P-C4' energy: -14.166 flat angles C4'-P-C4' energy: -13.387 flat angles P-C4'-P energy: -11.803 tors. eta vs tors. theta energy: -2.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -222.340874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.340874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.340874 (E_RNA) where: Base-Base interactions energy: -147.355 where: short stacking energy: -59.452 Base-Backbone interact. energy: -0.249 local terms energy: -74.737171 where: bonds (distance) C4'-P energy: -13.565 bonds (distance) P-C4' energy: -17.019 flat angles C4'-P-C4' energy: -16.137 flat angles P-C4'-P energy: -11.483 tors. eta vs tors. theta energy: -16.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -200.997104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.997104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.997104 (E_RNA) where: Base-Base interactions energy: -132.553 where: short stacking energy: -57.199 Base-Backbone interact. energy: -0.714 local terms energy: -67.730316 where: bonds (distance) C4'-P energy: -13.923 bonds (distance) P-C4' energy: -14.222 flat angles C4'-P-C4' energy: -11.934 flat angles P-C4'-P energy: -10.644 tors. eta vs tors. theta energy: -17.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -209.044576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.044576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.044576 (E_RNA) where: Base-Base interactions energy: -139.234 where: short stacking energy: -55.493 Base-Backbone interact. energy: -0.491 local terms energy: -69.319604 where: bonds (distance) C4'-P energy: -13.090 bonds (distance) P-C4' energy: -16.200 flat angles C4'-P-C4' energy: -15.009 flat angles P-C4'-P energy: -8.772 tors. eta vs tors. theta energy: -16.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -183.176897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.176897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.176897 (E_RNA) where: Base-Base interactions energy: -120.704 where: short stacking energy: -42.311 Base-Backbone interact. energy: -0.766 local terms energy: -61.707657 where: bonds (distance) C4'-P energy: -12.004 bonds (distance) P-C4' energy: -14.543 flat angles C4'-P-C4' energy: -16.575 flat angles P-C4'-P energy: -8.555 tors. eta vs tors. theta energy: -10.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -161.203487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.203487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.203487 (E_RNA) where: Base-Base interactions energy: -96.776 where: short stacking energy: -38.895 Base-Backbone interact. energy: -1.310 local terms energy: -63.117304 where: bonds (distance) C4'-P energy: -12.843 bonds (distance) P-C4' energy: -18.233 flat angles C4'-P-C4' energy: -12.026 flat angles P-C4'-P energy: -10.339 tors. eta vs tors. theta energy: -9.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -93.604398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.604398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.604398 (E_RNA) where: Base-Base interactions energy: -36.942 where: short stacking energy: -34.438 Base-Backbone interact. energy: -0.040 local terms energy: -56.622563 where: bonds (distance) C4'-P energy: -12.874 bonds (distance) P-C4' energy: -17.019 flat angles C4'-P-C4' energy: -12.259 flat angles P-C4'-P energy: -3.134 tors. eta vs tors. theta energy: -11.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -100.658769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.658769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.658769 (E_RNA) where: Base-Base interactions energy: -42.107 where: short stacking energy: -31.889 Base-Backbone interact. energy: 0.849 local terms energy: -59.400471 where: bonds (distance) C4'-P energy: -16.227 bonds (distance) P-C4' energy: -12.833 flat angles C4'-P-C4' energy: -16.367 flat angles P-C4'-P energy: -7.288 tors. eta vs tors. theta energy: -6.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -85.468583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.468583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.468583 (E_RNA) where: Base-Base interactions energy: -30.174 where: short stacking energy: -29.166 Base-Backbone interact. energy: -0.134 local terms energy: -55.161289 where: bonds (distance) C4'-P energy: -15.018 bonds (distance) P-C4' energy: -12.294 flat angles C4'-P-C4' energy: -14.424 flat angles P-C4'-P energy: -12.566 tors. eta vs tors. theta energy: -0.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -74.162200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.162200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.162200 (E_RNA) where: Base-Base interactions energy: -28.351 where: short stacking energy: -25.296 Base-Backbone interact. energy: 1.634 local terms energy: -47.445281 where: bonds (distance) C4'-P energy: -10.215 bonds (distance) P-C4' energy: -16.908 flat angles C4'-P-C4' energy: -11.550 flat angles P-C4'-P energy: -8.016 tors. eta vs tors. theta energy: -0.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -77.981987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.981987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.981987 (E_RNA) where: Base-Base interactions energy: -22.778 where: short stacking energy: -21.236 Base-Backbone interact. energy: -0.000 local terms energy: -55.203989 where: bonds (distance) C4'-P energy: -16.632 bonds (distance) P-C4' energy: -14.044 flat angles C4'-P-C4' energy: -14.592 flat angles P-C4'-P energy: -8.226 tors. eta vs tors. theta energy: -1.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -206.537365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.537365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.537365 (E_RNA) where: Base-Base interactions energy: -133.309 where: short stacking energy: -53.028 Base-Backbone interact. energy: -0.625 local terms energy: -72.603184 where: bonds (distance) C4'-P energy: -14.491 bonds (distance) P-C4' energy: -17.408 flat angles C4'-P-C4' energy: -14.921 flat angles P-C4'-P energy: -12.767 tors. eta vs tors. theta energy: -13.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -210.420859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.420859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.420859 (E_RNA) where: Base-Base interactions energy: -141.544 where: short stacking energy: -61.648 Base-Backbone interact. energy: -0.291 local terms energy: -68.586580 where: bonds (distance) C4'-P energy: -12.393 bonds (distance) P-C4' energy: -11.878 flat angles C4'-P-C4' energy: -18.787 flat angles P-C4'-P energy: -9.371 tors. eta vs tors. theta energy: -16.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -201.081275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.081275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.081275 (E_RNA) where: Base-Base interactions energy: -135.948 where: short stacking energy: -51.668 Base-Backbone interact. energy: -0.165 local terms energy: -64.968600 where: bonds (distance) C4'-P energy: -16.230 bonds (distance) P-C4' energy: -12.018 flat angles C4'-P-C4' energy: -14.208 flat angles P-C4'-P energy: -7.785 tors. eta vs tors. theta energy: -14.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -190.479652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.479652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.479652 (E_RNA) where: Base-Base interactions energy: -125.761 where: short stacking energy: -41.368 Base-Backbone interact. energy: -1.135 local terms energy: -63.583839 where: bonds (distance) C4'-P energy: -16.278 bonds (distance) P-C4' energy: -16.970 flat angles C4'-P-C4' energy: -10.769 flat angles P-C4'-P energy: -9.437 tors. eta vs tors. theta energy: -10.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -111.200464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.200464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.200464 (E_RNA) where: Base-Base interactions energy: -53.038 where: short stacking energy: -45.012 Base-Backbone interact. energy: -0.121 local terms energy: -58.041666 where: bonds (distance) C4'-P energy: -14.359 bonds (distance) P-C4' energy: -10.874 flat angles C4'-P-C4' energy: -13.358 flat angles P-C4'-P energy: -11.693 tors. eta vs tors. theta energy: -7.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -158.044090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.044090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.044090 (E_RNA) where: Base-Base interactions energy: -103.619 where: short stacking energy: -46.522 Base-Backbone interact. energy: -0.313 local terms energy: -54.112057 where: bonds (distance) C4'-P energy: -12.070 bonds (distance) P-C4' energy: -14.383 flat angles C4'-P-C4' energy: -16.523 flat angles P-C4'-P energy: -4.212 tors. eta vs tors. theta energy: -6.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -140.244661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.244661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.244661 (E_RNA) where: Base-Base interactions energy: -85.570 where: short stacking energy: -41.559 Base-Backbone interact. energy: -0.663 local terms energy: -54.012228 where: bonds (distance) C4'-P energy: -9.379 bonds (distance) P-C4' energy: -13.564 flat angles C4'-P-C4' energy: -11.721 flat angles P-C4'-P energy: -6.586 tors. eta vs tors. theta energy: -12.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -106.418664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.418664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.418664 (E_RNA) where: Base-Base interactions energy: -57.937 where: short stacking energy: -26.311 Base-Backbone interact. energy: -0.082 local terms energy: -48.399823 where: bonds (distance) C4'-P energy: -9.647 bonds (distance) P-C4' energy: -17.405 flat angles C4'-P-C4' energy: -10.151 flat angles P-C4'-P energy: -5.291 tors. eta vs tors. theta energy: -5.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -80.423802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.423802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.423802 (E_RNA) where: Base-Base interactions energy: -23.687 where: short stacking energy: -19.116 Base-Backbone interact. energy: -0.152 local terms energy: -56.584720 where: bonds (distance) C4'-P energy: -13.179 bonds (distance) P-C4' energy: -15.190 flat angles C4'-P-C4' energy: -13.469 flat angles P-C4'-P energy: -10.110 tors. eta vs tors. theta energy: -4.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -95.062348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.062348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.062348 (E_RNA) where: Base-Base interactions energy: -52.432 where: short stacking energy: -28.002 Base-Backbone interact. energy: -0.101 local terms energy: -42.529196 where: bonds (distance) C4'-P energy: -11.909 bonds (distance) P-C4' energy: -7.731 flat angles C4'-P-C4' energy: -13.701 flat angles P-C4'-P energy: -7.611 tors. eta vs tors. theta energy: -1.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -208.354517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.354517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.354517 (E_RNA) where: Base-Base interactions energy: -136.750 where: short stacking energy: -59.108 Base-Backbone interact. energy: -1.188 local terms energy: -70.416108 where: bonds (distance) C4'-P energy: -16.144 bonds (distance) P-C4' energy: -16.651 flat angles C4'-P-C4' energy: -13.897 flat angles P-C4'-P energy: -6.727 tors. eta vs tors. theta energy: -16.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -215.510198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.510198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.510198 (E_RNA) where: Base-Base interactions energy: -142.324 where: short stacking energy: -57.391 Base-Backbone interact. energy: -0.708 local terms energy: -72.478271 where: bonds (distance) C4'-P energy: -15.915 bonds (distance) P-C4' energy: -15.274 flat angles C4'-P-C4' energy: -16.742 flat angles P-C4'-P energy: -6.142 tors. eta vs tors. theta energy: -18.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -191.551887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.551887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.551887 (E_RNA) where: Base-Base interactions energy: -130.190 where: short stacking energy: -50.009 Base-Backbone interact. energy: -0.303 local terms energy: -61.058634 where: bonds (distance) C4'-P energy: -13.663 bonds (distance) P-C4' energy: -13.916 flat angles C4'-P-C4' energy: -14.744 flat angles P-C4'-P energy: -9.219 tors. eta vs tors. theta energy: -9.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -175.164765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.164765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.164765 (E_RNA) where: Base-Base interactions energy: -118.346 where: short stacking energy: -49.236 Base-Backbone interact. energy: -0.973 local terms energy: -55.845035 where: bonds (distance) C4'-P energy: -9.239 bonds (distance) P-C4' energy: -12.246 flat angles C4'-P-C4' energy: -12.569 flat angles P-C4'-P energy: -8.847 tors. eta vs tors. theta energy: -12.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -93.580852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.580852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.580852 (E_RNA) where: Base-Base interactions energy: -56.151 where: short stacking energy: -26.539 Base-Backbone interact. energy: -0.263 local terms energy: -37.167034 where: bonds (distance) C4'-P energy: -14.143 bonds (distance) P-C4' energy: -14.065 flat angles C4'-P-C4' energy: -6.269 flat angles P-C4'-P energy: -2.541 tors. eta vs tors. theta energy: -0.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -143.408635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.408635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.408635 (E_RNA) where: Base-Base interactions energy: -78.991 where: short stacking energy: -40.319 Base-Backbone interact. energy: 0.692 local terms energy: -65.109676 where: bonds (distance) C4'-P energy: -14.230 bonds (distance) P-C4' energy: -15.967 flat angles C4'-P-C4' energy: -11.299 flat angles P-C4'-P energy: -9.409 tors. eta vs tors. theta energy: -14.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -131.126728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.126728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.126728 (E_RNA) where: Base-Base interactions energy: -74.741 where: short stacking energy: -38.407 Base-Backbone interact. energy: -1.011 local terms energy: -55.374957 where: bonds (distance) C4'-P energy: -15.702 bonds (distance) P-C4' energy: -11.023 flat angles C4'-P-C4' energy: -15.842 flat angles P-C4'-P energy: -6.408 tors. eta vs tors. theta energy: -6.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -85.516369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.516369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.516369 (E_RNA) where: Base-Base interactions energy: -35.511 where: short stacking energy: -29.708 Base-Backbone interact. energy: 1.084 local terms energy: -51.089140 where: bonds (distance) C4'-P energy: -14.352 bonds (distance) P-C4' energy: -16.615 flat angles C4'-P-C4' energy: -11.405 flat angles P-C4'-P energy: -7.831 tors. eta vs tors. theta energy: -0.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -89.028571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.028571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.028571 (E_RNA) where: Base-Base interactions energy: -39.117 where: short stacking energy: -25.161 Base-Backbone interact. energy: -0.176 local terms energy: -49.735728 where: bonds (distance) C4'-P energy: -9.556 bonds (distance) P-C4' energy: -16.228 flat angles C4'-P-C4' energy: -15.330 flat angles P-C4'-P energy: -6.671 tors. eta vs tors. theta energy: -1.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -119.808489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.808489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.808489 (E_RNA) where: Base-Base interactions energy: -72.536 where: short stacking energy: -31.914 Base-Backbone interact. energy: -0.043 local terms energy: -47.229521 where: bonds (distance) C4'-P energy: -10.414 bonds (distance) P-C4' energy: -14.320 flat angles C4'-P-C4' energy: -9.042 flat angles P-C4'-P energy: -5.330 tors. eta vs tors. theta energy: -8.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -219.327553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.327553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.327553 (E_RNA) where: Base-Base interactions energy: -150.885 where: short stacking energy: -50.991 Base-Backbone interact. energy: -1.565 local terms energy: -66.876942 where: bonds (distance) C4'-P energy: -12.907 bonds (distance) P-C4' energy: -15.683 flat angles C4'-P-C4' energy: -14.172 flat angles P-C4'-P energy: -11.253 tors. eta vs tors. theta energy: -12.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -213.678249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.678249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.678249 (E_RNA) where: Base-Base interactions energy: -134.192 where: short stacking energy: -59.165 Base-Backbone interact. energy: -1.164 local terms energy: -78.321708 where: bonds (distance) C4'-P energy: -17.521 bonds (distance) P-C4' energy: -15.779 flat angles C4'-P-C4' energy: -15.866 flat angles P-C4'-P energy: -12.808 tors. eta vs tors. theta energy: -16.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -192.174155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.174155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.174155 (E_RNA) where: Base-Base interactions energy: -125.648 where: short stacking energy: -52.113 Base-Backbone interact. energy: -0.165 local terms energy: -66.361251 where: bonds (distance) C4'-P energy: -14.448 bonds (distance) P-C4' energy: -16.224 flat angles C4'-P-C4' energy: -12.411 flat angles P-C4'-P energy: -9.221 tors. eta vs tors. theta energy: -14.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -190.566685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.566685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.566685 (E_RNA) where: Base-Base interactions energy: -129.303 where: short stacking energy: -49.228 Base-Backbone interact. energy: -0.461 local terms energy: -60.801997 where: bonds (distance) C4'-P energy: -12.294 bonds (distance) P-C4' energy: -12.554 flat angles C4'-P-C4' energy: -12.591 flat angles P-C4'-P energy: -9.447 tors. eta vs tors. theta energy: -13.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -132.030272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.030272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.030272 (E_RNA) where: Base-Base interactions energy: -72.669 where: short stacking energy: -28.750 Base-Backbone interact. energy: -0.259 local terms energy: -59.102271 where: bonds (distance) C4'-P energy: -14.066 bonds (distance) P-C4' energy: -17.122 flat angles C4'-P-C4' energy: -15.705 flat angles P-C4'-P energy: -8.557 tors. eta vs tors. theta energy: -3.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -113.729495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.729495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.729495 (E_RNA) where: Base-Base interactions energy: -58.500 where: short stacking energy: -20.824 Base-Backbone interact. energy: -0.143 local terms energy: -55.086469 where: bonds (distance) C4'-P energy: -13.464 bonds (distance) P-C4' energy: -13.374 flat angles C4'-P-C4' energy: -13.002 flat angles P-C4'-P energy: -11.822 tors. eta vs tors. theta energy: -3.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -134.604950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.604950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.604950 (E_RNA) where: Base-Base interactions energy: -76.222 where: short stacking energy: -33.753 Base-Backbone interact. energy: -0.287 local terms energy: -58.095923 where: bonds (distance) C4'-P energy: -13.615 bonds (distance) P-C4' energy: -16.592 flat angles C4'-P-C4' energy: -11.712 flat angles P-C4'-P energy: -10.938 tors. eta vs tors. theta energy: -5.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -89.056934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.056934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.056934 (E_RNA) where: Base-Base interactions energy: -44.580 where: short stacking energy: -26.172 Base-Backbone interact. energy: -0.103 local terms energy: -44.374402 where: bonds (distance) C4'-P energy: -15.381 bonds (distance) P-C4' energy: -11.515 flat angles C4'-P-C4' energy: -9.545 flat angles P-C4'-P energy: -6.898 tors. eta vs tors. theta energy: -1.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -79.018258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.018258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.018258 (E_RNA) where: Base-Base interactions energy: -32.028 where: short stacking energy: -19.164 Base-Backbone interact. energy: 0.219 local terms energy: -47.208890 where: bonds (distance) C4'-P energy: -12.405 bonds (distance) P-C4' energy: -16.400 flat angles C4'-P-C4' energy: -7.608 flat angles P-C4'-P energy: -11.267 tors. eta vs tors. theta energy: 0.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -118.050442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.050442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.050442 (E_RNA) where: Base-Base interactions energy: -67.207 where: short stacking energy: -24.110 Base-Backbone interact. energy: -0.182 local terms energy: -50.661064 where: bonds (distance) C4'-P energy: -11.605 bonds (distance) P-C4' energy: -16.410 flat angles C4'-P-C4' energy: -13.271 flat angles P-C4'-P energy: -4.549 tors. eta vs tors. theta energy: -4.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -219.459736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.459736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.459736 (E_RNA) where: Base-Base interactions energy: -148.326 where: short stacking energy: -48.703 Base-Backbone interact. energy: -1.916 local terms energy: -69.217875 where: bonds (distance) C4'-P energy: -15.039 bonds (distance) P-C4' energy: -17.559 flat angles C4'-P-C4' energy: -11.188 flat angles P-C4'-P energy: -11.099 tors. eta vs tors. theta energy: -14.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -213.052582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.052582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.052582 (E_RNA) where: Base-Base interactions energy: -141.505 where: short stacking energy: -57.874 Base-Backbone interact. energy: -0.468 local terms energy: -71.079025 where: bonds (distance) C4'-P energy: -16.720 bonds (distance) P-C4' energy: -15.927 flat angles C4'-P-C4' energy: -15.387 flat angles P-C4'-P energy: -5.846 tors. eta vs tors. theta energy: -17.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -208.543513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.543513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.543513 (E_RNA) where: Base-Base interactions energy: -138.238 where: short stacking energy: -47.976 Base-Backbone interact. energy: -1.580 local terms energy: -68.725125 where: bonds (distance) C4'-P energy: -12.442 bonds (distance) P-C4' energy: -16.160 flat angles C4'-P-C4' energy: -16.143 flat angles P-C4'-P energy: -9.297 tors. eta vs tors. theta energy: -14.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -205.142415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.142415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.142415 (E_RNA) where: Base-Base interactions energy: -137.448 where: short stacking energy: -56.585 Base-Backbone interact. energy: 0.733 local terms energy: -68.427441 where: bonds (distance) C4'-P energy: -13.531 bonds (distance) P-C4' energy: -10.820 flat angles C4'-P-C4' energy: -16.574 flat angles P-C4'-P energy: -10.754 tors. eta vs tors. theta energy: -16.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -135.474911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.474911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.474911 (E_RNA) where: Base-Base interactions energy: -72.330 where: short stacking energy: -29.000 Base-Backbone interact. energy: -0.259 local terms energy: -62.886290 where: bonds (distance) C4'-P energy: -17.009 bonds (distance) P-C4' energy: -13.975 flat angles C4'-P-C4' energy: -16.791 flat angles P-C4'-P energy: -9.544 tors. eta vs tors. theta energy: -5.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -143.041887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.041887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.041887 (E_RNA) where: Base-Base interactions energy: -90.168 where: short stacking energy: -41.632 Base-Backbone interact. energy: -1.469 local terms energy: -51.404744 where: bonds (distance) C4'-P energy: -11.643 bonds (distance) P-C4' energy: -15.445 flat angles C4'-P-C4' energy: -8.750 flat angles P-C4'-P energy: -8.460 tors. eta vs tors. theta energy: -7.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -84.547915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.547915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.547915 (E_RNA) where: Base-Base interactions energy: -36.804 where: short stacking energy: -23.995 Base-Backbone interact. energy: -0.108 local terms energy: -47.636735 where: bonds (distance) C4'-P energy: -11.485 bonds (distance) P-C4' energy: -16.713 flat angles C4'-P-C4' energy: -9.187 flat angles P-C4'-P energy: -9.486 tors. eta vs tors. theta energy: -0.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -80.170732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.170732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.170732 (E_RNA) where: Base-Base interactions energy: -41.721 where: short stacking energy: -27.655 Base-Backbone interact. energy: -0.756 local terms energy: -37.694209 where: bonds (distance) C4'-P energy: -9.630 bonds (distance) P-C4' energy: -15.977 flat angles C4'-P-C4' energy: -4.851 flat angles P-C4'-P energy: -4.889 tors. eta vs tors. theta energy: -2.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -67.184444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.184444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.184444 (E_RNA) where: Base-Base interactions energy: -21.318 where: short stacking energy: -12.432 Base-Backbone interact. energy: -0.524 local terms energy: -45.342661 where: bonds (distance) C4'-P energy: -11.938 bonds (distance) P-C4' energy: -12.580 flat angles C4'-P-C4' energy: -15.887 flat angles P-C4'-P energy: -7.881 tors. eta vs tors. theta energy: 2.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -86.675716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.675716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.675716 (E_RNA) where: Base-Base interactions energy: -29.730 where: short stacking energy: -29.730 Base-Backbone interact. energy: -0.072 local terms energy: -56.874214 where: bonds (distance) C4'-P energy: -15.713 bonds (distance) P-C4' energy: -14.599 flat angles C4'-P-C4' energy: -12.110 flat angles P-C4'-P energy: -8.511 tors. eta vs tors. theta energy: -5.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -209.509045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.509045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.509045 (E_RNA) where: Base-Base interactions energy: -144.728 where: short stacking energy: -56.468 Base-Backbone interact. energy: -0.680 local terms energy: -64.101105 where: bonds (distance) C4'-P energy: -11.900 bonds (distance) P-C4' energy: -15.222 flat angles C4'-P-C4' energy: -12.025 flat angles P-C4'-P energy: -7.807 tors. eta vs tors. theta energy: -17.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -218.160800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.160800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.160800 (E_RNA) where: Base-Base interactions energy: -152.696 where: short stacking energy: -54.485 Base-Backbone interact. energy: -0.393 local terms energy: -65.071998 where: bonds (distance) C4'-P energy: -13.307 bonds (distance) P-C4' energy: -17.417 flat angles C4'-P-C4' energy: -8.585 flat angles P-C4'-P energy: -9.158 tors. eta vs tors. theta energy: -16.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -211.293145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.293145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.293145 (E_RNA) where: Base-Base interactions energy: -144.354 where: short stacking energy: -60.070 Base-Backbone interact. energy: 0.426 local terms energy: -67.365119 where: bonds (distance) C4'-P energy: -12.476 bonds (distance) P-C4' energy: -15.315 flat angles C4'-P-C4' energy: -13.488 flat angles P-C4'-P energy: -6.656 tors. eta vs tors. theta energy: -19.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -190.128211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.128211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.128211 (E_RNA) where: Base-Base interactions energy: -122.126 where: short stacking energy: -45.160 Base-Backbone interact. energy: -1.810 local terms energy: -66.193074 where: bonds (distance) C4'-P energy: -14.849 bonds (distance) P-C4' energy: -11.226 flat angles C4'-P-C4' energy: -16.649 flat angles P-C4'-P energy: -11.763 tors. eta vs tors. theta energy: -11.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -153.454457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.454457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.454457 (E_RNA) where: Base-Base interactions energy: -100.279 where: short stacking energy: -46.993 Base-Backbone interact. energy: -0.698 local terms energy: -52.477498 where: bonds (distance) C4'-P energy: -16.085 bonds (distance) P-C4' energy: -15.353 flat angles C4'-P-C4' energy: -9.777 flat angles P-C4'-P energy: -5.535 tors. eta vs tors. theta energy: -5.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -133.225741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.225741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.225741 (E_RNA) where: Base-Base interactions energy: -75.646 where: short stacking energy: -40.995 Base-Backbone interact. energy: -0.067 local terms energy: -57.512420 where: bonds (distance) C4'-P energy: -14.658 bonds (distance) P-C4' energy: -14.332 flat angles C4'-P-C4' energy: -13.426 flat angles P-C4'-P energy: -6.436 tors. eta vs tors. theta energy: -8.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -82.898888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.898888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.898888 (E_RNA) where: Base-Base interactions energy: -37.060 where: short stacking energy: -23.020 Base-Backbone interact. energy: -0.239 local terms energy: -45.599705 where: bonds (distance) C4'-P energy: -14.086 bonds (distance) P-C4' energy: -15.734 flat angles C4'-P-C4' energy: -11.447 flat angles P-C4'-P energy: -4.821 tors. eta vs tors. theta energy: 0.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -85.244133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.244133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.244133 (E_RNA) where: Base-Base interactions energy: -31.658 where: short stacking energy: -30.836 Base-Backbone interact. energy: -0.034 local terms energy: -53.552300 where: bonds (distance) C4'-P energy: -17.622 bonds (distance) P-C4' energy: -14.366 flat angles C4'-P-C4' energy: -6.508 flat angles P-C4'-P energy: -11.170 tors. eta vs tors. theta energy: -3.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -82.873169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.873169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.873169 (E_RNA) where: Base-Base interactions energy: -34.874 where: short stacking energy: -20.428 Base-Backbone interact. energy: -0.263 local terms energy: -47.736457 where: bonds (distance) C4'-P energy: -7.611 bonds (distance) P-C4' energy: -17.743 flat angles C4'-P-C4' energy: -11.956 flat angles P-C4'-P energy: -5.900 tors. eta vs tors. theta energy: -4.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -76.145812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.145812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.145812 (E_RNA) where: Base-Base interactions energy: -29.080 where: short stacking energy: -29.080 Base-Backbone interact. energy: -0.086 local terms energy: -46.980048 where: bonds (distance) C4'-P energy: -11.089 bonds (distance) P-C4' energy: -13.958 flat angles C4'-P-C4' energy: -10.180 flat angles P-C4'-P energy: -8.694 tors. eta vs tors. theta energy: -3.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -216.432072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.432072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.432072 (E_RNA) where: Base-Base interactions energy: -144.564 where: short stacking energy: -60.008 Base-Backbone interact. energy: -0.746 local terms energy: -71.122169 where: bonds (distance) C4'-P energy: -13.412 bonds (distance) P-C4' energy: -16.076 flat angles C4'-P-C4' energy: -16.400 flat angles P-C4'-P energy: -5.456 tors. eta vs tors. theta energy: -19.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -223.733802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.733802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.733802 (E_RNA) where: Base-Base interactions energy: -144.860 where: short stacking energy: -62.198 Base-Backbone interact. energy: -2.607 local terms energy: -76.266476 where: bonds (distance) C4'-P energy: -16.168 bonds (distance) P-C4' energy: -16.805 flat angles C4'-P-C4' energy: -15.790 flat angles P-C4'-P energy: -9.385 tors. eta vs tors. theta energy: -18.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -202.806335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.806335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.806335 (E_RNA) where: Base-Base interactions energy: -130.243 where: short stacking energy: -54.732 Base-Backbone interact. energy: -1.140 local terms energy: -71.422976 where: bonds (distance) C4'-P energy: -16.387 bonds (distance) P-C4' energy: -14.234 flat angles C4'-P-C4' energy: -11.119 flat angles P-C4'-P energy: -11.757 tors. eta vs tors. theta energy: -17.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -180.566832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.566832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.566832 (E_RNA) where: Base-Base interactions energy: -112.547 where: short stacking energy: -41.260 Base-Backbone interact. energy: -0.141 local terms energy: -67.879633 where: bonds (distance) C4'-P energy: -15.133 bonds (distance) P-C4' energy: -15.574 flat angles C4'-P-C4' energy: -16.755 flat angles P-C4'-P energy: -10.158 tors. eta vs tors. theta energy: -10.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -155.511827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.511827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.511827 (E_RNA) where: Base-Base interactions energy: -92.793 where: short stacking energy: -39.877 Base-Backbone interact. energy: -0.539 local terms energy: -62.178955 where: bonds (distance) C4'-P energy: -13.958 bonds (distance) P-C4' energy: -16.286 flat angles C4'-P-C4' energy: -12.663 flat angles P-C4'-P energy: -9.190 tors. eta vs tors. theta energy: -10.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -143.219479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.219479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.219479 (E_RNA) where: Base-Base interactions energy: -85.271 where: short stacking energy: -45.968 Base-Backbone interact. energy: 0.374 local terms energy: -58.322798 where: bonds (distance) C4'-P energy: -12.914 bonds (distance) P-C4' energy: -11.265 flat angles C4'-P-C4' energy: -13.891 flat angles P-C4'-P energy: -9.447 tors. eta vs tors. theta energy: -10.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -80.819358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.819358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.819358 (E_RNA) where: Base-Base interactions energy: -30.134 where: short stacking energy: -27.077 Base-Backbone interact. energy: -1.159 local terms energy: -49.526876 where: bonds (distance) C4'-P energy: -11.784 bonds (distance) P-C4' energy: -16.433 flat angles C4'-P-C4' energy: -8.056 flat angles P-C4'-P energy: -10.029 tors. eta vs tors. theta energy: -3.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -74.852318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.852318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.852318 (E_RNA) where: Base-Base interactions energy: -38.224 where: short stacking energy: -24.567 Base-Backbone interact. energy: -0.062 local terms energy: -36.566369 where: bonds (distance) C4'-P energy: -11.917 bonds (distance) P-C4' energy: -10.605 flat angles C4'-P-C4' energy: -7.633 flat angles P-C4'-P energy: -4.305 tors. eta vs tors. theta energy: -2.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -77.577854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.577854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.577854 (E_RNA) where: Base-Base interactions energy: -24.037 where: short stacking energy: -24.037 Base-Backbone interact. energy: -0.277 local terms energy: -53.263945 where: bonds (distance) C4'-P energy: -11.921 bonds (distance) P-C4' energy: -12.704 flat angles C4'-P-C4' energy: -14.554 flat angles P-C4'-P energy: -10.441 tors. eta vs tors. theta energy: -3.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -85.579354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.579354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.579354 (E_RNA) where: Base-Base interactions energy: -41.510 where: short stacking energy: -26.992 Base-Backbone interact. energy: -0.216 local terms energy: -43.853286 where: bonds (distance) C4'-P energy: -14.086 bonds (distance) P-C4' energy: -14.368 flat angles C4'-P-C4' energy: -9.774 flat angles P-C4'-P energy: -2.361 tors. eta vs tors. theta energy: -3.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -229.817679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.817679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.817679 (E_RNA) where: Base-Base interactions energy: -155.364 where: short stacking energy: -53.771 Base-Backbone interact. energy: -0.623 local terms energy: -73.830650 where: bonds (distance) C4'-P energy: -14.485 bonds (distance) P-C4' energy: -18.193 flat angles C4'-P-C4' energy: -14.499 flat angles P-C4'-P energy: -6.860 tors. eta vs tors. theta energy: -19.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -220.199877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.199877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.199877 (E_RNA) where: Base-Base interactions energy: -146.436 where: short stacking energy: -58.219 Base-Backbone interact. energy: -0.240 local terms energy: -73.523476 where: bonds (distance) C4'-P energy: -16.388 bonds (distance) P-C4' energy: -12.599 flat angles C4'-P-C4' energy: -16.208 flat angles P-C4'-P energy: -8.132 tors. eta vs tors. theta energy: -20.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -203.429008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.429008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.429008 (E_RNA) where: Base-Base interactions energy: -130.281 where: short stacking energy: -48.888 Base-Backbone interact. energy: -1.388 local terms energy: -71.759394 where: bonds (distance) C4'-P energy: -16.177 bonds (distance) P-C4' energy: -16.001 flat angles C4'-P-C4' energy: -13.272 flat angles P-C4'-P energy: -11.305 tors. eta vs tors. theta energy: -15.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -190.361839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.361839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.361839 (E_RNA) where: Base-Base interactions energy: -126.853 where: short stacking energy: -54.428 Base-Backbone interact. energy: -0.071 local terms energy: -63.438319 where: bonds (distance) C4'-P energy: -13.313 bonds (distance) P-C4' energy: -11.034 flat angles C4'-P-C4' energy: -16.093 flat angles P-C4'-P energy: -8.358 tors. eta vs tors. theta energy: -14.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -142.190701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.190701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.190701 (E_RNA) where: Base-Base interactions energy: -81.095 where: short stacking energy: -38.573 Base-Backbone interact. energy: -0.333 local terms energy: -60.762733 where: bonds (distance) C4'-P energy: -12.525 bonds (distance) P-C4' energy: -11.047 flat angles C4'-P-C4' energy: -18.198 flat angles P-C4'-P energy: -10.536 tors. eta vs tors. theta energy: -8.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -144.148942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.148942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.148942 (E_RNA) where: Base-Base interactions energy: -83.744 where: short stacking energy: -28.773 Base-Backbone interact. energy: -0.092 local terms energy: -60.313334 where: bonds (distance) C4'-P energy: -13.209 bonds (distance) P-C4' energy: -16.286 flat angles C4'-P-C4' energy: -12.551 flat angles P-C4'-P energy: -7.554 tors. eta vs tors. theta energy: -10.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -87.621837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.621837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.621837 (E_RNA) where: Base-Base interactions energy: -37.421 where: short stacking energy: -28.478 Base-Backbone interact. energy: -0.458 local terms energy: -49.742606 where: bonds (distance) C4'-P energy: -6.097 bonds (distance) P-C4' energy: -12.626 flat angles C4'-P-C4' energy: -10.376 flat angles P-C4'-P energy: -12.397 tors. eta vs tors. theta energy: -8.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -99.217248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.217248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.217248 (E_RNA) where: Base-Base interactions energy: -48.436 where: short stacking energy: -23.694 Base-Backbone interact. energy: -0.140 local terms energy: -50.642206 where: bonds (distance) C4'-P energy: -14.381 bonds (distance) P-C4' energy: -14.181 flat angles C4'-P-C4' energy: -13.880 flat angles P-C4'-P energy: -7.471 tors. eta vs tors. theta energy: -0.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -82.920477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.920477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.920477 (E_RNA) where: Base-Base interactions energy: -31.444 where: short stacking energy: -27.901 Base-Backbone interact. energy: -0.008 local terms energy: -51.468533 where: bonds (distance) C4'-P energy: -16.893 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -6.574 flat angles P-C4'-P energy: -6.628 tors. eta vs tors. theta energy: -4.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -67.172842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.172842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.172842 (E_RNA) where: Base-Base interactions energy: -23.316 where: short stacking energy: -23.316 Base-Backbone interact. energy: -0.098 local terms energy: -43.759031 where: bonds (distance) C4'-P energy: -7.532 bonds (distance) P-C4' energy: -13.753 flat angles C4'-P-C4' energy: -14.688 flat angles P-C4'-P energy: -5.474 tors. eta vs tors. theta energy: -2.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -222.748955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.748955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.748955 (E_RNA) where: Base-Base interactions energy: -147.588 where: short stacking energy: -54.378 Base-Backbone interact. energy: -1.390 local terms energy: -73.771113 where: bonds (distance) C4'-P energy: -16.260 bonds (distance) P-C4' energy: -11.645 flat angles C4'-P-C4' energy: -15.747 flat angles P-C4'-P energy: -10.009 tors. eta vs tors. theta energy: -20.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -198.416436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.416436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.416436 (E_RNA) where: Base-Base interactions energy: -123.888 where: short stacking energy: -47.998 Base-Backbone interact. energy: -0.020 local terms energy: -74.508480 where: bonds (distance) C4'-P energy: -16.102 bonds (distance) P-C4' energy: -17.761 flat angles C4'-P-C4' energy: -17.531 flat angles P-C4'-P energy: -9.765 tors. eta vs tors. theta energy: -13.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -201.854828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.854828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.854828 (E_RNA) where: Base-Base interactions energy: -133.186 where: short stacking energy: -55.476 Base-Backbone interact. energy: -0.599 local terms energy: -68.070050 where: bonds (distance) C4'-P energy: -14.066 bonds (distance) P-C4' energy: -14.145 flat angles C4'-P-C4' energy: -13.052 flat angles P-C4'-P energy: -10.270 tors. eta vs tors. theta energy: -16.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -185.869619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.869619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.869619 (E_RNA) where: Base-Base interactions energy: -118.705 where: short stacking energy: -49.305 Base-Backbone interact. energy: -0.032 local terms energy: -67.132223 where: bonds (distance) C4'-P energy: -14.806 bonds (distance) P-C4' energy: -15.473 flat angles C4'-P-C4' energy: -15.478 flat angles P-C4'-P energy: -9.086 tors. eta vs tors. theta energy: -12.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -146.470482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.470482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.470482 (E_RNA) where: Base-Base interactions energy: -92.108 where: short stacking energy: -37.324 Base-Backbone interact. energy: 0.016 local terms energy: -54.378830 where: bonds (distance) C4'-P energy: -8.661 bonds (distance) P-C4' energy: -12.867 flat angles C4'-P-C4' energy: -15.919 flat angles P-C4'-P energy: -9.285 tors. eta vs tors. theta energy: -7.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -135.617944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.617944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.617944 (E_RNA) where: Base-Base interactions energy: -70.777 where: short stacking energy: -33.955 Base-Backbone interact. energy: -0.161 local terms energy: -64.679696 where: bonds (distance) C4'-P energy: -16.631 bonds (distance) P-C4' energy: -17.090 flat angles C4'-P-C4' energy: -9.133 flat angles P-C4'-P energy: -13.520 tors. eta vs tors. theta energy: -8.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -102.407542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.407542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.407542 (E_RNA) where: Base-Base interactions energy: -43.177 where: short stacking energy: -19.992 Base-Backbone interact. energy: -0.698 local terms energy: -58.533074 where: bonds (distance) C4'-P energy: -15.738 bonds (distance) P-C4' energy: -16.149 flat angles C4'-P-C4' energy: -15.062 flat angles P-C4'-P energy: -8.077 tors. eta vs tors. theta energy: -3.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -80.570217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.570217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.570217 (E_RNA) where: Base-Base interactions energy: -28.939 where: short stacking energy: -26.447 Base-Backbone interact. energy: 0.040 local terms energy: -51.671022 where: bonds (distance) C4'-P energy: -6.518 bonds (distance) P-C4' energy: -16.929 flat angles C4'-P-C4' energy: -9.822 flat angles P-C4'-P energy: -10.911 tors. eta vs tors. theta energy: -7.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -76.503787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.503787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.503787 (E_RNA) where: Base-Base interactions energy: -29.873 where: short stacking energy: -26.398 Base-Backbone interact. energy: -0.164 local terms energy: -46.466779 where: bonds (distance) C4'-P energy: -10.333 bonds (distance) P-C4' energy: -13.901 flat angles C4'-P-C4' energy: -14.044 flat angles P-C4'-P energy: -6.108 tors. eta vs tors. theta energy: -2.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -64.602356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.602356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.602356 (E_RNA) where: Base-Base interactions energy: -22.047 where: short stacking energy: -21.734 Base-Backbone interact. energy: 0.954 local terms energy: -43.509577 where: bonds (distance) C4'-P energy: -14.305 bonds (distance) P-C4' energy: -11.116 flat angles C4'-P-C4' energy: -7.146 flat angles P-C4'-P energy: -9.740 tors. eta vs tors. theta energy: -1.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -219.460049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.460049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.460049 (E_RNA) where: Base-Base interactions energy: -144.367 where: short stacking energy: -60.458 Base-Backbone interact. energy: -0.928 local terms energy: -74.165062 where: bonds (distance) C4'-P energy: -14.621 bonds (distance) P-C4' energy: -16.952 flat angles C4'-P-C4' energy: -16.976 flat angles P-C4'-P energy: -8.468 tors. eta vs tors. theta energy: -17.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -205.372590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.372590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.372590 (E_RNA) where: Base-Base interactions energy: -140.300 where: short stacking energy: -54.366 Base-Backbone interact. energy: -0.205 local terms energy: -64.867551 where: bonds (distance) C4'-P energy: -12.960 bonds (distance) P-C4' energy: -16.241 flat angles C4'-P-C4' energy: -14.816 flat angles P-C4'-P energy: -5.939 tors. eta vs tors. theta energy: -14.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -208.100295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.100295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.100295 (E_RNA) where: Base-Base interactions energy: -140.077 where: short stacking energy: -54.063 Base-Backbone interact. energy: -0.793 local terms energy: -67.230400 where: bonds (distance) C4'-P energy: -14.786 bonds (distance) P-C4' energy: -14.991 flat angles C4'-P-C4' energy: -12.126 flat angles P-C4'-P energy: -8.244 tors. eta vs tors. theta energy: -17.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -186.269110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.269110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.269110 (E_RNA) where: Base-Base interactions energy: -127.858 where: short stacking energy: -42.943 Base-Backbone interact. energy: -0.618 local terms energy: -57.793074 where: bonds (distance) C4'-P energy: -15.212 bonds (distance) P-C4' energy: -9.331 flat angles C4'-P-C4' energy: -9.504 flat angles P-C4'-P energy: -11.732 tors. eta vs tors. theta energy: -12.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -141.233343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.233343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.233343 (E_RNA) where: Base-Base interactions energy: -80.286 where: short stacking energy: -48.470 Base-Backbone interact. energy: -0.065 local terms energy: -60.883011 where: bonds (distance) C4'-P energy: -10.617 bonds (distance) P-C4' energy: -14.389 flat angles C4'-P-C4' energy: -14.531 flat angles P-C4'-P energy: -7.336 tors. eta vs tors. theta energy: -14.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -150.561896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.561896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.561896 (E_RNA) where: Base-Base interactions energy: -83.918 where: short stacking energy: -41.064 Base-Backbone interact. energy: -0.734 local terms energy: -65.909226 where: bonds (distance) C4'-P energy: -15.679 bonds (distance) P-C4' energy: -16.983 flat angles C4'-P-C4' energy: -12.416 flat angles P-C4'-P energy: -9.793 tors. eta vs tors. theta energy: -11.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -83.966032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.966032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.966032 (E_RNA) where: Base-Base interactions energy: -32.785 where: short stacking energy: -32.785 Base-Backbone interact. energy: -0.088 local terms energy: -51.093400 where: bonds (distance) C4'-P energy: -14.719 bonds (distance) P-C4' energy: -15.451 flat angles C4'-P-C4' energy: -12.337 flat angles P-C4'-P energy: -5.931 tors. eta vs tors. theta energy: -2.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -79.952569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.952569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.952569 (E_RNA) where: Base-Base interactions energy: -31.390 where: short stacking energy: -23.796 Base-Backbone interact. energy: -0.308 local terms energy: -48.255092 where: bonds (distance) C4'-P energy: -14.140 bonds (distance) P-C4' energy: -12.950 flat angles C4'-P-C4' energy: -15.148 flat angles P-C4'-P energy: -8.115 tors. eta vs tors. theta energy: 2.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -80.254405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.254405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.254405 (E_RNA) where: Base-Base interactions energy: -28.249 where: short stacking energy: -19.729 Base-Backbone interact. energy: -0.507 local terms energy: -51.498919 where: bonds (distance) C4'-P energy: -11.793 bonds (distance) P-C4' energy: -16.225 flat angles C4'-P-C4' energy: -13.412 flat angles P-C4'-P energy: -8.280 tors. eta vs tors. theta energy: -1.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -70.232261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.232261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.232261 (E_RNA) where: Base-Base interactions energy: -29.216 where: short stacking energy: -29.216 Base-Backbone interact. energy: -0.119 local terms energy: -40.896515 where: bonds (distance) C4'-P energy: -9.121 bonds (distance) P-C4' energy: -10.839 flat angles C4'-P-C4' energy: -10.613 flat angles P-C4'-P energy: -6.531 tors. eta vs tors. theta energy: -3.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -219.551885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.551885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.551885 (E_RNA) where: Base-Base interactions energy: -143.483 where: short stacking energy: -53.832 Base-Backbone interact. energy: -1.520 local terms energy: -74.548105 where: bonds (distance) C4'-P energy: -14.843 bonds (distance) P-C4' energy: -15.292 flat angles C4'-P-C4' energy: -17.347 flat angles P-C4'-P energy: -8.249 tors. eta vs tors. theta energy: -18.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -216.793420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.793420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.793420 (E_RNA) where: Base-Base interactions energy: -140.736 where: short stacking energy: -61.010 Base-Backbone interact. energy: -0.791 local terms energy: -75.266528 where: bonds (distance) C4'-P energy: -16.438 bonds (distance) P-C4' energy: -14.917 flat angles C4'-P-C4' energy: -16.877 flat angles P-C4'-P energy: -8.760 tors. eta vs tors. theta energy: -18.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -200.354369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.354369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.354369 (E_RNA) where: Base-Base interactions energy: -136.056 where: short stacking energy: -51.770 Base-Backbone interact. energy: -1.512 local terms energy: -62.787297 where: bonds (distance) C4'-P energy: -15.486 bonds (distance) P-C4' energy: -13.805 flat angles C4'-P-C4' energy: -14.058 flat angles P-C4'-P energy: -6.732 tors. eta vs tors. theta energy: -12.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -187.793820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.793820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.793820 (E_RNA) where: Base-Base interactions energy: -120.765 where: short stacking energy: -43.575 Base-Backbone interact. energy: -1.413 local terms energy: -65.615758 where: bonds (distance) C4'-P energy: -12.329 bonds (distance) P-C4' energy: -13.574 flat angles C4'-P-C4' energy: -15.497 flat angles P-C4'-P energy: -12.621 tors. eta vs tors. theta energy: -11.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -138.025570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.025570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.025570 (E_RNA) where: Base-Base interactions energy: -81.465 where: short stacking energy: -45.575 Base-Backbone interact. energy: -0.292 local terms energy: -56.268654 where: bonds (distance) C4'-P energy: -13.172 bonds (distance) P-C4' energy: -11.334 flat angles C4'-P-C4' energy: -12.362 flat angles P-C4'-P energy: -10.614 tors. eta vs tors. theta energy: -8.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -153.716447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.716447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.716447 (E_RNA) where: Base-Base interactions energy: -89.242 where: short stacking energy: -47.105 Base-Backbone interact. energy: -0.155 local terms energy: -64.318938 where: bonds (distance) C4'-P energy: -16.217 bonds (distance) P-C4' energy: -9.300 flat angles C4'-P-C4' energy: -11.765 flat angles P-C4'-P energy: -10.328 tors. eta vs tors. theta energy: -16.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -92.564321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.564321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.564321 (E_RNA) where: Base-Base interactions energy: -35.362 where: short stacking energy: -35.362 Base-Backbone interact. energy: -0.065 local terms energy: -57.137013 where: bonds (distance) C4'-P energy: -12.798 bonds (distance) P-C4' energy: -15.949 flat angles C4'-P-C4' energy: -11.535 flat angles P-C4'-P energy: -10.927 tors. eta vs tors. theta energy: -5.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -85.319751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.319751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.319751 (E_RNA) where: Base-Base interactions energy: -35.134 where: short stacking energy: -20.927 Base-Backbone interact. energy: -0.403 local terms energy: -49.783002 where: bonds (distance) C4'-P energy: -13.983 bonds (distance) P-C4' energy: -13.810 flat angles C4'-P-C4' energy: -12.568 flat angles P-C4'-P energy: -8.740 tors. eta vs tors. theta energy: -0.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -86.937165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.937165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.937165 (E_RNA) where: Base-Base interactions energy: -38.449 where: short stacking energy: -25.666 Base-Backbone interact. energy: -0.573 local terms energy: -47.914785 where: bonds (distance) C4'-P energy: -8.729 bonds (distance) P-C4' energy: -12.548 flat angles C4'-P-C4' energy: -11.774 flat angles P-C4'-P energy: -13.112 tors. eta vs tors. theta energy: -1.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -72.233223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.233223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.233223 (E_RNA) where: Base-Base interactions energy: -24.043 where: short stacking energy: -22.874 Base-Backbone interact. energy: -0.589 local terms energy: -47.600679 where: bonds (distance) C4'-P energy: -10.924 bonds (distance) P-C4' energy: -12.835 flat angles C4'-P-C4' energy: -11.853 flat angles P-C4'-P energy: -9.308 tors. eta vs tors. theta energy: -2.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -222.821925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.821925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.821925 (E_RNA) where: Base-Base interactions energy: -146.807 where: short stacking energy: -60.620 Base-Backbone interact. energy: -0.101 local terms energy: -75.914152 where: bonds (distance) C4'-P energy: -17.498 bonds (distance) P-C4' energy: -14.566 flat angles C4'-P-C4' energy: -13.126 flat angles P-C4'-P energy: -11.256 tors. eta vs tors. theta energy: -19.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -208.419429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.419429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.419429 (E_RNA) where: Base-Base interactions energy: -143.779 where: short stacking energy: -56.616 Base-Backbone interact. energy: 1.016 local terms energy: -65.656303 where: bonds (distance) C4'-P energy: -13.453 bonds (distance) P-C4' energy: -14.669 flat angles C4'-P-C4' energy: -15.270 flat angles P-C4'-P energy: -10.401 tors. eta vs tors. theta energy: -11.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -197.795826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.795826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.795826 (E_RNA) where: Base-Base interactions energy: -124.788 where: short stacking energy: -52.423 Base-Backbone interact. energy: -0.488 local terms energy: -72.520253 where: bonds (distance) C4'-P energy: -14.794 bonds (distance) P-C4' energy: -18.215 flat angles C4'-P-C4' energy: -13.588 flat angles P-C4'-P energy: -8.442 tors. eta vs tors. theta energy: -17.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -205.434356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.434356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.434356 (E_RNA) where: Base-Base interactions energy: -139.047 where: short stacking energy: -57.962 Base-Backbone interact. energy: -1.156 local terms energy: -65.231836 where: bonds (distance) C4'-P energy: -14.485 bonds (distance) P-C4' energy: -13.786 flat angles C4'-P-C4' energy: -12.288 flat angles P-C4'-P energy: -8.222 tors. eta vs tors. theta energy: -16.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -133.309320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.309320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.309320 (E_RNA) where: Base-Base interactions energy: -61.417 where: short stacking energy: -38.357 Base-Backbone interact. energy: -0.177 local terms energy: -71.714963 where: bonds (distance) C4'-P energy: -14.223 bonds (distance) P-C4' energy: -13.909 flat angles C4'-P-C4' energy: -16.549 flat angles P-C4'-P energy: -11.334 tors. eta vs tors. theta energy: -15.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -97.024160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.024160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.024160 (E_RNA) where: Base-Base interactions energy: -44.287 where: short stacking energy: -32.243 Base-Backbone interact. energy: 0.727 local terms energy: -53.464650 where: bonds (distance) C4'-P energy: -12.174 bonds (distance) P-C4' energy: -10.085 flat angles C4'-P-C4' energy: -14.194 flat angles P-C4'-P energy: -9.061 tors. eta vs tors. theta energy: -7.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -94.222959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.222959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.222959 (E_RNA) where: Base-Base interactions energy: -45.737 where: short stacking energy: -40.457 Base-Backbone interact. energy: -0.104 local terms energy: -48.381780 where: bonds (distance) C4'-P energy: -11.081 bonds (distance) P-C4' energy: -8.332 flat angles C4'-P-C4' energy: -10.959 flat angles P-C4'-P energy: -8.490 tors. eta vs tors. theta energy: -9.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -86.198042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.198042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.198042 (E_RNA) where: Base-Base interactions energy: -37.598 where: short stacking energy: -33.636 Base-Backbone interact. energy: -0.909 local terms energy: -47.691434 where: bonds (distance) C4'-P energy: -11.437 bonds (distance) P-C4' energy: -10.721 flat angles C4'-P-C4' energy: -13.457 flat angles P-C4'-P energy: -9.947 tors. eta vs tors. theta energy: -2.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -74.625726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.625726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.625726 (E_RNA) where: Base-Base interactions energy: -26.225 where: short stacking energy: -15.176 Base-Backbone interact. energy: -0.253 local terms energy: -48.147780 where: bonds (distance) C4'-P energy: -11.880 bonds (distance) P-C4' energy: -16.372 flat angles C4'-P-C4' energy: -7.018 flat angles P-C4'-P energy: -11.454 tors. eta vs tors. theta energy: -1.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -120.802551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.802551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.802551 (E_RNA) where: Base-Base interactions energy: -62.552 where: short stacking energy: -27.088 Base-Backbone interact. energy: -0.422 local terms energy: -57.828303 where: bonds (distance) C4'-P energy: -15.109 bonds (distance) P-C4' energy: -15.850 flat angles C4'-P-C4' energy: -11.576 flat angles P-C4'-P energy: -8.092 tors. eta vs tors. theta energy: -7.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -224.358885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.358885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.358885 (E_RNA) where: Base-Base interactions energy: -148.881 where: short stacking energy: -61.737 Base-Backbone interact. energy: -0.899 local terms energy: -74.579035 where: bonds (distance) C4'-P energy: -16.343 bonds (distance) P-C4' energy: -15.560 flat angles C4'-P-C4' energy: -16.080 flat angles P-C4'-P energy: -7.058 tors. eta vs tors. theta energy: -19.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -216.960644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.960644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.960644 (E_RNA) where: Base-Base interactions energy: -148.621 where: short stacking energy: -62.937 Base-Backbone interact. energy: -0.652 local terms energy: -67.687945 where: bonds (distance) C4'-P energy: -13.644 bonds (distance) P-C4' energy: -12.915 flat angles C4'-P-C4' energy: -12.695 flat angles P-C4'-P energy: -8.606 tors. eta vs tors. theta energy: -19.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -211.642802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.642802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.642802 (E_RNA) where: Base-Base interactions energy: -146.853 where: short stacking energy: -56.982 Base-Backbone interact. energy: -1.061 local terms energy: -63.728955 where: bonds (distance) C4'-P energy: -9.658 bonds (distance) P-C4' energy: -14.709 flat angles C4'-P-C4' energy: -11.805 flat angles P-C4'-P energy: -10.678 tors. eta vs tors. theta energy: -16.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -191.797278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.797278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.797278 (E_RNA) where: Base-Base interactions energy: -124.091 where: short stacking energy: -56.464 Base-Backbone interact. energy: -0.075 local terms energy: -67.630745 where: bonds (distance) C4'-P energy: -15.055 bonds (distance) P-C4' energy: -10.460 flat angles C4'-P-C4' energy: -17.186 flat angles P-C4'-P energy: -10.240 tors. eta vs tors. theta energy: -14.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -140.057625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.057625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.057625 (E_RNA) where: Base-Base interactions energy: -77.783 where: short stacking energy: -43.666 Base-Backbone interact. energy: -0.660 local terms energy: -61.615543 where: bonds (distance) C4'-P energy: -11.908 bonds (distance) P-C4' energy: -14.535 flat angles C4'-P-C4' energy: -13.083 flat angles P-C4'-P energy: -10.626 tors. eta vs tors. theta energy: -11.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -104.388311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.388311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.388311 (E_RNA) where: Base-Base interactions energy: -58.195 where: short stacking energy: -29.191 Base-Backbone interact. energy: -0.089 local terms energy: -46.104930 where: bonds (distance) C4'-P energy: -6.693 bonds (distance) P-C4' energy: -12.803 flat angles C4'-P-C4' energy: -16.042 flat angles P-C4'-P energy: -10.517 tors. eta vs tors. theta energy: -0.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -99.228867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.228867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.228867 (E_RNA) where: Base-Base interactions energy: -55.851 where: short stacking energy: -21.101 Base-Backbone interact. energy: 0.069 local terms energy: -43.446477 where: bonds (distance) C4'-P energy: -15.800 bonds (distance) P-C4' energy: -11.546 flat angles C4'-P-C4' energy: -8.930 flat angles P-C4'-P energy: -9.253 tors. eta vs tors. theta energy: 2.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -76.561217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.561217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.561217 (E_RNA) where: Base-Base interactions energy: -32.998 where: short stacking energy: -30.660 Base-Backbone interact. energy: 1.545 local terms energy: -45.108953 where: bonds (distance) C4'-P energy: -14.728 bonds (distance) P-C4' energy: -9.855 flat angles C4'-P-C4' energy: -11.518 flat angles P-C4'-P energy: -7.299 tors. eta vs tors. theta energy: -1.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -90.182615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.182615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.182615 (E_RNA) where: Base-Base interactions energy: -48.525 where: short stacking energy: -27.660 Base-Backbone interact. energy: 2.178 local terms energy: -43.835476 where: bonds (distance) C4'-P energy: -13.510 bonds (distance) P-C4' energy: -17.267 flat angles C4'-P-C4' energy: -5.966 flat angles P-C4'-P energy: -2.717 tors. eta vs tors. theta energy: -4.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -84.979095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.979095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.979095 (E_RNA) where: Base-Base interactions energy: -48.019 where: short stacking energy: -22.853 Base-Backbone interact. energy: -1.228 local terms energy: -35.732364 where: bonds (distance) C4'-P energy: -16.082 bonds (distance) P-C4' energy: -13.234 flat angles C4'-P-C4' energy: -2.894 flat angles P-C4'-P energy: -4.984 tors. eta vs tors. theta energy: 1.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -214.487122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.487122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.487122 (E_RNA) where: Base-Base interactions energy: -147.676 where: short stacking energy: -57.689 Base-Backbone interact. energy: 1.384 local terms energy: -68.195589 where: bonds (distance) C4'-P energy: -13.635 bonds (distance) P-C4' energy: -15.234 flat angles C4'-P-C4' energy: -15.263 flat angles P-C4'-P energy: -9.963 tors. eta vs tors. theta energy: -14.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -215.352784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.352784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.352784 (E_RNA) where: Base-Base interactions energy: -140.940 where: short stacking energy: -60.219 Base-Backbone interact. energy: -1.998 local terms energy: -72.414916 where: bonds (distance) C4'-P energy: -16.446 bonds (distance) P-C4' energy: -16.361 flat angles C4'-P-C4' energy: -14.133 flat angles P-C4'-P energy: -6.462 tors. eta vs tors. theta energy: -19.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -215.749028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.749028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.749028 (E_RNA) where: Base-Base interactions energy: -149.191 where: short stacking energy: -59.309 Base-Backbone interact. energy: -0.637 local terms energy: -65.921006 where: bonds (distance) C4'-P energy: -12.170 bonds (distance) P-C4' energy: -15.444 flat angles C4'-P-C4' energy: -15.169 flat angles P-C4'-P energy: -4.923 tors. eta vs tors. theta energy: -18.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -192.018730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.018730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.018730 (E_RNA) where: Base-Base interactions energy: -128.233 where: short stacking energy: -51.098 Base-Backbone interact. energy: -0.714 local terms energy: -63.071067 where: bonds (distance) C4'-P energy: -11.499 bonds (distance) P-C4' energy: -16.678 flat angles C4'-P-C4' energy: -11.263 flat angles P-C4'-P energy: -10.683 tors. eta vs tors. theta energy: -12.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -131.669781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.669781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.669781 (E_RNA) where: Base-Base interactions energy: -69.886 where: short stacking energy: -27.035 Base-Backbone interact. energy: -0.139 local terms energy: -61.645257 where: bonds (distance) C4'-P energy: -13.879 bonds (distance) P-C4' energy: -16.873 flat angles C4'-P-C4' energy: -11.824 flat angles P-C4'-P energy: -11.107 tors. eta vs tors. theta energy: -7.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -101.952092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.952092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.952092 (E_RNA) where: Base-Base interactions energy: -46.037 where: short stacking energy: -26.611 Base-Backbone interact. energy: -0.141 local terms energy: -55.773733 where: bonds (distance) C4'-P energy: -15.178 bonds (distance) P-C4' energy: -14.927 flat angles C4'-P-C4' energy: -12.147 flat angles P-C4'-P energy: -10.052 tors. eta vs tors. theta energy: -3.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -91.098607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.098607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.098607 (E_RNA) where: Base-Base interactions energy: -37.958 where: short stacking energy: -35.210 Base-Backbone interact. energy: -0.020 local terms energy: -53.120719 where: bonds (distance) C4'-P energy: -14.700 bonds (distance) P-C4' energy: -15.346 flat angles C4'-P-C4' energy: -12.328 flat angles P-C4'-P energy: -3.850 tors. eta vs tors. theta energy: -6.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -95.554421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.554421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.554421 (E_RNA) where: Base-Base interactions energy: -45.203 where: short stacking energy: -31.207 Base-Backbone interact. energy: -0.119 local terms energy: -50.232728 where: bonds (distance) C4'-P energy: -12.017 bonds (distance) P-C4' energy: -14.955 flat angles C4'-P-C4' energy: -9.153 flat angles P-C4'-P energy: -8.249 tors. eta vs tors. theta energy: -5.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -83.013113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.013113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.013113 (E_RNA) where: Base-Base interactions energy: -26.909 where: short stacking energy: -19.364 Base-Backbone interact. energy: -0.333 local terms energy: -55.771093 where: bonds (distance) C4'-P energy: -14.376 bonds (distance) P-C4' energy: -15.031 flat angles C4'-P-C4' energy: -14.810 flat angles P-C4'-P energy: -7.951 tors. eta vs tors. theta energy: -3.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -67.512447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.512447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.512447 (E_RNA) where: Base-Base interactions energy: -23.133 where: short stacking energy: -20.139 Base-Backbone interact. energy: 2.350 local terms energy: -46.729300 where: bonds (distance) C4'-P energy: -13.462 bonds (distance) P-C4' energy: -13.287 flat angles C4'-P-C4' energy: -9.679 flat angles P-C4'-P energy: -6.846 tors. eta vs tors. theta energy: -3.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -215.037395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.037395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.037395 (E_RNA) where: Base-Base interactions energy: -146.884 where: short stacking energy: -56.197 Base-Backbone interact. energy: -0.488 local terms energy: -67.665327 where: bonds (distance) C4'-P energy: -10.890 bonds (distance) P-C4' energy: -17.116 flat angles C4'-P-C4' energy: -15.543 flat angles P-C4'-P energy: -9.195 tors. eta vs tors. theta energy: -14.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -213.477280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.477280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.477280 (E_RNA) where: Base-Base interactions energy: -142.938 where: short stacking energy: -57.560 Base-Backbone interact. energy: 0.293 local terms energy: -70.832824 where: bonds (distance) C4'-P energy: -14.218 bonds (distance) P-C4' energy: -14.592 flat angles C4'-P-C4' energy: -15.498 flat angles P-C4'-P energy: -8.978 tors. eta vs tors. theta energy: -17.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -199.857547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.857547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.857547 (E_RNA) where: Base-Base interactions energy: -128.509 where: short stacking energy: -51.834 Base-Backbone interact. energy: -0.032 local terms energy: -71.316397 where: bonds (distance) C4'-P energy: -15.468 bonds (distance) P-C4' energy: -14.792 flat angles C4'-P-C4' energy: -16.847 flat angles P-C4'-P energy: -9.976 tors. eta vs tors. theta energy: -14.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -187.772033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.772033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.772033 (E_RNA) where: Base-Base interactions energy: -121.958 where: short stacking energy: -53.890 Base-Backbone interact. energy: -0.145 local terms energy: -65.668384 where: bonds (distance) C4'-P energy: -12.483 bonds (distance) P-C4' energy: -11.862 flat angles C4'-P-C4' energy: -16.847 flat angles P-C4'-P energy: -11.099 tors. eta vs tors. theta energy: -13.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -116.240713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.240713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.240713 (E_RNA) where: Base-Base interactions energy: -67.846 where: short stacking energy: -40.499 Base-Backbone interact. energy: -0.042 local terms energy: -48.352635 where: bonds (distance) C4'-P energy: -12.546 bonds (distance) P-C4' energy: -12.873 flat angles C4'-P-C4' energy: -10.427 flat angles P-C4'-P energy: -5.560 tors. eta vs tors. theta energy: -6.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -109.121672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.121672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.121672 (E_RNA) where: Base-Base interactions energy: -52.263 where: short stacking energy: -26.669 Base-Backbone interact. energy: -0.122 local terms energy: -56.736888 where: bonds (distance) C4'-P energy: -16.918 bonds (distance) P-C4' energy: -15.844 flat angles C4'-P-C4' energy: -8.373 flat angles P-C4'-P energy: -11.984 tors. eta vs tors. theta energy: -3.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -93.698812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.698812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.698812 (E_RNA) where: Base-Base interactions energy: -50.285 where: short stacking energy: -27.037 Base-Backbone interact. energy: 1.425 local terms energy: -44.837893 where: bonds (distance) C4'-P energy: -12.757 bonds (distance) P-C4' energy: -10.936 flat angles C4'-P-C4' energy: -10.682 flat angles P-C4'-P energy: -8.460 tors. eta vs tors. theta energy: -2.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -80.379088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.379088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.379088 (E_RNA) where: Base-Base interactions energy: -18.346 where: short stacking energy: -16.988 Base-Backbone interact. energy: -0.049 local terms energy: -61.984375 where: bonds (distance) C4'-P energy: -16.147 bonds (distance) P-C4' energy: -18.144 flat angles C4'-P-C4' energy: -15.984 flat angles P-C4'-P energy: -11.707 tors. eta vs tors. theta energy: -0.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -76.513630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.513630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.513630 (E_RNA) where: Base-Base interactions energy: -23.283 where: short stacking energy: -22.336 Base-Backbone interact. energy: -0.078 local terms energy: -53.152711 where: bonds (distance) C4'-P energy: -13.659 bonds (distance) P-C4' energy: -14.325 flat angles C4'-P-C4' energy: -13.191 flat angles P-C4'-P energy: -11.249 tors. eta vs tors. theta energy: -0.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -81.092719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.092719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.092719 (E_RNA) where: Base-Base interactions energy: -32.205 where: short stacking energy: -27.486 Base-Backbone interact. energy: -0.427 local terms energy: -48.460676 where: bonds (distance) C4'-P energy: -11.780 bonds (distance) P-C4' energy: -15.493 flat angles C4'-P-C4' energy: -10.847 flat angles P-C4'-P energy: -9.371 tors. eta vs tors. theta energy: -0.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -222.467903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.467903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.467903 (E_RNA) where: Base-Base interactions energy: -145.297 where: short stacking energy: -60.284 Base-Backbone interact. energy: -1.066 local terms energy: -76.105276 where: bonds (distance) C4'-P energy: -17.063 bonds (distance) P-C4' energy: -16.191 flat angles C4'-P-C4' energy: -13.975 flat angles P-C4'-P energy: -11.178 tors. eta vs tors. theta energy: -17.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -216.401169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.401169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.401169 (E_RNA) where: Base-Base interactions energy: -149.045 where: short stacking energy: -59.656 Base-Backbone interact. energy: -0.656 local terms energy: -66.700201 where: bonds (distance) C4'-P energy: -12.968 bonds (distance) P-C4' energy: -16.501 flat angles C4'-P-C4' energy: -13.124 flat angles P-C4'-P energy: -5.085 tors. eta vs tors. theta energy: -19.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -199.175288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.175288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.175288 (E_RNA) where: Base-Base interactions energy: -132.698 where: short stacking energy: -47.791 Base-Backbone interact. energy: -0.938 local terms energy: -65.540017 where: bonds (distance) C4'-P energy: -12.595 bonds (distance) P-C4' energy: -14.791 flat angles C4'-P-C4' energy: -16.967 flat angles P-C4'-P energy: -8.214 tors. eta vs tors. theta energy: -12.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -205.478929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.478929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.478929 (E_RNA) where: Base-Base interactions energy: -142.535 where: short stacking energy: -56.362 Base-Backbone interact. energy: -1.493 local terms energy: -61.450383 where: bonds (distance) C4'-P energy: -10.194 bonds (distance) P-C4' energy: -14.820 flat angles C4'-P-C4' energy: -11.065 flat angles P-C4'-P energy: -7.611 tors. eta vs tors. theta energy: -17.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -93.775462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.775462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.775462 (E_RNA) where: Base-Base interactions energy: -40.580 where: short stacking energy: -28.419 Base-Backbone interact. energy: -0.601 local terms energy: -52.594315 where: bonds (distance) C4'-P energy: -13.271 bonds (distance) P-C4' energy: -12.869 flat angles C4'-P-C4' energy: -14.740 flat angles P-C4'-P energy: -8.021 tors. eta vs tors. theta energy: -3.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -128.769093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.769093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.769093 (E_RNA) where: Base-Base interactions energy: -69.094 where: short stacking energy: -37.780 Base-Backbone interact. energy: -0.182 local terms energy: -59.493795 where: bonds (distance) C4'-P energy: -14.530 bonds (distance) P-C4' energy: -13.056 flat angles C4'-P-C4' energy: -14.001 flat angles P-C4'-P energy: -5.559 tors. eta vs tors. theta energy: -12.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -101.421105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.421105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.421105 (E_RNA) where: Base-Base interactions energy: -41.224 where: short stacking energy: -40.175 Base-Backbone interact. energy: -0.002 local terms energy: -60.195160 where: bonds (distance) C4'-P energy: -14.190 bonds (distance) P-C4' energy: -9.217 flat angles C4'-P-C4' energy: -13.289 flat angles P-C4'-P energy: -11.090 tors. eta vs tors. theta energy: -12.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -109.577003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.577003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.577003 (E_RNA) where: Base-Base interactions energy: -60.884 where: short stacking energy: -25.439 Base-Backbone interact. energy: -0.228 local terms energy: -48.464849 where: bonds (distance) C4'-P energy: -10.033 bonds (distance) P-C4' energy: -15.829 flat angles C4'-P-C4' energy: -11.719 flat angles P-C4'-P energy: -8.007 tors. eta vs tors. theta energy: -2.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -75.375920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.375920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.375920 (E_RNA) where: Base-Base interactions energy: -35.522 where: short stacking energy: -27.384 Base-Backbone interact. energy: 0.442 local terms energy: -40.296686 where: bonds (distance) C4'-P energy: -13.774 bonds (distance) P-C4' energy: -12.620 flat angles C4'-P-C4' energy: -7.218 flat angles P-C4'-P energy: -4.649 tors. eta vs tors. theta energy: -2.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -64.562353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.562353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.562353 (E_RNA) where: Base-Base interactions energy: -20.501 where: short stacking energy: -23.301 Base-Backbone interact. energy: -0.385 local terms energy: -43.675999 where: bonds (distance) C4'-P energy: -11.904 bonds (distance) P-C4' energy: -14.644 flat angles C4'-P-C4' energy: -8.913 flat angles P-C4'-P energy: -9.685 tors. eta vs tors. theta energy: 1.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -226.785489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.785489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.785489 (E_RNA) where: Base-Base interactions energy: -160.072 where: short stacking energy: -61.808 Base-Backbone interact. energy: -0.110 local terms energy: -66.604282 where: bonds (distance) C4'-P energy: -16.022 bonds (distance) P-C4' energy: -15.992 flat angles C4'-P-C4' energy: -13.427 flat angles P-C4'-P energy: -3.624 tors. eta vs tors. theta energy: -17.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -201.758009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.758009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.758009 (E_RNA) where: Base-Base interactions energy: -130.549 where: short stacking energy: -52.429 Base-Backbone interact. energy: -0.610 local terms energy: -70.598884 where: bonds (distance) C4'-P energy: -13.188 bonds (distance) P-C4' energy: -13.341 flat angles C4'-P-C4' energy: -15.887 flat angles P-C4'-P energy: -12.150 tors. eta vs tors. theta energy: -16.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -214.285176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.285176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.285176 (E_RNA) where: Base-Base interactions energy: -143.191 where: short stacking energy: -56.480 Base-Backbone interact. energy: -2.066 local terms energy: -69.028561 where: bonds (distance) C4'-P energy: -15.031 bonds (distance) P-C4' energy: -11.300 flat angles C4'-P-C4' energy: -13.999 flat angles P-C4'-P energy: -11.038 tors. eta vs tors. theta energy: -17.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -207.836913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.836913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.836913 (E_RNA) where: Base-Base interactions energy: -134.906 where: short stacking energy: -56.376 Base-Backbone interact. energy: -0.284 local terms energy: -72.646596 where: bonds (distance) C4'-P energy: -13.822 bonds (distance) P-C4' energy: -17.178 flat angles C4'-P-C4' energy: -15.893 flat angles P-C4'-P energy: -10.413 tors. eta vs tors. theta energy: -15.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -90.394355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.394355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.394355 (E_RNA) where: Base-Base interactions energy: -36.928 where: short stacking energy: -33.136 Base-Backbone interact. energy: -0.181 local terms energy: -53.285607 where: bonds (distance) C4'-P energy: -11.621 bonds (distance) P-C4' energy: -13.512 flat angles C4'-P-C4' energy: -10.098 flat angles P-C4'-P energy: -12.432 tors. eta vs tors. theta energy: -5.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -117.030687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.030687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.030687 (E_RNA) where: Base-Base interactions energy: -66.492 where: short stacking energy: -24.895 Base-Backbone interact. energy: -0.220 local terms energy: -50.319110 where: bonds (distance) C4'-P energy: -13.821 bonds (distance) P-C4' energy: -12.490 flat angles C4'-P-C4' energy: -14.129 flat angles P-C4'-P energy: -6.908 tors. eta vs tors. theta energy: -2.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -111.501337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.501337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.501337 (E_RNA) where: Base-Base interactions energy: -52.621 where: short stacking energy: -39.450 Base-Backbone interact. energy: -0.076 local terms energy: -58.804052 where: bonds (distance) C4'-P energy: -13.925 bonds (distance) P-C4' energy: -15.033 flat angles C4'-P-C4' energy: -14.785 flat angles P-C4'-P energy: -4.382 tors. eta vs tors. theta energy: -10.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -75.679179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.679179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.679179 (E_RNA) where: Base-Base interactions energy: -28.460 where: short stacking energy: -23.678 Base-Backbone interact. energy: -0.162 local terms energy: -47.056655 where: bonds (distance) C4'-P energy: -11.464 bonds (distance) P-C4' energy: -13.588 flat angles C4'-P-C4' energy: -16.671 flat angles P-C4'-P energy: -5.092 tors. eta vs tors. theta energy: -0.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -78.649195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.649195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.649195 (E_RNA) where: Base-Base interactions energy: -39.666 where: short stacking energy: -22.856 Base-Backbone interact. energy: -0.909 local terms energy: -38.074062 where: bonds (distance) C4'-P energy: -8.975 bonds (distance) P-C4' energy: -12.985 flat angles C4'-P-C4' energy: -8.558 flat angles P-C4'-P energy: -6.131 tors. eta vs tors. theta energy: -1.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -76.360341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.360341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.360341 (E_RNA) where: Base-Base interactions energy: -28.638 where: short stacking energy: -27.091 Base-Backbone interact. energy: -0.056 local terms energy: -47.666379 where: bonds (distance) C4'-P energy: -14.360 bonds (distance) P-C4' energy: -14.909 flat angles C4'-P-C4' energy: -11.482 flat angles P-C4'-P energy: -5.785 tors. eta vs tors. theta energy: -1.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -223.462277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.462277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.462277 (E_RNA) where: Base-Base interactions energy: -157.722 where: short stacking energy: -64.747 Base-Backbone interact. energy: -0.111 local terms energy: -65.629679 where: bonds (distance) C4'-P energy: -17.559 bonds (distance) P-C4' energy: -16.532 flat angles C4'-P-C4' energy: -13.424 flat angles P-C4'-P energy: -2.206 tors. eta vs tors. theta energy: -15.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -203.832417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.832417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.832417 (E_RNA) where: Base-Base interactions energy: -131.547 where: short stacking energy: -59.379 Base-Backbone interact. energy: -0.157 local terms energy: -72.128248 where: bonds (distance) C4'-P energy: -15.379 bonds (distance) P-C4' energy: -14.877 flat angles C4'-P-C4' energy: -12.423 flat angles P-C4'-P energy: -10.995 tors. eta vs tors. theta energy: -18.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -214.375101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.375101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.375101 (E_RNA) where: Base-Base interactions energy: -141.259 where: short stacking energy: -58.989 Base-Backbone interact. energy: -0.083 local terms energy: -73.033032 where: bonds (distance) C4'-P energy: -14.595 bonds (distance) P-C4' energy: -16.121 flat angles C4'-P-C4' energy: -16.990 flat angles P-C4'-P energy: -11.210 tors. eta vs tors. theta energy: -14.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -199.477646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.477646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.477646 (E_RNA) where: Base-Base interactions energy: -125.652 where: short stacking energy: -48.286 Base-Backbone interact. energy: -0.793 local terms energy: -73.032204 where: bonds (distance) C4'-P energy: -17.782 bonds (distance) P-C4' energy: -17.298 flat angles C4'-P-C4' energy: -11.858 flat angles P-C4'-P energy: -9.364 tors. eta vs tors. theta energy: -16.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -151.231908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.231908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.231908 (E_RNA) where: Base-Base interactions energy: -100.244 where: short stacking energy: -32.757 Base-Backbone interact. energy: -0.052 local terms energy: -50.936178 where: bonds (distance) C4'-P energy: -14.993 bonds (distance) P-C4' energy: -16.218 flat angles C4'-P-C4' energy: -10.699 flat angles P-C4'-P energy: -5.117 tors. eta vs tors. theta energy: -3.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -95.779166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.779166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.779166 (E_RNA) where: Base-Base interactions energy: -36.084 where: short stacking energy: -34.738 Base-Backbone interact. energy: -0.038 local terms energy: -59.657176 where: bonds (distance) C4'-P energy: -14.716 bonds (distance) P-C4' energy: -11.866 flat angles C4'-P-C4' energy: -12.950 flat angles P-C4'-P energy: -9.572 tors. eta vs tors. theta energy: -10.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -93.055783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.055783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.055783 (E_RNA) where: Base-Base interactions energy: -32.523 where: short stacking energy: -32.523 Base-Backbone interact. energy: 0.150 local terms energy: -60.682725 where: bonds (distance) C4'-P energy: -13.490 bonds (distance) P-C4' energy: -13.212 flat angles C4'-P-C4' energy: -12.693 flat angles P-C4'-P energy: -11.647 tors. eta vs tors. theta energy: -9.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -91.313059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.313059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.313059 (E_RNA) where: Base-Base interactions energy: -37.967 where: short stacking energy: -32.805 Base-Backbone interact. energy: -0.039 local terms energy: -53.307123 where: bonds (distance) C4'-P energy: -13.929 bonds (distance) P-C4' energy: -13.091 flat angles C4'-P-C4' energy: -12.116 flat angles P-C4'-P energy: -8.051 tors. eta vs tors. theta energy: -6.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -71.166358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.166358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.166358 (E_RNA) where: Base-Base interactions energy: -24.494 where: short stacking energy: -25.335 Base-Backbone interact. energy: 0.138 local terms energy: -46.810476 where: bonds (distance) C4'-P energy: -14.547 bonds (distance) P-C4' energy: -14.435 flat angles C4'-P-C4' energy: -9.101 flat angles P-C4'-P energy: -8.660 tors. eta vs tors. theta energy: -0.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -83.015632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.015632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.015632 (E_RNA) where: Base-Base interactions energy: -35.409 where: short stacking energy: -35.409 Base-Backbone interact. energy: 1.729 local terms energy: -49.335816 where: bonds (distance) C4'-P energy: -13.018 bonds (distance) P-C4' energy: -12.057 flat angles C4'-P-C4' energy: -14.008 flat angles P-C4'-P energy: -8.785 tors. eta vs tors. theta energy: -1.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -225.260998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.260998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.260998 (E_RNA) where: Base-Base interactions energy: -162.486 where: short stacking energy: -63.538 Base-Backbone interact. energy: -0.033 local terms energy: -62.741907 where: bonds (distance) C4'-P energy: -12.542 bonds (distance) P-C4' energy: -15.514 flat angles C4'-P-C4' energy: -13.937 flat angles P-C4'-P energy: -5.678 tors. eta vs tors. theta energy: -15.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -204.060763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.060763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.060763 (E_RNA) where: Base-Base interactions energy: -138.209 where: short stacking energy: -57.222 Base-Backbone interact. energy: -1.547 local terms energy: -64.304667 where: bonds (distance) C4'-P energy: -13.777 bonds (distance) P-C4' energy: -13.376 flat angles C4'-P-C4' energy: -15.389 flat angles P-C4'-P energy: -6.559 tors. eta vs tors. theta energy: -15.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -205.360507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.360507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.360507 (E_RNA) where: Base-Base interactions energy: -136.390 where: short stacking energy: -47.182 Base-Backbone interact. energy: 0.072 local terms energy: -69.042344 where: bonds (distance) C4'-P energy: -14.103 bonds (distance) P-C4' energy: -13.331 flat angles C4'-P-C4' energy: -16.512 flat angles P-C4'-P energy: -7.459 tors. eta vs tors. theta energy: -17.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -195.211549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.211549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.211549 (E_RNA) where: Base-Base interactions energy: -132.288 where: short stacking energy: -48.356 Base-Backbone interact. energy: -0.899 local terms energy: -62.024613 where: bonds (distance) C4'-P energy: -13.374 bonds (distance) P-C4' energy: -15.436 flat angles C4'-P-C4' energy: -12.268 flat angles P-C4'-P energy: -9.577 tors. eta vs tors. theta energy: -11.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -145.052018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.052018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.052018 (E_RNA) where: Base-Base interactions energy: -95.464 where: short stacking energy: -31.150 Base-Backbone interact. energy: -0.075 local terms energy: -49.513116 where: bonds (distance) C4'-P energy: -13.709 bonds (distance) P-C4' energy: -14.743 flat angles C4'-P-C4' energy: -8.618 flat angles P-C4'-P energy: -7.743 tors. eta vs tors. theta energy: -4.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -100.059340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.059340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.059340 (E_RNA) where: Base-Base interactions energy: -50.583 where: short stacking energy: -31.442 Base-Backbone interact. energy: -0.009 local terms energy: -49.466662 where: bonds (distance) C4'-P energy: -9.184 bonds (distance) P-C4' energy: -13.727 flat angles C4'-P-C4' energy: -11.744 flat angles P-C4'-P energy: -8.981 tors. eta vs tors. theta energy: -5.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -99.668622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.668622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.668622 (E_RNA) where: Base-Base interactions energy: -53.994 where: short stacking energy: -18.135 Base-Backbone interact. energy: -0.309 local terms energy: -45.365314 where: bonds (distance) C4'-P energy: -10.493 bonds (distance) P-C4' energy: -13.131 flat angles C4'-P-C4' energy: -12.506 flat angles P-C4'-P energy: -7.407 tors. eta vs tors. theta energy: -1.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -90.415002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.415002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.415002 (E_RNA) where: Base-Base interactions energy: -35.413 where: short stacking energy: -35.913 Base-Backbone interact. energy: 0.544 local terms energy: -55.546021 where: bonds (distance) C4'-P energy: -8.933 bonds (distance) P-C4' energy: -14.771 flat angles C4'-P-C4' energy: -15.038 flat angles P-C4'-P energy: -10.027 tors. eta vs tors. theta energy: -6.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -75.588844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.588844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.588844 (E_RNA) where: Base-Base interactions energy: -27.562 where: short stacking energy: -25.670 Base-Backbone interact. energy: -0.016 local terms energy: -48.010941 where: bonds (distance) C4'-P energy: -6.516 bonds (distance) P-C4' energy: -13.566 flat angles C4'-P-C4' energy: -11.948 flat angles P-C4'-P energy: -8.646 tors. eta vs tors. theta energy: -7.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -72.696259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.696259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.696259 (E_RNA) where: Base-Base interactions energy: -23.120 where: short stacking energy: -17.871 Base-Backbone interact. energy: -0.253 local terms energy: -49.323329 where: bonds (distance) C4'-P energy: -14.033 bonds (distance) P-C4' energy: -16.671 flat angles C4'-P-C4' energy: -12.592 flat angles P-C4'-P energy: -6.003 tors. eta vs tors. theta energy: -0.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -218.356981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.356981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.356981 (E_RNA) where: Base-Base interactions energy: -148.115 where: short stacking energy: -61.660 Base-Backbone interact. energy: -0.113 local terms energy: -70.129078 where: bonds (distance) C4'-P energy: -13.266 bonds (distance) P-C4' energy: -16.622 flat angles C4'-P-C4' energy: -12.843 flat angles P-C4'-P energy: -9.111 tors. eta vs tors. theta energy: -18.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -212.499832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.499832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.499832 (E_RNA) where: Base-Base interactions energy: -135.424 where: short stacking energy: -57.079 Base-Backbone interact. energy: -0.717 local terms energy: -76.358828 where: bonds (distance) C4'-P energy: -16.367 bonds (distance) P-C4' energy: -15.631 flat angles C4'-P-C4' energy: -16.812 flat angles P-C4'-P energy: -8.217 tors. eta vs tors. theta energy: -19.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -217.484169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.484169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.484169 (E_RNA) where: Base-Base interactions energy: -144.601 where: short stacking energy: -54.788 Base-Backbone interact. energy: -0.201 local terms energy: -72.682149 where: bonds (distance) C4'-P energy: -15.087 bonds (distance) P-C4' energy: -15.151 flat angles C4'-P-C4' energy: -14.361 flat angles P-C4'-P energy: -10.096 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -203.622968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.622968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.622968 (E_RNA) where: Base-Base interactions energy: -137.365 where: short stacking energy: -51.927 Base-Backbone interact. energy: -0.501 local terms energy: -65.756061 where: bonds (distance) C4'-P energy: -13.113 bonds (distance) P-C4' energy: -13.492 flat angles C4'-P-C4' energy: -16.513 flat angles P-C4'-P energy: -10.840 tors. eta vs tors. theta energy: -11.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -141.397492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.397492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.397492 (E_RNA) where: Base-Base interactions energy: -84.901 where: short stacking energy: -30.147 Base-Backbone interact. energy: -0.083 local terms energy: -56.413995 where: bonds (distance) C4'-P energy: -16.672 bonds (distance) P-C4' energy: -15.346 flat angles C4'-P-C4' energy: -11.430 flat angles P-C4'-P energy: -7.660 tors. eta vs tors. theta energy: -5.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -96.773573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.773573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.773573 (E_RNA) where: Base-Base interactions energy: -43.730 where: short stacking energy: -31.575 Base-Backbone interact. energy: -0.026 local terms energy: -53.017658 where: bonds (distance) C4'-P energy: -12.252 bonds (distance) P-C4' energy: -15.883 flat angles C4'-P-C4' energy: -12.050 flat angles P-C4'-P energy: -6.878 tors. eta vs tors. theta energy: -5.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -85.716086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.716086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.716086 (E_RNA) where: Base-Base interactions energy: -37.843 where: short stacking energy: -15.855 Base-Backbone interact. energy: -0.659 local terms energy: -47.214059 where: bonds (distance) C4'-P energy: -12.128 bonds (distance) P-C4' energy: -16.005 flat angles C4'-P-C4' energy: -9.621 flat angles P-C4'-P energy: -11.600 tors. eta vs tors. theta energy: 2.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -86.787794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.787794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.787794 (E_RNA) where: Base-Base interactions energy: -29.160 where: short stacking energy: -27.473 Base-Backbone interact. energy: -0.177 local terms energy: -57.450973 where: bonds (distance) C4'-P energy: -13.125 bonds (distance) P-C4' energy: -16.153 flat angles C4'-P-C4' energy: -16.691 flat angles P-C4'-P energy: -7.549 tors. eta vs tors. theta energy: -3.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -93.586121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.586121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.586121 (E_RNA) where: Base-Base interactions energy: -43.853 where: short stacking energy: -25.400 Base-Backbone interact. energy: 0.697 local terms energy: -50.429535 where: bonds (distance) C4'-P energy: -12.148 bonds (distance) P-C4' energy: -15.311 flat angles C4'-P-C4' energy: -9.667 flat angles P-C4'-P energy: -11.654 tors. eta vs tors. theta energy: -1.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -78.184900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.184900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.184900 (E_RNA) where: Base-Base interactions energy: -23.160 where: short stacking energy: -23.160 Base-Backbone interact. energy: -0.111 local terms energy: -54.914486 where: bonds (distance) C4'-P energy: -14.310 bonds (distance) P-C4' energy: -14.463 flat angles C4'-P-C4' energy: -12.114 flat angles P-C4'-P energy: -9.484 tors. eta vs tors. theta energy: -4.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -218.624570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.624570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.624570 (E_RNA) where: Base-Base interactions energy: -146.696 where: short stacking energy: -59.307 Base-Backbone interact. energy: -0.307 local terms energy: -71.621036 where: bonds (distance) C4'-P energy: -10.551 bonds (distance) P-C4' energy: -16.547 flat angles C4'-P-C4' energy: -18.099 flat angles P-C4'-P energy: -8.625 tors. eta vs tors. theta energy: -17.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -204.460076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.460076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.460076 (E_RNA) where: Base-Base interactions energy: -132.806 where: short stacking energy: -48.792 Base-Backbone interact. energy: -1.807 local terms energy: -69.846806 where: bonds (distance) C4'-P energy: -13.544 bonds (distance) P-C4' energy: -16.105 flat angles C4'-P-C4' energy: -12.711 flat angles P-C4'-P energy: -11.048 tors. eta vs tors. theta energy: -16.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -224.180616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.180616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.180616 (E_RNA) where: Base-Base interactions energy: -148.720 where: short stacking energy: -58.884 Base-Backbone interact. energy: -0.767 local terms energy: -74.693706 where: bonds (distance) C4'-P energy: -15.349 bonds (distance) P-C4' energy: -17.421 flat angles C4'-P-C4' energy: -12.592 flat angles P-C4'-P energy: -7.838 tors. eta vs tors. theta energy: -21.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -205.430524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.430524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.430524 (E_RNA) where: Base-Base interactions energy: -145.595 where: short stacking energy: -54.331 Base-Backbone interact. energy: -0.169 local terms energy: -59.665556 where: bonds (distance) C4'-P energy: -12.091 bonds (distance) P-C4' energy: -15.033 flat angles C4'-P-C4' energy: -11.388 flat angles P-C4'-P energy: -6.231 tors. eta vs tors. theta energy: -14.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -156.847810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.847810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.847810 (E_RNA) where: Base-Base interactions energy: -92.456 where: short stacking energy: -53.060 Base-Backbone interact. energy: -0.015 local terms energy: -64.377411 where: bonds (distance) C4'-P energy: -12.869 bonds (distance) P-C4' energy: -12.373 flat angles C4'-P-C4' energy: -16.894 flat angles P-C4'-P energy: -9.248 tors. eta vs tors. theta energy: -12.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -102.560547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.560547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.560547 (E_RNA) where: Base-Base interactions energy: -37.004 where: short stacking energy: -36.196 Base-Backbone interact. energy: -0.178 local terms energy: -65.378523 where: bonds (distance) C4'-P energy: -17.096 bonds (distance) P-C4' energy: -16.589 flat angles C4'-P-C4' energy: -12.502 flat angles P-C4'-P energy: -11.500 tors. eta vs tors. theta energy: -7.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -83.678583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.678583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.678583 (E_RNA) where: Base-Base interactions energy: -30.863 where: short stacking energy: -26.227 Base-Backbone interact. energy: -0.483 local terms energy: -52.332457 where: bonds (distance) C4'-P energy: -12.046 bonds (distance) P-C4' energy: -16.259 flat angles C4'-P-C4' energy: -12.609 flat angles P-C4'-P energy: -9.066 tors. eta vs tors. theta energy: -2.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -75.662756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.662756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.662756 (E_RNA) where: Base-Base interactions energy: -26.965 where: short stacking energy: -26.965 Base-Backbone interact. energy: -0.026 local terms energy: -48.671221 where: bonds (distance) C4'-P energy: -14.418 bonds (distance) P-C4' energy: -16.445 flat angles C4'-P-C4' energy: -11.728 flat angles P-C4'-P energy: -3.062 tors. eta vs tors. theta energy: -3.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -93.383689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.383689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.383689 (E_RNA) where: Base-Base interactions energy: -45.539 where: short stacking energy: -17.014 Base-Backbone interact. energy: 0.649 local terms energy: -48.494172 where: bonds (distance) C4'-P energy: -10.723 bonds (distance) P-C4' energy: -17.699 flat angles C4'-P-C4' energy: -14.574 flat angles P-C4'-P energy: -5.772 tors. eta vs tors. theta energy: 0.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -80.371460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.371460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.371460 (E_RNA) where: Base-Base interactions energy: -30.074 where: short stacking energy: -21.195 Base-Backbone interact. energy: 0.597 local terms energy: -50.894371 where: bonds (distance) C4'-P energy: -15.879 bonds (distance) P-C4' energy: -11.096 flat angles C4'-P-C4' energy: -10.354 flat angles P-C4'-P energy: -10.890 tors. eta vs tors. theta energy: -2.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -219.165261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.165261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.165261 (E_RNA) where: Base-Base interactions energy: -143.559 where: short stacking energy: -58.923 Base-Backbone interact. energy: -0.853 local terms energy: -74.752595 where: bonds (distance) C4'-P energy: -15.000 bonds (distance) P-C4' energy: -18.018 flat angles C4'-P-C4' energy: -11.606 flat angles P-C4'-P energy: -10.134 tors. eta vs tors. theta energy: -19.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -210.063549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.063549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.063549 (E_RNA) where: Base-Base interactions energy: -139.700 where: short stacking energy: -54.712 Base-Backbone interact. energy: -0.283 local terms energy: -70.080779 where: bonds (distance) C4'-P energy: -14.754 bonds (distance) P-C4' energy: -13.765 flat angles C4'-P-C4' energy: -17.158 flat angles P-C4'-P energy: -6.207 tors. eta vs tors. theta energy: -18.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -217.197848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.197848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.197848 (E_RNA) where: Base-Base interactions energy: -140.246 where: short stacking energy: -60.134 Base-Backbone interact. energy: -0.676 local terms energy: -76.275736 where: bonds (distance) C4'-P energy: -15.240 bonds (distance) P-C4' energy: -17.495 flat angles C4'-P-C4' energy: -16.305 flat angles P-C4'-P energy: -9.776 tors. eta vs tors. theta energy: -17.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -197.381029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.381029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.381029 (E_RNA) where: Base-Base interactions energy: -130.382 where: short stacking energy: -49.279 Base-Backbone interact. energy: -0.389 local terms energy: -66.610630 where: bonds (distance) C4'-P energy: -12.770 bonds (distance) P-C4' energy: -12.253 flat angles C4'-P-C4' energy: -17.240 flat angles P-C4'-P energy: -8.248 tors. eta vs tors. theta energy: -16.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -152.379406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.379406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.379406 (E_RNA) where: Base-Base interactions energy: -90.264 where: short stacking energy: -42.389 Base-Backbone interact. energy: 1.344 local terms energy: -63.459514 where: bonds (distance) C4'-P energy: -13.842 bonds (distance) P-C4' energy: -15.317 flat angles C4'-P-C4' energy: -15.118 flat angles P-C4'-P energy: -10.885 tors. eta vs tors. theta energy: -8.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -89.301433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.301433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.301433 (E_RNA) where: Base-Base interactions energy: -48.519 where: short stacking energy: -20.378 Base-Backbone interact. energy: 0.525 local terms energy: -41.307134 where: bonds (distance) C4'-P energy: -14.752 bonds (distance) P-C4' energy: -15.660 flat angles C4'-P-C4' energy: -10.189 flat angles P-C4'-P energy: -5.663 tors. eta vs tors. theta energy: 4.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -108.368696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.368696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.368696 (E_RNA) where: Base-Base interactions energy: -60.059 where: short stacking energy: -37.943 Base-Backbone interact. energy: -0.031 local terms energy: -48.279578 where: bonds (distance) C4'-P energy: -9.305 bonds (distance) P-C4' energy: -13.105 flat angles C4'-P-C4' energy: -10.136 flat angles P-C4'-P energy: -8.266 tors. eta vs tors. theta energy: -7.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -110.824554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.824554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.824554 (E_RNA) where: Base-Base interactions energy: -58.988 where: short stacking energy: -28.148 Base-Backbone interact. energy: -0.044 local terms energy: -51.792121 where: bonds (distance) C4'-P energy: -10.955 bonds (distance) P-C4' energy: -16.522 flat angles C4'-P-C4' energy: -13.924 flat angles P-C4'-P energy: -6.034 tors. eta vs tors. theta energy: -4.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -67.286998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.286998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.286998 (E_RNA) where: Base-Base interactions energy: -25.162 where: short stacking energy: -17.806 Base-Backbone interact. energy: -0.918 local terms energy: -41.206835 where: bonds (distance) C4'-P energy: -11.526 bonds (distance) P-C4' energy: -15.194 flat angles C4'-P-C4' energy: -11.096 flat angles P-C4'-P energy: -2.432 tors. eta vs tors. theta energy: -0.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -75.419308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.419308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.419308 (E_RNA) where: Base-Base interactions energy: -20.707 where: short stacking energy: -19.134 Base-Backbone interact. energy: -0.102 local terms energy: -54.609622 where: bonds (distance) C4'-P energy: -13.113 bonds (distance) P-C4' energy: -16.653 flat angles C4'-P-C4' energy: -13.400 flat angles P-C4'-P energy: -8.695 tors. eta vs tors. theta energy: -2.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -219.681320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.681320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.681320 (E_RNA) where: Base-Base interactions energy: -143.404 where: short stacking energy: -58.914 Base-Backbone interact. energy: -0.379 local terms energy: -75.898333 where: bonds (distance) C4'-P energy: -16.802 bonds (distance) P-C4' energy: -15.740 flat angles C4'-P-C4' energy: -13.796 flat angles P-C4'-P energy: -11.034 tors. eta vs tors. theta energy: -18.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -213.201438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.201438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.201438 (E_RNA) where: Base-Base interactions energy: -139.801 where: short stacking energy: -50.572 Base-Backbone interact. energy: -0.065 local terms energy: -73.335515 where: bonds (distance) C4'-P energy: -13.119 bonds (distance) P-C4' energy: -17.724 flat angles C4'-P-C4' energy: -18.692 flat angles P-C4'-P energy: -7.009 tors. eta vs tors. theta energy: -16.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -217.816629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.816629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.816629 (E_RNA) where: Base-Base interactions energy: -149.723 where: short stacking energy: -61.730 Base-Backbone interact. energy: -0.213 local terms energy: -67.881287 where: bonds (distance) C4'-P energy: -16.795 bonds (distance) P-C4' energy: -14.606 flat angles C4'-P-C4' energy: -13.012 flat angles P-C4'-P energy: -4.391 tors. eta vs tors. theta energy: -19.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -143.000890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.000890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.000890 (E_RNA) where: Base-Base interactions energy: -83.684 where: short stacking energy: -40.458 Base-Backbone interact. energy: 1.243 local terms energy: -60.558978 where: bonds (distance) C4'-P energy: -15.460 bonds (distance) P-C4' energy: -17.576 flat angles C4'-P-C4' energy: -8.855 flat angles P-C4'-P energy: -10.654 tors. eta vs tors. theta energy: -8.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -199.843179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.843179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.843179 (E_RNA) where: Base-Base interactions energy: -144.639 where: short stacking energy: -57.399 Base-Backbone interact. energy: -0.153 local terms energy: -55.051497 where: bonds (distance) C4'-P energy: -14.171 bonds (distance) P-C4' energy: -12.755 flat angles C4'-P-C4' energy: -14.952 flat angles P-C4'-P energy: 0.373 tors. eta vs tors. theta energy: -13.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -87.523224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.523224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.523224 (E_RNA) where: Base-Base interactions energy: -35.789 where: short stacking energy: -17.930 Base-Backbone interact. energy: -0.125 local terms energy: -51.609453 where: bonds (distance) C4'-P energy: -14.292 bonds (distance) P-C4' energy: -14.731 flat angles C4'-P-C4' energy: -14.572 flat angles P-C4'-P energy: -7.123 tors. eta vs tors. theta energy: -0.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -89.068647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.068647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.068647 (E_RNA) where: Base-Base interactions energy: -27.446 where: short stacking energy: -27.446 Base-Backbone interact. energy: -0.231 local terms energy: -61.391817 where: bonds (distance) C4'-P energy: -17.488 bonds (distance) P-C4' energy: -14.532 flat angles C4'-P-C4' energy: -16.158 flat angles P-C4'-P energy: -11.334 tors. eta vs tors. theta energy: -1.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -142.361703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.361703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.361703 (E_RNA) where: Base-Base interactions energy: -83.309 where: short stacking energy: -38.928 Base-Backbone interact. energy: 3.914 local terms energy: -62.966866 where: bonds (distance) C4'-P energy: -13.453 bonds (distance) P-C4' energy: -12.756 flat angles C4'-P-C4' energy: -14.646 flat angles P-C4'-P energy: -11.817 tors. eta vs tors. theta energy: -10.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -83.212745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.212745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.212745 (E_RNA) where: Base-Base interactions energy: -32.084 where: short stacking energy: -13.055 Base-Backbone interact. energy: -0.479 local terms energy: -50.649680 where: bonds (distance) C4'-P energy: -14.972 bonds (distance) P-C4' energy: -12.011 flat angles C4'-P-C4' energy: -15.514 flat angles P-C4'-P energy: -11.164 tors. eta vs tors. theta energy: 3.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -83.209172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.209172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.209172 (E_RNA) where: Base-Base interactions energy: -31.999 where: short stacking energy: -29.637 Base-Backbone interact. energy: -0.032 local terms energy: -51.178775 where: bonds (distance) C4'-P energy: -15.966 bonds (distance) P-C4' energy: -16.252 flat angles C4'-P-C4' energy: -3.780 flat angles P-C4'-P energy: -9.671 tors. eta vs tors. theta energy: -5.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -224.344992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.344992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.344992 (E_RNA) where: Base-Base interactions energy: -149.569 where: short stacking energy: -62.762 Base-Backbone interact. energy: -1.575 local terms energy: -73.200529 where: bonds (distance) C4'-P energy: -16.652 bonds (distance) P-C4' energy: -12.620 flat angles C4'-P-C4' energy: -15.006 flat angles P-C4'-P energy: -8.900 tors. eta vs tors. theta energy: -20.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -216.909682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.909682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.909682 (E_RNA) where: Base-Base interactions energy: -152.973 where: short stacking energy: -46.374 Base-Backbone interact. energy: 0.041 local terms energy: -63.978253 where: bonds (distance) C4'-P energy: -13.209 bonds (distance) P-C4' energy: -14.261 flat angles C4'-P-C4' energy: -16.413 flat angles P-C4'-P energy: -8.098 tors. eta vs tors. theta energy: -11.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -215.103097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.103097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.103097 (E_RNA) where: Base-Base interactions energy: -140.713 where: short stacking energy: -58.206 Base-Backbone interact. energy: -1.035 local terms energy: -73.355488 where: bonds (distance) C4'-P energy: -14.296 bonds (distance) P-C4' energy: -14.670 flat angles C4'-P-C4' energy: -12.855 flat angles P-C4'-P energy: -10.941 tors. eta vs tors. theta energy: -20.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -143.176673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.176673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.176673 (E_RNA) where: Base-Base interactions energy: -73.337 where: short stacking energy: -31.859 Base-Backbone interact. energy: -0.223 local terms energy: -69.616280 where: bonds (distance) C4'-P energy: -14.226 bonds (distance) P-C4' energy: -16.129 flat angles C4'-P-C4' energy: -14.558 flat angles P-C4'-P energy: -12.024 tors. eta vs tors. theta energy: -12.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -189.690547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.690547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.690547 (E_RNA) where: Base-Base interactions energy: -127.389 where: short stacking energy: -53.336 Base-Backbone interact. energy: -0.671 local terms energy: -61.630862 where: bonds (distance) C4'-P energy: -7.619 bonds (distance) P-C4' energy: -12.204 flat angles C4'-P-C4' energy: -17.448 flat angles P-C4'-P energy: -10.398 tors. eta vs tors. theta energy: -13.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -93.168054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.168054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.168054 (E_RNA) where: Base-Base interactions energy: -42.329 where: short stacking energy: -31.799 Base-Backbone interact. energy: 0.595 local terms energy: -51.433755 where: bonds (distance) C4'-P energy: -12.732 bonds (distance) P-C4' energy: -15.544 flat angles C4'-P-C4' energy: -12.973 flat angles P-C4'-P energy: -6.123 tors. eta vs tors. theta energy: -4.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -87.610850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.610850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.610850 (E_RNA) where: Base-Base interactions energy: -36.888 where: short stacking energy: -33.190 Base-Backbone interact. energy: 0.670 local terms energy: -51.392566 where: bonds (distance) C4'-P energy: -15.154 bonds (distance) P-C4' energy: -13.708 flat angles C4'-P-C4' energy: -13.843 flat angles P-C4'-P energy: -4.699 tors. eta vs tors. theta energy: -3.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -108.800935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.800935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.800935 (E_RNA) where: Base-Base interactions energy: -52.096 where: short stacking energy: -30.708 Base-Backbone interact. energy: 0.814 local terms energy: -57.519175 where: bonds (distance) C4'-P energy: -14.247 bonds (distance) P-C4' energy: -14.985 flat angles C4'-P-C4' energy: -13.840 flat angles P-C4'-P energy: -11.149 tors. eta vs tors. theta energy: -3.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -71.086232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.086232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.086232 (E_RNA) where: Base-Base interactions energy: -21.263 where: short stacking energy: -17.730 Base-Backbone interact. energy: -0.102 local terms energy: -49.720407 where: bonds (distance) C4'-P energy: -15.424 bonds (distance) P-C4' energy: -15.401 flat angles C4'-P-C4' energy: -9.291 flat angles P-C4'-P energy: -12.992 tors. eta vs tors. theta energy: 3.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -73.194446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.194446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.194446 (E_RNA) where: Base-Base interactions energy: -34.710 where: short stacking energy: -10.889 Base-Backbone interact. energy: -1.660 local terms energy: -36.824393 where: bonds (distance) C4'-P energy: -14.372 bonds (distance) P-C4' energy: -13.582 flat angles C4'-P-C4' energy: -6.563 flat angles P-C4'-P energy: -7.273 tors. eta vs tors. theta energy: 4.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -222.644610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.644610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.644610 (E_RNA) where: Base-Base interactions energy: -149.413 where: short stacking energy: -58.753 Base-Backbone interact. energy: -1.932 local terms energy: -71.299772 where: bonds (distance) C4'-P energy: -14.290 bonds (distance) P-C4' energy: -18.028 flat angles C4'-P-C4' energy: -13.469 flat angles P-C4'-P energy: -6.079 tors. eta vs tors. theta energy: -19.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -209.227412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.227412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.227412 (E_RNA) where: Base-Base interactions energy: -138.372 where: short stacking energy: -56.737 Base-Backbone interact. energy: 0.710 local terms energy: -71.565627 where: bonds (distance) C4'-P energy: -13.012 bonds (distance) P-C4' energy: -12.986 flat angles C4'-P-C4' energy: -17.354 flat angles P-C4'-P energy: -10.899 tors. eta vs tors. theta energy: -17.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -215.766188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.766188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.766188 (E_RNA) where: Base-Base interactions energy: -149.449 where: short stacking energy: -44.065 Base-Backbone interact. energy: -0.340 local terms energy: -65.976626 where: bonds (distance) C4'-P energy: -13.622 bonds (distance) P-C4' energy: -16.281 flat angles C4'-P-C4' energy: -15.050 flat angles P-C4'-P energy: -7.577 tors. eta vs tors. theta energy: -13.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -190.694905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.694905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.694905 (E_RNA) where: Base-Base interactions energy: -121.064 where: short stacking energy: -58.802 Base-Backbone interact. energy: -0.308 local terms energy: -69.322946 where: bonds (distance) C4'-P energy: -16.102 bonds (distance) P-C4' energy: -15.473 flat angles C4'-P-C4' energy: -14.125 flat angles P-C4'-P energy: -6.720 tors. eta vs tors. theta energy: -16.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -139.822784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.822784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.822784 (E_RNA) where: Base-Base interactions energy: -70.112 where: short stacking energy: -34.722 Base-Backbone interact. energy: -0.239 local terms energy: -69.472236 where: bonds (distance) C4'-P energy: -15.660 bonds (distance) P-C4' energy: -18.253 flat angles C4'-P-C4' energy: -15.776 flat angles P-C4'-P energy: -10.176 tors. eta vs tors. theta energy: -9.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -105.188068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.188068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.188068 (E_RNA) where: Base-Base interactions energy: -45.920 where: short stacking energy: -45.920 Base-Backbone interact. energy: -0.007 local terms energy: -59.261320 where: bonds (distance) C4'-P energy: -13.808 bonds (distance) P-C4' energy: -12.370 flat angles C4'-P-C4' energy: -12.425 flat angles P-C4'-P energy: -8.385 tors. eta vs tors. theta energy: -12.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -81.694699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.694699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.694699 (E_RNA) where: Base-Base interactions energy: -27.180 where: short stacking energy: -28.066 Base-Backbone interact. energy: -0.978 local terms energy: -53.535981 where: bonds (distance) C4'-P energy: -10.124 bonds (distance) P-C4' energy: -12.927 flat angles C4'-P-C4' energy: -14.322 flat angles P-C4'-P energy: -11.170 tors. eta vs tors. theta energy: -4.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -76.235451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.235451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.235451 (E_RNA) where: Base-Base interactions energy: -27.661 where: short stacking energy: -27.661 Base-Backbone interact. energy: -0.100 local terms energy: -48.474537 where: bonds (distance) C4'-P energy: -7.276 bonds (distance) P-C4' energy: -14.508 flat angles C4'-P-C4' energy: -14.435 flat angles P-C4'-P energy: -11.050 tors. eta vs tors. theta energy: -1.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -85.954288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.954288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.954288 (E_RNA) where: Base-Base interactions energy: -30.330 where: short stacking energy: -22.990 Base-Backbone interact. energy: -0.297 local terms energy: -55.327440 where: bonds (distance) C4'-P energy: -14.264 bonds (distance) P-C4' energy: -16.718 flat angles C4'-P-C4' energy: -10.957 flat angles P-C4'-P energy: -11.701 tors. eta vs tors. theta energy: -1.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -73.039555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.039555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.039555 (E_RNA) where: Base-Base interactions energy: -27.468 where: short stacking energy: -24.930 Base-Backbone interact. energy: -0.197 local terms energy: -45.373966 where: bonds (distance) C4'-P energy: -10.604 bonds (distance) P-C4' energy: -12.308 flat angles C4'-P-C4' energy: -9.499 flat angles P-C4'-P energy: -10.880 tors. eta vs tors. theta energy: -2.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -211.272834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.272834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.272834 (E_RNA) where: Base-Base interactions energy: -143.878 where: short stacking energy: -61.319 Base-Backbone interact. energy: -0.135 local terms energy: -67.259998 where: bonds (distance) C4'-P energy: -10.783 bonds (distance) P-C4' energy: -13.740 flat angles C4'-P-C4' energy: -13.745 flat angles P-C4'-P energy: -10.410 tors. eta vs tors. theta energy: -18.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -220.713797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.713797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.713797 (E_RNA) where: Base-Base interactions energy: -147.614 where: short stacking energy: -59.670 Base-Backbone interact. energy: -1.057 local terms energy: -72.042994 where: bonds (distance) C4'-P energy: -12.703 bonds (distance) P-C4' energy: -16.622 flat angles C4'-P-C4' energy: -15.670 flat angles P-C4'-P energy: -9.477 tors. eta vs tors. theta energy: -17.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -208.851297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.851297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.851297 (E_RNA) where: Base-Base interactions energy: -137.789 where: short stacking energy: -57.710 Base-Backbone interact. energy: -0.913 local terms energy: -70.149924 where: bonds (distance) C4'-P energy: -11.275 bonds (distance) P-C4' energy: -17.267 flat angles C4'-P-C4' energy: -15.690 flat angles P-C4'-P energy: -9.565 tors. eta vs tors. theta energy: -16.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -183.204920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.204920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.204920 (E_RNA) where: Base-Base interactions energy: -118.484 where: short stacking energy: -43.893 Base-Backbone interact. energy: -0.569 local terms energy: -64.151482 where: bonds (distance) C4'-P energy: -13.237 bonds (distance) P-C4' energy: -15.602 flat angles C4'-P-C4' energy: -11.572 flat angles P-C4'-P energy: -9.836 tors. eta vs tors. theta energy: -13.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -166.464456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.464456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.464456 (E_RNA) where: Base-Base interactions energy: -94.482 where: short stacking energy: -48.866 Base-Backbone interact. energy: -0.002 local terms energy: -71.980501 where: bonds (distance) C4'-P energy: -12.479 bonds (distance) P-C4' energy: -17.785 flat angles C4'-P-C4' energy: -14.557 flat angles P-C4'-P energy: -10.858 tors. eta vs tors. theta energy: -16.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -95.364986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.364986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.364986 (E_RNA) where: Base-Base interactions energy: -39.969 where: short stacking energy: -26.388 Base-Backbone interact. energy: -0.225 local terms energy: -55.171003 where: bonds (distance) C4'-P energy: -14.529 bonds (distance) P-C4' energy: -12.902 flat angles C4'-P-C4' energy: -13.300 flat angles P-C4'-P energy: -9.346 tors. eta vs tors. theta energy: -5.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -84.613472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.613472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.613472 (E_RNA) where: Base-Base interactions energy: -24.871 where: short stacking energy: -24.107 Base-Backbone interact. energy: -0.213 local terms energy: -59.529474 where: bonds (distance) C4'-P energy: -15.279 bonds (distance) P-C4' energy: -16.883 flat angles C4'-P-C4' energy: -13.520 flat angles P-C4'-P energy: -8.209 tors. eta vs tors. theta energy: -5.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -76.565138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.565138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.565138 (E_RNA) where: Base-Base interactions energy: -31.269 where: short stacking energy: -19.752 Base-Backbone interact. energy: -0.536 local terms energy: -44.760185 where: bonds (distance) C4'-P energy: -12.459 bonds (distance) P-C4' energy: -14.846 flat angles C4'-P-C4' energy: -14.614 flat angles P-C4'-P energy: -3.342 tors. eta vs tors. theta energy: 0.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -82.742627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.742627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.742627 (E_RNA) where: Base-Base interactions energy: -27.921 where: short stacking energy: -25.992 Base-Backbone interact. energy: -0.261 local terms energy: -54.560650 where: bonds (distance) C4'-P energy: -14.504 bonds (distance) P-C4' energy: -15.622 flat angles C4'-P-C4' energy: -14.032 flat angles P-C4'-P energy: -7.874 tors. eta vs tors. theta energy: -2.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -70.937081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.937081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.937081 (E_RNA) where: Base-Base interactions energy: -18.568 where: short stacking energy: -16.224 Base-Backbone interact. energy: -0.105 local terms energy: -52.263971 where: bonds (distance) C4'-P energy: -15.382 bonds (distance) P-C4' energy: -13.680 flat angles C4'-P-C4' energy: -15.440 flat angles P-C4'-P energy: -9.875 tors. eta vs tors. theta energy: 2.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -207.228330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.228330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.228330 (E_RNA) where: Base-Base interactions energy: -131.796 where: short stacking energy: -50.901 Base-Backbone interact. energy: -0.198 local terms energy: -75.234550 where: bonds (distance) C4'-P energy: -16.964 bonds (distance) P-C4' energy: -15.670 flat angles C4'-P-C4' energy: -12.638 flat angles P-C4'-P energy: -11.169 tors. eta vs tors. theta energy: -18.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -204.792957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.792957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.792957 (E_RNA) where: Base-Base interactions energy: -135.417 where: short stacking energy: -52.671 Base-Backbone interact. energy: -0.947 local terms energy: -68.429002 where: bonds (distance) C4'-P energy: -16.119 bonds (distance) P-C4' energy: -15.663 flat angles C4'-P-C4' energy: -14.681 flat angles P-C4'-P energy: -10.998 tors. eta vs tors. theta energy: -10.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -203.546500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.546500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.546500 (E_RNA) where: Base-Base interactions energy: -138.102 where: short stacking energy: -51.922 Base-Backbone interact. energy: -0.193 local terms energy: -65.251653 where: bonds (distance) C4'-P energy: -9.557 bonds (distance) P-C4' energy: -16.576 flat angles C4'-P-C4' energy: -13.005 flat angles P-C4'-P energy: -10.360 tors. eta vs tors. theta energy: -15.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -190.932744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.932744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.932744 (E_RNA) where: Base-Base interactions energy: -123.598 where: short stacking energy: -49.173 Base-Backbone interact. energy: -0.250 local terms energy: -67.085060 where: bonds (distance) C4'-P energy: -15.402 bonds (distance) P-C4' energy: -16.377 flat angles C4'-P-C4' energy: -14.055 flat angles P-C4'-P energy: -7.007 tors. eta vs tors. theta energy: -14.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -141.713753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.713753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.713753 (E_RNA) where: Base-Base interactions energy: -84.924 where: short stacking energy: -47.878 Base-Backbone interact. energy: -0.286 local terms energy: -56.503511 where: bonds (distance) C4'-P energy: -8.452 bonds (distance) P-C4' energy: -12.818 flat angles C4'-P-C4' energy: -14.556 flat angles P-C4'-P energy: -10.435 tors. eta vs tors. theta energy: -10.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -94.183222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.183222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.183222 (E_RNA) where: Base-Base interactions energy: -35.631 where: short stacking energy: -32.646 Base-Backbone interact. energy: -0.077 local terms energy: -58.475405 where: bonds (distance) C4'-P energy: -9.128 bonds (distance) P-C4' energy: -16.375 flat angles C4'-P-C4' energy: -14.600 flat angles P-C4'-P energy: -11.229 tors. eta vs tors. theta energy: -7.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -86.786225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.786225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.786225 (E_RNA) where: Base-Base interactions energy: -37.247 where: short stacking energy: -18.307 Base-Backbone interact. energy: -0.686 local terms energy: -48.853045 where: bonds (distance) C4'-P energy: -13.379 bonds (distance) P-C4' energy: -14.373 flat angles C4'-P-C4' energy: -15.048 flat angles P-C4'-P energy: -9.046 tors. eta vs tors. theta energy: 2.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -107.649226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.649226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.649226 (E_RNA) where: Base-Base interactions energy: -56.153 where: short stacking energy: -17.541 Base-Backbone interact. energy: -0.316 local terms energy: -51.179425 where: bonds (distance) C4'-P energy: -15.928 bonds (distance) P-C4' energy: -13.485 flat angles C4'-P-C4' energy: -14.499 flat angles P-C4'-P energy: -9.555 tors. eta vs tors. theta energy: 2.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -83.127689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.127689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.127689 (E_RNA) where: Base-Base interactions energy: -35.192 where: short stacking energy: -30.855 Base-Backbone interact. energy: 0.179 local terms energy: -48.115365 where: bonds (distance) C4'-P energy: -10.643 bonds (distance) P-C4' energy: -15.898 flat angles C4'-P-C4' energy: -14.560 flat angles P-C4'-P energy: -4.334 tors. eta vs tors. theta energy: -2.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -72.310510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.310510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.310510 (E_RNA) where: Base-Base interactions energy: -26.164 where: short stacking energy: -17.414 Base-Backbone interact. energy: -0.697 local terms energy: -45.449498 where: bonds (distance) C4'-P energy: -13.154 bonds (distance) P-C4' energy: -15.734 flat angles C4'-P-C4' energy: -8.046 flat angles P-C4'-P energy: -7.365 tors. eta vs tors. theta energy: -1.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -219.922248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.922248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.922248 (E_RNA) where: Base-Base interactions energy: -150.957 where: short stacking energy: -63.140 Base-Backbone interact. energy: -0.254 local terms energy: -68.711168 where: bonds (distance) C4'-P energy: -13.176 bonds (distance) P-C4' energy: -16.225 flat angles C4'-P-C4' energy: -10.378 flat angles P-C4'-P energy: -12.087 tors. eta vs tors. theta energy: -16.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -210.790289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.790289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.790289 (E_RNA) where: Base-Base interactions energy: -138.135 where: short stacking energy: -57.795 Base-Backbone interact. energy: 0.499 local terms energy: -73.154298 where: bonds (distance) C4'-P energy: -15.240 bonds (distance) P-C4' energy: -14.356 flat angles C4'-P-C4' energy: -15.641 flat angles P-C4'-P energy: -12.028 tors. eta vs tors. theta energy: -15.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -204.568531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.568531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.568531 (E_RNA) where: Base-Base interactions energy: -133.694 where: short stacking energy: -55.364 Base-Backbone interact. energy: -0.698 local terms energy: -70.176620 where: bonds (distance) C4'-P energy: -16.070 bonds (distance) P-C4' energy: -12.937 flat angles C4'-P-C4' energy: -14.753 flat angles P-C4'-P energy: -10.528 tors. eta vs tors. theta energy: -15.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -197.567044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.567044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.567044 (E_RNA) where: Base-Base interactions energy: -130.949 where: short stacking energy: -55.442 Base-Backbone interact. energy: -1.600 local terms energy: -65.018512 where: bonds (distance) C4'-P energy: -13.125 bonds (distance) P-C4' energy: -16.231 flat angles C4'-P-C4' energy: -13.961 flat angles P-C4'-P energy: -7.353 tors. eta vs tors. theta energy: -14.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -143.395510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.395510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.395510 (E_RNA) where: Base-Base interactions energy: -83.688 where: short stacking energy: -41.073 Base-Backbone interact. energy: 0.002 local terms energy: -59.708838 where: bonds (distance) C4'-P energy: -12.520 bonds (distance) P-C4' energy: -13.170 flat angles C4'-P-C4' energy: -16.103 flat angles P-C4'-P energy: -8.018 tors. eta vs tors. theta energy: -9.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -101.813229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.813229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.813229 (E_RNA) where: Base-Base interactions energy: -50.892 where: short stacking energy: -29.077 Base-Backbone interact. energy: 0.631 local terms energy: -51.552775 where: bonds (distance) C4'-P energy: -12.025 bonds (distance) P-C4' energy: -14.145 flat angles C4'-P-C4' energy: -11.430 flat angles P-C4'-P energy: -8.007 tors. eta vs tors. theta energy: -5.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -97.089023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.089023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.089023 (E_RNA) where: Base-Base interactions energy: -52.933 where: short stacking energy: -20.581 Base-Backbone interact. energy: -0.812 local terms energy: -43.343428 where: bonds (distance) C4'-P energy: -13.713 bonds (distance) P-C4' energy: -9.427 flat angles C4'-P-C4' energy: -9.656 flat angles P-C4'-P energy: -7.819 tors. eta vs tors. theta energy: -2.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -82.989046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.989046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.989046 (E_RNA) where: Base-Base interactions energy: -39.400 where: short stacking energy: -25.734 Base-Backbone interact. energy: -0.601 local terms energy: -42.988232 where: bonds (distance) C4'-P energy: -11.710 bonds (distance) P-C4' energy: -11.983 flat angles C4'-P-C4' energy: -13.251 flat angles P-C4'-P energy: -4.831 tors. eta vs tors. theta energy: -1.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -85.549230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.549230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.549230 (E_RNA) where: Base-Base interactions energy: -38.415 where: short stacking energy: -26.447 Base-Backbone interact. energy: -0.051 local terms energy: -47.082555 where: bonds (distance) C4'-P energy: -10.945 bonds (distance) P-C4' energy: -13.297 flat angles C4'-P-C4' energy: -11.090 flat angles P-C4'-P energy: -9.501 tors. eta vs tors. theta energy: -2.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -78.354738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.354738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.354738 (E_RNA) where: Base-Base interactions energy: -30.680 where: short stacking energy: -30.535 Base-Backbone interact. energy: 0.070 local terms energy: -47.743952 where: bonds (distance) C4'-P energy: -8.390 bonds (distance) P-C4' energy: -16.325 flat angles C4'-P-C4' energy: -12.189 flat angles P-C4'-P energy: -6.651 tors. eta vs tors. theta energy: -4.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -221.073400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.073400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.073400 (E_RNA) where: Base-Base interactions energy: -146.760 where: short stacking energy: -63.656 Base-Backbone interact. energy: -0.139 local terms energy: -74.175023 where: bonds (distance) C4'-P energy: -16.106 bonds (distance) P-C4' energy: -11.926 flat angles C4'-P-C4' energy: -17.167 flat angles P-C4'-P energy: -9.241 tors. eta vs tors. theta energy: -19.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -216.676758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.676758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.676758 (E_RNA) where: Base-Base interactions energy: -143.235 where: short stacking energy: -56.414 Base-Backbone interact. energy: -0.716 local terms energy: -72.725722 where: bonds (distance) C4'-P energy: -17.373 bonds (distance) P-C4' energy: -18.116 flat angles C4'-P-C4' energy: -16.310 flat angles P-C4'-P energy: -4.502 tors. eta vs tors. theta energy: -16.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -212.592601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.592601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.592601 (E_RNA) where: Base-Base interactions energy: -139.482 where: short stacking energy: -51.244 Base-Backbone interact. energy: -0.065 local terms energy: -73.045146 where: bonds (distance) C4'-P energy: -16.376 bonds (distance) P-C4' energy: -17.992 flat angles C4'-P-C4' energy: -15.557 flat angles P-C4'-P energy: -4.631 tors. eta vs tors. theta energy: -18.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -204.106796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.106796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.106796 (E_RNA) where: Base-Base interactions energy: -137.953 where: short stacking energy: -62.395 Base-Backbone interact. energy: 0.147 local terms energy: -66.301375 where: bonds (distance) C4'-P energy: -13.177 bonds (distance) P-C4' energy: -12.031 flat angles C4'-P-C4' energy: -16.139 flat angles P-C4'-P energy: -8.600 tors. eta vs tors. theta energy: -16.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -159.921314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.921314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.921314 (E_RNA) where: Base-Base interactions energy: -99.408 where: short stacking energy: -41.481 Base-Backbone interact. energy: 1.726 local terms energy: -62.239192 where: bonds (distance) C4'-P energy: -10.413 bonds (distance) P-C4' energy: -15.699 flat angles C4'-P-C4' energy: -14.475 flat angles P-C4'-P energy: -9.358 tors. eta vs tors. theta energy: -12.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -78.708743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.708743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.708743 (E_RNA) where: Base-Base interactions energy: -33.307 where: short stacking energy: -28.718 Base-Backbone interact. energy: 0.113 local terms energy: -45.514066 where: bonds (distance) C4'-P energy: -11.577 bonds (distance) P-C4' energy: -13.737 flat angles C4'-P-C4' energy: -13.242 flat angles P-C4'-P energy: -5.524 tors. eta vs tors. theta energy: -1.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -79.414892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.414892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.414892 (E_RNA) where: Base-Base interactions energy: -28.871 where: short stacking energy: -21.555 Base-Backbone interact. energy: -1.115 local terms energy: -49.428379 where: bonds (distance) C4'-P energy: -14.371 bonds (distance) P-C4' energy: -12.492 flat angles C4'-P-C4' energy: -14.121 flat angles P-C4'-P energy: -6.340 tors. eta vs tors. theta energy: -2.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -84.199967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.199967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.199967 (E_RNA) where: Base-Base interactions energy: -30.416 where: short stacking energy: -30.416 Base-Backbone interact. energy: -0.034 local terms energy: -53.750351 where: bonds (distance) C4'-P energy: -16.242 bonds (distance) P-C4' energy: -15.158 flat angles C4'-P-C4' energy: -9.908 flat angles P-C4'-P energy: -7.708 tors. eta vs tors. theta energy: -4.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -78.499834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.499834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.499834 (E_RNA) where: Base-Base interactions energy: -30.930 where: short stacking energy: -29.678 Base-Backbone interact. energy: -0.037 local terms energy: -47.533102 where: bonds (distance) C4'-P energy: -12.060 bonds (distance) P-C4' energy: -15.889 flat angles C4'-P-C4' energy: -8.692 flat angles P-C4'-P energy: -8.812 tors. eta vs tors. theta energy: -2.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -77.511403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.511403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.511403 (E_RNA) where: Base-Base interactions energy: -35.454 where: short stacking energy: -24.749 Base-Backbone interact. energy: -0.420 local terms energy: -41.637033 where: bonds (distance) C4'-P energy: -10.803 bonds (distance) P-C4' energy: -15.463 flat angles C4'-P-C4' energy: -13.027 flat angles P-C4'-P energy: -9.752 tors. eta vs tors. theta energy: 7.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -221.808758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.808758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.808758 (E_RNA) where: Base-Base interactions energy: -148.769 where: short stacking energy: -60.629 Base-Backbone interact. energy: -0.072 local terms energy: -72.967429 where: bonds (distance) C4'-P energy: -16.666 bonds (distance) P-C4' energy: -15.043 flat angles C4'-P-C4' energy: -15.353 flat angles P-C4'-P energy: -7.407 tors. eta vs tors. theta energy: -18.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -213.841115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.841115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.841115 (E_RNA) where: Base-Base interactions energy: -141.002 where: short stacking energy: -55.689 Base-Backbone interact. energy: -0.465 local terms energy: -72.374300 where: bonds (distance) C4'-P energy: -16.607 bonds (distance) P-C4' energy: -16.437 flat angles C4'-P-C4' energy: -16.061 flat angles P-C4'-P energy: -8.862 tors. eta vs tors. theta energy: -14.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -221.780776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.780776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.780776 (E_RNA) where: Base-Base interactions energy: -146.989 where: short stacking energy: -58.508 Base-Backbone interact. energy: -0.897 local terms energy: -73.893926 where: bonds (distance) C4'-P energy: -17.634 bonds (distance) P-C4' energy: -14.914 flat angles C4'-P-C4' energy: -14.674 flat angles P-C4'-P energy: -11.378 tors. eta vs tors. theta energy: -15.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -205.720272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.720272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.720272 (E_RNA) where: Base-Base interactions energy: -144.179 where: short stacking energy: -61.162 Base-Backbone interact. energy: -0.105 local terms energy: -61.435994 where: bonds (distance) C4'-P energy: -11.726 bonds (distance) P-C4' energy: -15.350 flat angles C4'-P-C4' energy: -14.710 flat angles P-C4'-P energy: -2.792 tors. eta vs tors. theta energy: -16.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -156.747912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.747912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.747912 (E_RNA) where: Base-Base interactions energy: -100.232 where: short stacking energy: -39.667 Base-Backbone interact. energy: -0.131 local terms energy: -56.384846 where: bonds (distance) C4'-P energy: -14.960 bonds (distance) P-C4' energy: -15.502 flat angles C4'-P-C4' energy: -10.458 flat angles P-C4'-P energy: -4.865 tors. eta vs tors. theta energy: -10.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -94.978749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.978749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.978749 (E_RNA) where: Base-Base interactions energy: -40.324 where: short stacking energy: -12.778 Base-Backbone interact. energy: -0.320 local terms energy: -54.335083 where: bonds (distance) C4'-P energy: -15.010 bonds (distance) P-C4' energy: -14.933 flat angles C4'-P-C4' energy: -12.968 flat angles P-C4'-P energy: -7.473 tors. eta vs tors. theta energy: -3.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -118.103779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.103779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.103779 (E_RNA) where: Base-Base interactions energy: -65.770 where: short stacking energy: -32.340 Base-Backbone interact. energy: -0.245 local terms energy: -52.088946 where: bonds (distance) C4'-P energy: -11.797 bonds (distance) P-C4' energy: -13.725 flat angles C4'-P-C4' energy: -13.141 flat angles P-C4'-P energy: -6.249 tors. eta vs tors. theta energy: -7.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -77.465687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.465687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.465687 (E_RNA) where: Base-Base interactions energy: -22.937 where: short stacking energy: -22.937 Base-Backbone interact. energy: -0.017 local terms energy: -54.511700 where: bonds (distance) C4'-P energy: -15.809 bonds (distance) P-C4' energy: -16.265 flat angles C4'-P-C4' energy: -10.121 flat angles P-C4'-P energy: -9.445 tors. eta vs tors. theta energy: -2.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -80.148538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.148538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.148538 (E_RNA) where: Base-Base interactions energy: -37.999 where: short stacking energy: -21.483 Base-Backbone interact. energy: -0.278 local terms energy: -41.872337 where: bonds (distance) C4'-P energy: -13.714 bonds (distance) P-C4' energy: -7.667 flat angles C4'-P-C4' energy: -11.114 flat angles P-C4'-P energy: -9.355 tors. eta vs tors. theta energy: -0.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -113.984798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.984798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.984798 (E_RNA) where: Base-Base interactions energy: -63.972 where: short stacking energy: -32.836 Base-Backbone interact. energy: 2.319 local terms energy: -52.331599 where: bonds (distance) C4'-P energy: -14.165 bonds (distance) P-C4' energy: -16.237 flat angles C4'-P-C4' energy: -10.259 flat angles P-C4'-P energy: -6.001 tors. eta vs tors. theta energy: -5.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -222.918745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.918745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.918745 (E_RNA) where: Base-Base interactions energy: -149.250 where: short stacking energy: -54.363 Base-Backbone interact. energy: -0.215 local terms energy: -73.453831 where: bonds (distance) C4'-P energy: -15.395 bonds (distance) P-C4' energy: -16.909 flat angles C4'-P-C4' energy: -13.000 flat angles P-C4'-P energy: -7.845 tors. eta vs tors. theta energy: -20.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -217.385224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.385224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.385224 (E_RNA) where: Base-Base interactions energy: -144.498 where: short stacking energy: -61.935 Base-Backbone interact. energy: 0.636 local terms energy: -73.522769 where: bonds (distance) C4'-P energy: -12.202 bonds (distance) P-C4' energy: -15.210 flat angles C4'-P-C4' energy: -16.493 flat angles P-C4'-P energy: -10.737 tors. eta vs tors. theta energy: -18.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -201.698811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.698811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.698811 (E_RNA) where: Base-Base interactions energy: -131.361 where: short stacking energy: -56.370 Base-Backbone interact. energy: -1.975 local terms energy: -68.362988 where: bonds (distance) C4'-P energy: -14.529 bonds (distance) P-C4' energy: -12.911 flat angles C4'-P-C4' energy: -13.832 flat angles P-C4'-P energy: -9.349 tors. eta vs tors. theta energy: -17.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -195.639888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.639888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.639888 (E_RNA) where: Base-Base interactions energy: -137.255 where: short stacking energy: -55.889 Base-Backbone interact. energy: -1.335 local terms energy: -57.050101 where: bonds (distance) C4'-P energy: -8.654 bonds (distance) P-C4' energy: -14.077 flat angles C4'-P-C4' energy: -11.977 flat angles P-C4'-P energy: -5.124 tors. eta vs tors. theta energy: -17.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -130.105243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.105243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.105243 (E_RNA) where: Base-Base interactions energy: -72.873 where: short stacking energy: -32.671 Base-Backbone interact. energy: 0.392 local terms energy: -57.623927 where: bonds (distance) C4'-P energy: -15.242 bonds (distance) P-C4' energy: -17.764 flat angles C4'-P-C4' energy: -14.783 flat angles P-C4'-P energy: -5.549 tors. eta vs tors. theta energy: -4.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -135.012598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.012598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.012598 (E_RNA) where: Base-Base interactions energy: -80.904 where: short stacking energy: -31.097 Base-Backbone interact. energy: -0.315 local terms energy: -53.793378 where: bonds (distance) C4'-P energy: -11.597 bonds (distance) P-C4' energy: -15.519 flat angles C4'-P-C4' energy: -13.137 flat angles P-C4'-P energy: -9.295 tors. eta vs tors. theta energy: -4.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -86.228593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.228593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.228593 (E_RNA) where: Base-Base interactions energy: -32.460 where: short stacking energy: -29.475 Base-Backbone interact. energy: -0.003 local terms energy: -53.764687 where: bonds (distance) C4'-P energy: -13.439 bonds (distance) P-C4' energy: -16.851 flat angles C4'-P-C4' energy: -4.723 flat angles P-C4'-P energy: -12.823 tors. eta vs tors. theta energy: -5.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -80.353284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.353284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.353284 (E_RNA) where: Base-Base interactions energy: -26.777 where: short stacking energy: -20.981 Base-Backbone interact. energy: -1.137 local terms energy: -52.439780 where: bonds (distance) C4'-P energy: -9.748 bonds (distance) P-C4' energy: -13.138 flat angles C4'-P-C4' energy: -12.695 flat angles P-C4'-P energy: -10.681 tors. eta vs tors. theta energy: -6.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -74.263597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.263597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.263597 (E_RNA) where: Base-Base interactions energy: -17.721 where: short stacking energy: -17.121 Base-Backbone interact. energy: 0.422 local terms energy: -56.964227 where: bonds (distance) C4'-P energy: -15.150 bonds (distance) P-C4' energy: -14.353 flat angles C4'-P-C4' energy: -12.669 flat angles P-C4'-P energy: -10.265 tors. eta vs tors. theta energy: -4.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -70.772825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.772825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.772825 (E_RNA) where: Base-Base interactions energy: -27.122 where: short stacking energy: -14.578 Base-Backbone interact. energy: -0.193 local terms energy: -43.457466 where: bonds (distance) C4'-P energy: -8.667 bonds (distance) P-C4' energy: -17.767 flat angles C4'-P-C4' energy: -11.389 flat angles P-C4'-P energy: -6.254 tors. eta vs tors. theta energy: 0.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -217.954362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.954362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.954362 (E_RNA) where: Base-Base interactions energy: -144.979 where: short stacking energy: -57.567 Base-Backbone interact. energy: -0.466 local terms energy: -72.509201 where: bonds (distance) C4'-P energy: -16.214 bonds (distance) P-C4' energy: -16.847 flat angles C4'-P-C4' energy: -16.137 flat angles P-C4'-P energy: -6.877 tors. eta vs tors. theta energy: -16.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -217.962420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.962420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.962420 (E_RNA) where: Base-Base interactions energy: -143.716 where: short stacking energy: -57.613 Base-Backbone interact. energy: -0.200 local terms energy: -74.046500 where: bonds (distance) C4'-P energy: -17.415 bonds (distance) P-C4' energy: -16.840 flat angles C4'-P-C4' energy: -13.571 flat angles P-C4'-P energy: -8.255 tors. eta vs tors. theta energy: -17.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -215.751030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.751030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.751030 (E_RNA) where: Base-Base interactions energy: -150.154 where: short stacking energy: -53.128 Base-Backbone interact. energy: -0.142 local terms energy: -65.455044 where: bonds (distance) C4'-P energy: -16.674 bonds (distance) P-C4' energy: -14.014 flat angles C4'-P-C4' energy: -13.884 flat angles P-C4'-P energy: -8.581 tors. eta vs tors. theta energy: -12.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -199.241006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.241006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.241006 (E_RNA) where: Base-Base interactions energy: -123.828 where: short stacking energy: -48.921 Base-Backbone interact. energy: -1.760 local terms energy: -73.652939 where: bonds (distance) C4'-P energy: -17.042 bonds (distance) P-C4' energy: -16.321 flat angles C4'-P-C4' energy: -15.917 flat angles P-C4'-P energy: -9.531 tors. eta vs tors. theta energy: -14.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -168.205028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.205028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.205028 (E_RNA) where: Base-Base interactions energy: -103.626 where: short stacking energy: -48.944 Base-Backbone interact. energy: 0.106 local terms energy: -64.685010 where: bonds (distance) C4'-P energy: -15.760 bonds (distance) P-C4' energy: -16.224 flat angles C4'-P-C4' energy: -13.097 flat angles P-C4'-P energy: -8.725 tors. eta vs tors. theta energy: -10.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -141.262992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.262992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.262992 (E_RNA) where: Base-Base interactions energy: -76.144 where: short stacking energy: -33.897 Base-Backbone interact. energy: 0.877 local terms energy: -65.996098 where: bonds (distance) C4'-P energy: -16.338 bonds (distance) P-C4' energy: -16.296 flat angles C4'-P-C4' energy: -18.042 flat angles P-C4'-P energy: -6.236 tors. eta vs tors. theta energy: -9.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -92.476596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.476596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.476596 (E_RNA) where: Base-Base interactions energy: -31.989 where: short stacking energy: -30.554 Base-Backbone interact. energy: -0.239 local terms energy: -60.248937 where: bonds (distance) C4'-P energy: -10.707 bonds (distance) P-C4' energy: -15.682 flat angles C4'-P-C4' energy: -12.240 flat angles P-C4'-P energy: -11.017 tors. eta vs tors. theta energy: -10.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -93.794232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.794232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.794232 (E_RNA) where: Base-Base interactions energy: -39.599 where: short stacking energy: -21.903 Base-Backbone interact. energy: -0.260 local terms energy: -53.935079 where: bonds (distance) C4'-P energy: -15.688 bonds (distance) P-C4' energy: -8.707 flat angles C4'-P-C4' energy: -12.875 flat angles P-C4'-P energy: -11.722 tors. eta vs tors. theta energy: -4.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -84.958440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.958440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.958440 (E_RNA) where: Base-Base interactions energy: -28.204 where: short stacking energy: -25.398 Base-Backbone interact. energy: -0.098 local terms energy: -56.656237 where: bonds (distance) C4'-P energy: -14.202 bonds (distance) P-C4' energy: -13.861 flat angles C4'-P-C4' energy: -11.677 flat angles P-C4'-P energy: -11.219 tors. eta vs tors. theta energy: -5.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -74.084871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.084871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.084871 (E_RNA) where: Base-Base interactions energy: -26.430 where: short stacking energy: -24.854 Base-Backbone interact. energy: -0.214 local terms energy: -47.441496 where: bonds (distance) C4'-P energy: -14.302 bonds (distance) P-C4' energy: -10.969 flat angles C4'-P-C4' energy: -16.581 flat angles P-C4'-P energy: -5.032 tors. eta vs tors. theta energy: -0.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -214.725600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.725600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.725600 (E_RNA) where: Base-Base interactions energy: -141.645 where: short stacking energy: -51.441 Base-Backbone interact. energy: -0.214 local terms energy: -72.866620 where: bonds (distance) C4'-P energy: -15.408 bonds (distance) P-C4' energy: -15.564 flat angles C4'-P-C4' energy: -13.795 flat angles P-C4'-P energy: -11.751 tors. eta vs tors. theta energy: -16.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -210.019746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.019746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.019746 (E_RNA) where: Base-Base interactions energy: -143.597 where: short stacking energy: -52.960 Base-Backbone interact. energy: -0.239 local terms energy: -66.183734 where: bonds (distance) C4'-P energy: -13.653 bonds (distance) P-C4' energy: -16.929 flat angles C4'-P-C4' energy: -15.444 flat angles P-C4'-P energy: -6.498 tors. eta vs tors. theta energy: -13.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -213.097688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.097688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.097688 (E_RNA) where: Base-Base interactions energy: -137.495 where: short stacking energy: -51.086 Base-Backbone interact. energy: -1.693 local terms energy: -73.909756 where: bonds (distance) C4'-P energy: -15.518 bonds (distance) P-C4' energy: -16.157 flat angles C4'-P-C4' energy: -15.362 flat angles P-C4'-P energy: -13.080 tors. eta vs tors. theta energy: -13.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -171.895522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.895522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.895522 (E_RNA) where: Base-Base interactions energy: -111.657 where: short stacking energy: -44.430 Base-Backbone interact. energy: 0.128 local terms energy: -60.366376 where: bonds (distance) C4'-P energy: -12.973 bonds (distance) P-C4' energy: -15.610 flat angles C4'-P-C4' energy: -10.870 flat angles P-C4'-P energy: -8.207 tors. eta vs tors. theta energy: -12.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -208.145609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.145609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.145609 (E_RNA) where: Base-Base interactions energy: -138.312 where: short stacking energy: -55.360 Base-Backbone interact. energy: -1.138 local terms energy: -68.695607 where: bonds (distance) C4'-P energy: -13.212 bonds (distance) P-C4' energy: -13.492 flat angles C4'-P-C4' energy: -13.550 flat angles P-C4'-P energy: -10.127 tors. eta vs tors. theta energy: -18.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -150.663791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.663791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.663791 (E_RNA) where: Base-Base interactions energy: -92.612 where: short stacking energy: -46.473 Base-Backbone interact. energy: 0.218 local terms energy: -58.269557 where: bonds (distance) C4'-P energy: -12.910 bonds (distance) P-C4' energy: -14.779 flat angles C4'-P-C4' energy: -5.623 flat angles P-C4'-P energy: -12.826 tors. eta vs tors. theta energy: -12.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -97.840479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.840479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.840479 (E_RNA) where: Base-Base interactions energy: -39.676 where: short stacking energy: -30.353 Base-Backbone interact. energy: -0.077 local terms energy: -58.087329 where: bonds (distance) C4'-P energy: -14.657 bonds (distance) P-C4' energy: -16.325 flat angles C4'-P-C4' energy: -14.377 flat angles P-C4'-P energy: -7.532 tors. eta vs tors. theta energy: -5.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -86.669109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.669109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.669109 (E_RNA) where: Base-Base interactions energy: -36.035 where: short stacking energy: -21.813 Base-Backbone interact. energy: -0.446 local terms energy: -50.187535 where: bonds (distance) C4'-P energy: -15.462 bonds (distance) P-C4' energy: -15.274 flat angles C4'-P-C4' energy: -14.292 flat angles P-C4'-P energy: -6.469 tors. eta vs tors. theta energy: 1.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -75.264692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.264692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.264692 (E_RNA) where: Base-Base interactions energy: -27.969 where: short stacking energy: -10.668 Base-Backbone interact. energy: -1.059 local terms energy: -46.236278 where: bonds (distance) C4'-P energy: -13.130 bonds (distance) P-C4' energy: -17.531 flat angles C4'-P-C4' energy: -13.541 flat angles P-C4'-P energy: -5.134 tors. eta vs tors. theta energy: 3.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -67.774493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.774493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.774493 (E_RNA) where: Base-Base interactions energy: -27.081 where: short stacking energy: -27.081 Base-Backbone interact. energy: -0.017 local terms energy: -40.676769 where: bonds (distance) C4'-P energy: -9.938 bonds (distance) P-C4' energy: -8.568 flat angles C4'-P-C4' energy: -8.667 flat angles P-C4'-P energy: -9.045 tors. eta vs tors. theta energy: -4.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -214.661329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.661329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.661329 (E_RNA) where: Base-Base interactions energy: -144.561 where: short stacking energy: -58.408 Base-Backbone interact. energy: -0.177 local terms energy: -69.923564 where: bonds (distance) C4'-P energy: -16.980 bonds (distance) P-C4' energy: -14.338 flat angles C4'-P-C4' energy: -14.883 flat angles P-C4'-P energy: -7.184 tors. eta vs tors. theta energy: -16.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -193.768045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.768045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.768045 (E_RNA) where: Base-Base interactions energy: -131.441 where: short stacking energy: -53.983 Base-Backbone interact. energy: -0.618 local terms energy: -61.708639 where: bonds (distance) C4'-P energy: -16.926 bonds (distance) P-C4' energy: -8.003 flat angles C4'-P-C4' energy: -10.448 flat angles P-C4'-P energy: -11.096 tors. eta vs tors. theta energy: -15.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -194.453912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.453912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.453912 (E_RNA) where: Base-Base interactions energy: -123.264 where: short stacking energy: -41.456 Base-Backbone interact. energy: -1.700 local terms energy: -69.489379 where: bonds (distance) C4'-P energy: -18.458 bonds (distance) P-C4' energy: -12.053 flat angles C4'-P-C4' energy: -14.648 flat angles P-C4'-P energy: -11.705 tors. eta vs tors. theta energy: -12.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -190.329561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.329561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.329561 (E_RNA) where: Base-Base interactions energy: -127.496 where: short stacking energy: -42.130 Base-Backbone interact. energy: -1.084 local terms energy: -61.749588 where: bonds (distance) C4'-P energy: -11.835 bonds (distance) P-C4' energy: -12.123 flat angles C4'-P-C4' energy: -9.309 flat angles P-C4'-P energy: -10.652 tors. eta vs tors. theta energy: -17.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -185.565928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.565928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.565928 (E_RNA) where: Base-Base interactions energy: -119.789 where: short stacking energy: -44.114 Base-Backbone interact. energy: -0.089 local terms energy: -65.688341 where: bonds (distance) C4'-P energy: -13.226 bonds (distance) P-C4' energy: -15.589 flat angles C4'-P-C4' energy: -14.213 flat angles P-C4'-P energy: -6.484 tors. eta vs tors. theta energy: -16.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -144.714674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.714674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.714674 (E_RNA) where: Base-Base interactions energy: -89.880 where: short stacking energy: -31.544 Base-Backbone interact. energy: -0.098 local terms energy: -54.735861 where: bonds (distance) C4'-P energy: -11.334 bonds (distance) P-C4' energy: -16.171 flat angles C4'-P-C4' energy: -11.468 flat angles P-C4'-P energy: -5.192 tors. eta vs tors. theta energy: -10.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -83.159955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.159955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.159955 (E_RNA) where: Base-Base interactions energy: -29.727 where: short stacking energy: -29.727 Base-Backbone interact. energy: -0.005 local terms energy: -53.428003 where: bonds (distance) C4'-P energy: -13.108 bonds (distance) P-C4' energy: -12.600 flat angles C4'-P-C4' energy: -16.598 flat angles P-C4'-P energy: -7.021 tors. eta vs tors. theta energy: -4.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -84.517849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.517849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.517849 (E_RNA) where: Base-Base interactions energy: -35.986 where: short stacking energy: -32.259 Base-Backbone interact. energy: -0.289 local terms energy: -48.242898 where: bonds (distance) C4'-P energy: -14.620 bonds (distance) P-C4' energy: -13.906 flat angles C4'-P-C4' energy: -4.902 flat angles P-C4'-P energy: -8.049 tors. eta vs tors. theta energy: -6.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -80.576702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.576702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.576702 (E_RNA) where: Base-Base interactions energy: -37.401 where: short stacking energy: -25.895 Base-Backbone interact. energy: -0.108 local terms energy: -43.067392 where: bonds (distance) C4'-P energy: -11.131 bonds (distance) P-C4' energy: -10.316 flat angles C4'-P-C4' energy: -9.012 flat angles P-C4'-P energy: -6.434 tors. eta vs tors. theta energy: -6.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -73.402804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.402804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.402804 (E_RNA) where: Base-Base interactions energy: -28.120 where: short stacking energy: -27.134 Base-Backbone interact. energy: -0.198 local terms energy: -45.084475 where: bonds (distance) C4'-P energy: -13.697 bonds (distance) P-C4' energy: -10.325 flat angles C4'-P-C4' energy: -10.028 flat angles P-C4'-P energy: -9.730 tors. eta vs tors. theta energy: -1.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -216.995329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.995329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.995329 (E_RNA) where: Base-Base interactions energy: -146.000 where: short stacking energy: -61.482 Base-Backbone interact. energy: -0.346 local terms energy: -70.649803 where: bonds (distance) C4'-P energy: -15.772 bonds (distance) P-C4' energy: -16.048 flat angles C4'-P-C4' energy: -17.016 flat angles P-C4'-P energy: -5.094 tors. eta vs tors. theta energy: -16.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -199.767747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.767747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.767747 (E_RNA) where: Base-Base interactions energy: -126.165 where: short stacking energy: -51.058 Base-Backbone interact. energy: -0.348 local terms energy: -73.255349 where: bonds (distance) C4'-P energy: -16.553 bonds (distance) P-C4' energy: -16.347 flat angles C4'-P-C4' energy: -14.227 flat angles P-C4'-P energy: -12.185 tors. eta vs tors. theta energy: -13.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -205.010084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.010084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.010084 (E_RNA) where: Base-Base interactions energy: -137.130 where: short stacking energy: -54.074 Base-Backbone interact. energy: -1.252 local terms energy: -66.627898 where: bonds (distance) C4'-P energy: -12.351 bonds (distance) P-C4' energy: -11.016 flat angles C4'-P-C4' energy: -17.746 flat angles P-C4'-P energy: -10.459 tors. eta vs tors. theta energy: -15.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -186.769828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.769828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.769828 (E_RNA) where: Base-Base interactions energy: -116.583 where: short stacking energy: -47.892 Base-Backbone interact. energy: -0.839 local terms energy: -69.348038 where: bonds (distance) C4'-P energy: -13.375 bonds (distance) P-C4' energy: -18.160 flat angles C4'-P-C4' energy: -15.520 flat angles P-C4'-P energy: -10.014 tors. eta vs tors. theta energy: -12.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -178.518326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.518326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.518326 (E_RNA) where: Base-Base interactions energy: -121.149 where: short stacking energy: -52.426 Base-Backbone interact. energy: -0.010 local terms energy: -57.359490 where: bonds (distance) C4'-P energy: -8.141 bonds (distance) P-C4' energy: -14.352 flat angles C4'-P-C4' energy: -15.588 flat angles P-C4'-P energy: -4.941 tors. eta vs tors. theta energy: -14.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -92.905946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.905946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.905946 (E_RNA) where: Base-Base interactions energy: -36.302 where: short stacking energy: -35.367 Base-Backbone interact. energy: -0.246 local terms energy: -56.357774 where: bonds (distance) C4'-P energy: -10.865 bonds (distance) P-C4' energy: -14.473 flat angles C4'-P-C4' energy: -13.963 flat angles P-C4'-P energy: -8.524 tors. eta vs tors. theta energy: -8.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -139.517574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.517574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.517574 (E_RNA) where: Base-Base interactions energy: -78.246 where: short stacking energy: -40.624 Base-Backbone interact. energy: 0.925 local terms energy: -62.196337 where: bonds (distance) C4'-P energy: -13.067 bonds (distance) P-C4' energy: -14.824 flat angles C4'-P-C4' energy: -12.508 flat angles P-C4'-P energy: -8.975 tors. eta vs tors. theta energy: -12.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -82.277685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.277685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.277685 (E_RNA) where: Base-Base interactions energy: -32.191 where: short stacking energy: -26.594 Base-Backbone interact. energy: -0.264 local terms energy: -49.822020 where: bonds (distance) C4'-P energy: -11.673 bonds (distance) P-C4' energy: -14.689 flat angles C4'-P-C4' energy: -10.173 flat angles P-C4'-P energy: -9.643 tors. eta vs tors. theta energy: -3.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -84.190421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.190421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.190421 (E_RNA) where: Base-Base interactions energy: -40.572 where: short stacking energy: -25.642 Base-Backbone interact. energy: -0.084 local terms energy: -43.534930 where: bonds (distance) C4'-P energy: -13.552 bonds (distance) P-C4' energy: -8.122 flat angles C4'-P-C4' energy: -16.088 flat angles P-C4'-P energy: -5.401 tors. eta vs tors. theta energy: -0.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -77.341977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.341977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.341977 (E_RNA) where: Base-Base interactions energy: -27.958 where: short stacking energy: -26.034 Base-Backbone interact. energy: 0.382 local terms energy: -49.766325 where: bonds (distance) C4'-P energy: -11.374 bonds (distance) P-C4' energy: -16.811 flat angles C4'-P-C4' energy: -7.757 flat angles P-C4'-P energy: -8.690 tors. eta vs tors. theta energy: -5.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -206.068202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.068202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.068202 (E_RNA) where: Base-Base interactions energy: -137.955 where: short stacking energy: -50.520 Base-Backbone interact. energy: -0.923 local terms energy: -67.190588 where: bonds (distance) C4'-P energy: -13.324 bonds (distance) P-C4' energy: -12.048 flat angles C4'-P-C4' energy: -15.784 flat angles P-C4'-P energy: -12.427 tors. eta vs tors. theta energy: -13.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -192.701035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.701035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.701035 (E_RNA) where: Base-Base interactions energy: -124.609 where: short stacking energy: -55.245 Base-Backbone interact. energy: -0.448 local terms energy: -67.643437 where: bonds (distance) C4'-P energy: -17.415 bonds (distance) P-C4' energy: -15.387 flat angles C4'-P-C4' energy: -16.855 flat angles P-C4'-P energy: -7.062 tors. eta vs tors. theta energy: -10.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -202.469229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.469229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.469229 (E_RNA) where: Base-Base interactions energy: -129.529 where: short stacking energy: -44.357 Base-Backbone interact. energy: -0.065 local terms energy: -72.875068 where: bonds (distance) C4'-P energy: -16.599 bonds (distance) P-C4' energy: -17.048 flat angles C4'-P-C4' energy: -14.665 flat angles P-C4'-P energy: -12.359 tors. eta vs tors. theta energy: -12.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -205.398982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.398982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.398982 (E_RNA) where: Base-Base interactions energy: -138.575 where: short stacking energy: -58.632 Base-Backbone interact. energy: -2.035 local terms energy: -64.789036 where: bonds (distance) C4'-P energy: -11.024 bonds (distance) P-C4' energy: -13.874 flat angles C4'-P-C4' energy: -15.898 flat angles P-C4'-P energy: -6.544 tors. eta vs tors. theta energy: -17.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -180.147706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.147706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.147706 (E_RNA) where: Base-Base interactions energy: -117.121 where: short stacking energy: -50.028 Base-Backbone interact. energy: 1.399 local terms energy: -64.425496 where: bonds (distance) C4'-P energy: -12.935 bonds (distance) P-C4' energy: -15.513 flat angles C4'-P-C4' energy: -14.876 flat angles P-C4'-P energy: -8.268 tors. eta vs tors. theta energy: -12.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -79.759677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.759677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.759677 (E_RNA) where: Base-Base interactions energy: -29.729 where: short stacking energy: -25.636 Base-Backbone interact. energy: -0.081 local terms energy: -49.949504 where: bonds (distance) C4'-P energy: -14.091 bonds (distance) P-C4' energy: -12.578 flat angles C4'-P-C4' energy: -12.410 flat angles P-C4'-P energy: -8.058 tors. eta vs tors. theta energy: -2.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -142.526661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.526661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.526661 (E_RNA) where: Base-Base interactions energy: -84.958 where: short stacking energy: -40.818 Base-Backbone interact. energy: -0.158 local terms energy: -57.409897 where: bonds (distance) C4'-P energy: -16.217 bonds (distance) P-C4' energy: -14.881 flat angles C4'-P-C4' energy: -7.486 flat angles P-C4'-P energy: -6.855 tors. eta vs tors. theta energy: -11.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -112.087319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.087319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.087319 (E_RNA) where: Base-Base interactions energy: -58.925 where: short stacking energy: -33.686 Base-Backbone interact. energy: -0.129 local terms energy: -53.032951 where: bonds (distance) C4'-P energy: -12.823 bonds (distance) P-C4' energy: -16.761 flat angles C4'-P-C4' energy: -12.310 flat angles P-C4'-P energy: -5.591 tors. eta vs tors. theta energy: -5.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -86.563047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.563047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.563047 (E_RNA) where: Base-Base interactions energy: -28.302 where: short stacking energy: -26.693 Base-Backbone interact. energy: -0.216 local terms energy: -58.045370 where: bonds (distance) C4'-P energy: -13.979 bonds (distance) P-C4' energy: -13.938 flat angles C4'-P-C4' energy: -15.696 flat angles P-C4'-P energy: -7.137 tors. eta vs tors. theta energy: -7.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -71.828943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.828943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.828943 (E_RNA) where: Base-Base interactions energy: -26.741 where: short stacking energy: -18.319 Base-Backbone interact. energy: -0.217 local terms energy: -44.870812 where: bonds (distance) C4'-P energy: -13.453 bonds (distance) P-C4' energy: -17.305 flat angles C4'-P-C4' energy: -7.939 flat angles P-C4'-P energy: -6.876 tors. eta vs tors. theta energy: 0.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -205.726183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.726183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.726183 (E_RNA) where: Base-Base interactions energy: -136.603 where: short stacking energy: -54.308 Base-Backbone interact. energy: -0.088 local terms energy: -69.035000 where: bonds (distance) C4'-P energy: -15.302 bonds (distance) P-C4' energy: -17.737 flat angles C4'-P-C4' energy: -15.420 flat angles P-C4'-P energy: -4.124 tors. eta vs tors. theta energy: -16.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -201.538264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.538264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.538264 (E_RNA) where: Base-Base interactions energy: -136.111 where: short stacking energy: -53.367 Base-Backbone interact. energy: -1.221 local terms energy: -64.206471 where: bonds (distance) C4'-P energy: -11.668 bonds (distance) P-C4' energy: -12.743 flat angles C4'-P-C4' energy: -14.511 flat angles P-C4'-P energy: -10.757 tors. eta vs tors. theta energy: -14.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -195.892021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.892021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.892021 (E_RNA) where: Base-Base interactions energy: -130.238 where: short stacking energy: -54.277 Base-Backbone interact. energy: 0.072 local terms energy: -65.725678 where: bonds (distance) C4'-P energy: -12.181 bonds (distance) P-C4' energy: -17.696 flat angles C4'-P-C4' energy: -14.668 flat angles P-C4'-P energy: -4.330 tors. eta vs tors. theta energy: -16.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -171.263425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.263425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.263425 (E_RNA) where: Base-Base interactions energy: -108.851 where: short stacking energy: -45.175 Base-Backbone interact. energy: -0.073 local terms energy: -62.339394 where: bonds (distance) C4'-P energy: -14.028 bonds (distance) P-C4' energy: -13.868 flat angles C4'-P-C4' energy: -15.263 flat angles P-C4'-P energy: -8.067 tors. eta vs tors. theta energy: -11.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -168.866848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.866848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.866848 (E_RNA) where: Base-Base interactions energy: -110.806 where: short stacking energy: -40.346 Base-Backbone interact. energy: -0.240 local terms energy: -57.820461 where: bonds (distance) C4'-P energy: -14.053 bonds (distance) P-C4' energy: -13.439 flat angles C4'-P-C4' energy: -12.822 flat angles P-C4'-P energy: -9.621 tors. eta vs tors. theta energy: -7.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -160.129106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.129106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.129106 (E_RNA) where: Base-Base interactions energy: -96.114 where: short stacking energy: -44.829 Base-Backbone interact. energy: 0.309 local terms energy: -64.324022 where: bonds (distance) C4'-P energy: -12.702 bonds (distance) P-C4' energy: -14.310 flat angles C4'-P-C4' energy: -12.426 flat angles P-C4'-P energy: -9.607 tors. eta vs tors. theta energy: -15.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -89.632768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.632768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.632768 (E_RNA) where: Base-Base interactions energy: -33.948 where: short stacking energy: -31.250 Base-Backbone interact. energy: -0.041 local terms energy: -55.644365 where: bonds (distance) C4'-P energy: -14.157 bonds (distance) P-C4' energy: -12.961 flat angles C4'-P-C4' energy: -13.102 flat angles P-C4'-P energy: -5.742 tors. eta vs tors. theta energy: -9.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -88.065824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.065824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.065824 (E_RNA) where: Base-Base interactions energy: -26.057 where: short stacking energy: -25.428 Base-Backbone interact. energy: -0.070 local terms energy: -61.939074 where: bonds (distance) C4'-P energy: -14.654 bonds (distance) P-C4' energy: -15.716 flat angles C4'-P-C4' energy: -13.059 flat angles P-C4'-P energy: -10.638 tors. eta vs tors. theta energy: -7.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -70.495416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.495416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.495416 (E_RNA) where: Base-Base interactions energy: -26.141 where: short stacking energy: -24.319 Base-Backbone interact. energy: -0.173 local terms energy: -44.181458 where: bonds (distance) C4'-P energy: -12.948 bonds (distance) P-C4' energy: -11.349 flat angles C4'-P-C4' energy: -11.857 flat angles P-C4'-P energy: -6.290 tors. eta vs tors. theta energy: -1.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -86.660687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.660687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.660687 (E_RNA) where: Base-Base interactions energy: -42.781 where: short stacking energy: -24.442 Base-Backbone interact. energy: -0.263 local terms energy: -43.617203 where: bonds (distance) C4'-P energy: -14.211 bonds (distance) P-C4' energy: -9.731 flat angles C4'-P-C4' energy: -11.064 flat angles P-C4'-P energy: -7.183 tors. eta vs tors. theta energy: -1.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -208.433968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.433968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.433968 (E_RNA) where: Base-Base interactions energy: -139.629 where: short stacking energy: -55.778 Base-Backbone interact. energy: -1.481 local terms energy: -67.323801 where: bonds (distance) C4'-P energy: -13.954 bonds (distance) P-C4' energy: -16.911 flat angles C4'-P-C4' energy: -16.454 flat angles P-C4'-P energy: -4.760 tors. eta vs tors. theta energy: -15.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -206.436934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.436934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.436934 (E_RNA) where: Base-Base interactions energy: -131.623 where: short stacking energy: -50.734 Base-Backbone interact. energy: -0.437 local terms energy: -74.376424 where: bonds (distance) C4'-P energy: -15.143 bonds (distance) P-C4' energy: -17.181 flat angles C4'-P-C4' energy: -15.369 flat angles P-C4'-P energy: -11.781 tors. eta vs tors. theta energy: -14.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -182.560104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.560104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.560104 (E_RNA) where: Base-Base interactions energy: -122.548 where: short stacking energy: -43.019 Base-Backbone interact. energy: -0.607 local terms energy: -59.405210 where: bonds (distance) C4'-P energy: -12.224 bonds (distance) P-C4' energy: -15.915 flat angles C4'-P-C4' energy: -14.655 flat angles P-C4'-P energy: 0.179 tors. eta vs tors. theta energy: -16.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -174.135089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.135089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.135089 (E_RNA) where: Base-Base interactions energy: -114.220 where: short stacking energy: -38.895 Base-Backbone interact. energy: 0.097 local terms energy: -60.012533 where: bonds (distance) C4'-P energy: -12.776 bonds (distance) P-C4' energy: -12.651 flat angles C4'-P-C4' energy: -12.251 flat angles P-C4'-P energy: -9.578 tors. eta vs tors. theta energy: -12.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -146.892233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.892233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.892233 (E_RNA) where: Base-Base interactions energy: -87.928 where: short stacking energy: -42.799 Base-Backbone interact. energy: -1.327 local terms energy: -57.637187 where: bonds (distance) C4'-P energy: -11.503 bonds (distance) P-C4' energy: -13.762 flat angles C4'-P-C4' energy: -13.921 flat angles P-C4'-P energy: -9.405 tors. eta vs tors. theta energy: -9.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -141.127529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.127529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.127529 (E_RNA) where: Base-Base interactions energy: -79.640 where: short stacking energy: -29.731 Base-Backbone interact. energy: -0.454 local terms energy: -61.033098 where: bonds (distance) C4'-P energy: -11.966 bonds (distance) P-C4' energy: -14.193 flat angles C4'-P-C4' energy: -13.796 flat angles P-C4'-P energy: -8.696 tors. eta vs tors. theta energy: -12.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -105.695783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.695783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.695783 (E_RNA) where: Base-Base interactions energy: -33.643 where: short stacking energy: -33.643 Base-Backbone interact. energy: -0.049 local terms energy: -72.003578 where: bonds (distance) C4'-P energy: -15.391 bonds (distance) P-C4' energy: -17.379 flat angles C4'-P-C4' energy: -15.447 flat angles P-C4'-P energy: -5.980 tors. eta vs tors. theta energy: -17.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -83.163968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.163968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.163968 (E_RNA) where: Base-Base interactions energy: -30.340 where: short stacking energy: -30.198 Base-Backbone interact. energy: -0.072 local terms energy: -52.752385 where: bonds (distance) C4'-P energy: -13.135 bonds (distance) P-C4' energy: -15.118 flat angles C4'-P-C4' energy: -13.263 flat angles P-C4'-P energy: -7.842 tors. eta vs tors. theta energy: -3.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -84.185646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.185646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.185646 (E_RNA) where: Base-Base interactions energy: -42.775 where: short stacking energy: -29.461 Base-Backbone interact. energy: -0.343 local terms energy: -41.067414 where: bonds (distance) C4'-P energy: -12.891 bonds (distance) P-C4' energy: -9.518 flat angles C4'-P-C4' energy: -10.716 flat angles P-C4'-P energy: -6.826 tors. eta vs tors. theta energy: -1.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -72.887370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.887370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.887370 (E_RNA) where: Base-Base interactions energy: -29.101 where: short stacking energy: -17.250 Base-Backbone interact. energy: -0.067 local terms energy: -43.719247 where: bonds (distance) C4'-P energy: -13.130 bonds (distance) P-C4' energy: -13.299 flat angles C4'-P-C4' energy: -11.885 flat angles P-C4'-P energy: -10.248 tors. eta vs tors. theta energy: 4.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -199.753347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.753347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.753347 (E_RNA) where: Base-Base interactions energy: -138.306 where: short stacking energy: -55.537 Base-Backbone interact. energy: -0.066 local terms energy: -61.381574 where: bonds (distance) C4'-P energy: -10.476 bonds (distance) P-C4' energy: -12.699 flat angles C4'-P-C4' energy: -13.960 flat angles P-C4'-P energy: -11.526 tors. eta vs tors. theta energy: -12.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -209.836205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.836205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.836205 (E_RNA) where: Base-Base interactions energy: -138.608 where: short stacking energy: -54.997 Base-Backbone interact. energy: -0.176 local terms energy: -71.052173 where: bonds (distance) C4'-P energy: -15.402 bonds (distance) P-C4' energy: -15.642 flat angles C4'-P-C4' energy: -17.085 flat angles P-C4'-P energy: -5.815 tors. eta vs tors. theta energy: -17.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -188.760663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.760663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.760663 (E_RNA) where: Base-Base interactions energy: -120.244 where: short stacking energy: -51.242 Base-Backbone interact. energy: 0.920 local terms energy: -69.436699 where: bonds (distance) C4'-P energy: -16.333 bonds (distance) P-C4' energy: -16.132 flat angles C4'-P-C4' energy: -15.209 flat angles P-C4'-P energy: -12.798 tors. eta vs tors. theta energy: -8.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -169.242662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.242662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.242662 (E_RNA) where: Base-Base interactions energy: -117.566 where: short stacking energy: -53.120 Base-Backbone interact. energy: -0.332 local terms energy: -51.345617 where: bonds (distance) C4'-P energy: -8.249 bonds (distance) P-C4' energy: -14.345 flat angles C4'-P-C4' energy: -12.935 flat angles P-C4'-P energy: -4.593 tors. eta vs tors. theta energy: -11.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -168.181559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.181559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.181559 (E_RNA) where: Base-Base interactions energy: -109.486 where: short stacking energy: -44.759 Base-Backbone interact. energy: -0.291 local terms energy: -58.404854 where: bonds (distance) C4'-P energy: -16.503 bonds (distance) P-C4' energy: -13.955 flat angles C4'-P-C4' energy: -12.309 flat angles P-C4'-P energy: -2.957 tors. eta vs tors. theta energy: -12.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -102.708853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.708853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.708853 (E_RNA) where: Base-Base interactions energy: -53.636 where: short stacking energy: -23.110 Base-Backbone interact. energy: -0.054 local terms energy: -49.018709 where: bonds (distance) C4'-P energy: -15.415 bonds (distance) P-C4' energy: -11.519 flat angles C4'-P-C4' energy: -14.348 flat angles P-C4'-P energy: -5.074 tors. eta vs tors. theta energy: -2.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -85.243297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.243297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.243297 (E_RNA) where: Base-Base interactions energy: -31.082 where: short stacking energy: -25.337 Base-Backbone interact. energy: -0.205 local terms energy: -53.956588 where: bonds (distance) C4'-P energy: -13.605 bonds (distance) P-C4' energy: -17.187 flat angles C4'-P-C4' energy: -11.181 flat angles P-C4'-P energy: -10.198 tors. eta vs tors. theta energy: -1.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -88.012508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.012508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.012508 (E_RNA) where: Base-Base interactions energy: -42.464 where: short stacking energy: -30.406 Base-Backbone interact. energy: -0.223 local terms energy: -45.325770 where: bonds (distance) C4'-P energy: -10.563 bonds (distance) P-C4' energy: -14.905 flat angles C4'-P-C4' energy: -9.784 flat angles P-C4'-P energy: -6.972 tors. eta vs tors. theta energy: -3.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -91.059309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.059309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.059309 (E_RNA) where: Base-Base interactions energy: -45.979 where: short stacking energy: -14.371 Base-Backbone interact. energy: -0.541 local terms energy: -44.539730 where: bonds (distance) C4'-P energy: -8.707 bonds (distance) P-C4' energy: -13.959 flat angles C4'-P-C4' energy: -13.646 flat angles P-C4'-P energy: -7.886 tors. eta vs tors. theta energy: -0.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -73.429055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.429055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.429055 (E_RNA) where: Base-Base interactions energy: -19.827 where: short stacking energy: -19.777 Base-Backbone interact. energy: 0.464 local terms energy: -54.066421 where: bonds (distance) C4'-P energy: -13.483 bonds (distance) P-C4' energy: -10.697 flat angles C4'-P-C4' energy: -12.672 flat angles P-C4'-P energy: -12.637 tors. eta vs tors. theta energy: -4.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -213.491968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.491968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.491968 (E_RNA) where: Base-Base interactions energy: -144.038 where: short stacking energy: -56.583 Base-Backbone interact. energy: -0.798 local terms energy: -68.655745 where: bonds (distance) C4'-P energy: -15.216 bonds (distance) P-C4' energy: -14.047 flat angles C4'-P-C4' energy: -15.903 flat angles P-C4'-P energy: -9.986 tors. eta vs tors. theta energy: -13.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -207.730457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.730457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.730457 (E_RNA) where: Base-Base interactions energy: -147.458 where: short stacking energy: -45.947 Base-Backbone interact. energy: -0.388 local terms energy: -59.884056 where: bonds (distance) C4'-P energy: -11.378 bonds (distance) P-C4' energy: -17.402 flat angles C4'-P-C4' energy: -15.008 flat angles P-C4'-P energy: -6.498 tors. eta vs tors. theta energy: -9.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -190.683904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.683904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.683904 (E_RNA) where: Base-Base interactions energy: -121.026 where: short stacking energy: -52.958 Base-Backbone interact. energy: -0.204 local terms energy: -69.454161 where: bonds (distance) C4'-P energy: -14.806 bonds (distance) P-C4' energy: -15.903 flat angles C4'-P-C4' energy: -14.585 flat angles P-C4'-P energy: -5.947 tors. eta vs tors. theta energy: -18.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -159.267855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.267855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.267855 (E_RNA) where: Base-Base interactions energy: -93.256 where: short stacking energy: -41.980 Base-Backbone interact. energy: -0.083 local terms energy: -65.928633 where: bonds (distance) C4'-P energy: -13.891 bonds (distance) P-C4' energy: -16.660 flat angles C4'-P-C4' energy: -16.897 flat angles P-C4'-P energy: -7.672 tors. eta vs tors. theta energy: -10.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -162.216114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.216114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.216114 (E_RNA) where: Base-Base interactions energy: -101.993 where: short stacking energy: -41.479 Base-Backbone interact. energy: -0.346 local terms energy: -59.877359 where: bonds (distance) C4'-P energy: -14.601 bonds (distance) P-C4' energy: -10.045 flat angles C4'-P-C4' energy: -15.736 flat angles P-C4'-P energy: -8.412 tors. eta vs tors. theta energy: -11.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -95.077091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.077091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.077091 (E_RNA) where: Base-Base interactions energy: -41.868 where: short stacking energy: -37.433 Base-Backbone interact. energy: 1.858 local terms energy: -55.067123 where: bonds (distance) C4'-P energy: -4.571 bonds (distance) P-C4' energy: -13.880 flat angles C4'-P-C4' energy: -17.126 flat angles P-C4'-P energy: -13.631 tors. eta vs tors. theta energy: -5.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -86.724919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.724919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.724919 (E_RNA) where: Base-Base interactions energy: -33.057 where: short stacking energy: -33.057 Base-Backbone interact. energy: -0.007 local terms energy: -53.661604 where: bonds (distance) C4'-P energy: -15.477 bonds (distance) P-C4' energy: -13.316 flat angles C4'-P-C4' energy: -8.266 flat angles P-C4'-P energy: -4.835 tors. eta vs tors. theta energy: -11.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -83.094685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.094685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.094685 (E_RNA) where: Base-Base interactions energy: -33.458 where: short stacking energy: -25.023 Base-Backbone interact. energy: -0.230 local terms energy: -49.407018 where: bonds (distance) C4'-P energy: -13.945 bonds (distance) P-C4' energy: -12.930 flat angles C4'-P-C4' energy: -16.457 flat angles P-C4'-P energy: -6.538 tors. eta vs tors. theta energy: 0.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -90.867765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.867765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.867765 (E_RNA) where: Base-Base interactions energy: -38.745 where: short stacking energy: -20.404 Base-Backbone interact. energy: -0.210 local terms energy: -51.913177 where: bonds (distance) C4'-P energy: -12.554 bonds (distance) P-C4' energy: -15.606 flat angles C4'-P-C4' energy: -13.429 flat angles P-C4'-P energy: -6.457 tors. eta vs tors. theta energy: -3.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -71.717282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.717282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.717282 (E_RNA) where: Base-Base interactions energy: -26.074 where: short stacking energy: -26.074 Base-Backbone interact. energy: -0.140 local terms energy: -45.502982 where: bonds (distance) C4'-P energy: -5.487 bonds (distance) P-C4' energy: -15.559 flat angles C4'-P-C4' energy: -13.891 flat angles P-C4'-P energy: -9.902 tors. eta vs tors. theta energy: -0.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -211.216287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.216287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.216287 (E_RNA) where: Base-Base interactions energy: -138.331 where: short stacking energy: -51.810 Base-Backbone interact. energy: -0.083 local terms energy: -72.802251 where: bonds (distance) C4'-P energy: -13.803 bonds (distance) P-C4' energy: -14.712 flat angles C4'-P-C4' energy: -17.677 flat angles P-C4'-P energy: -11.659 tors. eta vs tors. theta energy: -14.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -196.387784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.387784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.387784 (E_RNA) where: Base-Base interactions energy: -125.903 where: short stacking energy: -49.701 Base-Backbone interact. energy: 0.334 local terms energy: -70.818727 where: bonds (distance) C4'-P energy: -15.145 bonds (distance) P-C4' energy: -13.103 flat angles C4'-P-C4' energy: -14.729 flat angles P-C4'-P energy: -14.058 tors. eta vs tors. theta energy: -13.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -178.825461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.825461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.825461 (E_RNA) where: Base-Base interactions energy: -114.808 where: short stacking energy: -50.494 Base-Backbone interact. energy: -1.737 local terms energy: -62.280225 where: bonds (distance) C4'-P energy: -9.847 bonds (distance) P-C4' energy: -16.783 flat angles C4'-P-C4' energy: -16.043 flat angles P-C4'-P energy: -9.327 tors. eta vs tors. theta energy: -10.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -176.009491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.009491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.009491 (E_RNA) where: Base-Base interactions energy: -119.547 where: short stacking energy: -40.650 Base-Backbone interact. energy: -0.558 local terms energy: -55.904028 where: bonds (distance) C4'-P energy: -14.152 bonds (distance) P-C4' energy: -15.509 flat angles C4'-P-C4' energy: -10.014 flat angles P-C4'-P energy: -5.780 tors. eta vs tors. theta energy: -10.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -165.579740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.579740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.579740 (E_RNA) where: Base-Base interactions energy: -102.485 where: short stacking energy: -47.571 Base-Backbone interact. energy: -0.027 local terms energy: -63.068407 where: bonds (distance) C4'-P energy: -16.669 bonds (distance) P-C4' energy: -16.667 flat angles C4'-P-C4' energy: -11.228 flat angles P-C4'-P energy: -6.491 tors. eta vs tors. theta energy: -12.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -113.505674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.505674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.505674 (E_RNA) where: Base-Base interactions energy: -60.109 where: short stacking energy: -26.492 Base-Backbone interact. energy: -0.708 local terms energy: -52.689154 where: bonds (distance) C4'-P energy: -10.783 bonds (distance) P-C4' energy: -9.041 flat angles C4'-P-C4' energy: -17.044 flat angles P-C4'-P energy: -7.144 tors. eta vs tors. theta energy: -8.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -85.922540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.922540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.922540 (E_RNA) where: Base-Base interactions energy: -27.023 where: short stacking energy: -22.311 Base-Backbone interact. energy: 3.478 local terms energy: -62.377667 where: bonds (distance) C4'-P energy: -15.936 bonds (distance) P-C4' energy: -15.803 flat angles C4'-P-C4' energy: -12.048 flat angles P-C4'-P energy: -12.474 tors. eta vs tors. theta energy: -6.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -85.246499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.246499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.246499 (E_RNA) where: Base-Base interactions energy: -30.210 where: short stacking energy: -22.266 Base-Backbone interact. energy: -0.529 local terms energy: -54.507779 where: bonds (distance) C4'-P energy: -15.903 bonds (distance) P-C4' energy: -11.802 flat angles C4'-P-C4' energy: -15.722 flat angles P-C4'-P energy: -12.002 tors. eta vs tors. theta energy: 0.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -90.297546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.297546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.297546 (E_RNA) where: Base-Base interactions energy: -39.415 where: short stacking energy: -33.651 Base-Backbone interact. energy: -0.197 local terms energy: -50.685232 where: bonds (distance) C4'-P energy: -12.074 bonds (distance) P-C4' energy: -15.606 flat angles C4'-P-C4' energy: -9.489 flat angles P-C4'-P energy: -4.951 tors. eta vs tors. theta energy: -8.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -70.360136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.360136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.360136 (E_RNA) where: Base-Base interactions energy: -28.295 where: short stacking energy: -16.075 Base-Backbone interact. energy: 1.363 local terms energy: -43.428166 where: bonds (distance) C4'-P energy: -10.343 bonds (distance) P-C4' energy: -11.991 flat angles C4'-P-C4' energy: -15.846 flat angles P-C4'-P energy: -7.301 tors. eta vs tors. theta energy: 2.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -214.569113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.569113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.569113 (E_RNA) where: Base-Base interactions energy: -141.681 where: short stacking energy: -58.735 Base-Backbone interact. energy: -0.190 local terms energy: -72.697996 where: bonds (distance) C4'-P energy: -13.841 bonds (distance) P-C4' energy: -16.731 flat angles C4'-P-C4' energy: -13.419 flat angles P-C4'-P energy: -10.095 tors. eta vs tors. theta energy: -18.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -194.837638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.837638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.837638 (E_RNA) where: Base-Base interactions energy: -127.569 where: short stacking energy: -48.463 Base-Backbone interact. energy: -0.375 local terms energy: -66.893149 where: bonds (distance) C4'-P energy: -17.087 bonds (distance) P-C4' energy: -15.015 flat angles C4'-P-C4' energy: -13.391 flat angles P-C4'-P energy: -9.307 tors. eta vs tors. theta energy: -12.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -190.139789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.139789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.139789 (E_RNA) where: Base-Base interactions energy: -121.689 where: short stacking energy: -49.503 Base-Backbone interact. energy: 0.136 local terms energy: -68.585981 where: bonds (distance) C4'-P energy: -13.540 bonds (distance) P-C4' energy: -16.911 flat angles C4'-P-C4' energy: -14.199 flat angles P-C4'-P energy: -8.193 tors. eta vs tors. theta energy: -15.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -173.605981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.605981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.605981 (E_RNA) where: Base-Base interactions energy: -113.959 where: short stacking energy: -41.391 Base-Backbone interact. energy: -1.815 local terms energy: -57.831733 where: bonds (distance) C4'-P energy: -9.601 bonds (distance) P-C4' energy: -14.806 flat angles C4'-P-C4' energy: -13.813 flat angles P-C4'-P energy: -9.571 tors. eta vs tors. theta energy: -10.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -149.463613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.463613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.463613 (E_RNA) where: Base-Base interactions energy: -87.754 where: short stacking energy: -48.013 Base-Backbone interact. energy: -0.054 local terms energy: -61.655583 where: bonds (distance) C4'-P energy: -13.441 bonds (distance) P-C4' energy: -11.962 flat angles C4'-P-C4' energy: -14.111 flat angles P-C4'-P energy: -4.476 tors. eta vs tors. theta energy: -17.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -113.444952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.444952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.444952 (E_RNA) where: Base-Base interactions energy: -58.595 where: short stacking energy: -30.365 Base-Backbone interact. energy: -0.081 local terms energy: -54.768532 where: bonds (distance) C4'-P energy: -13.896 bonds (distance) P-C4' energy: -11.856 flat angles C4'-P-C4' energy: -16.087 flat angles P-C4'-P energy: -11.738 tors. eta vs tors. theta energy: -1.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -92.721311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.721311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.721311 (E_RNA) where: Base-Base interactions energy: -33.542 where: short stacking energy: -33.542 Base-Backbone interact. energy: -0.098 local terms energy: -59.080500 where: bonds (distance) C4'-P energy: -12.365 bonds (distance) P-C4' energy: -16.811 flat angles C4'-P-C4' energy: -17.125 flat angles P-C4'-P energy: -7.673 tors. eta vs tors. theta energy: -5.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -103.179237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.179237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -103.179237 (E_RNA) where: Base-Base interactions energy: -48.230 where: short stacking energy: -28.714 Base-Backbone interact. energy: -0.328 local terms energy: -54.622064 where: bonds (distance) C4'-P energy: -13.838 bonds (distance) P-C4' energy: -15.100 flat angles C4'-P-C4' energy: -12.667 flat angles P-C4'-P energy: -8.824 tors. eta vs tors. theta energy: -4.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -78.257144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.257144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.257144 (E_RNA) where: Base-Base interactions energy: -26.210 where: short stacking energy: -18.640 Base-Backbone interact. energy: -0.256 local terms energy: -51.791613 where: bonds (distance) C4'-P energy: -15.030 bonds (distance) P-C4' energy: -17.570 flat angles C4'-P-C4' energy: -12.049 flat angles P-C4'-P energy: -8.173 tors. eta vs tors. theta energy: 1.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -102.216705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.216705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.216705 (E_RNA) where: Base-Base interactions energy: -56.127 where: short stacking energy: -24.474 Base-Backbone interact. energy: -0.483 local terms energy: -45.606126 where: bonds (distance) C4'-P energy: -14.098 bonds (distance) P-C4' energy: -13.157 flat angles C4'-P-C4' energy: -13.224 flat angles P-C4'-P energy: 0.466 tors. eta vs tors. theta energy: -5.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -225.785896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.785896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.785896 (E_RNA) where: Base-Base interactions energy: -159.607 where: short stacking energy: -53.220 Base-Backbone interact. energy: -1.005 local terms energy: -65.173802 where: bonds (distance) C4'-P energy: -10.427 bonds (distance) P-C4' energy: -14.464 flat angles C4'-P-C4' energy: -15.121 flat angles P-C4'-P energy: -9.661 tors. eta vs tors. theta energy: -15.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -191.533279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.533279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.533279 (E_RNA) where: Base-Base interactions energy: -125.389 where: short stacking energy: -48.917 Base-Backbone interact. energy: -0.199 local terms energy: -65.945757 where: bonds (distance) C4'-P energy: -12.410 bonds (distance) P-C4' energy: -16.383 flat angles C4'-P-C4' energy: -16.185 flat angles P-C4'-P energy: -9.663 tors. eta vs tors. theta energy: -11.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -195.408928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.408928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.408928 (E_RNA) where: Base-Base interactions energy: -133.502 where: short stacking energy: -55.948 Base-Backbone interact. energy: -0.185 local terms energy: -61.721835 where: bonds (distance) C4'-P energy: -10.857 bonds (distance) P-C4' energy: -17.169 flat angles C4'-P-C4' energy: -12.718 flat angles P-C4'-P energy: -8.234 tors. eta vs tors. theta energy: -12.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -145.929911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.929911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.929911 (E_RNA) where: Base-Base interactions energy: -92.371 where: short stacking energy: -49.121 Base-Backbone interact. energy: -0.020 local terms energy: -53.538963 where: bonds (distance) C4'-P energy: -11.072 bonds (distance) P-C4' energy: -16.657 flat angles C4'-P-C4' energy: -10.783 flat angles P-C4'-P energy: -2.761 tors. eta vs tors. theta energy: -12.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -144.151173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.151173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.151173 (E_RNA) where: Base-Base interactions energy: -85.822 where: short stacking energy: -37.798 Base-Backbone interact. energy: -1.271 local terms energy: -57.058530 where: bonds (distance) C4'-P energy: -12.595 bonds (distance) P-C4' energy: -17.245 flat angles C4'-P-C4' energy: -13.608 flat angles P-C4'-P energy: -4.802 tors. eta vs tors. theta energy: -8.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -152.571041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.571041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.571041 (E_RNA) where: Base-Base interactions energy: -91.457 where: short stacking energy: -47.675 Base-Backbone interact. energy: -0.459 local terms energy: -60.655142 where: bonds (distance) C4'-P energy: -14.247 bonds (distance) P-C4' energy: -13.229 flat angles C4'-P-C4' energy: -12.697 flat angles P-C4'-P energy: -5.097 tors. eta vs tors. theta energy: -15.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -109.027831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.027831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.027831 (E_RNA) where: Base-Base interactions energy: -59.020 where: short stacking energy: -27.726 Base-Backbone interact. energy: -0.122 local terms energy: -49.886555 where: bonds (distance) C4'-P energy: -15.605 bonds (distance) P-C4' energy: -17.274 flat angles C4'-P-C4' energy: -14.661 flat angles P-C4'-P energy: -2.902 tors. eta vs tors. theta energy: 0.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -78.769988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.769988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.769988 (E_RNA) where: Base-Base interactions energy: -29.750 where: short stacking energy: -24.948 Base-Backbone interact. energy: -0.837 local terms energy: -48.182530 where: bonds (distance) C4'-P energy: -7.437 bonds (distance) P-C4' energy: -17.957 flat angles C4'-P-C4' energy: -11.122 flat angles P-C4'-P energy: -9.191 tors. eta vs tors. theta energy: -2.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -100.029378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.029378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.029378 (E_RNA) where: Base-Base interactions energy: -52.914 where: short stacking energy: -34.985 Base-Backbone interact. energy: -0.158 local terms energy: -46.957965 where: bonds (distance) C4'-P energy: -12.985 bonds (distance) P-C4' energy: -12.163 flat angles C4'-P-C4' energy: -11.270 flat angles P-C4'-P energy: -4.332 tors. eta vs tors. theta energy: -6.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -70.489565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.489565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.489565 (E_RNA) where: Base-Base interactions energy: -30.388 where: short stacking energy: -23.731 Base-Backbone interact. energy: -0.434 local terms energy: -39.668060 where: bonds (distance) C4'-P energy: -9.113 bonds (distance) P-C4' energy: -9.372 flat angles C4'-P-C4' energy: -11.110 flat angles P-C4'-P energy: -5.752 tors. eta vs tors. theta energy: -4.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -220.836910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.836910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.836910 (E_RNA) where: Base-Base interactions energy: -146.935 where: short stacking energy: -57.161 Base-Backbone interact. energy: -1.984 local terms energy: -71.917867 where: bonds (distance) C4'-P energy: -15.286 bonds (distance) P-C4' energy: -14.302 flat angles C4'-P-C4' energy: -16.429 flat angles P-C4'-P energy: -8.116 tors. eta vs tors. theta energy: -17.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -198.139512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.139512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.139512 (E_RNA) where: Base-Base interactions energy: -131.922 where: short stacking energy: -53.196 Base-Backbone interact. energy: -1.589 local terms energy: -64.628737 where: bonds (distance) C4'-P energy: -13.949 bonds (distance) P-C4' energy: -15.480 flat angles C4'-P-C4' energy: -12.428 flat angles P-C4'-P energy: -8.252 tors. eta vs tors. theta energy: -14.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -189.249994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.249994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.249994 (E_RNA) where: Base-Base interactions energy: -121.483 where: short stacking energy: -50.307 Base-Backbone interact. energy: -0.004 local terms energy: -67.762898 where: bonds (distance) C4'-P energy: -16.296 bonds (distance) P-C4' energy: -14.471 flat angles C4'-P-C4' energy: -16.091 flat angles P-C4'-P energy: -8.751 tors. eta vs tors. theta energy: -12.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -147.415437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.415437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.415437 (E_RNA) where: Base-Base interactions energy: -84.687 where: short stacking energy: -42.267 Base-Backbone interact. energy: -0.157 local terms energy: -62.570747 where: bonds (distance) C4'-P energy: -15.634 bonds (distance) P-C4' energy: -13.006 flat angles C4'-P-C4' energy: -10.772 flat angles P-C4'-P energy: -9.257 tors. eta vs tors. theta energy: -13.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -145.877234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.877234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.877234 (E_RNA) where: Base-Base interactions energy: -81.783 where: short stacking energy: -42.661 Base-Backbone interact. energy: -0.953 local terms energy: -63.141214 where: bonds (distance) C4'-P energy: -15.693 bonds (distance) P-C4' energy: -12.516 flat angles C4'-P-C4' energy: -13.550 flat angles P-C4'-P energy: -8.697 tors. eta vs tors. theta energy: -12.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -156.522728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.522728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.522728 (E_RNA) where: Base-Base interactions energy: -99.236 where: short stacking energy: -34.722 Base-Backbone interact. energy: -0.368 local terms energy: -56.919297 where: bonds (distance) C4'-P energy: -14.438 bonds (distance) P-C4' energy: -13.130 flat angles C4'-P-C4' energy: -12.996 flat angles P-C4'-P energy: -8.738 tors. eta vs tors. theta energy: -7.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -90.309874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.309874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.309874 (E_RNA) where: Base-Base interactions energy: -48.798 where: short stacking energy: -28.453 Base-Backbone interact. energy: 0.392 local terms energy: -41.904106 where: bonds (distance) C4'-P energy: -9.007 bonds (distance) P-C4' energy: -9.581 flat angles C4'-P-C4' energy: -14.349 flat angles P-C4'-P energy: -8.262 tors. eta vs tors. theta energy: -0.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -84.362271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.362271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.362271 (E_RNA) where: Base-Base interactions energy: -29.842 where: short stacking energy: -29.842 Base-Backbone interact. energy: -0.042 local terms energy: -54.477923 where: bonds (distance) C4'-P energy: -12.817 bonds (distance) P-C4' energy: -16.464 flat angles C4'-P-C4' energy: -8.396 flat angles P-C4'-P energy: -12.392 tors. eta vs tors. theta energy: -4.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -77.106874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.106874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.106874 (E_RNA) where: Base-Base interactions energy: -23.471 where: short stacking energy: -23.471 Base-Backbone interact. energy: -0.509 local terms energy: -53.126477 where: bonds (distance) C4'-P energy: -14.309 bonds (distance) P-C4' energy: -13.029 flat angles C4'-P-C4' energy: -13.608 flat angles P-C4'-P energy: -8.573 tors. eta vs tors. theta energy: -3.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -73.053227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.053227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.053227 (E_RNA) where: Base-Base interactions energy: -24.171 where: short stacking energy: -23.391 Base-Backbone interact. energy: -0.248 local terms energy: -48.634751 where: bonds (distance) C4'-P energy: -11.191 bonds (distance) P-C4' energy: -14.677 flat angles C4'-P-C4' energy: -12.285 flat angles P-C4'-P energy: -5.898 tors. eta vs tors. theta energy: -4.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -226.825850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.825850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.825850 (E_RNA) where: Base-Base interactions energy: -151.738 where: short stacking energy: -53.257 Base-Backbone interact. energy: -0.092 local terms energy: -74.996411 where: bonds (distance) C4'-P energy: -16.359 bonds (distance) P-C4' energy: -16.725 flat angles C4'-P-C4' energy: -17.935 flat angles P-C4'-P energy: -7.668 tors. eta vs tors. theta energy: -16.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -189.276724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.276724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.276724 (E_RNA) where: Base-Base interactions energy: -125.194 where: short stacking energy: -35.721 Base-Backbone interact. energy: -0.802 local terms energy: -63.280837 where: bonds (distance) C4'-P energy: -15.234 bonds (distance) P-C4' energy: -15.419 flat angles C4'-P-C4' energy: -15.939 flat angles P-C4'-P energy: -9.532 tors. eta vs tors. theta energy: -7.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -193.004433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.004433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.004433 (E_RNA) where: Base-Base interactions energy: -127.260 where: short stacking energy: -55.945 Base-Backbone interact. energy: 3.246 local terms energy: -68.990251 where: bonds (distance) C4'-P energy: -13.563 bonds (distance) P-C4' energy: -17.210 flat angles C4'-P-C4' energy: -16.815 flat angles P-C4'-P energy: -8.719 tors. eta vs tors. theta energy: -12.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -170.857815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.857815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.857815 (E_RNA) where: Base-Base interactions energy: -102.932 where: short stacking energy: -52.466 Base-Backbone interact. energy: -0.169 local terms energy: -67.757195 where: bonds (distance) C4'-P energy: -14.657 bonds (distance) P-C4' energy: -15.607 flat angles C4'-P-C4' energy: -15.103 flat angles P-C4'-P energy: -7.221 tors. eta vs tors. theta energy: -15.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -139.595643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.595643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.595643 (E_RNA) where: Base-Base interactions energy: -79.295 where: short stacking energy: -38.158 Base-Backbone interact. energy: -0.355 local terms energy: -59.945564 where: bonds (distance) C4'-P energy: -14.239 bonds (distance) P-C4' energy: -12.961 flat angles C4'-P-C4' energy: -10.413 flat angles P-C4'-P energy: -11.721 tors. eta vs tors. theta energy: -10.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -159.706775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.706775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.706775 (E_RNA) where: Base-Base interactions energy: -103.199 where: short stacking energy: -45.444 Base-Backbone interact. energy: -0.749 local terms energy: -55.758849 where: bonds (distance) C4'-P energy: -11.586 bonds (distance) P-C4' energy: -15.770 flat angles C4'-P-C4' energy: -13.907 flat angles P-C4'-P energy: -5.204 tors. eta vs tors. theta energy: -9.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -92.365343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.365343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.365343 (E_RNA) where: Base-Base interactions energy: -37.695 where: short stacking energy: -37.068 Base-Backbone interact. energy: -0.030 local terms energy: -54.640034 where: bonds (distance) C4'-P energy: -8.004 bonds (distance) P-C4' energy: -15.892 flat angles C4'-P-C4' energy: -11.846 flat angles P-C4'-P energy: -8.100 tors. eta vs tors. theta energy: -10.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -71.162573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.162573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.162573 (E_RNA) where: Base-Base interactions energy: -27.437 where: short stacking energy: -25.325 Base-Backbone interact. energy: -0.052 local terms energy: -43.673855 where: bonds (distance) C4'-P energy: -10.020 bonds (distance) P-C4' energy: -13.550 flat angles C4'-P-C4' energy: -11.758 flat angles P-C4'-P energy: -1.909 tors. eta vs tors. theta energy: -6.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -74.133252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.133252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.133252 (E_RNA) where: Base-Base interactions energy: -33.966 where: short stacking energy: -33.966 Base-Backbone interact. energy: 0.211 local terms energy: -40.378926 where: bonds (distance) C4'-P energy: -11.058 bonds (distance) P-C4' energy: -7.282 flat angles C4'-P-C4' energy: -15.808 flat angles P-C4'-P energy: -3.622 tors. eta vs tors. theta energy: -2.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -72.631916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.631916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.631916 (E_RNA) where: Base-Base interactions energy: -26.279 where: short stacking energy: -22.034 Base-Backbone interact. energy: 0.417 local terms energy: -46.769981 where: bonds (distance) C4'-P energy: -13.457 bonds (distance) P-C4' energy: -8.910 flat angles C4'-P-C4' energy: -13.407 flat angles P-C4'-P energy: -11.719 tors. eta vs tors. theta energy: 0.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -217.770469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.770469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.770469 (E_RNA) where: Base-Base interactions energy: -148.230 where: short stacking energy: -61.522 Base-Backbone interact. energy: -1.691 local terms energy: -67.849132 where: bonds (distance) C4'-P energy: -8.268 bonds (distance) P-C4' energy: -16.945 flat angles C4'-P-C4' energy: -14.775 flat angles P-C4'-P energy: -8.688 tors. eta vs tors. theta energy: -19.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -202.315373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.315373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.315373 (E_RNA) where: Base-Base interactions energy: -128.110 where: short stacking energy: -52.901 Base-Backbone interact. energy: -0.322 local terms energy: -73.882885 where: bonds (distance) C4'-P energy: -15.321 bonds (distance) P-C4' energy: -17.696 flat angles C4'-P-C4' energy: -15.809 flat angles P-C4'-P energy: -11.738 tors. eta vs tors. theta energy: -13.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -182.240133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.240133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.240133 (E_RNA) where: Base-Base interactions energy: -117.029 where: short stacking energy: -48.073 Base-Backbone interact. energy: -0.125 local terms energy: -65.085993 where: bonds (distance) C4'-P energy: -17.407 bonds (distance) P-C4' energy: -17.724 flat angles C4'-P-C4' energy: -12.392 flat angles P-C4'-P energy: -5.296 tors. eta vs tors. theta energy: -12.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -152.820912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.820912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.820912 (E_RNA) where: Base-Base interactions energy: -94.570 where: short stacking energy: -48.772 Base-Backbone interact. energy: -0.149 local terms energy: -58.101281 where: bonds (distance) C4'-P energy: -15.054 bonds (distance) P-C4' energy: -10.716 flat angles C4'-P-C4' energy: -11.931 flat angles P-C4'-P energy: -6.843 tors. eta vs tors. theta energy: -13.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -139.820674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.820674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.820674 (E_RNA) where: Base-Base interactions energy: -86.002 where: short stacking energy: -36.873 Base-Backbone interact. energy: -0.419 local terms energy: -53.399448 where: bonds (distance) C4'-P energy: -12.319 bonds (distance) P-C4' energy: -12.602 flat angles C4'-P-C4' energy: -15.439 flat angles P-C4'-P energy: -7.805 tors. eta vs tors. theta energy: -5.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -140.012069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.012069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.012069 (E_RNA) where: Base-Base interactions energy: -84.624 where: short stacking energy: -26.567 Base-Backbone interact. energy: -0.082 local terms energy: -55.305906 where: bonds (distance) C4'-P energy: -10.753 bonds (distance) P-C4' energy: -14.673 flat angles C4'-P-C4' energy: -14.287 flat angles P-C4'-P energy: -6.524 tors. eta vs tors. theta energy: -9.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -100.665107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.665107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.665107 (E_RNA) where: Base-Base interactions energy: -42.233 where: short stacking energy: -23.942 Base-Backbone interact. energy: -0.097 local terms energy: -58.334675 where: bonds (distance) C4'-P energy: -14.897 bonds (distance) P-C4' energy: -14.560 flat angles C4'-P-C4' energy: -10.637 flat angles P-C4'-P energy: -10.994 tors. eta vs tors. theta energy: -7.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -74.151123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.151123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.151123 (E_RNA) where: Base-Base interactions energy: -24.006 where: short stacking energy: -22.307 Base-Backbone interact. energy: -0.294 local terms energy: -49.850851 where: bonds (distance) C4'-P energy: -14.339 bonds (distance) P-C4' energy: -13.813 flat angles C4'-P-C4' energy: -10.180 flat angles P-C4'-P energy: -9.751 tors. eta vs tors. theta energy: -1.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -91.427207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.427207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.427207 (E_RNA) where: Base-Base interactions energy: -38.004 where: short stacking energy: -38.004 Base-Backbone interact. energy: -0.028 local terms energy: -53.394831 where: bonds (distance) C4'-P energy: -12.153 bonds (distance) P-C4' energy: -17.601 flat angles C4'-P-C4' energy: -9.739 flat angles P-C4'-P energy: -7.731 tors. eta vs tors. theta energy: -6.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -92.193515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.193515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.193515 (E_RNA) where: Base-Base interactions energy: -42.132 where: short stacking energy: -24.432 Base-Backbone interact. energy: -0.415 local terms energy: -49.647081 where: bonds (distance) C4'-P energy: -14.695 bonds (distance) P-C4' energy: -13.485 flat angles C4'-P-C4' energy: -15.500 flat angles P-C4'-P energy: -7.488 tors. eta vs tors. theta energy: 1.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -222.941074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.941074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.941074 (E_RNA) where: Base-Base interactions energy: -156.669 where: short stacking energy: -57.317 Base-Backbone interact. energy: -0.279 local terms energy: -65.993235 where: bonds (distance) C4'-P energy: -13.208 bonds (distance) P-C4' energy: -15.185 flat angles C4'-P-C4' energy: -12.740 flat angles P-C4'-P energy: -7.851 tors. eta vs tors. theta energy: -17.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -187.466875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.466875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.466875 (E_RNA) where: Base-Base interactions energy: -131.037 where: short stacking energy: -44.790 Base-Backbone interact. energy: -0.434 local terms energy: -55.995814 where: bonds (distance) C4'-P energy: -12.631 bonds (distance) P-C4' energy: -14.397 flat angles C4'-P-C4' energy: -12.407 flat angles P-C4'-P energy: -6.094 tors. eta vs tors. theta energy: -10.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -198.627264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.627264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.627264 (E_RNA) where: Base-Base interactions energy: -131.402 where: short stacking energy: -54.376 Base-Backbone interact. energy: -0.170 local terms energy: -67.055454 where: bonds (distance) C4'-P energy: -13.722 bonds (distance) P-C4' energy: -14.192 flat angles C4'-P-C4' energy: -12.600 flat angles P-C4'-P energy: -11.935 tors. eta vs tors. theta energy: -14.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -173.874815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.874815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.874815 (E_RNA) where: Base-Base interactions energy: -105.247 where: short stacking energy: -53.696 Base-Backbone interact. energy: -0.104 local terms energy: -68.524148 where: bonds (distance) C4'-P energy: -12.603 bonds (distance) P-C4' energy: -13.455 flat angles C4'-P-C4' energy: -13.868 flat angles P-C4'-P energy: -11.631 tors. eta vs tors. theta energy: -16.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -149.558881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.558881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.558881 (E_RNA) where: Base-Base interactions energy: -95.212 where: short stacking energy: -40.477 Base-Backbone interact. energy: -0.138 local terms energy: -54.209337 where: bonds (distance) C4'-P energy: -15.523 bonds (distance) P-C4' energy: -11.096 flat angles C4'-P-C4' energy: -11.971 flat angles P-C4'-P energy: -6.279 tors. eta vs tors. theta energy: -9.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -153.703326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.703326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.703326 (E_RNA) where: Base-Base interactions energy: -102.019 where: short stacking energy: -37.273 Base-Backbone interact. energy: -0.480 local terms energy: -51.203945 where: bonds (distance) C4'-P energy: -12.767 bonds (distance) P-C4' energy: -11.406 flat angles C4'-P-C4' energy: -11.078 flat angles P-C4'-P energy: -5.324 tors. eta vs tors. theta energy: -10.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -86.672021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.672021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.672021 (E_RNA) where: Base-Base interactions energy: -32.348 where: short stacking energy: -24.848 Base-Backbone interact. energy: -0.016 local terms energy: -54.307442 where: bonds (distance) C4'-P energy: -13.108 bonds (distance) P-C4' energy: -15.745 flat angles C4'-P-C4' energy: -10.745 flat angles P-C4'-P energy: -11.802 tors. eta vs tors. theta energy: -2.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -71.302806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.302806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.302806 (E_RNA) where: Base-Base interactions energy: -20.117 where: short stacking energy: -20.117 Base-Backbone interact. energy: -0.258 local terms energy: -50.927509 where: bonds (distance) C4'-P energy: -10.451 bonds (distance) P-C4' energy: -15.664 flat angles C4'-P-C4' energy: -12.506 flat angles P-C4'-P energy: -13.548 tors. eta vs tors. theta energy: 1.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -88.890401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.890401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.890401 (E_RNA) where: Base-Base interactions energy: -39.245 where: short stacking energy: -32.385 Base-Backbone interact. energy: -0.066 local terms energy: -49.579733 where: bonds (distance) C4'-P energy: -6.159 bonds (distance) P-C4' energy: -14.626 flat angles C4'-P-C4' energy: -13.919 flat angles P-C4'-P energy: -9.210 tors. eta vs tors. theta energy: -5.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -67.767081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.767081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.767081 (E_RNA) where: Base-Base interactions energy: -21.511 where: short stacking energy: -20.314 Base-Backbone interact. energy: -0.084 local terms energy: -46.171770 where: bonds (distance) C4'-P energy: -10.196 bonds (distance) P-C4' energy: -11.020 flat angles C4'-P-C4' energy: -13.356 flat angles P-C4'-P energy: -10.144 tors. eta vs tors. theta energy: -1.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -226.792442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.792442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.792442 (E_RNA) where: Base-Base interactions energy: -150.559 where: short stacking energy: -57.748 Base-Backbone interact. energy: -0.935 local terms energy: -75.298511 where: bonds (distance) C4'-P energy: -14.708 bonds (distance) P-C4' energy: -16.687 flat angles C4'-P-C4' energy: -14.656 flat angles P-C4'-P energy: -11.076 tors. eta vs tors. theta energy: -18.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -208.432808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.432808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.432808 (E_RNA) where: Base-Base interactions energy: -135.977 where: short stacking energy: -55.230 Base-Backbone interact. energy: -0.676 local terms energy: -71.779908 where: bonds (distance) C4'-P energy: -12.129 bonds (distance) P-C4' energy: -17.037 flat angles C4'-P-C4' energy: -17.327 flat angles P-C4'-P energy: -9.958 tors. eta vs tors. theta energy: -15.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -186.656669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.656669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.656669 (E_RNA) where: Base-Base interactions energy: -129.504 where: short stacking energy: -42.362 Base-Backbone interact. energy: -0.645 local terms energy: -56.507659 where: bonds (distance) C4'-P energy: -11.333 bonds (distance) P-C4' energy: -14.734 flat angles C4'-P-C4' energy: -16.206 flat angles P-C4'-P energy: -5.588 tors. eta vs tors. theta energy: -8.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -176.201343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.201343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.201343 (E_RNA) where: Base-Base interactions energy: -111.139 where: short stacking energy: -33.265 Base-Backbone interact. energy: 0.063 local terms energy: -65.125463 where: bonds (distance) C4'-P energy: -16.914 bonds (distance) P-C4' energy: -15.597 flat angles C4'-P-C4' energy: -15.220 flat angles P-C4'-P energy: -7.591 tors. eta vs tors. theta energy: -9.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -185.386718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.386718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.386718 (E_RNA) where: Base-Base interactions energy: -116.864 where: short stacking energy: -48.736 Base-Backbone interact. energy: -0.120 local terms energy: -68.402992 where: bonds (distance) C4'-P energy: -14.326 bonds (distance) P-C4' energy: -16.758 flat angles C4'-P-C4' energy: -15.623 flat angles P-C4'-P energy: -8.071 tors. eta vs tors. theta energy: -13.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -146.209020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.209020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.209020 (E_RNA) where: Base-Base interactions energy: -87.258 where: short stacking energy: -42.672 Base-Backbone interact. energy: -0.090 local terms energy: -58.860745 where: bonds (distance) C4'-P energy: -16.145 bonds (distance) P-C4' energy: -13.945 flat angles C4'-P-C4' energy: -13.035 flat angles P-C4'-P energy: -7.290 tors. eta vs tors. theta energy: -8.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -104.528048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.528048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.528048 (E_RNA) where: Base-Base interactions energy: -52.225 where: short stacking energy: -37.878 Base-Backbone interact. energy: -0.106 local terms energy: -52.196947 where: bonds (distance) C4'-P energy: -10.498 bonds (distance) P-C4' energy: -16.195 flat angles C4'-P-C4' energy: -16.559 flat angles P-C4'-P energy: -1.766 tors. eta vs tors. theta energy: -7.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -77.491624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.491624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.491624 (E_RNA) where: Base-Base interactions energy: -30.104 where: short stacking energy: -24.038 Base-Backbone interact. energy: -0.772 local terms energy: -46.615521 where: bonds (distance) C4'-P energy: -9.692 bonds (distance) P-C4' energy: -14.628 flat angles C4'-P-C4' energy: -16.299 flat angles P-C4'-P energy: -4.752 tors. eta vs tors. theta energy: -1.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -81.446014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.446014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.446014 (E_RNA) where: Base-Base interactions energy: -35.849 where: short stacking energy: -17.928 Base-Backbone interact. energy: -0.507 local terms energy: -45.089589 where: bonds (distance) C4'-P energy: -9.363 bonds (distance) P-C4' energy: -14.004 flat angles C4'-P-C4' energy: -16.300 flat angles P-C4'-P energy: -3.829 tors. eta vs tors. theta energy: -1.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -73.626914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.626914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.626914 (E_RNA) where: Base-Base interactions energy: -26.387 where: short stacking energy: -26.387 Base-Backbone interact. energy: -0.005 local terms energy: -47.235579 where: bonds (distance) C4'-P energy: -10.302 bonds (distance) P-C4' energy: -14.014 flat angles C4'-P-C4' energy: -13.913 flat angles P-C4'-P energy: -7.731 tors. eta vs tors. theta energy: -1.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -219.062057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.062057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.062057 (E_RNA) where: Base-Base interactions energy: -152.875 where: short stacking energy: -56.760 Base-Backbone interact. energy: -0.856 local terms energy: -65.330950 where: bonds (distance) C4'-P energy: -13.271 bonds (distance) P-C4' energy: -17.591 flat angles C4'-P-C4' energy: -13.785 flat angles P-C4'-P energy: -4.181 tors. eta vs tors. theta energy: -16.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -208.642256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.642256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.642256 (E_RNA) where: Base-Base interactions energy: -136.192 where: short stacking energy: -56.140 Base-Backbone interact. energy: -0.653 local terms energy: -71.797004 where: bonds (distance) C4'-P energy: -15.523 bonds (distance) P-C4' energy: -15.452 flat angles C4'-P-C4' energy: -12.616 flat angles P-C4'-P energy: -10.474 tors. eta vs tors. theta energy: -17.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -185.788815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.788815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.788815 (E_RNA) where: Base-Base interactions energy: -122.811 where: short stacking energy: -55.387 Base-Backbone interact. energy: -0.505 local terms energy: -62.472792 where: bonds (distance) C4'-P energy: -12.256 bonds (distance) P-C4' energy: -15.899 flat angles C4'-P-C4' energy: -15.388 flat angles P-C4'-P energy: -2.788 tors. eta vs tors. theta energy: -16.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -190.025359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.025359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.025359 (E_RNA) where: Base-Base interactions energy: -126.274 where: short stacking energy: -52.323 Base-Backbone interact. energy: -0.492 local terms energy: -63.258820 where: bonds (distance) C4'-P energy: -17.042 bonds (distance) P-C4' energy: -10.039 flat angles C4'-P-C4' energy: -11.472 flat angles P-C4'-P energy: -12.125 tors. eta vs tors. theta energy: -12.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -162.704831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.704831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.704831 (E_RNA) where: Base-Base interactions energy: -105.585 where: short stacking energy: -43.219 Base-Backbone interact. energy: -0.127 local terms energy: -56.992600 where: bonds (distance) C4'-P energy: -12.932 bonds (distance) P-C4' energy: -14.421 flat angles C4'-P-C4' energy: -14.115 flat angles P-C4'-P energy: -6.862 tors. eta vs tors. theta energy: -8.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -91.361195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.361195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.361195 (E_RNA) where: Base-Base interactions energy: -37.991 where: short stacking energy: -36.891 Base-Backbone interact. energy: -0.236 local terms energy: -53.134185 where: bonds (distance) C4'-P energy: -14.049 bonds (distance) P-C4' energy: -12.448 flat angles C4'-P-C4' energy: -10.117 flat angles P-C4'-P energy: -8.257 tors. eta vs tors. theta energy: -8.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -125.644156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.644156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.644156 (E_RNA) where: Base-Base interactions energy: -76.157 where: short stacking energy: -34.116 Base-Backbone interact. energy: -0.430 local terms energy: -49.057537 where: bonds (distance) C4'-P energy: -5.675 bonds (distance) P-C4' energy: -17.563 flat angles C4'-P-C4' energy: -11.587 flat angles P-C4'-P energy: -7.070 tors. eta vs tors. theta energy: -7.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -95.162773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.162773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.162773 (E_RNA) where: Base-Base interactions energy: -39.834 where: short stacking energy: -39.834 Base-Backbone interact. energy: -0.012 local terms energy: -55.316539 where: bonds (distance) C4'-P energy: -11.652 bonds (distance) P-C4' energy: -11.992 flat angles C4'-P-C4' energy: -12.493 flat angles P-C4'-P energy: -8.797 tors. eta vs tors. theta energy: -10.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -89.808623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.808623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.808623 (E_RNA) where: Base-Base interactions energy: -44.370 where: short stacking energy: -25.966 Base-Backbone interact. energy: 0.144 local terms energy: -45.582596 where: bonds (distance) C4'-P energy: -16.280 bonds (distance) P-C4' energy: -10.425 flat angles C4'-P-C4' energy: -13.815 flat angles P-C4'-P energy: -1.922 tors. eta vs tors. theta energy: -3.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -84.641484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.641484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.641484 (E_RNA) where: Base-Base interactions energy: -30.365 where: short stacking energy: -30.365 Base-Backbone interact. energy: -0.919 local terms energy: -53.356940 where: bonds (distance) C4'-P energy: -11.433 bonds (distance) P-C4' energy: -9.496 flat angles C4'-P-C4' energy: -13.786 flat angles P-C4'-P energy: -9.658 tors. eta vs tors. theta energy: -8.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -223.550942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.550942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.550942 (E_RNA) where: Base-Base interactions energy: -153.480 where: short stacking energy: -60.202 Base-Backbone interact. energy: -0.137 local terms energy: -69.933441 where: bonds (distance) C4'-P energy: -14.264 bonds (distance) P-C4' energy: -14.197 flat angles C4'-P-C4' energy: -14.970 flat angles P-C4'-P energy: -10.674 tors. eta vs tors. theta energy: -15.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -207.368093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.368093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.368093 (E_RNA) where: Base-Base interactions energy: -137.541 where: short stacking energy: -57.261 Base-Backbone interact. energy: -1.110 local terms energy: -68.716759 where: bonds (distance) C4'-P energy: -12.446 bonds (distance) P-C4' energy: -15.888 flat angles C4'-P-C4' energy: -14.450 flat angles P-C4'-P energy: -9.030 tors. eta vs tors. theta energy: -16.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -198.649403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.649403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.649403 (E_RNA) where: Base-Base interactions energy: -127.632 where: short stacking energy: -44.134 Base-Backbone interact. energy: -0.098 local terms energy: -70.919542 where: bonds (distance) C4'-P energy: -16.354 bonds (distance) P-C4' energy: -17.789 flat angles C4'-P-C4' energy: -14.379 flat angles P-C4'-P energy: -11.632 tors. eta vs tors. theta energy: -10.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -180.422758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.422758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.422758 (E_RNA) where: Base-Base interactions energy: -121.507 where: short stacking energy: -47.096 Base-Backbone interact. energy: -0.793 local terms energy: -58.122679 where: bonds (distance) C4'-P energy: -14.479 bonds (distance) P-C4' energy: -15.771 flat angles C4'-P-C4' energy: -9.650 flat angles P-C4'-P energy: -5.158 tors. eta vs tors. theta energy: -13.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -91.981573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.981573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.981573 (E_RNA) where: Base-Base interactions energy: -32.166 where: short stacking energy: -30.448 Base-Backbone interact. energy: -0.110 local terms energy: -59.705750 where: bonds (distance) C4'-P energy: -15.569 bonds (distance) P-C4' energy: -15.854 flat angles C4'-P-C4' energy: -15.727 flat angles P-C4'-P energy: -9.561 tors. eta vs tors. theta energy: -2.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -101.104627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.104627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.104627 (E_RNA) where: Base-Base interactions energy: -42.624 where: short stacking energy: -42.624 Base-Backbone interact. energy: 0.007 local terms energy: -58.486892 where: bonds (distance) C4'-P energy: -18.333 bonds (distance) P-C4' energy: -14.618 flat angles C4'-P-C4' energy: -6.853 flat angles P-C4'-P energy: -7.743 tors. eta vs tors. theta energy: -10.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -99.285752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.285752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.285752 (E_RNA) where: Base-Base interactions energy: -40.413 where: short stacking energy: -36.176 Base-Backbone interact. energy: -0.059 local terms energy: -58.813805 where: bonds (distance) C4'-P energy: -10.040 bonds (distance) P-C4' energy: -15.018 flat angles C4'-P-C4' energy: -15.014 flat angles P-C4'-P energy: -10.513 tors. eta vs tors. theta energy: -8.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -78.447589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.447589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.447589 (E_RNA) where: Base-Base interactions energy: -24.552 where: short stacking energy: -23.693 Base-Backbone interact. energy: -0.176 local terms energy: -53.720237 where: bonds (distance) C4'-P energy: -16.794 bonds (distance) P-C4' energy: -16.049 flat angles C4'-P-C4' energy: -12.138 flat angles P-C4'-P energy: -7.024 tors. eta vs tors. theta energy: -1.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -80.155044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.155044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.155044 (E_RNA) where: Base-Base interactions energy: -32.031 where: short stacking energy: -29.426 Base-Backbone interact. energy: 0.197 local terms energy: -48.320187 where: bonds (distance) C4'-P energy: -10.660 bonds (distance) P-C4' energy: -17.010 flat angles C4'-P-C4' energy: -13.604 flat angles P-C4'-P energy: -8.830 tors. eta vs tors. theta energy: 1.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -68.393905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.393905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.393905 (E_RNA) where: Base-Base interactions energy: -19.648 where: short stacking energy: -19.639 Base-Backbone interact. energy: 0.265 local terms energy: -49.011073 where: bonds (distance) C4'-P energy: -16.455 bonds (distance) P-C4' energy: -16.875 flat angles C4'-P-C4' energy: -8.111 flat angles P-C4'-P energy: -9.761 tors. eta vs tors. theta energy: 2.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -218.819840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.819840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.819840 (E_RNA) where: Base-Base interactions energy: -147.934 where: short stacking energy: -58.854 Base-Backbone interact. energy: -0.129 local terms energy: -70.756950 where: bonds (distance) C4'-P energy: -14.807 bonds (distance) P-C4' energy: -16.675 flat angles C4'-P-C4' energy: -16.636 flat angles P-C4'-P energy: -5.095 tors. eta vs tors. theta energy: -17.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -206.016659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.016659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.016659 (E_RNA) where: Base-Base interactions energy: -146.136 where: short stacking energy: -55.330 Base-Backbone interact. energy: 0.097 local terms energy: -59.977291 where: bonds (distance) C4'-P energy: -12.413 bonds (distance) P-C4' energy: -11.893 flat angles C4'-P-C4' energy: -13.762 flat angles P-C4'-P energy: -9.978 tors. eta vs tors. theta energy: -11.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -190.215720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.215720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.215720 (E_RNA) where: Base-Base interactions energy: -139.460 where: short stacking energy: -57.520 Base-Backbone interact. energy: -0.113 local terms energy: -50.642685 where: bonds (distance) C4'-P energy: -8.666 bonds (distance) P-C4' energy: -12.212 flat angles C4'-P-C4' energy: -13.198 flat angles P-C4'-P energy: -3.895 tors. eta vs tors. theta energy: -12.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -144.002752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.002752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.002752 (E_RNA) where: Base-Base interactions energy: -85.198 where: short stacking energy: -45.437 Base-Backbone interact. energy: -0.216 local terms energy: -58.588116 where: bonds (distance) C4'-P energy: -13.312 bonds (distance) P-C4' energy: -15.895 flat angles C4'-P-C4' energy: -13.280 flat angles P-C4'-P energy: -8.129 tors. eta vs tors. theta energy: -7.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -182.049552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.049552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.049552 (E_RNA) where: Base-Base interactions energy: -118.485 where: short stacking energy: -49.079 Base-Backbone interact. energy: -1.114 local terms energy: -62.450426 where: bonds (distance) C4'-P energy: -12.073 bonds (distance) P-C4' energy: -16.168 flat angles C4'-P-C4' energy: -14.135 flat angles P-C4'-P energy: -6.893 tors. eta vs tors. theta energy: -13.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -88.759177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.759177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.759177 (E_RNA) where: Base-Base interactions energy: -30.344 where: short stacking energy: -29.000 Base-Backbone interact. energy: -0.236 local terms energy: -58.179392 where: bonds (distance) C4'-P energy: -12.692 bonds (distance) P-C4' energy: -18.175 flat angles C4'-P-C4' energy: -12.686 flat angles P-C4'-P energy: -9.380 tors. eta vs tors. theta energy: -5.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -82.838528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.838528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.838528 (E_RNA) where: Base-Base interactions energy: -34.276 where: short stacking energy: -32.347 Base-Backbone interact. energy: -0.140 local terms energy: -48.422944 where: bonds (distance) C4'-P energy: -5.043 bonds (distance) P-C4' energy: -13.448 flat angles C4'-P-C4' energy: -15.790 flat angles P-C4'-P energy: -9.001 tors. eta vs tors. theta energy: -5.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -84.217277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.217277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.217277 (E_RNA) where: Base-Base interactions energy: -32.232 where: short stacking energy: -19.112 Base-Backbone interact. energy: 0.488 local terms energy: -52.472965 where: bonds (distance) C4'-P energy: -16.972 bonds (distance) P-C4' energy: -14.424 flat angles C4'-P-C4' energy: -11.890 flat angles P-C4'-P energy: -5.681 tors. eta vs tors. theta energy: -3.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -75.274639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.274639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.274639 (E_RNA) where: Base-Base interactions energy: -30.621 where: short stacking energy: -27.771 Base-Backbone interact. energy: -0.026 local terms energy: -44.627415 where: bonds (distance) C4'-P energy: -12.335 bonds (distance) P-C4' energy: -15.737 flat angles C4'-P-C4' energy: -8.721 flat angles P-C4'-P energy: -9.914 tors. eta vs tors. theta energy: 2.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -72.737382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.737382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.737382 (E_RNA) where: Base-Base interactions energy: -26.991 where: short stacking energy: -26.991 Base-Backbone interact. energy: 0.302 local terms energy: -46.048754 where: bonds (distance) C4'-P energy: -15.684 bonds (distance) P-C4' energy: -14.129 flat angles C4'-P-C4' energy: -14.404 flat angles P-C4'-P energy: -0.677 tors. eta vs tors. theta energy: -1.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -220.332981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.332981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.332981 (E_RNA) where: Base-Base interactions energy: -151.788 where: short stacking energy: -65.180 Base-Backbone interact. energy: -0.227 local terms energy: -68.318136 where: bonds (distance) C4'-P energy: -12.371 bonds (distance) P-C4' energy: -13.208 flat angles C4'-P-C4' energy: -15.360 flat angles P-C4'-P energy: -9.561 tors. eta vs tors. theta energy: -17.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -197.462822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.462822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.462822 (E_RNA) where: Base-Base interactions energy: -133.179 where: short stacking energy: -42.500 Base-Backbone interact. energy: -0.073 local terms energy: -64.210823 where: bonds (distance) C4'-P energy: -14.799 bonds (distance) P-C4' energy: -14.802 flat angles C4'-P-C4' energy: -16.600 flat angles P-C4'-P energy: -5.410 tors. eta vs tors. theta energy: -12.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -194.362954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.362954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.362954 (E_RNA) where: Base-Base interactions energy: -126.471 where: short stacking energy: -44.933 Base-Backbone interact. energy: -1.098 local terms energy: -66.793706 where: bonds (distance) C4'-P energy: -14.172 bonds (distance) P-C4' energy: -15.195 flat angles C4'-P-C4' energy: -14.110 flat angles P-C4'-P energy: -10.578 tors. eta vs tors. theta energy: -12.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -147.935150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.935150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.935150 (E_RNA) where: Base-Base interactions energy: -88.718 where: short stacking energy: -48.894 Base-Backbone interact. energy: -0.239 local terms energy: -58.978524 where: bonds (distance) C4'-P energy: -15.610 bonds (distance) P-C4' energy: -7.785 flat angles C4'-P-C4' energy: -12.778 flat angles P-C4'-P energy: -9.973 tors. eta vs tors. theta energy: -12.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -175.382547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.382547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.382547 (E_RNA) where: Base-Base interactions energy: -113.478 where: short stacking energy: -40.310 Base-Backbone interact. energy: -0.065 local terms energy: -61.839752 where: bonds (distance) C4'-P energy: -12.729 bonds (distance) P-C4' energy: -11.043 flat angles C4'-P-C4' energy: -15.189 flat angles P-C4'-P energy: -12.108 tors. eta vs tors. theta energy: -10.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -104.302309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.302309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.302309 (E_RNA) where: Base-Base interactions energy: -56.140 where: short stacking energy: -24.407 Base-Backbone interact. energy: 0.055 local terms energy: -48.217078 where: bonds (distance) C4'-P energy: -14.388 bonds (distance) P-C4' energy: -13.173 flat angles C4'-P-C4' energy: -7.336 flat angles P-C4'-P energy: -5.887 tors. eta vs tors. theta energy: -7.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -101.136413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.136413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.136413 (E_RNA) where: Base-Base interactions energy: -40.475 where: short stacking energy: -23.814 Base-Backbone interact. energy: -0.378 local terms energy: -60.283634 where: bonds (distance) C4'-P energy: -13.585 bonds (distance) P-C4' energy: -17.390 flat angles C4'-P-C4' energy: -13.074 flat angles P-C4'-P energy: -9.937 tors. eta vs tors. theta energy: -6.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -110.116287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.116287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.116287 (E_RNA) where: Base-Base interactions energy: -54.664 where: short stacking energy: -27.678 Base-Backbone interact. energy: -0.079 local terms energy: -55.373520 where: bonds (distance) C4'-P energy: -13.009 bonds (distance) P-C4' energy: -13.745 flat angles C4'-P-C4' energy: -12.628 flat angles P-C4'-P energy: -4.243 tors. eta vs tors. theta energy: -11.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -72.783251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.783251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.783251 (E_RNA) where: Base-Base interactions energy: -27.515 where: short stacking energy: -25.737 Base-Backbone interact. energy: -0.124 local terms energy: -45.144393 where: bonds (distance) C4'-P energy: -12.286 bonds (distance) P-C4' energy: -9.505 flat angles C4'-P-C4' energy: -12.504 flat angles P-C4'-P energy: -9.427 tors. eta vs tors. theta energy: -1.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -71.401913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.401913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.401913 (E_RNA) where: Base-Base interactions energy: -24.510 where: short stacking energy: -18.111 Base-Backbone interact. energy: -0.426 local terms energy: -46.465922 where: bonds (distance) C4'-P energy: -11.884 bonds (distance) P-C4' energy: -15.547 flat angles C4'-P-C4' energy: -12.583 flat angles P-C4'-P energy: -7.502 tors. eta vs tors. theta energy: 1.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -205.409186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.409186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.409186 (E_RNA) where: Base-Base interactions energy: -134.817 where: short stacking energy: -54.193 Base-Backbone interact. energy: 0.955 local terms energy: -71.547868 where: bonds (distance) C4'-P energy: -17.908 bonds (distance) P-C4' energy: -15.514 flat angles C4'-P-C4' energy: -14.022 flat angles P-C4'-P energy: -7.417 tors. eta vs tors. theta energy: -16.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -200.959063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.959063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.959063 (E_RNA) where: Base-Base interactions energy: -128.421 where: short stacking energy: -47.689 Base-Backbone interact. energy: 0.186 local terms energy: -72.724358 where: bonds (distance) C4'-P energy: -15.709 bonds (distance) P-C4' energy: -16.032 flat angles C4'-P-C4' energy: -16.659 flat angles P-C4'-P energy: -11.062 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -195.833774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.833774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.833774 (E_RNA) where: Base-Base interactions energy: -135.568 where: short stacking energy: -47.467 Base-Backbone interact. energy: -0.092 local terms energy: -60.174263 where: bonds (distance) C4'-P energy: -12.807 bonds (distance) P-C4' energy: -13.657 flat angles C4'-P-C4' energy: -15.011 flat angles P-C4'-P energy: -7.404 tors. eta vs tors. theta energy: -11.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -190.249328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.249328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.249328 (E_RNA) where: Base-Base interactions energy: -119.891 where: short stacking energy: -50.456 Base-Backbone interact. energy: -0.295 local terms energy: -70.064283 where: bonds (distance) C4'-P energy: -16.144 bonds (distance) P-C4' energy: -16.537 flat angles C4'-P-C4' energy: -12.714 flat angles P-C4'-P energy: -10.912 tors. eta vs tors. theta energy: -13.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -125.443141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.443141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.443141 (E_RNA) where: Base-Base interactions energy: -67.617 where: short stacking energy: -35.996 Base-Backbone interact. energy: -0.097 local terms energy: -57.729528 where: bonds (distance) C4'-P energy: -12.051 bonds (distance) P-C4' energy: -15.854 flat angles C4'-P-C4' energy: -15.907 flat angles P-C4'-P energy: -9.064 tors. eta vs tors. theta energy: -4.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -96.727551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.727551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.727551 (E_RNA) where: Base-Base interactions energy: -40.071 where: short stacking energy: -28.457 Base-Backbone interact. energy: 1.035 local terms energy: -57.691610 where: bonds (distance) C4'-P energy: -15.047 bonds (distance) P-C4' energy: -15.554 flat angles C4'-P-C4' energy: -11.844 flat angles P-C4'-P energy: -8.932 tors. eta vs tors. theta energy: -6.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -93.605927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.605927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.605927 (E_RNA) where: Base-Base interactions energy: -46.906 where: short stacking energy: -23.124 Base-Backbone interact. energy: -0.075 local terms energy: -46.625165 where: bonds (distance) C4'-P energy: -12.290 bonds (distance) P-C4' energy: -17.259 flat angles C4'-P-C4' energy: -11.657 flat angles P-C4'-P energy: -6.880 tors. eta vs tors. theta energy: 1.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -85.282547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.282547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.282547 (E_RNA) where: Base-Base interactions energy: -35.363 where: short stacking energy: -31.786 Base-Backbone interact. energy: -0.068 local terms energy: -49.851600 where: bonds (distance) C4'-P energy: -15.452 bonds (distance) P-C4' energy: -15.451 flat angles C4'-P-C4' energy: -6.518 flat angles P-C4'-P energy: -7.098 tors. eta vs tors. theta energy: -5.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -79.947832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.947832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.947832 (E_RNA) where: Base-Base interactions energy: -43.540 where: short stacking energy: -18.234 Base-Backbone interact. energy: -0.644 local terms energy: -35.764104 where: bonds (distance) C4'-P energy: -8.613 bonds (distance) P-C4' energy: -8.950 flat angles C4'-P-C4' energy: -10.753 flat angles P-C4'-P energy: -5.495 tors. eta vs tors. theta energy: -1.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -79.520761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.520761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.520761 (E_RNA) where: Base-Base interactions energy: -40.317 where: short stacking energy: -13.352 Base-Backbone interact. energy: 0.743 local terms energy: -39.946437 where: bonds (distance) C4'-P energy: -11.562 bonds (distance) P-C4' energy: -17.767 flat angles C4'-P-C4' energy: -8.137 flat angles P-C4'-P energy: -5.693 tors. eta vs tors. theta energy: 3.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -205.854372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.854372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.854372 (E_RNA) where: Base-Base interactions energy: -136.238 where: short stacking energy: -52.437 Base-Backbone interact. energy: -0.295 local terms energy: -69.321125 where: bonds (distance) C4'-P energy: -17.257 bonds (distance) P-C4' energy: -14.177 flat angles C4'-P-C4' energy: -17.196 flat angles P-C4'-P energy: -8.408 tors. eta vs tors. theta energy: -12.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -196.256803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.256803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.256803 (E_RNA) where: Base-Base interactions energy: -131.074 where: short stacking energy: -55.982 Base-Backbone interact. energy: -0.140 local terms energy: -65.042830 where: bonds (distance) C4'-P energy: -11.304 bonds (distance) P-C4' energy: -16.527 flat angles C4'-P-C4' energy: -16.873 flat angles P-C4'-P energy: -6.248 tors. eta vs tors. theta energy: -14.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -193.160608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.160608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.160608 (E_RNA) where: Base-Base interactions energy: -129.590 where: short stacking energy: -46.189 Base-Backbone interact. energy: -0.546 local terms energy: -63.024361 where: bonds (distance) C4'-P energy: -13.446 bonds (distance) P-C4' energy: -14.132 flat angles C4'-P-C4' energy: -16.013 flat angles P-C4'-P energy: -8.755 tors. eta vs tors. theta energy: -10.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -195.472134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.472134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.472134 (E_RNA) where: Base-Base interactions energy: -134.132 where: short stacking energy: -53.887 Base-Backbone interact. energy: -0.540 local terms energy: -60.800570 where: bonds (distance) C4'-P energy: -13.876 bonds (distance) P-C4' energy: -12.982 flat angles C4'-P-C4' energy: -12.379 flat angles P-C4'-P energy: -7.361 tors. eta vs tors. theta energy: -14.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -143.652856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.652856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.652856 (E_RNA) where: Base-Base interactions energy: -89.260 where: short stacking energy: -36.409 Base-Backbone interact. energy: -1.095 local terms energy: -53.297788 where: bonds (distance) C4'-P energy: -13.466 bonds (distance) P-C4' energy: -13.782 flat angles C4'-P-C4' energy: -12.335 flat angles P-C4'-P energy: -3.905 tors. eta vs tors. theta energy: -9.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -85.282704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.282704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.282704 (E_RNA) where: Base-Base interactions energy: -29.701 where: short stacking energy: -29.701 Base-Backbone interact. energy: -0.119 local terms energy: -55.462317 where: bonds (distance) C4'-P energy: -13.593 bonds (distance) P-C4' energy: -12.708 flat angles C4'-P-C4' energy: -15.306 flat angles P-C4'-P energy: -10.247 tors. eta vs tors. theta energy: -3.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -91.111446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.111446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.111446 (E_RNA) where: Base-Base interactions energy: -28.104 where: short stacking energy: -24.307 Base-Backbone interact. energy: -0.171 local terms energy: -62.836462 where: bonds (distance) C4'-P energy: -15.908 bonds (distance) P-C4' energy: -16.540 flat angles C4'-P-C4' energy: -16.945 flat angles P-C4'-P energy: -11.055 tors. eta vs tors. theta energy: -2.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -82.769017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.769017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.769017 (E_RNA) where: Base-Base interactions energy: -37.640 where: short stacking energy: -20.201 Base-Backbone interact. energy: -0.193 local terms energy: -44.935157 where: bonds (distance) C4'-P energy: -14.450 bonds (distance) P-C4' energy: -15.464 flat angles C4'-P-C4' energy: -12.044 flat angles P-C4'-P energy: -5.309 tors. eta vs tors. theta energy: 2.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -71.655261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.655261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.655261 (E_RNA) where: Base-Base interactions energy: -23.153 where: short stacking energy: -22.260 Base-Backbone interact. energy: -0.232 local terms energy: -48.270382 where: bonds (distance) C4'-P energy: -10.378 bonds (distance) P-C4' energy: -15.967 flat angles C4'-P-C4' energy: -14.519 flat angles P-C4'-P energy: -6.262 tors. eta vs tors. theta energy: -1.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -74.765709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.765709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.765709 (E_RNA) where: Base-Base interactions energy: -20.886 where: short stacking energy: -20.886 Base-Backbone interact. energy: -0.223 local terms energy: -53.655844 where: bonds (distance) C4'-P energy: -17.969 bonds (distance) P-C4' energy: -15.973 flat angles C4'-P-C4' energy: -12.155 flat angles P-C4'-P energy: -7.091 tors. eta vs tors. theta energy: -0.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -208.036914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.036914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.036914 (E_RNA) where: Base-Base interactions energy: -143.106 where: short stacking energy: -60.519 Base-Backbone interact. energy: -0.510 local terms energy: -64.420766 where: bonds (distance) C4'-P energy: -15.036 bonds (distance) P-C4' energy: -13.483 flat angles C4'-P-C4' energy: -16.408 flat angles P-C4'-P energy: -4.345 tors. eta vs tors. theta energy: -15.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -212.883286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.883286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.883286 (E_RNA) where: Base-Base interactions energy: -136.067 where: short stacking energy: -51.976 Base-Backbone interact. energy: -0.664 local terms energy: -76.152198 where: bonds (distance) C4'-P energy: -15.510 bonds (distance) P-C4' energy: -16.293 flat angles C4'-P-C4' energy: -16.579 flat angles P-C4'-P energy: -11.192 tors. eta vs tors. theta energy: -16.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -200.134807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.134807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.134807 (E_RNA) where: Base-Base interactions energy: -133.562 where: short stacking energy: -55.585 Base-Backbone interact. energy: 0.319 local terms energy: -66.891367 where: bonds (distance) C4'-P energy: -13.789 bonds (distance) P-C4' energy: -17.370 flat angles C4'-P-C4' energy: -13.706 flat angles P-C4'-P energy: -8.679 tors. eta vs tors. theta energy: -13.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -187.855747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.855747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.855747 (E_RNA) where: Base-Base interactions energy: -130.560 where: short stacking energy: -51.826 Base-Backbone interact. energy: -0.226 local terms energy: -57.069294 where: bonds (distance) C4'-P energy: -12.302 bonds (distance) P-C4' energy: -13.420 flat angles C4'-P-C4' energy: -13.934 flat angles P-C4'-P energy: -10.796 tors. eta vs tors. theta energy: -6.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -135.107789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.107789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.107789 (E_RNA) where: Base-Base interactions energy: -73.879 where: short stacking energy: -42.888 Base-Backbone interact. energy: -0.106 local terms energy: -61.122940 where: bonds (distance) C4'-P energy: -14.653 bonds (distance) P-C4' energy: -16.166 flat angles C4'-P-C4' energy: -11.634 flat angles P-C4'-P energy: -10.292 tors. eta vs tors. theta energy: -8.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -125.829382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.829382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.829382 (E_RNA) where: Base-Base interactions energy: -60.655 where: short stacking energy: -36.177 Base-Backbone interact. energy: -0.040 local terms energy: -65.134916 where: bonds (distance) C4'-P energy: -13.216 bonds (distance) P-C4' energy: -14.592 flat angles C4'-P-C4' energy: -12.498 flat angles P-C4'-P energy: -11.673 tors. eta vs tors. theta energy: -13.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -114.675718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.675718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.675718 (E_RNA) where: Base-Base interactions energy: -58.803 where: short stacking energy: -25.570 Base-Backbone interact. energy: -0.175 local terms energy: -55.697818 where: bonds (distance) C4'-P energy: -16.305 bonds (distance) P-C4' energy: -13.946 flat angles C4'-P-C4' energy: -11.193 flat angles P-C4'-P energy: -7.433 tors. eta vs tors. theta energy: -6.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -98.687451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.687451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.687451 (E_RNA) where: Base-Base interactions energy: -47.013 where: short stacking energy: -22.433 Base-Backbone interact. energy: -0.350 local terms energy: -51.325044 where: bonds (distance) C4'-P energy: -12.791 bonds (distance) P-C4' energy: -17.184 flat angles C4'-P-C4' energy: -11.200 flat angles P-C4'-P energy: -6.467 tors. eta vs tors. theta energy: -3.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -73.714177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.714177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.714177 (E_RNA) where: Base-Base interactions energy: -30.514 where: short stacking energy: -23.127 Base-Backbone interact. energy: -0.243 local terms energy: -42.956655 where: bonds (distance) C4'-P energy: -13.117 bonds (distance) P-C4' energy: -16.340 flat angles C4'-P-C4' energy: -5.949 flat angles P-C4'-P energy: -8.776 tors. eta vs tors. theta energy: 1.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -75.549578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.549578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.549578 (E_RNA) where: Base-Base interactions energy: -24.159 where: short stacking energy: -21.822 Base-Backbone interact. energy: -0.034 local terms energy: -51.356282 where: bonds (distance) C4'-P energy: -15.704 bonds (distance) P-C4' energy: -14.856 flat angles C4'-P-C4' energy: -11.814 flat angles P-C4'-P energy: -6.499 tors. eta vs tors. theta energy: -2.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -215.449205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.449205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.449205 (E_RNA) where: Base-Base interactions energy: -148.337 where: short stacking energy: -62.065 Base-Backbone interact. energy: -0.050 local terms energy: -67.061629 where: bonds (distance) C4'-P energy: -12.220 bonds (distance) P-C4' energy: -13.017 flat angles C4'-P-C4' energy: -16.102 flat angles P-C4'-P energy: -9.148 tors. eta vs tors. theta energy: -16.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -204.897096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.897096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.897096 (E_RNA) where: Base-Base interactions energy: -137.995 where: short stacking energy: -57.610 Base-Backbone interact. energy: -0.002 local terms energy: -66.899492 where: bonds (distance) C4'-P energy: -17.994 bonds (distance) P-C4' energy: -15.666 flat angles C4'-P-C4' energy: -13.494 flat angles P-C4'-P energy: -6.621 tors. eta vs tors. theta energy: -13.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -202.964665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.964665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.964665 (E_RNA) where: Base-Base interactions energy: -141.397 where: short stacking energy: -55.714 Base-Backbone interact. energy: -1.637 local terms energy: -59.930455 where: bonds (distance) C4'-P energy: -14.653 bonds (distance) P-C4' energy: -12.725 flat angles C4'-P-C4' energy: -14.887 flat angles P-C4'-P energy: -2.852 tors. eta vs tors. theta energy: -14.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -169.284385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.284385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.284385 (E_RNA) where: Base-Base interactions energy: -113.405 where: short stacking energy: -44.258 Base-Backbone interact. energy: -0.389 local terms energy: -55.490555 where: bonds (distance) C4'-P energy: -11.653 bonds (distance) P-C4' energy: -12.052 flat angles C4'-P-C4' energy: -11.877 flat angles P-C4'-P energy: -10.094 tors. eta vs tors. theta energy: -9.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -168.348946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.348946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.348946 (E_RNA) where: Base-Base interactions energy: -92.983 where: short stacking energy: -49.397 Base-Backbone interact. energy: -0.009 local terms energy: -75.356604 where: bonds (distance) C4'-P energy: -15.772 bonds (distance) P-C4' energy: -17.559 flat angles C4'-P-C4' energy: -17.358 flat angles P-C4'-P energy: -8.650 tors. eta vs tors. theta energy: -16.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -142.534669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.534669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.534669 (E_RNA) where: Base-Base interactions energy: -87.121 where: short stacking energy: -39.602 Base-Backbone interact. energy: -0.572 local terms energy: -54.841369 where: bonds (distance) C4'-P energy: -11.316 bonds (distance) P-C4' energy: -17.523 flat angles C4'-P-C4' energy: -11.609 flat angles P-C4'-P energy: -8.630 tors. eta vs tors. theta energy: -5.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -114.616799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.616799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.616799 (E_RNA) where: Base-Base interactions energy: -61.200 where: short stacking energy: -28.535 Base-Backbone interact. energy: 0.940 local terms energy: -54.356684 where: bonds (distance) C4'-P energy: -4.205 bonds (distance) P-C4' energy: -17.936 flat angles C4'-P-C4' energy: -15.932 flat angles P-C4'-P energy: -10.005 tors. eta vs tors. theta energy: -6.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -79.890500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.890500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.890500 (E_RNA) where: Base-Base interactions energy: -33.690 where: short stacking energy: -32.368 Base-Backbone interact. energy: -0.321 local terms energy: -45.879736 where: bonds (distance) C4'-P energy: -11.913 bonds (distance) P-C4' energy: -14.722 flat angles C4'-P-C4' energy: -7.427 flat angles P-C4'-P energy: -10.274 tors. eta vs tors. theta energy: -1.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -82.084818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.084818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.084818 (E_RNA) where: Base-Base interactions energy: -41.805 where: short stacking energy: -21.848 Base-Backbone interact. energy: -0.145 local terms energy: -40.134149 where: bonds (distance) C4'-P energy: -10.231 bonds (distance) P-C4' energy: -14.203 flat angles C4'-P-C4' energy: -7.834 flat angles P-C4'-P energy: -8.725 tors. eta vs tors. theta energy: 0.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -77.945288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.945288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.945288 (E_RNA) where: Base-Base interactions energy: -22.452 where: short stacking energy: -20.752 Base-Backbone interact. energy: -0.787 local terms energy: -54.706204 where: bonds (distance) C4'-P energy: -16.400 bonds (distance) P-C4' energy: -15.188 flat angles C4'-P-C4' energy: -13.344 flat angles P-C4'-P energy: -4.911 tors. eta vs tors. theta energy: -4.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -211.674253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.674253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.674253 (E_RNA) where: Base-Base interactions energy: -139.907 where: short stacking energy: -59.569 Base-Backbone interact. energy: 0.203 local terms energy: -71.970183 where: bonds (distance) C4'-P energy: -14.452 bonds (distance) P-C4' energy: -14.453 flat angles C4'-P-C4' energy: -15.924 flat angles P-C4'-P energy: -10.597 tors. eta vs tors. theta energy: -16.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -208.005901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.005901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.005901 (E_RNA) where: Base-Base interactions energy: -146.008 where: short stacking energy: -41.754 Base-Backbone interact. energy: -0.110 local terms energy: -61.887564 where: bonds (distance) C4'-P energy: -10.234 bonds (distance) P-C4' energy: -13.097 flat angles C4'-P-C4' energy: -14.717 flat angles P-C4'-P energy: -10.069 tors. eta vs tors. theta energy: -13.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -197.262961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.262961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.262961 (E_RNA) where: Base-Base interactions energy: -126.251 where: short stacking energy: -52.724 Base-Backbone interact. energy: -0.953 local terms energy: -70.059159 where: bonds (distance) C4'-P energy: -14.666 bonds (distance) P-C4' energy: -17.691 flat angles C4'-P-C4' energy: -15.371 flat angles P-C4'-P energy: -8.966 tors. eta vs tors. theta energy: -13.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -190.934747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.934747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.934747 (E_RNA) where: Base-Base interactions energy: -119.007 where: short stacking energy: -46.132 Base-Backbone interact. energy: -0.494 local terms energy: -71.433476 where: bonds (distance) C4'-P energy: -14.261 bonds (distance) P-C4' energy: -17.784 flat angles C4'-P-C4' energy: -17.112 flat angles P-C4'-P energy: -7.495 tors. eta vs tors. theta energy: -14.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -147.858910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.858910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.858910 (E_RNA) where: Base-Base interactions energy: -83.178 where: short stacking energy: -42.299 Base-Backbone interact. energy: -0.003 local terms energy: -64.677709 where: bonds (distance) C4'-P energy: -10.033 bonds (distance) P-C4' energy: -15.100 flat angles C4'-P-C4' energy: -17.487 flat angles P-C4'-P energy: -8.455 tors. eta vs tors. theta energy: -13.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -134.158978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.158978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.158978 (E_RNA) where: Base-Base interactions energy: -73.913 where: short stacking energy: -38.289 Base-Backbone interact. energy: -0.065 local terms energy: -60.181686 where: bonds (distance) C4'-P energy: -13.320 bonds (distance) P-C4' energy: -14.972 flat angles C4'-P-C4' energy: -12.518 flat angles P-C4'-P energy: -10.354 tors. eta vs tors. theta energy: -9.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -86.133772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.133772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.133772 (E_RNA) where: Base-Base interactions energy: -41.944 where: short stacking energy: -31.443 Base-Backbone interact. energy: -0.261 local terms energy: -43.928945 where: bonds (distance) C4'-P energy: -8.261 bonds (distance) P-C4' energy: -15.384 flat angles C4'-P-C4' energy: -11.397 flat angles P-C4'-P energy: -3.874 tors. eta vs tors. theta energy: -5.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -98.321098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.321098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.321098 (E_RNA) where: Base-Base interactions energy: -53.369 where: short stacking energy: -27.300 Base-Backbone interact. energy: 0.380 local terms energy: -45.332364 where: bonds (distance) C4'-P energy: -14.363 bonds (distance) P-C4' energy: -13.489 flat angles C4'-P-C4' energy: -5.951 flat angles P-C4'-P energy: -8.030 tors. eta vs tors. theta energy: -3.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -78.383853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.383853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.383853 (E_RNA) where: Base-Base interactions energy: -26.204 where: short stacking energy: -25.007 Base-Backbone interact. energy: -0.129 local terms energy: -52.051464 where: bonds (distance) C4'-P energy: -15.693 bonds (distance) P-C4' energy: -15.375 flat angles C4'-P-C4' energy: -12.012 flat angles P-C4'-P energy: -7.833 tors. eta vs tors. theta energy: -1.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -74.558369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.558369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.558369 (E_RNA) where: Base-Base interactions energy: -28.102 where: short stacking energy: -23.302 Base-Backbone interact. energy: -0.377 local terms energy: -46.079923 where: bonds (distance) C4'-P energy: -11.134 bonds (distance) P-C4' energy: -16.295 flat angles C4'-P-C4' energy: -10.207 flat angles P-C4'-P energy: -8.925 tors. eta vs tors. theta energy: 0.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -211.782851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.782851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.782851 (E_RNA) where: Base-Base interactions energy: -146.115 where: short stacking energy: -59.549 Base-Backbone interact. energy: 1.312 local terms energy: -66.979471 where: bonds (distance) C4'-P energy: -14.448 bonds (distance) P-C4' energy: -12.626 flat angles C4'-P-C4' energy: -15.502 flat angles P-C4'-P energy: -6.601 tors. eta vs tors. theta energy: -17.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -215.677253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.677253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.677253 (E_RNA) where: Base-Base interactions energy: -139.096 where: short stacking energy: -56.288 Base-Backbone interact. energy: -1.513 local terms energy: -75.068245 where: bonds (distance) C4'-P energy: -18.094 bonds (distance) P-C4' energy: -15.806 flat angles C4'-P-C4' energy: -13.282 flat angles P-C4'-P energy: -7.492 tors. eta vs tors. theta energy: -20.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -202.562333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.562333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.562333 (E_RNA) where: Base-Base interactions energy: -129.725 where: short stacking energy: -51.971 Base-Backbone interact. energy: -1.736 local terms energy: -71.102285 where: bonds (distance) C4'-P energy: -17.916 bonds (distance) P-C4' energy: -12.067 flat angles C4'-P-C4' energy: -14.458 flat angles P-C4'-P energy: -11.047 tors. eta vs tors. theta energy: -15.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -198.122045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.122045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.122045 (E_RNA) where: Base-Base interactions energy: -120.113 where: short stacking energy: -51.478 Base-Backbone interact. energy: -0.014 local terms energy: -77.995581 where: bonds (distance) C4'-P energy: -16.429 bonds (distance) P-C4' energy: -16.181 flat angles C4'-P-C4' energy: -17.635 flat angles P-C4'-P energy: -8.592 tors. eta vs tors. theta energy: -19.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -159.154704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.154704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.154704 (E_RNA) where: Base-Base interactions energy: -98.370 where: short stacking energy: -52.205 Base-Backbone interact. energy: -0.245 local terms energy: -60.540137 where: bonds (distance) C4'-P energy: -14.636 bonds (distance) P-C4' energy: -12.988 flat angles C4'-P-C4' energy: -13.914 flat angles P-C4'-P energy: -8.803 tors. eta vs tors. theta energy: -10.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -122.248902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.248902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.248902 (E_RNA) where: Base-Base interactions energy: -59.446 where: short stacking energy: -26.678 Base-Backbone interact. energy: -0.359 local terms energy: -62.443585 where: bonds (distance) C4'-P energy: -15.820 bonds (distance) P-C4' energy: -14.205 flat angles C4'-P-C4' energy: -13.070 flat angles P-C4'-P energy: -7.512 tors. eta vs tors. theta energy: -11.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -87.647239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.647239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.647239 (E_RNA) where: Base-Base interactions energy: -39.240 where: short stacking energy: -26.997 Base-Backbone interact. energy: -0.006 local terms energy: -48.400952 where: bonds (distance) C4'-P energy: -11.796 bonds (distance) P-C4' energy: -15.860 flat angles C4'-P-C4' energy: -10.094 flat angles P-C4'-P energy: -5.957 tors. eta vs tors. theta energy: -4.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -76.913916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.913916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.913916 (E_RNA) where: Base-Base interactions energy: -27.394 where: short stacking energy: -27.394 Base-Backbone interact. energy: -0.224 local terms energy: -49.295724 where: bonds (distance) C4'-P energy: -14.823 bonds (distance) P-C4' energy: -14.516 flat angles C4'-P-C4' energy: -14.319 flat angles P-C4'-P energy: -6.382 tors. eta vs tors. theta energy: 0.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -85.501744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.501744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.501744 (E_RNA) where: Base-Base interactions energy: -38.889 where: short stacking energy: -22.815 Base-Backbone interact. energy: -0.139 local terms energy: -46.473754 where: bonds (distance) C4'-P energy: -12.570 bonds (distance) P-C4' energy: -17.330 flat angles C4'-P-C4' energy: -7.022 flat angles P-C4'-P energy: -11.451 tors. eta vs tors. theta energy: 1.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -79.836584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.836584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.836584 (E_RNA) where: Base-Base interactions energy: -37.754 where: short stacking energy: -22.186 Base-Backbone interact. energy: -0.535 local terms energy: -41.547998 where: bonds (distance) C4'-P energy: -11.627 bonds (distance) P-C4' energy: -14.558 flat angles C4'-P-C4' energy: -8.996 flat angles P-C4'-P energy: -6.125 tors. eta vs tors. theta energy: -0.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -203.347488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.347488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.347488 (E_RNA) where: Base-Base interactions energy: -138.510 where: short stacking energy: -57.418 Base-Backbone interact. energy: -0.013 local terms energy: -64.824995 where: bonds (distance) C4'-P energy: -13.205 bonds (distance) P-C4' energy: -14.209 flat angles C4'-P-C4' energy: -16.234 flat angles P-C4'-P energy: -7.324 tors. eta vs tors. theta energy: -13.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -216.828345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.828345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.828345 (E_RNA) where: Base-Base interactions energy: -140.049 where: short stacking energy: -56.784 Base-Backbone interact. energy: -1.901 local terms energy: -74.877457 where: bonds (distance) C4'-P energy: -14.587 bonds (distance) P-C4' energy: -18.007 flat angles C4'-P-C4' energy: -15.588 flat angles P-C4'-P energy: -10.821 tors. eta vs tors. theta energy: -15.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -199.160071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.160071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.160071 (E_RNA) where: Base-Base interactions energy: -129.629 where: short stacking energy: -47.225 Base-Backbone interact. energy: -0.069 local terms energy: -69.461639 where: bonds (distance) C4'-P energy: -14.465 bonds (distance) P-C4' energy: -15.106 flat angles C4'-P-C4' energy: -14.527 flat angles P-C4'-P energy: -9.528 tors. eta vs tors. theta energy: -15.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -180.526470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.526470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.526470 (E_RNA) where: Base-Base interactions energy: -120.831 where: short stacking energy: -48.694 Base-Backbone interact. energy: -0.177 local terms energy: -59.518866 where: bonds (distance) C4'-P energy: -17.133 bonds (distance) P-C4' energy: -12.320 flat angles C4'-P-C4' energy: -14.039 flat angles P-C4'-P energy: -6.265 tors. eta vs tors. theta energy: -9.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -167.158373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.158373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.158373 (E_RNA) where: Base-Base interactions energy: -107.062 where: short stacking energy: -45.451 Base-Backbone interact. energy: 0.579 local terms energy: -60.675232 where: bonds (distance) C4'-P energy: -15.344 bonds (distance) P-C4' energy: -14.668 flat angles C4'-P-C4' energy: -11.108 flat angles P-C4'-P energy: -5.662 tors. eta vs tors. theta energy: -13.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -114.715326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.715326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.715326 (E_RNA) where: Base-Base interactions energy: -65.224 where: short stacking energy: -33.144 Base-Backbone interact. energy: -0.842 local terms energy: -48.650103 where: bonds (distance) C4'-P energy: -13.100 bonds (distance) P-C4' energy: -13.831 flat angles C4'-P-C4' energy: -11.550 flat angles P-C4'-P energy: -8.699 tors. eta vs tors. theta energy: -1.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -127.185882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.185882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.185882 (E_RNA) where: Base-Base interactions energy: -72.142 where: short stacking energy: -43.475 Base-Backbone interact. energy: -0.264 local terms energy: -54.780032 where: bonds (distance) C4'-P energy: -11.448 bonds (distance) P-C4' energy: -9.162 flat angles C4'-P-C4' energy: -15.384 flat angles P-C4'-P energy: -8.015 tors. eta vs tors. theta energy: -10.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -84.013328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.013328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.013328 (E_RNA) where: Base-Base interactions energy: -28.599 where: short stacking energy: -28.599 Base-Backbone interact. energy: 0.782 local terms energy: -56.196213 where: bonds (distance) C4'-P energy: -12.914 bonds (distance) P-C4' energy: -16.622 flat angles C4'-P-C4' energy: -15.209 flat angles P-C4'-P energy: -7.866 tors. eta vs tors. theta energy: -3.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -72.039008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.039008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.039008 (E_RNA) where: Base-Base interactions energy: -19.787 where: short stacking energy: -18.088 Base-Backbone interact. energy: -0.404 local terms energy: -51.847831 where: bonds (distance) C4'-P energy: -12.972 bonds (distance) P-C4' energy: -13.430 flat angles C4'-P-C4' energy: -16.743 flat angles P-C4'-P energy: -6.875 tors. eta vs tors. theta energy: -1.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -80.090177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.090177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.090177 (E_RNA) where: Base-Base interactions energy: -23.559 where: short stacking energy: -18.559 Base-Backbone interact. energy: -0.202 local terms energy: -56.328303 where: bonds (distance) C4'-P energy: -13.978 bonds (distance) P-C4' energy: -14.727 flat angles C4'-P-C4' energy: -15.330 flat angles P-C4'-P energy: -10.295 tors. eta vs tors. theta energy: -1.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 1 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 2555095 moves confirmed later: 2936220 all moves confirmed: 5491315 percent of confirmed moves: 3.432072 current total energy: -197.536699 recalc. total energy: -197.536699 replica 10 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 2790707 moves confirmed later: 3247461 all moves confirmed: 6038168 percent of confirmed moves: 3.773855 current total energy: -175.719135 recalc. total energy: -175.719135 replica 7 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 3096814 moves confirmed later: 3653623 all moves confirmed: 6750437 percent of confirmed moves: 4.219023 current total energy: -137.348543 recalc. total energy: -137.348543 replica 9 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 2603468 moves confirmed later: 3003790 all moves confirmed: 5607258 percent of confirmed moves: 3.504536 current total energy: -156.351745 recalc. total energy: -156.351745 replica 2 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 4392074 moves confirmed later: 5317610 all moves confirmed: 9709684 percent of confirmed moves: 6.068553 current total energy: -80.889821 recalc. total energy: -80.889821 replica 3 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 3803598 moves confirmed later: 4530985 all moves confirmed: 8334583 percent of confirmed moves: 5.209114 current total energy: -137.177016 recalc. total energy: -137.177016 replica 4 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 4864166 moves confirmed later: 5983254 all moves confirmed: 10847420 percent of confirmed moves: 6.779637 current total energy: -88.336847 recalc. total energy: -88.336847 replica 6 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 4785945 moves confirmed later: 5889991 all moves confirmed: 10675936 percent of confirmed moves: 6.672460 current total energy: -32.554466 recalc. total energy: -32.554466 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 4819687 moves confirmed later: 5908636 all moves confirmed: 10728323 percent of confirmed moves: 6.705202 current total energy: -23.218805 recalc. total energy: -23.218805 replica 5 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 4748548 moves confirmed later: 5818035 all moves confirmed: 10566583 percent of confirmed moves: 6.604114 current total energy: -33.128061 recalc. total energy: -33.128061 out arg RESULTS//1/Tetraloop_10_steps-86350510_01 Time of doing 1600000 iterations: 422.458 seconds