SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-77393f2a/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -282.900789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.900789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.900789 (E_RNA) where: Base-Base interactions energy: -10.155 where: short stacking energy: -10.155 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -386.858577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.858577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.858577 (E_RNA) where: Base-Base interactions energy: -171.706 where: short stacking energy: -169.786 Base-Backbone interact. energy: -0.212 local terms energy: -214.941268 where: bonds (distance) C4'-P energy: -50.599 bonds (distance) P-C4' energy: -46.939 flat angles C4'-P-C4' energy: -48.202 flat angles P-C4'-P energy: -29.667 tors. eta vs tors. theta energy: -39.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -392.016384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.016384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.016384 (E_RNA) where: Base-Base interactions energy: -189.128 where: short stacking energy: -174.785 Base-Backbone interact. energy: 0.113 local terms energy: -203.001230 where: bonds (distance) C4'-P energy: -39.805 bonds (distance) P-C4' energy: -44.981 flat angles C4'-P-C4' energy: -48.973 flat angles P-C4'-P energy: -28.979 tors. eta vs tors. theta energy: -40.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -375.150196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.150196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.150196 (E_RNA) where: Base-Base interactions energy: -180.813 where: short stacking energy: -166.416 Base-Backbone interact. energy: -0.060 local terms energy: -194.277479 where: bonds (distance) C4'-P energy: -39.226 bonds (distance) P-C4' energy: -38.953 flat angles C4'-P-C4' energy: -52.115 flat angles P-C4'-P energy: -27.604 tors. eta vs tors. theta energy: -36.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -325.560766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.560766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.560766 (E_RNA) where: Base-Base interactions energy: -140.218 where: short stacking energy: -140.952 Base-Backbone interact. energy: 0.079 local terms energy: -185.422146 where: bonds (distance) C4'-P energy: -42.907 bonds (distance) P-C4' energy: -39.817 flat angles C4'-P-C4' energy: -48.412 flat angles P-C4'-P energy: -21.682 tors. eta vs tors. theta energy: -32.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -316.469198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.469198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.469198 (E_RNA) where: Base-Base interactions energy: -131.302 where: short stacking energy: -131.302 Base-Backbone interact. energy: -0.183 local terms energy: -184.983969 where: bonds (distance) C4'-P energy: -48.112 bonds (distance) P-C4' energy: -53.551 flat angles C4'-P-C4' energy: -37.205 flat angles P-C4'-P energy: -14.936 tors. eta vs tors. theta energy: -31.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -283.814521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.814521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.814521 (E_RNA) where: Base-Base interactions energy: -14.047 where: short stacking energy: -14.047 Base-Backbone interact. energy: -0.000 local terms energy: -269.767070 where: bonds (distance) C4'-P energy: -66.690 bonds (distance) P-C4' energy: -63.252 flat angles C4'-P-C4' energy: -50.083 flat angles P-C4'-P energy: -58.595 tors. eta vs tors. theta energy: -31.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -283.321320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.321320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.321320 (E_RNA) where: Base-Base interactions energy: -12.926 where: short stacking energy: -12.926 Base-Backbone interact. energy: -0.000 local terms energy: -270.395380 where: bonds (distance) C4'-P energy: -66.806 bonds (distance) P-C4' energy: -63.259 flat angles C4'-P-C4' energy: -50.668 flat angles P-C4'-P energy: -58.669 tors. eta vs tors. theta energy: -30.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -283.880658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.880658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.880658 (E_RNA) where: Base-Base interactions energy: -16.378 where: short stacking energy: -16.378 Base-Backbone interact. energy: -0.000 local terms energy: -267.502190 where: bonds (distance) C4'-P energy: -64.479 bonds (distance) P-C4' energy: -62.759 flat angles C4'-P-C4' energy: -50.917 flat angles P-C4'-P energy: -58.561 tors. eta vs tors. theta energy: -30.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -283.272987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.272987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.272987 (E_RNA) where: Base-Base interactions energy: -16.179 where: short stacking energy: -16.179 Base-Backbone interact. energy: -0.000 local terms energy: -267.093709 where: bonds (distance) C4'-P energy: -64.479 bonds (distance) P-C4' energy: -62.759 flat angles C4'-P-C4' energy: -50.593 flat angles P-C4'-P energy: -58.476 tors. eta vs tors. theta energy: -30.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -284.036107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.036107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.036107 (E_RNA) where: Base-Base interactions energy: -15.412 where: short stacking energy: -15.412 Base-Backbone interact. energy: -0.000 local terms energy: -268.624351 where: bonds (distance) C4'-P energy: -65.957 bonds (distance) P-C4' energy: -63.252 flat angles C4'-P-C4' energy: -49.760 flat angles P-C4'-P energy: -58.632 tors. eta vs tors. theta energy: -31.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -443.828835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.828835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.828835 (E_RNA) where: Base-Base interactions energy: -226.840 where: short stacking energy: -174.859 Base-Backbone interact. energy: 0.883 local terms energy: -217.871033 where: bonds (distance) C4'-P energy: -49.174 bonds (distance) P-C4' energy: -51.537 flat angles C4'-P-C4' energy: -45.437 flat angles P-C4'-P energy: -29.636 tors. eta vs tors. theta energy: -42.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -431.043295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.043295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.043295 (E_RNA) where: Base-Base interactions energy: -229.826 where: short stacking energy: -163.549 Base-Backbone interact. energy: -0.624 local terms energy: -200.593915 where: bonds (distance) C4'-P energy: -48.165 bonds (distance) P-C4' energy: -47.706 flat angles C4'-P-C4' energy: -43.398 flat angles P-C4'-P energy: -31.102 tors. eta vs tors. theta energy: -30.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -399.009523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.009523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.009523 (E_RNA) where: Base-Base interactions energy: -197.328 where: short stacking energy: -164.626 Base-Backbone interact. energy: -1.769 local terms energy: -199.913191 where: bonds (distance) C4'-P energy: -43.401 bonds (distance) P-C4' energy: -43.246 flat angles C4'-P-C4' energy: -46.014 flat angles P-C4'-P energy: -31.636 tors. eta vs tors. theta energy: -35.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -330.072963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.072963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.072963 (E_RNA) where: Base-Base interactions energy: -153.179 where: short stacking energy: -124.276 Base-Backbone interact. energy: -0.610 local terms energy: -176.283559 where: bonds (distance) C4'-P energy: -42.102 bonds (distance) P-C4' energy: -48.428 flat angles C4'-P-C4' energy: -39.317 flat angles P-C4'-P energy: -19.945 tors. eta vs tors. theta energy: -26.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -407.404977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.404977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.404977 (E_RNA) where: Base-Base interactions energy: -234.711 where: short stacking energy: -132.269 Base-Backbone interact. energy: -0.540 local terms energy: -172.153473 where: bonds (distance) C4'-P energy: -39.331 bonds (distance) P-C4' energy: -35.167 flat angles C4'-P-C4' energy: -43.052 flat angles P-C4'-P energy: -26.082 tors. eta vs tors. theta energy: -28.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -286.159277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.159277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.159277 (E_RNA) where: Base-Base interactions energy: -137.963 where: short stacking energy: -91.096 Base-Backbone interact. energy: -0.502 local terms energy: -147.694164 where: bonds (distance) C4'-P energy: -33.503 bonds (distance) P-C4' energy: -37.747 flat angles C4'-P-C4' energy: -38.308 flat angles P-C4'-P energy: -25.431 tors. eta vs tors. theta energy: -12.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -263.397229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.397229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.397229 (E_RNA) where: Base-Base interactions energy: -109.519 where: short stacking energy: -81.987 Base-Backbone interact. energy: -0.239 local terms energy: -153.639861 where: bonds (distance) C4'-P energy: -39.708 bonds (distance) P-C4' energy: -38.212 flat angles C4'-P-C4' energy: -42.901 flat angles P-C4'-P energy: -32.289 tors. eta vs tors. theta energy: -0.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -278.758564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.758564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.758564 (E_RNA) where: Base-Base interactions energy: -144.949 where: short stacking energy: -96.491 Base-Backbone interact. energy: -0.861 local terms energy: -132.948353 where: bonds (distance) C4'-P energy: -39.294 bonds (distance) P-C4' energy: -39.974 flat angles C4'-P-C4' energy: -38.827 flat angles P-C4'-P energy: -9.772 tors. eta vs tors. theta energy: -5.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -317.566822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.566822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.566822 (E_RNA) where: Base-Base interactions energy: -157.824 where: short stacking energy: -91.760 Base-Backbone interact. energy: -0.623 local terms energy: -159.120086 where: bonds (distance) C4'-P energy: -35.735 bonds (distance) P-C4' energy: -41.507 flat angles C4'-P-C4' energy: -43.855 flat angles P-C4'-P energy: -26.009 tors. eta vs tors. theta energy: -12.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -211.172287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.172287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.172287 (E_RNA) where: Base-Base interactions energy: -98.600 where: short stacking energy: -66.222 Base-Backbone interact. energy: 2.596 local terms energy: -115.168004 where: bonds (distance) C4'-P energy: -34.517 bonds (distance) P-C4' energy: -40.958 flat angles C4'-P-C4' energy: -32.568 flat angles P-C4'-P energy: -17.341 tors. eta vs tors. theta energy: 10.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -484.242950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.242950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.242950 (E_RNA) where: Base-Base interactions energy: -260.493 where: short stacking energy: -172.829 Base-Backbone interact. energy: -0.316 local terms energy: -223.434471 where: bonds (distance) C4'-P energy: -43.074 bonds (distance) P-C4' energy: -53.505 flat angles C4'-P-C4' energy: -47.867 flat angles P-C4'-P energy: -37.284 tors. eta vs tors. theta energy: -41.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -456.030662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.030662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.030662 (E_RNA) where: Base-Base interactions energy: -235.060 where: short stacking energy: -183.676 Base-Backbone interact. energy: -1.234 local terms energy: -219.736177 where: bonds (distance) C4'-P energy: -50.161 bonds (distance) P-C4' energy: -48.864 flat angles C4'-P-C4' energy: -50.324 flat angles P-C4'-P energy: -33.223 tors. eta vs tors. theta energy: -37.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -432.403960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.403960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.403960 (E_RNA) where: Base-Base interactions energy: -240.246 where: short stacking energy: -177.240 Base-Backbone interact. energy: -1.020 local terms energy: -191.137415 where: bonds (distance) C4'-P energy: -43.341 bonds (distance) P-C4' energy: -44.852 flat angles C4'-P-C4' energy: -41.376 flat angles P-C4'-P energy: -21.369 tors. eta vs tors. theta energy: -40.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -399.133329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.133329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.133329 (E_RNA) where: Base-Base interactions energy: -218.882 where: short stacking energy: -135.512 Base-Backbone interact. energy: -1.315 local terms energy: -178.935987 where: bonds (distance) C4'-P energy: -46.162 bonds (distance) P-C4' energy: -46.798 flat angles C4'-P-C4' energy: -36.132 flat angles P-C4'-P energy: -26.385 tors. eta vs tors. theta energy: -23.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -437.233698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.233698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.233698 (E_RNA) where: Base-Base interactions energy: -260.648 where: short stacking energy: -136.580 Base-Backbone interact. energy: 1.256 local terms energy: -177.841918 where: bonds (distance) C4'-P energy: -41.732 bonds (distance) P-C4' energy: -43.832 flat angles C4'-P-C4' energy: -39.427 flat angles P-C4'-P energy: -27.346 tors. eta vs tors. theta energy: -25.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -262.288779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.288779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.288779 (E_RNA) where: Base-Base interactions energy: -108.564 where: short stacking energy: -101.596 Base-Backbone interact. energy: -3.551 local terms energy: -150.173753 where: bonds (distance) C4'-P energy: -45.867 bonds (distance) P-C4' energy: -49.451 flat angles C4'-P-C4' energy: -35.873 flat angles P-C4'-P energy: -23.587 tors. eta vs tors. theta energy: 4.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -317.626053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.626053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.626053 (E_RNA) where: Base-Base interactions energy: -179.441 where: short stacking energy: -89.721 Base-Backbone interact. energy: 3.606 local terms energy: -141.791198 where: bonds (distance) C4'-P energy: -40.830 bonds (distance) P-C4' energy: -41.456 flat angles C4'-P-C4' energy: -36.476 flat angles P-C4'-P energy: -17.679 tors. eta vs tors. theta energy: -5.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -233.512094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.512094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.512094 (E_RNA) where: Base-Base interactions energy: -102.828 where: short stacking energy: -78.845 Base-Backbone interact. energy: -0.149 local terms energy: -130.534777 where: bonds (distance) C4'-P energy: -33.643 bonds (distance) P-C4' energy: -41.108 flat angles C4'-P-C4' energy: -31.536 flat angles P-C4'-P energy: -20.944 tors. eta vs tors. theta energy: -3.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -293.827431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.827431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.827431 (E_RNA) where: Base-Base interactions energy: -145.976 where: short stacking energy: -94.484 Base-Backbone interact. energy: -0.196 local terms energy: -147.655069 where: bonds (distance) C4'-P energy: -44.503 bonds (distance) P-C4' energy: -34.413 flat angles C4'-P-C4' energy: -32.416 flat angles P-C4'-P energy: -18.314 tors. eta vs tors. theta energy: -18.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -208.506903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.506903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.506903 (E_RNA) where: Base-Base interactions energy: -74.342 where: short stacking energy: -56.963 Base-Backbone interact. energy: -1.061 local terms energy: -133.104293 where: bonds (distance) C4'-P energy: -39.657 bonds (distance) P-C4' energy: -46.888 flat angles C4'-P-C4' energy: -31.198 flat angles P-C4'-P energy: -20.408 tors. eta vs tors. theta energy: 5.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -491.948552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.948552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.948552 (E_RNA) where: Base-Base interactions energy: -260.786 where: short stacking energy: -176.637 Base-Backbone interact. energy: -0.210 local terms energy: -230.952507 where: bonds (distance) C4'-P energy: -50.008 bonds (distance) P-C4' energy: -50.717 flat angles C4'-P-C4' energy: -47.366 flat angles P-C4'-P energy: -37.082 tors. eta vs tors. theta energy: -45.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -480.419827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.419827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.419827 (E_RNA) where: Base-Base interactions energy: -280.835 where: short stacking energy: -159.520 Base-Backbone interact. energy: -2.307 local terms energy: -197.277919 where: bonds (distance) C4'-P energy: -39.465 bonds (distance) P-C4' energy: -48.588 flat angles C4'-P-C4' energy: -55.149 flat angles P-C4'-P energy: -27.063 tors. eta vs tors. theta energy: -27.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -499.948567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.948567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.948567 (E_RNA) where: Base-Base interactions energy: -286.647 where: short stacking energy: -172.983 Base-Backbone interact. energy: -0.824 local terms energy: -212.476835 where: bonds (distance) C4'-P energy: -45.800 bonds (distance) P-C4' energy: -42.781 flat angles C4'-P-C4' energy: -43.667 flat angles P-C4'-P energy: -33.058 tors. eta vs tors. theta energy: -47.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -448.711726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.711726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.711726 (E_RNA) where: Base-Base interactions energy: -259.071 where: short stacking energy: -139.157 Base-Backbone interact. energy: -0.412 local terms energy: -189.228912 where: bonds (distance) C4'-P energy: -39.050 bonds (distance) P-C4' energy: -45.445 flat angles C4'-P-C4' energy: -35.213 flat angles P-C4'-P energy: -35.009 tors. eta vs tors. theta energy: -34.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -423.406756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.406756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.406756 (E_RNA) where: Base-Base interactions energy: -284.069 where: short stacking energy: -126.988 Base-Backbone interact. energy: 2.080 local terms energy: -141.418260 where: bonds (distance) C4'-P energy: -37.570 bonds (distance) P-C4' energy: -38.160 flat angles C4'-P-C4' energy: -33.060 flat angles P-C4'-P energy: -14.449 tors. eta vs tors. theta energy: -18.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -367.081639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.081639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.081639 (E_RNA) where: Base-Base interactions energy: -206.659 where: short stacking energy: -121.987 Base-Backbone interact. energy: -0.890 local terms energy: -159.532728 where: bonds (distance) C4'-P energy: -40.483 bonds (distance) P-C4' energy: -41.445 flat angles C4'-P-C4' energy: -39.484 flat angles P-C4'-P energy: -23.035 tors. eta vs tors. theta energy: -15.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -297.989159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.989159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.989159 (E_RNA) where: Base-Base interactions energy: -130.535 where: short stacking energy: -81.497 Base-Backbone interact. energy: 0.132 local terms energy: -167.586105 where: bonds (distance) C4'-P energy: -44.027 bonds (distance) P-C4' energy: -38.766 flat angles C4'-P-C4' energy: -46.155 flat angles P-C4'-P energy: -19.794 tors. eta vs tors. theta energy: -18.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -316.490763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.490763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.490763 (E_RNA) where: Base-Base interactions energy: -165.390 where: short stacking energy: -92.449 Base-Backbone interact. energy: -1.124 local terms energy: -149.976864 where: bonds (distance) C4'-P energy: -38.841 bonds (distance) P-C4' energy: -36.895 flat angles C4'-P-C4' energy: -43.061 flat angles P-C4'-P energy: -25.463 tors. eta vs tors. theta energy: -5.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -273.600167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.600167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.600167 (E_RNA) where: Base-Base interactions energy: -132.637 where: short stacking energy: -83.272 Base-Backbone interact. energy: -1.049 local terms energy: -139.914843 where: bonds (distance) C4'-P energy: -41.739 bonds (distance) P-C4' energy: -35.296 flat angles C4'-P-C4' energy: -42.379 flat angles P-C4'-P energy: -17.063 tors. eta vs tors. theta energy: -3.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -216.084548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.084548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.084548 (E_RNA) where: Base-Base interactions energy: -94.455 where: short stacking energy: -64.996 Base-Backbone interact. energy: -0.002 local terms energy: -121.627683 where: bonds (distance) C4'-P energy: -30.812 bonds (distance) P-C4' energy: -37.562 flat angles C4'-P-C4' energy: -36.411 flat angles P-C4'-P energy: -17.997 tors. eta vs tors. theta energy: 1.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -528.536264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.536264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.536264 (E_RNA) where: Base-Base interactions energy: -331.661 where: short stacking energy: -171.776 Base-Backbone interact. energy: -1.655 local terms energy: -195.219961 where: bonds (distance) C4'-P energy: -41.564 bonds (distance) P-C4' energy: -46.305 flat angles C4'-P-C4' energy: -42.909 flat angles P-C4'-P energy: -30.412 tors. eta vs tors. theta energy: -34.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -470.804442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.804442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.804442 (E_RNA) where: Base-Base interactions energy: -257.832 where: short stacking energy: -170.454 Base-Backbone interact. energy: 0.481 local terms energy: -213.453116 where: bonds (distance) C4'-P energy: -45.808 bonds (distance) P-C4' energy: -50.674 flat angles C4'-P-C4' energy: -44.785 flat angles P-C4'-P energy: -34.716 tors. eta vs tors. theta energy: -37.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -464.266028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.266028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.266028 (E_RNA) where: Base-Base interactions energy: -273.687 where: short stacking energy: -169.613 Base-Backbone interact. energy: -0.765 local terms energy: -189.814119 where: bonds (distance) C4'-P energy: -43.627 bonds (distance) P-C4' energy: -36.129 flat angles C4'-P-C4' energy: -46.220 flat angles P-C4'-P energy: -28.368 tors. eta vs tors. theta energy: -35.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -448.940492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.940492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.940492 (E_RNA) where: Base-Base interactions energy: -258.359 where: short stacking energy: -139.750 Base-Backbone interact. energy: -1.137 local terms energy: -189.445048 where: bonds (distance) C4'-P energy: -41.030 bonds (distance) P-C4' energy: -46.577 flat angles C4'-P-C4' energy: -42.700 flat angles P-C4'-P energy: -23.317 tors. eta vs tors. theta energy: -35.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -423.823332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.823332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.823332 (E_RNA) where: Base-Base interactions energy: -229.396 where: short stacking energy: -151.124 Base-Backbone interact. energy: -1.244 local terms energy: -193.182977 where: bonds (distance) C4'-P energy: -39.284 bonds (distance) P-C4' energy: -42.438 flat angles C4'-P-C4' energy: -46.903 flat angles P-C4'-P energy: -32.005 tors. eta vs tors. theta energy: -32.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -439.931377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.931377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.931377 (E_RNA) where: Base-Base interactions energy: -262.454 where: short stacking energy: -141.439 Base-Backbone interact. energy: -0.939 local terms energy: -176.538934 where: bonds (distance) C4'-P energy: -37.555 bonds (distance) P-C4' energy: -37.713 flat angles C4'-P-C4' energy: -42.378 flat angles P-C4'-P energy: -22.693 tors. eta vs tors. theta energy: -36.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -397.436321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.436321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.436321 (E_RNA) where: Base-Base interactions energy: -223.132 where: short stacking energy: -118.837 Base-Backbone interact. energy: 1.557 local terms energy: -175.861769 where: bonds (distance) C4'-P energy: -27.408 bonds (distance) P-C4' energy: -48.798 flat angles C4'-P-C4' energy: -46.961 flat angles P-C4'-P energy: -24.944 tors. eta vs tors. theta energy: -27.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -333.197422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.197422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.197422 (E_RNA) where: Base-Base interactions energy: -179.084 where: short stacking energy: -115.133 Base-Backbone interact. energy: -0.892 local terms energy: -153.221073 where: bonds (distance) C4'-P energy: -35.596 bonds (distance) P-C4' energy: -42.303 flat angles C4'-P-C4' energy: -42.385 flat angles P-C4'-P energy: -18.326 tors. eta vs tors. theta energy: -14.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -261.206972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.206972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.206972 (E_RNA) where: Base-Base interactions energy: -130.175 where: short stacking energy: -73.379 Base-Backbone interact. energy: 0.297 local terms energy: -131.329125 where: bonds (distance) C4'-P energy: -24.798 bonds (distance) P-C4' energy: -35.504 flat angles C4'-P-C4' energy: -42.318 flat angles P-C4'-P energy: -32.539 tors. eta vs tors. theta energy: 3.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -284.119875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.119875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.119875 (E_RNA) where: Base-Base interactions energy: -159.850 where: short stacking energy: -76.193 Base-Backbone interact. energy: -0.749 local terms energy: -123.520795 where: bonds (distance) C4'-P energy: -34.955 bonds (distance) P-C4' energy: -33.729 flat angles C4'-P-C4' energy: -35.599 flat angles P-C4'-P energy: -15.490 tors. eta vs tors. theta energy: -3.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -534.652090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.652090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.652090 (E_RNA) where: Base-Base interactions energy: -335.810 where: short stacking energy: -166.423 Base-Backbone interact. energy: 1.234 local terms energy: -200.076579 where: bonds (distance) C4'-P energy: -43.566 bonds (distance) P-C4' energy: -47.053 flat angles C4'-P-C4' energy: -49.911 flat angles P-C4'-P energy: -27.024 tors. eta vs tors. theta energy: -32.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -474.309608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.309608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.309608 (E_RNA) where: Base-Base interactions energy: -270.887 where: short stacking energy: -175.082 Base-Backbone interact. energy: -0.248 local terms energy: -203.174416 where: bonds (distance) C4'-P energy: -41.877 bonds (distance) P-C4' energy: -43.609 flat angles C4'-P-C4' energy: -52.317 flat angles P-C4'-P energy: -24.780 tors. eta vs tors. theta energy: -40.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -475.023747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.023747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.023747 (E_RNA) where: Base-Base interactions energy: -283.211 where: short stacking energy: -173.883 Base-Backbone interact. energy: -1.060 local terms energy: -190.752157 where: bonds (distance) C4'-P energy: -46.971 bonds (distance) P-C4' energy: -33.341 flat angles C4'-P-C4' energy: -47.626 flat angles P-C4'-P energy: -31.108 tors. eta vs tors. theta energy: -31.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -391.349662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.349662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.349662 (E_RNA) where: Base-Base interactions energy: -218.700 where: short stacking energy: -150.730 Base-Backbone interact. energy: -0.355 local terms energy: -172.295305 where: bonds (distance) C4'-P energy: -35.628 bonds (distance) P-C4' energy: -50.169 flat angles C4'-P-C4' energy: -42.758 flat angles P-C4'-P energy: -19.703 tors. eta vs tors. theta energy: -24.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -427.443568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.443568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.443568 (E_RNA) where: Base-Base interactions energy: -251.084 where: short stacking energy: -127.725 Base-Backbone interact. energy: -0.525 local terms energy: -175.834546 where: bonds (distance) C4'-P energy: -34.692 bonds (distance) P-C4' energy: -48.297 flat angles C4'-P-C4' energy: -40.937 flat angles P-C4'-P energy: -26.555 tors. eta vs tors. theta energy: -25.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -451.962054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.962054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.962054 (E_RNA) where: Base-Base interactions energy: -278.378 where: short stacking energy: -137.958 Base-Backbone interact. energy: -2.297 local terms energy: -171.286660 where: bonds (distance) C4'-P energy: -40.758 bonds (distance) P-C4' energy: -43.436 flat angles C4'-P-C4' energy: -44.722 flat angles P-C4'-P energy: -26.701 tors. eta vs tors. theta energy: -15.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -412.450209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.450209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.450209 (E_RNA) where: Base-Base interactions energy: -254.337 where: short stacking energy: -131.785 Base-Backbone interact. energy: 0.220 local terms energy: -158.332925 where: bonds (distance) C4'-P energy: -33.930 bonds (distance) P-C4' energy: -48.335 flat angles C4'-P-C4' energy: -31.338 flat angles P-C4'-P energy: -31.847 tors. eta vs tors. theta energy: -12.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -379.536189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.536189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.536189 (E_RNA) where: Base-Base interactions energy: -213.155 where: short stacking energy: -112.838 Base-Backbone interact. energy: 1.318 local terms energy: -167.699287 where: bonds (distance) C4'-P energy: -46.646 bonds (distance) P-C4' energy: -47.883 flat angles C4'-P-C4' energy: -45.071 flat angles P-C4'-P energy: -24.632 tors. eta vs tors. theta energy: -3.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -296.196155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.196155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.196155 (E_RNA) where: Base-Base interactions energy: -172.638 where: short stacking energy: -88.560 Base-Backbone interact. energy: -0.822 local terms energy: -122.736562 where: bonds (distance) C4'-P energy: -33.236 bonds (distance) P-C4' energy: -28.118 flat angles C4'-P-C4' energy: -34.546 flat angles P-C4'-P energy: -21.502 tors. eta vs tors. theta energy: -5.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -283.722275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.722275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.722275 (E_RNA) where: Base-Base interactions energy: -151.562 where: short stacking energy: -64.413 Base-Backbone interact. energy: 1.492 local terms energy: -133.652202 where: bonds (distance) C4'-P energy: -36.312 bonds (distance) P-C4' energy: -45.517 flat angles C4'-P-C4' energy: -35.384 flat angles P-C4'-P energy: -14.265 tors. eta vs tors. theta energy: -2.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -543.983661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.983661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.983661 (E_RNA) where: Base-Base interactions energy: -349.082 where: short stacking energy: -167.622 Base-Backbone interact. energy: -1.848 local terms energy: -193.054030 where: bonds (distance) C4'-P energy: -51.783 bonds (distance) P-C4' energy: -44.729 flat angles C4'-P-C4' energy: -44.852 flat angles P-C4'-P energy: -15.272 tors. eta vs tors. theta energy: -36.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -490.057816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.057816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.057816 (E_RNA) where: Base-Base interactions energy: -290.465 where: short stacking energy: -194.848 Base-Backbone interact. energy: -0.485 local terms energy: -199.108032 where: bonds (distance) C4'-P energy: -42.188 bonds (distance) P-C4' energy: -43.392 flat angles C4'-P-C4' energy: -44.802 flat angles P-C4'-P energy: -25.264 tors. eta vs tors. theta energy: -43.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -487.672196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.672196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.672196 (E_RNA) where: Base-Base interactions energy: -283.471 where: short stacking energy: -179.506 Base-Backbone interact. energy: -2.433 local terms energy: -201.768962 where: bonds (distance) C4'-P energy: -44.222 bonds (distance) P-C4' energy: -48.124 flat angles C4'-P-C4' energy: -46.778 flat angles P-C4'-P energy: -26.042 tors. eta vs tors. theta energy: -36.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -438.047860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.047860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.047860 (E_RNA) where: Base-Base interactions energy: -258.322 where: short stacking energy: -125.572 Base-Backbone interact. energy: -2.244 local terms energy: -177.482304 where: bonds (distance) C4'-P energy: -42.374 bonds (distance) P-C4' energy: -44.391 flat angles C4'-P-C4' energy: -30.775 flat angles P-C4'-P energy: -32.013 tors. eta vs tors. theta energy: -27.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -458.644684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.644684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.644684 (E_RNA) where: Base-Base interactions energy: -281.006 where: short stacking energy: -151.814 Base-Backbone interact. energy: 0.230 local terms energy: -177.868643 where: bonds (distance) C4'-P energy: -42.548 bonds (distance) P-C4' energy: -38.838 flat angles C4'-P-C4' energy: -50.524 flat angles P-C4'-P energy: -28.293 tors. eta vs tors. theta energy: -17.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -417.023060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.023060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.023060 (E_RNA) where: Base-Base interactions energy: -239.261 where: short stacking energy: -125.393 Base-Backbone interact. energy: -0.640 local terms energy: -177.122016 where: bonds (distance) C4'-P energy: -39.232 bonds (distance) P-C4' energy: -51.248 flat angles C4'-P-C4' energy: -37.353 flat angles P-C4'-P energy: -22.575 tors. eta vs tors. theta energy: -26.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -452.255885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.255885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.255885 (E_RNA) where: Base-Base interactions energy: -275.138 where: short stacking energy: -133.333 Base-Backbone interact. energy: 0.742 local terms energy: -177.859990 where: bonds (distance) C4'-P energy: -37.178 bonds (distance) P-C4' energy: -36.972 flat angles C4'-P-C4' energy: -45.996 flat angles P-C4'-P energy: -35.693 tors. eta vs tors. theta energy: -22.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -402.142074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.142074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.142074 (E_RNA) where: Base-Base interactions energy: -260.362 where: short stacking energy: -113.493 Base-Backbone interact. energy: -1.280 local terms energy: -140.500703 where: bonds (distance) C4'-P energy: -38.746 bonds (distance) P-C4' energy: -39.401 flat angles C4'-P-C4' energy: -40.114 flat angles P-C4'-P energy: -13.019 tors. eta vs tors. theta energy: -9.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -324.549033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.549033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.549033 (E_RNA) where: Base-Base interactions energy: -200.890 where: short stacking energy: -98.268 Base-Backbone interact. energy: 1.756 local terms energy: -125.414397 where: bonds (distance) C4'-P energy: -28.021 bonds (distance) P-C4' energy: -33.716 flat angles C4'-P-C4' energy: -32.763 flat angles P-C4'-P energy: -26.756 tors. eta vs tors. theta energy: -4.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -289.002344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.002344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.002344 (E_RNA) where: Base-Base interactions energy: -166.543 where: short stacking energy: -88.530 Base-Backbone interact. energy: 1.071 local terms energy: -123.530448 where: bonds (distance) C4'-P energy: -40.509 bonds (distance) P-C4' energy: -41.705 flat angles C4'-P-C4' energy: -29.436 flat angles P-C4'-P energy: -13.638 tors. eta vs tors. theta energy: 1.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -571.311053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.311053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.311053 (E_RNA) where: Base-Base interactions energy: -344.222 where: short stacking energy: -188.557 Base-Backbone interact. energy: -4.285 local terms energy: -222.803462 where: bonds (distance) C4'-P energy: -45.086 bonds (distance) P-C4' energy: -47.288 flat angles C4'-P-C4' energy: -52.532 flat angles P-C4'-P energy: -34.104 tors. eta vs tors. theta energy: -43.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -508.463939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.463939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.463939 (E_RNA) where: Base-Base interactions energy: -292.698 where: short stacking energy: -171.968 Base-Backbone interact. energy: -0.862 local terms energy: -214.904063 where: bonds (distance) C4'-P energy: -42.955 bonds (distance) P-C4' energy: -44.287 flat angles C4'-P-C4' energy: -45.857 flat angles P-C4'-P energy: -30.631 tors. eta vs tors. theta energy: -51.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -468.902727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.902727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.902727 (E_RNA) where: Base-Base interactions energy: -268.591 where: short stacking energy: -175.717 Base-Backbone interact. energy: -0.979 local terms energy: -199.332742 where: bonds (distance) C4'-P energy: -47.764 bonds (distance) P-C4' energy: -44.049 flat angles C4'-P-C4' energy: -45.680 flat angles P-C4'-P energy: -18.577 tors. eta vs tors. theta energy: -43.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -501.470225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.470225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.470225 (E_RNA) where: Base-Base interactions energy: -306.891 where: short stacking energy: -170.654 Base-Backbone interact. energy: -2.515 local terms energy: -192.065159 where: bonds (distance) C4'-P energy: -48.439 bonds (distance) P-C4' energy: -41.058 flat angles C4'-P-C4' energy: -39.357 flat angles P-C4'-P energy: -28.433 tors. eta vs tors. theta energy: -34.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -424.807019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.807019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.807019 (E_RNA) where: Base-Base interactions energy: -231.425 where: short stacking energy: -142.737 Base-Backbone interact. energy: -1.761 local terms energy: -191.621691 where: bonds (distance) C4'-P energy: -43.320 bonds (distance) P-C4' energy: -45.206 flat angles C4'-P-C4' energy: -49.148 flat angles P-C4'-P energy: -19.319 tors. eta vs tors. theta energy: -34.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -445.474980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.474980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.474980 (E_RNA) where: Base-Base interactions energy: -264.336 where: short stacking energy: -116.126 Base-Backbone interact. energy: -1.004 local terms energy: -180.135009 where: bonds (distance) C4'-P energy: -43.832 bonds (distance) P-C4' energy: -38.623 flat angles C4'-P-C4' energy: -40.870 flat angles P-C4'-P energy: -30.570 tors. eta vs tors. theta energy: -26.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -444.231902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.231902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.231902 (E_RNA) where: Base-Base interactions energy: -297.008 where: short stacking energy: -128.632 Base-Backbone interact. energy: 1.338 local terms energy: -148.561813 where: bonds (distance) C4'-P energy: -36.530 bonds (distance) P-C4' energy: -37.178 flat angles C4'-P-C4' energy: -39.688 flat angles P-C4'-P energy: -18.304 tors. eta vs tors. theta energy: -16.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -467.703656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.703656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.703656 (E_RNA) where: Base-Base interactions energy: -302.915 where: short stacking energy: -143.194 Base-Backbone interact. energy: -0.740 local terms energy: -164.048666 where: bonds (distance) C4'-P energy: -38.526 bonds (distance) P-C4' energy: -42.570 flat angles C4'-P-C4' energy: -37.242 flat angles P-C4'-P energy: -23.978 tors. eta vs tors. theta energy: -21.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -304.239875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.239875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.239875 (E_RNA) where: Base-Base interactions energy: -159.060 where: short stacking energy: -77.707 Base-Backbone interact. energy: -2.397 local terms energy: -142.783143 where: bonds (distance) C4'-P energy: -31.600 bonds (distance) P-C4' energy: -41.275 flat angles C4'-P-C4' energy: -32.772 flat angles P-C4'-P energy: -34.345 tors. eta vs tors. theta energy: -2.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -337.026967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.026967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.026967 (E_RNA) where: Base-Base interactions energy: -180.495 where: short stacking energy: -107.212 Base-Backbone interact. energy: 1.792 local terms energy: -158.323438 where: bonds (distance) C4'-P energy: -36.485 bonds (distance) P-C4' energy: -45.420 flat angles C4'-P-C4' energy: -35.431 flat angles P-C4'-P energy: -22.724 tors. eta vs tors. theta energy: -18.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -545.381953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.381953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.381953 (E_RNA) where: Base-Base interactions energy: -333.805 where: short stacking energy: -187.868 Base-Backbone interact. energy: 0.031 local terms energy: -211.607956 where: bonds (distance) C4'-P energy: -42.324 bonds (distance) P-C4' energy: -48.473 flat angles C4'-P-C4' energy: -44.082 flat angles P-C4'-P energy: -37.057 tors. eta vs tors. theta energy: -39.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -531.402982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.402982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.402982 (E_RNA) where: Base-Base interactions energy: -310.590 where: short stacking energy: -179.334 Base-Backbone interact. energy: 0.349 local terms energy: -221.161869 where: bonds (distance) C4'-P energy: -43.808 bonds (distance) P-C4' energy: -47.547 flat angles C4'-P-C4' energy: -48.398 flat angles P-C4'-P energy: -31.976 tors. eta vs tors. theta energy: -49.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -522.413092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.413092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.413092 (E_RNA) where: Base-Base interactions energy: -339.865 where: short stacking energy: -179.899 Base-Backbone interact. energy: -0.450 local terms energy: -182.097957 where: bonds (distance) C4'-P energy: -39.355 bonds (distance) P-C4' energy: -46.871 flat angles C4'-P-C4' energy: -41.031 flat angles P-C4'-P energy: -18.196 tors. eta vs tors. theta energy: -36.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -455.649775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.649775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.649775 (E_RNA) where: Base-Base interactions energy: -257.792 where: short stacking energy: -171.056 Base-Backbone interact. energy: -1.496 local terms energy: -196.362066 where: bonds (distance) C4'-P energy: -42.390 bonds (distance) P-C4' energy: -45.263 flat angles C4'-P-C4' energy: -43.343 flat angles P-C4'-P energy: -29.531 tors. eta vs tors. theta energy: -35.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -456.876167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.876167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.876167 (E_RNA) where: Base-Base interactions energy: -276.249 where: short stacking energy: -144.579 Base-Backbone interact. energy: -0.206 local terms energy: -180.420683 where: bonds (distance) C4'-P energy: -43.534 bonds (distance) P-C4' energy: -39.993 flat angles C4'-P-C4' energy: -43.787 flat angles P-C4'-P energy: -30.568 tors. eta vs tors. theta energy: -22.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -425.726562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.726562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.726562 (E_RNA) where: Base-Base interactions energy: -233.614 where: short stacking energy: -154.405 Base-Backbone interact. energy: -2.372 local terms energy: -189.740868 where: bonds (distance) C4'-P energy: -42.826 bonds (distance) P-C4' energy: -42.345 flat angles C4'-P-C4' energy: -41.164 flat angles P-C4'-P energy: -32.595 tors. eta vs tors. theta energy: -30.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -508.194325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.194325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.194325 (E_RNA) where: Base-Base interactions energy: -311.520 where: short stacking energy: -165.196 Base-Backbone interact. energy: -0.161 local terms energy: -196.513008 where: bonds (distance) C4'-P energy: -42.633 bonds (distance) P-C4' energy: -37.115 flat angles C4'-P-C4' energy: -46.467 flat angles P-C4'-P energy: -28.565 tors. eta vs tors. theta energy: -41.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -463.096878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.096878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.096878 (E_RNA) where: Base-Base interactions energy: -300.937 where: short stacking energy: -130.891 Base-Backbone interact. energy: -1.383 local terms energy: -160.776844 where: bonds (distance) C4'-P energy: -36.866 bonds (distance) P-C4' energy: -40.975 flat angles C4'-P-C4' energy: -38.994 flat angles P-C4'-P energy: -24.000 tors. eta vs tors. theta energy: -19.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -308.902594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.902594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.902594 (E_RNA) where: Base-Base interactions energy: -169.108 where: short stacking energy: -95.608 Base-Backbone interact. energy: -0.155 local terms energy: -139.639543 where: bonds (distance) C4'-P energy: -30.671 bonds (distance) P-C4' energy: -40.926 flat angles C4'-P-C4' energy: -43.234 flat angles P-C4'-P energy: -17.320 tors. eta vs tors. theta energy: -7.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -289.730251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.730251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.730251 (E_RNA) where: Base-Base interactions energy: -135.546 where: short stacking energy: -77.345 Base-Backbone interact. energy: -0.590 local terms energy: -153.594375 where: bonds (distance) C4'-P energy: -42.136 bonds (distance) P-C4' energy: -40.566 flat angles C4'-P-C4' energy: -35.263 flat angles P-C4'-P energy: -30.168 tors. eta vs tors. theta energy: -5.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -572.299726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.299726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.299726 (E_RNA) where: Base-Base interactions energy: -366.635 where: short stacking energy: -188.561 Base-Backbone interact. energy: -2.447 local terms energy: -203.217415 where: bonds (distance) C4'-P energy: -47.302 bonds (distance) P-C4' energy: -51.224 flat angles C4'-P-C4' energy: -43.321 flat angles P-C4'-P energy: -25.434 tors. eta vs tors. theta energy: -35.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -540.929278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.929278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.929278 (E_RNA) where: Base-Base interactions energy: -340.267 where: short stacking energy: -186.577 Base-Backbone interact. energy: -0.735 local terms energy: -199.927192 where: bonds (distance) C4'-P energy: -47.744 bonds (distance) P-C4' energy: -38.435 flat angles C4'-P-C4' energy: -46.067 flat angles P-C4'-P energy: -26.834 tors. eta vs tors. theta energy: -40.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -488.341343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.341343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.341343 (E_RNA) where: Base-Base interactions energy: -284.523 where: short stacking energy: -160.819 Base-Backbone interact. energy: -0.934 local terms energy: -202.884261 where: bonds (distance) C4'-P energy: -35.603 bonds (distance) P-C4' energy: -50.453 flat angles C4'-P-C4' energy: -48.995 flat angles P-C4'-P energy: -28.534 tors. eta vs tors. theta energy: -39.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -480.092818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.092818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.092818 (E_RNA) where: Base-Base interactions energy: -316.440 where: short stacking energy: -127.514 Base-Backbone interact. energy: 1.126 local terms energy: -164.778563 where: bonds (distance) C4'-P energy: -34.521 bonds (distance) P-C4' energy: -39.972 flat angles C4'-P-C4' energy: -44.147 flat angles P-C4'-P energy: -23.500 tors. eta vs tors. theta energy: -22.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -404.638846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.638846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.638846 (E_RNA) where: Base-Base interactions energy: -219.510 where: short stacking energy: -137.948 Base-Backbone interact. energy: -1.819 local terms energy: -183.309430 where: bonds (distance) C4'-P energy: -41.457 bonds (distance) P-C4' energy: -42.182 flat angles C4'-P-C4' energy: -42.373 flat angles P-C4'-P energy: -29.374 tors. eta vs tors. theta energy: -27.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -526.171949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.171949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.171949 (E_RNA) where: Base-Base interactions energy: -331.332 where: short stacking energy: -159.934 Base-Backbone interact. energy: 2.229 local terms energy: -197.068892 where: bonds (distance) C4'-P energy: -40.072 bonds (distance) P-C4' energy: -45.216 flat angles C4'-P-C4' energy: -44.287 flat angles P-C4'-P energy: -35.459 tors. eta vs tors. theta energy: -32.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -362.498014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.498014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.498014 (E_RNA) where: Base-Base interactions energy: -201.437 where: short stacking energy: -124.678 Base-Backbone interact. energy: 3.161 local terms energy: -164.221807 where: bonds (distance) C4'-P energy: -33.950 bonds (distance) P-C4' energy: -41.338 flat angles C4'-P-C4' energy: -39.878 flat angles P-C4'-P energy: -22.552 tors. eta vs tors. theta energy: -26.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -465.561151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.561151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.561151 (E_RNA) where: Base-Base interactions energy: -286.951 where: short stacking energy: -142.249 Base-Backbone interact. energy: 2.673 local terms energy: -181.283489 where: bonds (distance) C4'-P energy: -38.422 bonds (distance) P-C4' energy: -46.833 flat angles C4'-P-C4' energy: -46.467 flat angles P-C4'-P energy: -27.805 tors. eta vs tors. theta energy: -21.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -342.719065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.719065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.719065 (E_RNA) where: Base-Base interactions energy: -177.863 where: short stacking energy: -92.538 Base-Backbone interact. energy: 0.392 local terms energy: -165.247873 where: bonds (distance) C4'-P energy: -44.388 bonds (distance) P-C4' energy: -45.086 flat angles C4'-P-C4' energy: -36.970 flat angles P-C4'-P energy: -28.284 tors. eta vs tors. theta energy: -10.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -289.921049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.921049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.921049 (E_RNA) where: Base-Base interactions energy: -150.291 where: short stacking energy: -93.262 Base-Backbone interact. energy: -1.763 local terms energy: -137.866965 where: bonds (distance) C4'-P energy: -39.422 bonds (distance) P-C4' energy: -45.135 flat angles C4'-P-C4' energy: -31.963 flat angles P-C4'-P energy: -14.227 tors. eta vs tors. theta energy: -7.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -586.791981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.791981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.791981 (E_RNA) where: Base-Base interactions energy: -367.356 where: short stacking energy: -167.287 Base-Backbone interact. energy: -0.299 local terms energy: -219.136891 where: bonds (distance) C4'-P energy: -42.636 bonds (distance) P-C4' energy: -49.273 flat angles C4'-P-C4' energy: -51.235 flat angles P-C4'-P energy: -40.109 tors. eta vs tors. theta energy: -35.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -550.229105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.229105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.229105 (E_RNA) where: Base-Base interactions energy: -343.118 where: short stacking energy: -163.359 Base-Backbone interact. energy: -1.577 local terms energy: -205.533141 where: bonds (distance) C4'-P energy: -43.517 bonds (distance) P-C4' energy: -47.607 flat angles C4'-P-C4' energy: -45.168 flat angles P-C4'-P energy: -35.464 tors. eta vs tors. theta energy: -33.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -526.478881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.478881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.478881 (E_RNA) where: Base-Base interactions energy: -326.798 where: short stacking energy: -157.410 Base-Backbone interact. energy: -2.178 local terms energy: -197.502649 where: bonds (distance) C4'-P energy: -44.602 bonds (distance) P-C4' energy: -49.088 flat angles C4'-P-C4' energy: -36.403 flat angles P-C4'-P energy: -29.678 tors. eta vs tors. theta energy: -37.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -481.164324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.164324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.164324 (E_RNA) where: Base-Base interactions energy: -293.627 where: short stacking energy: -155.797 Base-Backbone interact. energy: 0.286 local terms energy: -187.822931 where: bonds (distance) C4'-P energy: -37.447 bonds (distance) P-C4' energy: -41.890 flat angles C4'-P-C4' energy: -48.963 flat angles P-C4'-P energy: -26.634 tors. eta vs tors. theta energy: -32.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -542.123569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.123569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.123569 (E_RNA) where: Base-Base interactions energy: -336.610 where: short stacking energy: -167.651 Base-Backbone interact. energy: -1.482 local terms energy: -204.031502 where: bonds (distance) C4'-P energy: -46.420 bonds (distance) P-C4' energy: -40.236 flat angles C4'-P-C4' energy: -49.068 flat angles P-C4'-P energy: -28.877 tors. eta vs tors. theta energy: -39.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -384.356510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.356510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.356510 (E_RNA) where: Base-Base interactions energy: -217.526 where: short stacking energy: -127.096 Base-Backbone interact. energy: 2.925 local terms energy: -169.756040 where: bonds (distance) C4'-P energy: -37.368 bonds (distance) P-C4' energy: -45.981 flat angles C4'-P-C4' energy: -38.788 flat angles P-C4'-P energy: -25.472 tors. eta vs tors. theta energy: -22.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -489.842300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.842300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.842300 (E_RNA) where: Base-Base interactions energy: -323.276 where: short stacking energy: -157.773 Base-Backbone interact. energy: -2.178 local terms energy: -164.388468 where: bonds (distance) C4'-P energy: -33.072 bonds (distance) P-C4' energy: -42.881 flat angles C4'-P-C4' energy: -42.060 flat angles P-C4'-P energy: -19.021 tors. eta vs tors. theta energy: -27.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -368.556809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.556809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.556809 (E_RNA) where: Base-Base interactions energy: -203.145 where: short stacking energy: -126.468 Base-Backbone interact. energy: 0.110 local terms energy: -165.521459 where: bonds (distance) C4'-P energy: -41.356 bonds (distance) P-C4' energy: -35.057 flat angles C4'-P-C4' energy: -40.160 flat angles P-C4'-P energy: -23.921 tors. eta vs tors. theta energy: -25.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -282.459280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.459280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.459280 (E_RNA) where: Base-Base interactions energy: -137.745 where: short stacking energy: -92.316 Base-Backbone interact. energy: 0.803 local terms energy: -145.517583 where: bonds (distance) C4'-P energy: -42.181 bonds (distance) P-C4' energy: -41.585 flat angles C4'-P-C4' energy: -24.011 flat angles P-C4'-P energy: -27.440 tors. eta vs tors. theta energy: -10.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -371.899488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.899488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.899488 (E_RNA) where: Base-Base interactions energy: -228.034 where: short stacking energy: -108.791 Base-Backbone interact. energy: 0.143 local terms energy: -144.007762 where: bonds (distance) C4'-P energy: -35.749 bonds (distance) P-C4' energy: -35.465 flat angles C4'-P-C4' energy: -34.902 flat angles P-C4'-P energy: -29.074 tors. eta vs tors. theta energy: -8.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -610.272499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.272499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.272499 (E_RNA) where: Base-Base interactions energy: -407.472 where: short stacking energy: -174.811 Base-Backbone interact. energy: -2.430 local terms energy: -200.370094 where: bonds (distance) C4'-P energy: -45.432 bonds (distance) P-C4' energy: -42.171 flat angles C4'-P-C4' energy: -46.784 flat angles P-C4'-P energy: -30.356 tors. eta vs tors. theta energy: -35.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -561.487390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.487390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.487390 (E_RNA) where: Base-Base interactions energy: -348.720 where: short stacking energy: -194.992 Base-Backbone interact. energy: -1.559 local terms energy: -211.207704 where: bonds (distance) C4'-P energy: -48.526 bonds (distance) P-C4' energy: -45.180 flat angles C4'-P-C4' energy: -43.539 flat angles P-C4'-P energy: -27.862 tors. eta vs tors. theta energy: -46.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -536.239602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.239602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.239602 (E_RNA) where: Base-Base interactions energy: -326.774 where: short stacking energy: -177.669 Base-Backbone interact. energy: -1.721 local terms energy: -207.744083 where: bonds (distance) C4'-P energy: -40.622 bonds (distance) P-C4' energy: -44.869 flat angles C4'-P-C4' energy: -45.473 flat angles P-C4'-P energy: -32.813 tors. eta vs tors. theta energy: -43.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -566.835721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.835721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.835721 (E_RNA) where: Base-Base interactions energy: -365.344 where: short stacking energy: -185.517 Base-Backbone interact. energy: -0.342 local terms energy: -201.150007 where: bonds (distance) C4'-P energy: -40.132 bonds (distance) P-C4' energy: -42.314 flat angles C4'-P-C4' energy: -52.158 flat angles P-C4'-P energy: -19.932 tors. eta vs tors. theta energy: -46.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -497.407253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.407253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.407253 (E_RNA) where: Base-Base interactions energy: -313.690 where: short stacking energy: -143.377 Base-Backbone interact. energy: -2.050 local terms energy: -181.666878 where: bonds (distance) C4'-P energy: -42.297 bonds (distance) P-C4' energy: -45.482 flat angles C4'-P-C4' energy: -43.987 flat angles P-C4'-P energy: -21.119 tors. eta vs tors. theta energy: -28.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -548.376536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.376536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.376536 (E_RNA) where: Base-Base interactions energy: -367.634 where: short stacking energy: -161.337 Base-Backbone interact. energy: 1.745 local terms energy: -182.487165 where: bonds (distance) C4'-P energy: -35.950 bonds (distance) P-C4' energy: -42.899 flat angles C4'-P-C4' energy: -45.217 flat angles P-C4'-P energy: -26.061 tors. eta vs tors. theta energy: -32.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -357.870171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.870171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.870171 (E_RNA) where: Base-Base interactions energy: -187.531 where: short stacking energy: -91.325 Base-Backbone interact. energy: -0.778 local terms energy: -169.561267 where: bonds (distance) C4'-P energy: -41.491 bonds (distance) P-C4' energy: -45.311 flat angles C4'-P-C4' energy: -31.868 flat angles P-C4'-P energy: -36.462 tors. eta vs tors. theta energy: -14.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -367.696416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.696416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.696416 (E_RNA) where: Base-Base interactions energy: -215.059 where: short stacking energy: -112.679 Base-Backbone interact. energy: -0.106 local terms energy: -152.530791 where: bonds (distance) C4'-P energy: -37.272 bonds (distance) P-C4' energy: -43.611 flat angles C4'-P-C4' energy: -31.943 flat angles P-C4'-P energy: -24.665 tors. eta vs tors. theta energy: -15.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -291.432552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.432552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.432552 (E_RNA) where: Base-Base interactions energy: -170.849 where: short stacking energy: -89.372 Base-Backbone interact. energy: -0.541 local terms energy: -120.042428 where: bonds (distance) C4'-P energy: -36.799 bonds (distance) P-C4' energy: -28.904 flat angles C4'-P-C4' energy: -19.652 flat angles P-C4'-P energy: -27.794 tors. eta vs tors. theta energy: -6.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -393.616731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.616731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.616731 (E_RNA) where: Base-Base interactions energy: -243.380 where: short stacking energy: -118.130 Base-Backbone interact. energy: -0.023 local terms energy: -150.214221 where: bonds (distance) C4'-P energy: -28.216 bonds (distance) P-C4' energy: -40.087 flat angles C4'-P-C4' energy: -37.344 flat angles P-C4'-P energy: -31.001 tors. eta vs tors. theta energy: -13.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -623.643481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.643481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.643481 (E_RNA) where: Base-Base interactions energy: -404.114 where: short stacking energy: -174.657 Base-Backbone interact. energy: -0.446 local terms energy: -219.083365 where: bonds (distance) C4'-P energy: -47.988 bonds (distance) P-C4' energy: -49.547 flat angles C4'-P-C4' energy: -46.768 flat angles P-C4'-P energy: -32.049 tors. eta vs tors. theta energy: -42.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -550.431304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.431304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.431304 (E_RNA) where: Base-Base interactions energy: -333.753 where: short stacking energy: -182.313 Base-Backbone interact. energy: 0.415 local terms energy: -217.093080 where: bonds (distance) C4'-P energy: -49.469 bonds (distance) P-C4' energy: -45.250 flat angles C4'-P-C4' energy: -41.938 flat angles P-C4'-P energy: -36.054 tors. eta vs tors. theta energy: -44.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -638.288887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.288887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.288887 (E_RNA) where: Base-Base interactions energy: -414.637 where: short stacking energy: -231.370 Base-Backbone interact. energy: 0.177 local terms energy: -223.828894 where: bonds (distance) C4'-P energy: -44.585 bonds (distance) P-C4' energy: -38.550 flat angles C4'-P-C4' energy: -51.923 flat angles P-C4'-P energy: -32.748 tors. eta vs tors. theta energy: -56.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -544.562952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.562952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.562952 (E_RNA) where: Base-Base interactions energy: -361.193 where: short stacking energy: -168.043 Base-Backbone interact. energy: -2.034 local terms energy: -181.335112 where: bonds (distance) C4'-P energy: -33.493 bonds (distance) P-C4' energy: -41.898 flat angles C4'-P-C4' energy: -48.805 flat angles P-C4'-P energy: -27.717 tors. eta vs tors. theta energy: -29.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -578.753630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.753630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.753630 (E_RNA) where: Base-Base interactions energy: -394.679 where: short stacking energy: -174.095 Base-Backbone interact. energy: -1.500 local terms energy: -182.574414 where: bonds (distance) C4'-P energy: -42.436 bonds (distance) P-C4' energy: -33.858 flat angles C4'-P-C4' energy: -50.164 flat angles P-C4'-P energy: -25.278 tors. eta vs tors. theta energy: -30.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -474.484084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.484084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.484084 (E_RNA) where: Base-Base interactions energy: -306.403 where: short stacking energy: -129.817 Base-Backbone interact. energy: 4.848 local terms energy: -172.929112 where: bonds (distance) C4'-P energy: -45.263 bonds (distance) P-C4' energy: -51.009 flat angles C4'-P-C4' energy: -36.146 flat angles P-C4'-P energy: -25.635 tors. eta vs tors. theta energy: -14.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -369.499284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.499284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.499284 (E_RNA) where: Base-Base interactions energy: -221.057 where: short stacking energy: -142.517 Base-Backbone interact. energy: -2.265 local terms energy: -146.177605 where: bonds (distance) C4'-P energy: -27.105 bonds (distance) P-C4' energy: -40.482 flat angles C4'-P-C4' energy: -35.700 flat angles P-C4'-P energy: -19.589 tors. eta vs tors. theta energy: -23.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -354.808332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.808332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.808332 (E_RNA) where: Base-Base interactions energy: -210.959 where: short stacking energy: -122.200 Base-Backbone interact. energy: -1.819 local terms energy: -142.030458 where: bonds (distance) C4'-P energy: -33.440 bonds (distance) P-C4' energy: -31.016 flat angles C4'-P-C4' energy: -31.514 flat angles P-C4'-P energy: -30.454 tors. eta vs tors. theta energy: -15.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -411.184310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.184310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.184310 (E_RNA) where: Base-Base interactions energy: -257.291 where: short stacking energy: -139.609 Base-Backbone interact. energy: 0.681 local terms energy: -154.574427 where: bonds (distance) C4'-P energy: -31.318 bonds (distance) P-C4' energy: -38.555 flat angles C4'-P-C4' energy: -39.341 flat angles P-C4'-P energy: -20.122 tors. eta vs tors. theta energy: -25.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -280.116097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.116097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.116097 (E_RNA) where: Base-Base interactions energy: -169.820 where: short stacking energy: -99.006 Base-Backbone interact. energy: -2.407 local terms energy: -107.889678 where: bonds (distance) C4'-P energy: -30.544 bonds (distance) P-C4' energy: -31.020 flat angles C4'-P-C4' energy: -21.769 flat angles P-C4'-P energy: -23.390 tors. eta vs tors. theta energy: -1.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -618.524970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.524970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.524970 (E_RNA) where: Base-Base interactions energy: -409.597 where: short stacking energy: -191.285 Base-Backbone interact. energy: -1.643 local terms energy: -207.284676 where: bonds (distance) C4'-P energy: -43.796 bonds (distance) P-C4' energy: -49.551 flat angles C4'-P-C4' energy: -43.944 flat angles P-C4'-P energy: -27.913 tors. eta vs tors. theta energy: -42.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -629.175808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.175808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.175808 (E_RNA) where: Base-Base interactions energy: -401.538 where: short stacking energy: -217.186 Base-Backbone interact. energy: -0.699 local terms energy: -226.939204 where: bonds (distance) C4'-P energy: -49.262 bonds (distance) P-C4' energy: -39.298 flat angles C4'-P-C4' energy: -48.118 flat angles P-C4'-P energy: -35.712 tors. eta vs tors. theta energy: -54.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -548.134507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.134507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.134507 (E_RNA) where: Base-Base interactions energy: -337.652 where: short stacking energy: -183.782 Base-Backbone interact. energy: -4.978 local terms energy: -205.504720 where: bonds (distance) C4'-P energy: -32.956 bonds (distance) P-C4' energy: -44.281 flat angles C4'-P-C4' energy: -46.663 flat angles P-C4'-P energy: -36.608 tors. eta vs tors. theta energy: -44.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -592.862672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.862672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.862672 (E_RNA) where: Base-Base interactions energy: -394.067 where: short stacking energy: -183.832 Base-Backbone interact. energy: -0.001 local terms energy: -198.794540 where: bonds (distance) C4'-P energy: -37.467 bonds (distance) P-C4' energy: -41.881 flat angles C4'-P-C4' energy: -48.098 flat angles P-C4'-P energy: -24.816 tors. eta vs tors. theta energy: -46.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -512.653469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.653469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.653469 (E_RNA) where: Base-Base interactions energy: -329.134 where: short stacking energy: -159.675 Base-Backbone interact. energy: -2.385 local terms energy: -181.134008 where: bonds (distance) C4'-P energy: -47.174 bonds (distance) P-C4' energy: -35.241 flat angles C4'-P-C4' energy: -41.565 flat angles P-C4'-P energy: -24.709 tors. eta vs tors. theta energy: -32.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -492.270426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.270426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.270426 (E_RNA) where: Base-Base interactions energy: -304.694 where: short stacking energy: -148.220 Base-Backbone interact. energy: -1.119 local terms energy: -186.457952 where: bonds (distance) C4'-P energy: -37.337 bonds (distance) P-C4' energy: -38.516 flat angles C4'-P-C4' energy: -40.123 flat angles P-C4'-P energy: -36.033 tors. eta vs tors. theta energy: -34.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -363.720708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.720708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.720708 (E_RNA) where: Base-Base interactions energy: -205.877 where: short stacking energy: -112.649 Base-Backbone interact. energy: 0.453 local terms energy: -158.297276 where: bonds (distance) C4'-P energy: -37.696 bonds (distance) P-C4' energy: -40.219 flat angles C4'-P-C4' energy: -41.218 flat angles P-C4'-P energy: -28.367 tors. eta vs tors. theta energy: -10.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -424.807577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.807577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.807577 (E_RNA) where: Base-Base interactions energy: -249.736 where: short stacking energy: -131.323 Base-Backbone interact. energy: -0.277 local terms energy: -174.793902 where: bonds (distance) C4'-P energy: -36.086 bonds (distance) P-C4' energy: -45.763 flat angles C4'-P-C4' energy: -46.463 flat angles P-C4'-P energy: -23.138 tors. eta vs tors. theta energy: -23.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -306.079963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.079963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.079963 (E_RNA) where: Base-Base interactions energy: -156.076 where: short stacking energy: -83.955 Base-Backbone interact. energy: -0.372 local terms energy: -149.632345 where: bonds (distance) C4'-P energy: -29.602 bonds (distance) P-C4' energy: -40.114 flat angles C4'-P-C4' energy: -42.598 flat angles P-C4'-P energy: -25.984 tors. eta vs tors. theta energy: -11.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -262.757139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.757139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.757139 (E_RNA) where: Base-Base interactions energy: -144.718 where: short stacking energy: -75.409 Base-Backbone interact. energy: 0.985 local terms energy: -119.024485 where: bonds (distance) C4'-P energy: -29.593 bonds (distance) P-C4' energy: -43.544 flat angles C4'-P-C4' energy: -35.053 flat angles P-C4'-P energy: -11.883 tors. eta vs tors. theta energy: 1.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -659.051437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.051437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.051437 (E_RNA) where: Base-Base interactions energy: -420.836 where: short stacking energy: -225.892 Base-Backbone interact. energy: -0.083 local terms energy: -238.132084 where: bonds (distance) C4'-P energy: -44.618 bonds (distance) P-C4' energy: -45.234 flat angles C4'-P-C4' energy: -53.662 flat angles P-C4'-P energy: -35.710 tors. eta vs tors. theta energy: -58.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -598.135768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.135768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.135768 (E_RNA) where: Base-Base interactions energy: -400.385 where: short stacking energy: -173.704 Base-Backbone interact. energy: 0.471 local terms energy: -198.221608 where: bonds (distance) C4'-P energy: -34.558 bonds (distance) P-C4' energy: -45.333 flat angles C4'-P-C4' energy: -51.724 flat angles P-C4'-P energy: -26.364 tors. eta vs tors. theta energy: -40.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -617.095126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.095126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.095126 (E_RNA) where: Base-Base interactions energy: -408.314 where: short stacking energy: -196.378 Base-Backbone interact. energy: -0.680 local terms energy: -208.101513 where: bonds (distance) C4'-P energy: -40.436 bonds (distance) P-C4' energy: -46.679 flat angles C4'-P-C4' energy: -51.444 flat angles P-C4'-P energy: -32.341 tors. eta vs tors. theta energy: -37.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -499.829659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.829659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.829659 (E_RNA) where: Base-Base interactions energy: -299.168 where: short stacking energy: -161.525 Base-Backbone interact. energy: -1.378 local terms energy: -199.284323 where: bonds (distance) C4'-P energy: -49.237 bonds (distance) P-C4' energy: -41.576 flat angles C4'-P-C4' energy: -49.092 flat angles P-C4'-P energy: -27.481 tors. eta vs tors. theta energy: -31.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -520.129730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.129730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.129730 (E_RNA) where: Base-Base interactions energy: -326.380 where: short stacking energy: -157.824 Base-Backbone interact. energy: 0.520 local terms energy: -194.269298 where: bonds (distance) C4'-P energy: -34.990 bonds (distance) P-C4' energy: -44.969 flat angles C4'-P-C4' energy: -47.843 flat angles P-C4'-P energy: -36.188 tors. eta vs tors. theta energy: -30.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -460.309373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.309373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.309373 (E_RNA) where: Base-Base interactions energy: -272.681 where: short stacking energy: -146.207 Base-Backbone interact. energy: -1.486 local terms energy: -186.142213 where: bonds (distance) C4'-P energy: -43.943 bonds (distance) P-C4' energy: -42.539 flat angles C4'-P-C4' energy: -40.515 flat angles P-C4'-P energy: -31.446 tors. eta vs tors. theta energy: -27.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -449.673382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.673382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.673382 (E_RNA) where: Base-Base interactions energy: -289.167 where: short stacking energy: -144.245 Base-Backbone interact. energy: -0.287 local terms energy: -160.219116 where: bonds (distance) C4'-P energy: -37.489 bonds (distance) P-C4' energy: -29.867 flat angles C4'-P-C4' energy: -35.640 flat angles P-C4'-P energy: -26.748 tors. eta vs tors. theta energy: -30.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -298.743436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.743436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.743436 (E_RNA) where: Base-Base interactions energy: -146.863 where: short stacking energy: -94.079 Base-Backbone interact. energy: -0.682 local terms energy: -151.197772 where: bonds (distance) C4'-P energy: -43.127 bonds (distance) P-C4' energy: -41.760 flat angles C4'-P-C4' energy: -33.622 flat angles P-C4'-P energy: -17.168 tors. eta vs tors. theta energy: -15.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -327.773077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.773077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.773077 (E_RNA) where: Base-Base interactions energy: -180.510 where: short stacking energy: -110.156 Base-Backbone interact. energy: 0.390 local terms energy: -147.653187 where: bonds (distance) C4'-P energy: -38.735 bonds (distance) P-C4' energy: -33.340 flat angles C4'-P-C4' energy: -39.744 flat angles P-C4'-P energy: -24.355 tors. eta vs tors. theta energy: -11.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -281.916602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.916602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.916602 (E_RNA) where: Base-Base interactions energy: -137.974 where: short stacking energy: -80.313 Base-Backbone interact. energy: -0.907 local terms energy: -143.035382 where: bonds (distance) C4'-P energy: -44.149 bonds (distance) P-C4' energy: -40.230 flat angles C4'-P-C4' energy: -33.349 flat angles P-C4'-P energy: -27.384 tors. eta vs tors. theta energy: 2.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -651.476641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.476641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.476641 (E_RNA) where: Base-Base interactions energy: -408.049 where: short stacking energy: -217.908 Base-Backbone interact. energy: -2.310 local terms energy: -241.118368 where: bonds (distance) C4'-P energy: -50.218 bonds (distance) P-C4' energy: -49.138 flat angles C4'-P-C4' energy: -54.700 flat angles P-C4'-P energy: -31.835 tors. eta vs tors. theta energy: -55.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -693.585851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.585851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.585851 (E_RNA) where: Base-Base interactions energy: -474.305 where: short stacking energy: -222.933 Base-Backbone interact. energy: -0.728 local terms energy: -218.552634 where: bonds (distance) C4'-P energy: -41.416 bonds (distance) P-C4' energy: -42.778 flat angles C4'-P-C4' energy: -46.002 flat angles P-C4'-P energy: -26.974 tors. eta vs tors. theta energy: -61.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -565.452330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.452330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.452330 (E_RNA) where: Base-Base interactions energy: -349.435 where: short stacking energy: -162.554 Base-Backbone interact. energy: -3.041 local terms energy: -212.976761 where: bonds (distance) C4'-P energy: -46.470 bonds (distance) P-C4' energy: -45.355 flat angles C4'-P-C4' energy: -47.280 flat angles P-C4'-P energy: -32.820 tors. eta vs tors. theta energy: -41.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -573.051287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.051287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.051287 (E_RNA) where: Base-Base interactions energy: -362.342 where: short stacking energy: -171.952 Base-Backbone interact. energy: 1.745 local terms energy: -212.453934 where: bonds (distance) C4'-P energy: -38.329 bonds (distance) P-C4' energy: -48.344 flat angles C4'-P-C4' energy: -45.826 flat angles P-C4'-P energy: -29.015 tors. eta vs tors. theta energy: -50.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -478.834793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.834793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.834793 (E_RNA) where: Base-Base interactions energy: -309.282 where: short stacking energy: -159.866 Base-Backbone interact. energy: -0.662 local terms energy: -168.891631 where: bonds (distance) C4'-P energy: -36.574 bonds (distance) P-C4' energy: -35.413 flat angles C4'-P-C4' energy: -41.314 flat angles P-C4'-P energy: -26.806 tors. eta vs tors. theta energy: -28.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -467.226663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.226663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.226663 (E_RNA) where: Base-Base interactions energy: -286.683 where: short stacking energy: -142.304 Base-Backbone interact. energy: -1.640 local terms energy: -178.903708 where: bonds (distance) C4'-P energy: -39.739 bonds (distance) P-C4' energy: -43.377 flat angles C4'-P-C4' energy: -37.158 flat angles P-C4'-P energy: -27.457 tors. eta vs tors. theta energy: -31.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -440.414176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.414176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.414176 (E_RNA) where: Base-Base interactions energy: -265.644 where: short stacking energy: -136.898 Base-Backbone interact. energy: -0.219 local terms energy: -174.551490 where: bonds (distance) C4'-P energy: -41.278 bonds (distance) P-C4' energy: -35.712 flat angles C4'-P-C4' energy: -34.258 flat angles P-C4'-P energy: -31.557 tors. eta vs tors. theta energy: -31.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -386.059204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.059204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.059204 (E_RNA) where: Base-Base interactions energy: -217.655 where: short stacking energy: -116.936 Base-Backbone interact. energy: -0.693 local terms energy: -167.711084 where: bonds (distance) C4'-P energy: -42.428 bonds (distance) P-C4' energy: -45.310 flat angles C4'-P-C4' energy: -37.867 flat angles P-C4'-P energy: -16.614 tors. eta vs tors. theta energy: -25.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -293.545956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.545956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.545956 (E_RNA) where: Base-Base interactions energy: -147.999 where: short stacking energy: -93.636 Base-Backbone interact. energy: -0.371 local terms energy: -145.175204 where: bonds (distance) C4'-P energy: -38.416 bonds (distance) P-C4' energy: -33.050 flat angles C4'-P-C4' energy: -40.137 flat angles P-C4'-P energy: -21.640 tors. eta vs tors. theta energy: -11.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -357.499810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.499810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.499810 (E_RNA) where: Base-Base interactions energy: -215.538 where: short stacking energy: -99.639 Base-Backbone interact. energy: -1.404 local terms energy: -140.557740 where: bonds (distance) C4'-P energy: -26.002 bonds (distance) P-C4' energy: -39.042 flat angles C4'-P-C4' energy: -37.810 flat angles P-C4'-P energy: -26.378 tors. eta vs tors. theta energy: -11.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -717.945514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.945514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.945514 (E_RNA) where: Base-Base interactions energy: -478.817 where: short stacking energy: -232.184 Base-Backbone interact. energy: -0.647 local terms energy: -238.482248 where: bonds (distance) C4'-P energy: -41.630 bonds (distance) P-C4' energy: -46.510 flat angles C4'-P-C4' energy: -51.457 flat angles P-C4'-P energy: -37.936 tors. eta vs tors. theta energy: -60.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -628.049825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.049825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.049825 (E_RNA) where: Base-Base interactions energy: -411.690 where: short stacking energy: -221.496 Base-Backbone interact. energy: -0.255 local terms energy: -216.104857 where: bonds (distance) C4'-P energy: -45.347 bonds (distance) P-C4' energy: -39.860 flat angles C4'-P-C4' energy: -45.460 flat angles P-C4'-P energy: -32.159 tors. eta vs tors. theta energy: -53.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -593.287732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.287732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.287732 (E_RNA) where: Base-Base interactions energy: -387.966 where: short stacking energy: -199.597 Base-Backbone interact. energy: -0.179 local terms energy: -205.142403 where: bonds (distance) C4'-P energy: -30.900 bonds (distance) P-C4' energy: -44.443 flat angles C4'-P-C4' energy: -42.477 flat angles P-C4'-P energy: -32.246 tors. eta vs tors. theta energy: -55.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -582.644632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.644632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.644632 (E_RNA) where: Base-Base interactions energy: -376.559 where: short stacking energy: -172.135 Base-Backbone interact. energy: -1.390 local terms energy: -204.695404 where: bonds (distance) C4'-P energy: -40.067 bonds (distance) P-C4' energy: -47.625 flat angles C4'-P-C4' energy: -42.317 flat angles P-C4'-P energy: -25.857 tors. eta vs tors. theta energy: -48.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -461.740692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.740692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.740692 (E_RNA) where: Base-Base interactions energy: -300.294 where: short stacking energy: -130.573 Base-Backbone interact. energy: -0.138 local terms energy: -161.308531 where: bonds (distance) C4'-P energy: -42.293 bonds (distance) P-C4' energy: -45.048 flat angles C4'-P-C4' energy: -39.079 flat angles P-C4'-P energy: -18.638 tors. eta vs tors. theta energy: -16.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -462.922561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.922561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.922561 (E_RNA) where: Base-Base interactions energy: -294.157 where: short stacking energy: -148.147 Base-Backbone interact. energy: -0.254 local terms energy: -168.511459 where: bonds (distance) C4'-P energy: -43.453 bonds (distance) P-C4' energy: -43.141 flat angles C4'-P-C4' energy: -38.515 flat angles P-C4'-P energy: -23.963 tors. eta vs tors. theta energy: -19.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -485.035271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.035271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.035271 (E_RNA) where: Base-Base interactions energy: -299.929 where: short stacking energy: -158.497 Base-Backbone interact. energy: -0.320 local terms energy: -184.786364 where: bonds (distance) C4'-P energy: -38.886 bonds (distance) P-C4' energy: -40.466 flat angles C4'-P-C4' energy: -44.698 flat angles P-C4'-P energy: -26.867 tors. eta vs tors. theta energy: -33.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -379.642443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.642443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.642443 (E_RNA) where: Base-Base interactions energy: -230.891 where: short stacking energy: -105.629 Base-Backbone interact. energy: 2.839 local terms energy: -151.590332 where: bonds (distance) C4'-P energy: -42.017 bonds (distance) P-C4' energy: -43.369 flat angles C4'-P-C4' energy: -33.281 flat angles P-C4'-P energy: -24.989 tors. eta vs tors. theta energy: -7.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -338.488574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.488574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.488574 (E_RNA) where: Base-Base interactions energy: -197.797 where: short stacking energy: -109.975 Base-Backbone interact. energy: 0.634 local terms energy: -141.325594 where: bonds (distance) C4'-P energy: -39.550 bonds (distance) P-C4' energy: -38.841 flat angles C4'-P-C4' energy: -31.166 flat angles P-C4'-P energy: -19.936 tors. eta vs tors. theta energy: -11.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -272.289585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.289585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.289585 (E_RNA) where: Base-Base interactions energy: -121.509 where: short stacking energy: -81.725 Base-Backbone interact. energy: -0.212 local terms energy: -150.568910 where: bonds (distance) C4'-P energy: -33.967 bonds (distance) P-C4' energy: -42.349 flat angles C4'-P-C4' energy: -39.911 flat angles P-C4'-P energy: -25.324 tors. eta vs tors. theta energy: -9.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -706.925244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.925244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.925244 (E_RNA) where: Base-Base interactions energy: -478.559 where: short stacking energy: -217.527 Base-Backbone interact. energy: -0.960 local terms energy: -227.405866 where: bonds (distance) C4'-P energy: -41.766 bonds (distance) P-C4' energy: -44.406 flat angles C4'-P-C4' energy: -47.491 flat angles P-C4'-P energy: -33.442 tors. eta vs tors. theta energy: -60.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -653.912169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.912169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.912169 (E_RNA) where: Base-Base interactions energy: -421.860 where: short stacking energy: -228.785 Base-Backbone interact. energy: -1.817 local terms energy: -230.235155 where: bonds (distance) C4'-P energy: -41.529 bonds (distance) P-C4' energy: -46.441 flat angles C4'-P-C4' energy: -52.878 flat angles P-C4'-P energy: -29.789 tors. eta vs tors. theta energy: -59.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -629.720999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.720999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.720999 (E_RNA) where: Base-Base interactions energy: -423.105 where: short stacking energy: -192.414 Base-Backbone interact. energy: -0.722 local terms energy: -205.893803 where: bonds (distance) C4'-P energy: -39.814 bonds (distance) P-C4' energy: -39.708 flat angles C4'-P-C4' energy: -47.339 flat angles P-C4'-P energy: -26.921 tors. eta vs tors. theta energy: -52.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -584.825067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.825067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.825067 (E_RNA) where: Base-Base interactions energy: -376.116 where: short stacking energy: -173.605 Base-Backbone interact. energy: 0.970 local terms energy: -209.679209 where: bonds (distance) C4'-P energy: -43.906 bonds (distance) P-C4' energy: -48.179 flat angles C4'-P-C4' energy: -44.139 flat angles P-C4'-P energy: -26.620 tors. eta vs tors. theta energy: -46.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -452.482938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.482938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.482938 (E_RNA) where: Base-Base interactions energy: -257.881 where: short stacking energy: -155.866 Base-Backbone interact. energy: -0.989 local terms energy: -193.612801 where: bonds (distance) C4'-P energy: -35.973 bonds (distance) P-C4' energy: -44.403 flat angles C4'-P-C4' energy: -46.646 flat angles P-C4'-P energy: -27.028 tors. eta vs tors. theta energy: -39.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -492.949504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.949504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.949504 (E_RNA) where: Base-Base interactions energy: -308.095 where: short stacking energy: -159.094 Base-Backbone interact. energy: 0.155 local terms energy: -185.008953 where: bonds (distance) C4'-P energy: -42.575 bonds (distance) P-C4' energy: -29.712 flat angles C4'-P-C4' energy: -44.491 flat angles P-C4'-P energy: -28.502 tors. eta vs tors. theta energy: -39.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -407.412890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.412890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.412890 (E_RNA) where: Base-Base interactions energy: -254.654 where: short stacking energy: -122.515 Base-Backbone interact. energy: -0.647 local terms energy: -152.111565 where: bonds (distance) C4'-P energy: -39.091 bonds (distance) P-C4' energy: -37.648 flat angles C4'-P-C4' energy: -36.589 flat angles P-C4'-P energy: -18.802 tors. eta vs tors. theta energy: -19.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -407.801573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.801573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.801573 (E_RNA) where: Base-Base interactions energy: -253.135 where: short stacking energy: -133.180 Base-Backbone interact. energy: -0.902 local terms energy: -153.764774 where: bonds (distance) C4'-P energy: -35.208 bonds (distance) P-C4' energy: -35.814 flat angles C4'-P-C4' energy: -39.089 flat angles P-C4'-P energy: -23.774 tors. eta vs tors. theta energy: -19.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -283.016530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.016530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.016530 (E_RNA) where: Base-Base interactions energy: -171.045 where: short stacking energy: -78.151 Base-Backbone interact. energy: -0.695 local terms energy: -111.276826 where: bonds (distance) C4'-P energy: -19.957 bonds (distance) P-C4' energy: -33.179 flat angles C4'-P-C4' energy: -33.828 flat angles P-C4'-P energy: -21.189 tors. eta vs tors. theta energy: -3.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -247.842075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.842075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.842075 (E_RNA) where: Base-Base interactions energy: -136.421 where: short stacking energy: -94.664 Base-Backbone interact. energy: -0.577 local terms energy: -110.843611 where: bonds (distance) C4'-P energy: -31.587 bonds (distance) P-C4' energy: -35.969 flat angles C4'-P-C4' energy: -29.284 flat angles P-C4'-P energy: -4.176 tors. eta vs tors. theta energy: -9.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -718.062260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.062260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.062260 (E_RNA) where: Base-Base interactions energy: -474.178 where: short stacking energy: -223.560 Base-Backbone interact. energy: -0.305 local terms energy: -243.579183 where: bonds (distance) C4'-P energy: -52.687 bonds (distance) P-C4' energy: -47.748 flat angles C4'-P-C4' energy: -55.252 flat angles P-C4'-P energy: -32.544 tors. eta vs tors. theta energy: -55.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -666.363079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.363079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.363079 (E_RNA) where: Base-Base interactions energy: -439.883 where: short stacking energy: -219.834 Base-Backbone interact. energy: 2.826 local terms energy: -229.306132 where: bonds (distance) C4'-P energy: -43.942 bonds (distance) P-C4' energy: -48.395 flat angles C4'-P-C4' energy: -49.993 flat angles P-C4'-P energy: -30.128 tors. eta vs tors. theta energy: -56.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -651.326856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.326856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.326856 (E_RNA) where: Base-Base interactions energy: -437.994 where: short stacking energy: -186.878 Base-Backbone interact. energy: 0.701 local terms energy: -214.033694 where: bonds (distance) C4'-P energy: -41.465 bonds (distance) P-C4' energy: -47.024 flat angles C4'-P-C4' energy: -45.452 flat angles P-C4'-P energy: -35.802 tors. eta vs tors. theta energy: -44.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -583.187657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.187657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.187657 (E_RNA) where: Base-Base interactions energy: -378.408 where: short stacking energy: -164.797 Base-Backbone interact. energy: -2.206 local terms energy: -202.573450 where: bonds (distance) C4'-P energy: -42.787 bonds (distance) P-C4' energy: -52.617 flat angles C4'-P-C4' energy: -41.123 flat angles P-C4'-P energy: -25.559 tors. eta vs tors. theta energy: -40.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -502.831087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.831087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.831087 (E_RNA) where: Base-Base interactions energy: -306.288 where: short stacking energy: -161.196 Base-Backbone interact. energy: -1.229 local terms energy: -195.314069 where: bonds (distance) C4'-P energy: -42.180 bonds (distance) P-C4' energy: -40.623 flat angles C4'-P-C4' energy: -44.234 flat angles P-C4'-P energy: -26.042 tors. eta vs tors. theta energy: -42.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -434.042872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.042872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.042872 (E_RNA) where: Base-Base interactions energy: -261.086 where: short stacking energy: -163.138 Base-Backbone interact. energy: -0.087 local terms energy: -172.870705 where: bonds (distance) C4'-P energy: -37.973 bonds (distance) P-C4' energy: -33.362 flat angles C4'-P-C4' energy: -41.487 flat angles P-C4'-P energy: -20.465 tors. eta vs tors. theta energy: -39.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -430.628609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.628609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.628609 (E_RNA) where: Base-Base interactions energy: -250.943 where: short stacking energy: -128.635 Base-Backbone interact. energy: 0.510 local terms energy: -180.195731 where: bonds (distance) C4'-P energy: -39.082 bonds (distance) P-C4' energy: -34.209 flat angles C4'-P-C4' energy: -47.536 flat angles P-C4'-P energy: -27.182 tors. eta vs tors. theta energy: -32.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -398.501651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.501651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.501651 (E_RNA) where: Base-Base interactions energy: -220.757 where: short stacking energy: -111.341 Base-Backbone interact. energy: 0.691 local terms energy: -178.436213 where: bonds (distance) C4'-P energy: -41.727 bonds (distance) P-C4' energy: -47.020 flat angles C4'-P-C4' energy: -44.084 flat angles P-C4'-P energy: -24.593 tors. eta vs tors. theta energy: -21.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -231.063388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.063388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.063388 (E_RNA) where: Base-Base interactions energy: -102.039 where: short stacking energy: -77.601 Base-Backbone interact. energy: 1.070 local terms energy: -130.094401 where: bonds (distance) C4'-P energy: -30.455 bonds (distance) P-C4' energy: -41.797 flat angles C4'-P-C4' energy: -34.919 flat angles P-C4'-P energy: -20.798 tors. eta vs tors. theta energy: -2.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -308.313890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.313890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.313890 (E_RNA) where: Base-Base interactions energy: -184.612 where: short stacking energy: -88.636 Base-Backbone interact. energy: -0.353 local terms energy: -123.348223 where: bonds (distance) C4'-P energy: -35.972 bonds (distance) P-C4' energy: -34.096 flat angles C4'-P-C4' energy: -27.142 flat angles P-C4'-P energy: -22.731 tors. eta vs tors. theta energy: -3.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -729.042317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.042317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.042317 (E_RNA) where: Base-Base interactions energy: -493.274 where: short stacking energy: -232.156 Base-Backbone interact. energy: -0.902 local terms energy: -234.866798 where: bonds (distance) C4'-P energy: -41.058 bonds (distance) P-C4' energy: -46.588 flat angles C4'-P-C4' energy: -51.746 flat angles P-C4'-P energy: -32.132 tors. eta vs tors. theta energy: -63.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -685.591554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.591554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.591554 (E_RNA) where: Base-Base interactions energy: -449.984 where: short stacking energy: -196.459 Base-Backbone interact. energy: 0.618 local terms energy: -236.224943 where: bonds (distance) C4'-P energy: -49.834 bonds (distance) P-C4' energy: -46.173 flat angles C4'-P-C4' energy: -48.769 flat angles P-C4'-P energy: -37.827 tors. eta vs tors. theta energy: -53.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -659.562907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.562907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.562907 (E_RNA) where: Base-Base interactions energy: -433.356 where: short stacking energy: -215.498 Base-Backbone interact. energy: -1.253 local terms energy: -224.954263 where: bonds (distance) C4'-P energy: -44.497 bonds (distance) P-C4' energy: -40.377 flat angles C4'-P-C4' energy: -49.419 flat angles P-C4'-P energy: -36.554 tors. eta vs tors. theta energy: -54.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -556.493598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.493598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.493598 (E_RNA) where: Base-Base interactions energy: -364.927 where: short stacking energy: -160.389 Base-Backbone interact. energy: -1.878 local terms energy: -189.687827 where: bonds (distance) C4'-P energy: -42.041 bonds (distance) P-C4' energy: -42.106 flat angles C4'-P-C4' energy: -40.946 flat angles P-C4'-P energy: -27.987 tors. eta vs tors. theta energy: -36.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -483.322356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.322356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.322356 (E_RNA) where: Base-Base interactions energy: -308.952 where: short stacking energy: -154.868 Base-Backbone interact. energy: -0.595 local terms energy: -173.775816 where: bonds (distance) C4'-P energy: -42.203 bonds (distance) P-C4' energy: -37.409 flat angles C4'-P-C4' energy: -37.841 flat angles P-C4'-P energy: -28.406 tors. eta vs tors. theta energy: -27.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -500.737796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.737796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.737796 (E_RNA) where: Base-Base interactions energy: -324.641 where: short stacking energy: -159.709 Base-Backbone interact. energy: -0.457 local terms energy: -175.639525 where: bonds (distance) C4'-P energy: -46.423 bonds (distance) P-C4' energy: -32.513 flat angles C4'-P-C4' energy: -38.414 flat angles P-C4'-P energy: -24.343 tors. eta vs tors. theta energy: -33.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -407.488437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.488437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.488437 (E_RNA) where: Base-Base interactions energy: -228.339 where: short stacking energy: -125.887 Base-Backbone interact. energy: 1.053 local terms energy: -180.203001 where: bonds (distance) C4'-P energy: -42.430 bonds (distance) P-C4' energy: -35.025 flat angles C4'-P-C4' energy: -51.359 flat angles P-C4'-P energy: -23.212 tors. eta vs tors. theta energy: -28.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -404.011852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.011852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.011852 (E_RNA) where: Base-Base interactions energy: -232.872 where: short stacking energy: -120.433 Base-Backbone interact. energy: -1.616 local terms energy: -169.524086 where: bonds (distance) C4'-P energy: -38.966 bonds (distance) P-C4' energy: -45.663 flat angles C4'-P-C4' energy: -36.057 flat angles P-C4'-P energy: -29.737 tors. eta vs tors. theta energy: -19.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -252.107423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.107423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.107423 (E_RNA) where: Base-Base interactions energy: -126.038 where: short stacking energy: -77.763 Base-Backbone interact. energy: -1.179 local terms energy: -124.890128 where: bonds (distance) C4'-P energy: -35.119 bonds (distance) P-C4' energy: -35.309 flat angles C4'-P-C4' energy: -29.337 flat angles P-C4'-P energy: -17.023 tors. eta vs tors. theta energy: -8.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -365.774871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.774871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.774871 (E_RNA) where: Base-Base interactions energy: -222.570 where: short stacking energy: -114.655 Base-Backbone interact. energy: -0.861 local terms energy: -142.344135 where: bonds (distance) C4'-P energy: -44.200 bonds (distance) P-C4' energy: -37.236 flat angles C4'-P-C4' energy: -34.197 flat angles P-C4'-P energy: -20.213 tors. eta vs tors. theta energy: -6.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -759.231169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.231169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.231169 (E_RNA) where: Base-Base interactions energy: -530.923 where: short stacking energy: -236.935 Base-Backbone interact. energy: -0.722 local terms energy: -227.586543 where: bonds (distance) C4'-P energy: -41.624 bonds (distance) P-C4' energy: -38.193 flat angles C4'-P-C4' energy: -49.624 flat angles P-C4'-P energy: -34.097 tors. eta vs tors. theta energy: -64.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -683.347644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.347644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.347644 (E_RNA) where: Base-Base interactions energy: -457.664 where: short stacking energy: -214.421 Base-Backbone interact. energy: 1.093 local terms energy: -226.777147 where: bonds (distance) C4'-P energy: -45.243 bonds (distance) P-C4' energy: -43.142 flat angles C4'-P-C4' energy: -52.494 flat angles P-C4'-P energy: -34.403 tors. eta vs tors. theta energy: -51.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -657.790689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.790689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.790689 (E_RNA) where: Base-Base interactions energy: -428.878 where: short stacking energy: -220.019 Base-Backbone interact. energy: -0.540 local terms energy: -228.372804 where: bonds (distance) C4'-P energy: -47.285 bonds (distance) P-C4' energy: -46.579 flat angles C4'-P-C4' energy: -44.664 flat angles P-C4'-P energy: -27.734 tors. eta vs tors. theta energy: -62.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -546.733508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.733508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.733508 (E_RNA) where: Base-Base interactions energy: -346.450 where: short stacking energy: -149.782 Base-Backbone interact. energy: -1.609 local terms energy: -198.674487 where: bonds (distance) C4'-P energy: -45.300 bonds (distance) P-C4' energy: -43.342 flat angles C4'-P-C4' energy: -47.919 flat angles P-C4'-P energy: -24.074 tors. eta vs tors. theta energy: -38.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -507.965578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.965578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.965578 (E_RNA) where: Base-Base interactions energy: -309.471 where: short stacking energy: -179.161 Base-Backbone interact. energy: 0.447 local terms energy: -198.941584 where: bonds (distance) C4'-P energy: -35.144 bonds (distance) P-C4' energy: -38.102 flat angles C4'-P-C4' energy: -45.901 flat angles P-C4'-P energy: -28.131 tors. eta vs tors. theta energy: -51.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -514.717471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.717471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.717471 (E_RNA) where: Base-Base interactions energy: -305.468 where: short stacking energy: -164.943 Base-Backbone interact. energy: -0.256 local terms energy: -208.992958 where: bonds (distance) C4'-P energy: -39.365 bonds (distance) P-C4' energy: -48.581 flat angles C4'-P-C4' energy: -48.646 flat angles P-C4'-P energy: -26.826 tors. eta vs tors. theta energy: -45.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -382.360160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.360160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.360160 (E_RNA) where: Base-Base interactions energy: -229.872 where: short stacking energy: -121.066 Base-Backbone interact. energy: -2.632 local terms energy: -149.856085 where: bonds (distance) C4'-P energy: -34.285 bonds (distance) P-C4' energy: -41.171 flat angles C4'-P-C4' energy: -36.753 flat angles P-C4'-P energy: -19.677 tors. eta vs tors. theta energy: -17.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -348.035445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.035445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.035445 (E_RNA) where: Base-Base interactions energy: -208.345 where: short stacking energy: -91.438 Base-Backbone interact. energy: 3.118 local terms energy: -142.807794 where: bonds (distance) C4'-P energy: -42.189 bonds (distance) P-C4' energy: -39.396 flat angles C4'-P-C4' energy: -41.141 flat angles P-C4'-P energy: -11.347 tors. eta vs tors. theta energy: -8.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -339.112346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.112346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.112346 (E_RNA) where: Base-Base interactions energy: -181.520 where: short stacking energy: -114.773 Base-Backbone interact. energy: -0.290 local terms energy: -157.303105 where: bonds (distance) C4'-P energy: -41.597 bonds (distance) P-C4' energy: -44.871 flat angles C4'-P-C4' energy: -34.746 flat angles P-C4'-P energy: -25.972 tors. eta vs tors. theta energy: -10.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -265.640426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.640426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.640426 (E_RNA) where: Base-Base interactions energy: -117.874 where: short stacking energy: -78.571 Base-Backbone interact. energy: 0.539 local terms energy: -148.305455 where: bonds (distance) C4'-P energy: -36.822 bonds (distance) P-C4' energy: -41.489 flat angles C4'-P-C4' energy: -39.222 flat angles P-C4'-P energy: -26.936 tors. eta vs tors. theta energy: -3.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -750.301830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.301830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.301830 (E_RNA) where: Base-Base interactions energy: -506.495 where: short stacking energy: -219.483 Base-Backbone interact. energy: -2.137 local terms energy: -241.669725 where: bonds (distance) C4'-P energy: -45.973 bonds (distance) P-C4' energy: -53.364 flat angles C4'-P-C4' energy: -49.444 flat angles P-C4'-P energy: -33.068 tors. eta vs tors. theta energy: -59.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -687.927065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.927065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.927065 (E_RNA) where: Base-Base interactions energy: -445.845 where: short stacking energy: -240.184 Base-Backbone interact. energy: 0.543 local terms energy: -242.625362 where: bonds (distance) C4'-P energy: -42.336 bonds (distance) P-C4' energy: -47.995 flat angles C4'-P-C4' energy: -44.745 flat angles P-C4'-P energy: -37.039 tors. eta vs tors. theta energy: -70.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -648.667393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.667393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.667393 (E_RNA) where: Base-Base interactions energy: -424.250 where: short stacking energy: -202.424 Base-Backbone interact. energy: -0.347 local terms energy: -224.070783 where: bonds (distance) C4'-P energy: -43.095 bonds (distance) P-C4' energy: -44.812 flat angles C4'-P-C4' energy: -48.965 flat angles P-C4'-P energy: -35.152 tors. eta vs tors. theta energy: -52.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -619.266732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.266732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.266732 (E_RNA) where: Base-Base interactions energy: -415.618 where: short stacking energy: -178.409 Base-Backbone interact. energy: -1.365 local terms energy: -202.283620 where: bonds (distance) C4'-P energy: -44.383 bonds (distance) P-C4' energy: -42.479 flat angles C4'-P-C4' energy: -38.645 flat angles P-C4'-P energy: -31.403 tors. eta vs tors. theta energy: -45.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -486.888771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.888771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.888771 (E_RNA) where: Base-Base interactions energy: -307.247 where: short stacking energy: -166.277 Base-Backbone interact. energy: -0.370 local terms energy: -179.271632 where: bonds (distance) C4'-P energy: -36.944 bonds (distance) P-C4' energy: -38.619 flat angles C4'-P-C4' energy: -38.290 flat angles P-C4'-P energy: -28.847 tors. eta vs tors. theta energy: -36.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -522.157378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.157378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.157378 (E_RNA) where: Base-Base interactions energy: -324.508 where: short stacking energy: -168.680 Base-Backbone interact. energy: -1.034 local terms energy: -196.615674 where: bonds (distance) C4'-P energy: -45.000 bonds (distance) P-C4' energy: -36.308 flat angles C4'-P-C4' energy: -42.254 flat angles P-C4'-P energy: -29.981 tors. eta vs tors. theta energy: -43.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -408.599072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.599072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.599072 (E_RNA) where: Base-Base interactions energy: -232.453 where: short stacking energy: -149.880 Base-Backbone interact. energy: -0.542 local terms energy: -175.603477 where: bonds (distance) C4'-P energy: -38.134 bonds (distance) P-C4' energy: -40.788 flat angles C4'-P-C4' energy: -40.857 flat angles P-C4'-P energy: -29.749 tors. eta vs tors. theta energy: -26.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -358.657145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.657145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.657145 (E_RNA) where: Base-Base interactions energy: -218.523 where: short stacking energy: -96.548 Base-Backbone interact. energy: -0.082 local terms energy: -140.051681 where: bonds (distance) C4'-P energy: -30.910 bonds (distance) P-C4' energy: -33.665 flat angles C4'-P-C4' energy: -41.489 flat angles P-C4'-P energy: -23.162 tors. eta vs tors. theta energy: -10.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -379.010349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.010349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.010349 (E_RNA) where: Base-Base interactions energy: -229.254 where: short stacking energy: -104.174 Base-Backbone interact. energy: -0.757 local terms energy: -148.999755 where: bonds (distance) C4'-P energy: -31.985 bonds (distance) P-C4' energy: -36.584 flat angles C4'-P-C4' energy: -45.895 flat angles P-C4'-P energy: -23.010 tors. eta vs tors. theta energy: -11.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -271.995385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.995385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.995385 (E_RNA) where: Base-Base interactions energy: -131.356 where: short stacking energy: -76.836 Base-Backbone interact. energy: 1.146 local terms energy: -141.786057 where: bonds (distance) C4'-P energy: -45.307 bonds (distance) P-C4' energy: -34.329 flat angles C4'-P-C4' energy: -36.164 flat angles P-C4'-P energy: -24.442 tors. eta vs tors. theta energy: -1.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -750.213295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.213295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.213295 (E_RNA) where: Base-Base interactions energy: -513.776 where: short stacking energy: -244.802 Base-Backbone interact. energy: -2.338 local terms energy: -234.098860 where: bonds (distance) C4'-P energy: -42.395 bonds (distance) P-C4' energy: -47.177 flat angles C4'-P-C4' energy: -51.505 flat angles P-C4'-P energy: -30.656 tors. eta vs tors. theta energy: -62.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -677.104566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.104566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.104566 (E_RNA) where: Base-Base interactions energy: -433.818 where: short stacking energy: -236.315 Base-Backbone interact. energy: 0.295 local terms energy: -243.582528 where: bonds (distance) C4'-P energy: -43.940 bonds (distance) P-C4' energy: -42.845 flat angles C4'-P-C4' energy: -48.613 flat angles P-C4'-P energy: -36.847 tors. eta vs tors. theta energy: -71.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -640.396076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.396076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.396076 (E_RNA) where: Base-Base interactions energy: -421.302 where: short stacking energy: -185.762 Base-Backbone interact. energy: -0.280 local terms energy: -218.814514 where: bonds (distance) C4'-P energy: -43.926 bonds (distance) P-C4' energy: -49.153 flat angles C4'-P-C4' energy: -45.155 flat angles P-C4'-P energy: -27.238 tors. eta vs tors. theta energy: -53.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -608.586204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.586204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.586204 (E_RNA) where: Base-Base interactions energy: -420.125 where: short stacking energy: -181.051 Base-Backbone interact. energy: 1.316 local terms energy: -189.777093 where: bonds (distance) C4'-P energy: -41.305 bonds (distance) P-C4' energy: -36.696 flat angles C4'-P-C4' energy: -44.545 flat angles P-C4'-P energy: -26.461 tors. eta vs tors. theta energy: -40.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -508.274285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.274285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.274285 (E_RNA) where: Base-Base interactions energy: -308.470 where: short stacking energy: -184.987 Base-Backbone interact. energy: -0.895 local terms energy: -198.909696 where: bonds (distance) C4'-P energy: -43.198 bonds (distance) P-C4' energy: -43.356 flat angles C4'-P-C4' energy: -39.301 flat angles P-C4'-P energy: -34.063 tors. eta vs tors. theta energy: -38.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -467.383022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.383022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.383022 (E_RNA) where: Base-Base interactions energy: -280.830 where: short stacking energy: -132.215 Base-Backbone interact. energy: -0.870 local terms energy: -185.682881 where: bonds (distance) C4'-P energy: -45.567 bonds (distance) P-C4' energy: -37.199 flat angles C4'-P-C4' energy: -42.901 flat angles P-C4'-P energy: -33.201 tors. eta vs tors. theta energy: -26.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -371.211600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.211600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.211600 (E_RNA) where: Base-Base interactions energy: -218.066 where: short stacking energy: -114.317 Base-Backbone interact. energy: 0.703 local terms energy: -153.848485 where: bonds (distance) C4'-P energy: -39.037 bonds (distance) P-C4' energy: -42.401 flat angles C4'-P-C4' energy: -38.741 flat angles P-C4'-P energy: -17.968 tors. eta vs tors. theta energy: -15.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -344.599349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.599349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.599349 (E_RNA) where: Base-Base interactions energy: -198.416 where: short stacking energy: -121.610 Base-Backbone interact. energy: -1.183 local terms energy: -145.000107 where: bonds (distance) C4'-P energy: -25.116 bonds (distance) P-C4' energy: -35.823 flat angles C4'-P-C4' energy: -30.877 flat angles P-C4'-P energy: -27.183 tors. eta vs tors. theta energy: -26.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -382.530116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.530116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.530116 (E_RNA) where: Base-Base interactions energy: -221.727 where: short stacking energy: -107.320 Base-Backbone interact. energy: 0.047 local terms energy: -160.850111 where: bonds (distance) C4'-P energy: -41.369 bonds (distance) P-C4' energy: -46.224 flat angles C4'-P-C4' energy: -37.203 flat angles P-C4'-P energy: -24.386 tors. eta vs tors. theta energy: -11.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -230.527968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.527968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.527968 (E_RNA) where: Base-Base interactions energy: -113.537 where: short stacking energy: -64.327 Base-Backbone interact. energy: -0.878 local terms energy: -116.113037 where: bonds (distance) C4'-P energy: -32.315 bonds (distance) P-C4' energy: -46.081 flat angles C4'-P-C4' energy: -35.120 flat angles P-C4'-P energy: -10.828 tors. eta vs tors. theta energy: 8.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -745.169829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.169829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.169829 (E_RNA) where: Base-Base interactions energy: -515.660 where: short stacking energy: -230.905 Base-Backbone interact. energy: 0.525 local terms energy: -230.034585 where: bonds (distance) C4'-P energy: -40.414 bonds (distance) P-C4' energy: -43.125 flat angles C4'-P-C4' energy: -55.717 flat angles P-C4'-P energy: -32.877 tors. eta vs tors. theta energy: -57.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -686.797091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.797091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.797091 (E_RNA) where: Base-Base interactions energy: -451.861 where: short stacking energy: -223.926 Base-Backbone interact. energy: -2.135 local terms energy: -232.801039 where: bonds (distance) C4'-P energy: -46.931 bonds (distance) P-C4' energy: -43.859 flat angles C4'-P-C4' energy: -47.420 flat angles P-C4'-P energy: -38.035 tors. eta vs tors. theta energy: -56.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -627.696155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.696155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.696155 (E_RNA) where: Base-Base interactions energy: -417.385 where: short stacking energy: -185.343 Base-Backbone interact. energy: 0.384 local terms energy: -210.694204 where: bonds (distance) C4'-P energy: -48.132 bonds (distance) P-C4' energy: -42.494 flat angles C4'-P-C4' energy: -45.031 flat angles P-C4'-P energy: -32.870 tors. eta vs tors. theta energy: -42.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -603.477474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.477474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.477474 (E_RNA) where: Base-Base interactions energy: -400.777 where: short stacking energy: -176.895 Base-Backbone interact. energy: 4.820 local terms energy: -207.520632 where: bonds (distance) C4'-P energy: -42.802 bonds (distance) P-C4' energy: -47.534 flat angles C4'-P-C4' energy: -50.209 flat angles P-C4'-P energy: -26.421 tors. eta vs tors. theta energy: -40.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -510.716695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.716695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.716695 (E_RNA) where: Base-Base interactions energy: -317.162 where: short stacking energy: -155.493 Base-Backbone interact. energy: -1.128 local terms energy: -192.426890 where: bonds (distance) C4'-P energy: -41.024 bonds (distance) P-C4' energy: -42.958 flat angles C4'-P-C4' energy: -41.190 flat angles P-C4'-P energy: -34.057 tors. eta vs tors. theta energy: -33.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -477.233857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.233857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.233857 (E_RNA) where: Base-Base interactions energy: -289.321 where: short stacking energy: -161.579 Base-Backbone interact. energy: 0.446 local terms energy: -188.358636 where: bonds (distance) C4'-P energy: -34.025 bonds (distance) P-C4' energy: -42.617 flat angles C4'-P-C4' energy: -48.365 flat angles P-C4'-P energy: -25.908 tors. eta vs tors. theta energy: -37.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -381.975034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.975034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.975034 (E_RNA) where: Base-Base interactions energy: -224.209 where: short stacking energy: -139.366 Base-Backbone interact. energy: 0.194 local terms energy: -157.960185 where: bonds (distance) C4'-P energy: -33.698 bonds (distance) P-C4' energy: -40.183 flat angles C4'-P-C4' energy: -37.976 flat angles P-C4'-P energy: -22.482 tors. eta vs tors. theta energy: -23.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -433.402355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.402355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.402355 (E_RNA) where: Base-Base interactions energy: -268.928 where: short stacking energy: -138.978 Base-Backbone interact. energy: -1.029 local terms energy: -163.444966 where: bonds (distance) C4'-P energy: -29.225 bonds (distance) P-C4' energy: -41.448 flat angles C4'-P-C4' energy: -39.459 flat angles P-C4'-P energy: -31.445 tors. eta vs tors. theta energy: -21.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -310.825582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.825582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.825582 (E_RNA) where: Base-Base interactions energy: -155.735 where: short stacking energy: -100.024 Base-Backbone interact. energy: -1.004 local terms energy: -154.086652 where: bonds (distance) C4'-P energy: -36.718 bonds (distance) P-C4' energy: -42.928 flat angles C4'-P-C4' energy: -38.229 flat angles P-C4'-P energy: -27.328 tors. eta vs tors. theta energy: -8.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -209.145211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.145211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.145211 (E_RNA) where: Base-Base interactions energy: -90.251 where: short stacking energy: -70.170 Base-Backbone interact. energy: 0.062 local terms energy: -118.955635 where: bonds (distance) C4'-P energy: -37.931 bonds (distance) P-C4' energy: -38.419 flat angles C4'-P-C4' energy: -27.147 flat angles P-C4'-P energy: -18.517 tors. eta vs tors. theta energy: 3.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -745.689037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.689037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.689037 (E_RNA) where: Base-Base interactions energy: -497.508 where: short stacking energy: -216.805 Base-Backbone interact. energy: -1.206 local terms energy: -246.974821 where: bonds (distance) C4'-P energy: -45.207 bonds (distance) P-C4' energy: -48.862 flat angles C4'-P-C4' energy: -50.296 flat angles P-C4'-P energy: -36.216 tors. eta vs tors. theta energy: -66.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -683.682204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.682204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.682204 (E_RNA) where: Base-Base interactions energy: -451.075 where: short stacking energy: -216.589 Base-Backbone interact. energy: -0.472 local terms energy: -232.134648 where: bonds (distance) C4'-P energy: -46.025 bonds (distance) P-C4' energy: -52.183 flat angles C4'-P-C4' energy: -42.333 flat angles P-C4'-P energy: -36.253 tors. eta vs tors. theta energy: -55.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -631.911248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.911248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.911248 (E_RNA) where: Base-Base interactions energy: -416.091 where: short stacking energy: -186.226 Base-Backbone interact. energy: -1.550 local terms energy: -214.270677 where: bonds (distance) C4'-P energy: -45.645 bonds (distance) P-C4' energy: -47.847 flat angles C4'-P-C4' energy: -51.176 flat angles P-C4'-P energy: -26.837 tors. eta vs tors. theta energy: -42.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -629.194880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.194880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.194880 (E_RNA) where: Base-Base interactions energy: -419.641 where: short stacking energy: -204.329 Base-Backbone interact. energy: 3.564 local terms energy: -213.117540 where: bonds (distance) C4'-P energy: -39.855 bonds (distance) P-C4' energy: -49.939 flat angles C4'-P-C4' energy: -42.812 flat angles P-C4'-P energy: -31.218 tors. eta vs tors. theta energy: -49.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -503.174060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.174060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.174060 (E_RNA) where: Base-Base interactions energy: -309.241 where: short stacking energy: -140.428 Base-Backbone interact. energy: -0.903 local terms energy: -193.030042 where: bonds (distance) C4'-P energy: -40.960 bonds (distance) P-C4' energy: -47.007 flat angles C4'-P-C4' energy: -43.779 flat angles P-C4'-P energy: -37.645 tors. eta vs tors. theta energy: -23.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -466.823442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.823442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.823442 (E_RNA) where: Base-Base interactions energy: -296.350 where: short stacking energy: -161.897 Base-Backbone interact. energy: 0.241 local terms energy: -170.715006 where: bonds (distance) C4'-P energy: -39.023 bonds (distance) P-C4' energy: -36.854 flat angles C4'-P-C4' energy: -35.531 flat angles P-C4'-P energy: -31.423 tors. eta vs tors. theta energy: -27.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -364.224813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.224813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.224813 (E_RNA) where: Base-Base interactions energy: -183.962 where: short stacking energy: -117.604 Base-Backbone interact. energy: 0.509 local terms energy: -180.772384 where: bonds (distance) C4'-P energy: -43.628 bonds (distance) P-C4' energy: -47.417 flat angles C4'-P-C4' energy: -33.944 flat angles P-C4'-P energy: -30.936 tors. eta vs tors. theta energy: -24.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -425.474239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.474239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.474239 (E_RNA) where: Base-Base interactions energy: -259.101 where: short stacking energy: -114.823 Base-Backbone interact. energy: -1.809 local terms energy: -164.564548 where: bonds (distance) C4'-P energy: -43.294 bonds (distance) P-C4' energy: -38.411 flat angles C4'-P-C4' energy: -34.483 flat angles P-C4'-P energy: -33.113 tors. eta vs tors. theta energy: -15.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -277.118261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.118261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.118261 (E_RNA) where: Base-Base interactions energy: -132.902 where: short stacking energy: -62.306 Base-Backbone interact. energy: -1.703 local terms energy: -142.513228 where: bonds (distance) C4'-P energy: -37.038 bonds (distance) P-C4' energy: -38.683 flat angles C4'-P-C4' energy: -39.363 flat angles P-C4'-P energy: -29.083 tors. eta vs tors. theta energy: 1.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -283.896071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.896071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.896071 (E_RNA) where: Base-Base interactions energy: -145.208 where: short stacking energy: -106.084 Base-Backbone interact. energy: -0.434 local terms energy: -138.254171 where: bonds (distance) C4'-P energy: -39.711 bonds (distance) P-C4' energy: -37.214 flat angles C4'-P-C4' energy: -31.754 flat angles P-C4'-P energy: -9.216 tors. eta vs tors. theta energy: -20.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -763.642248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.642248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.642248 (E_RNA) where: Base-Base interactions energy: -527.889 where: short stacking energy: -228.412 Base-Backbone interact. energy: -3.015 local terms energy: -232.738586 where: bonds (distance) C4'-P energy: -45.665 bonds (distance) P-C4' energy: -45.516 flat angles C4'-P-C4' energy: -50.894 flat angles P-C4'-P energy: -31.351 tors. eta vs tors. theta energy: -59.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -673.338102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.338102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.338102 (E_RNA) where: Base-Base interactions energy: -422.778 where: short stacking energy: -223.121 Base-Backbone interact. energy: -0.379 local terms energy: -250.181599 where: bonds (distance) C4'-P energy: -54.099 bonds (distance) P-C4' energy: -44.906 flat angles C4'-P-C4' energy: -50.958 flat angles P-C4'-P energy: -32.856 tors. eta vs tors. theta energy: -67.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -643.589612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.589612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.589612 (E_RNA) where: Base-Base interactions energy: -434.943 where: short stacking energy: -198.416 Base-Backbone interact. energy: -1.789 local terms energy: -206.858045 where: bonds (distance) C4'-P energy: -40.701 bonds (distance) P-C4' energy: -44.044 flat angles C4'-P-C4' energy: -45.612 flat angles P-C4'-P energy: -29.288 tors. eta vs tors. theta energy: -47.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -607.676779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.676779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.676779 (E_RNA) where: Base-Base interactions energy: -419.343 where: short stacking energy: -190.404 Base-Backbone interact. energy: 0.530 local terms energy: -188.863735 where: bonds (distance) C4'-P energy: -42.718 bonds (distance) P-C4' energy: -30.611 flat angles C4'-P-C4' energy: -49.124 flat angles P-C4'-P energy: -24.003 tors. eta vs tors. theta energy: -42.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -500.237798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.237798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.237798 (E_RNA) where: Base-Base interactions energy: -320.875 where: short stacking energy: -167.978 Base-Backbone interact. energy: -0.298 local terms energy: -179.064364 where: bonds (distance) C4'-P energy: -33.075 bonds (distance) P-C4' energy: -42.663 flat angles C4'-P-C4' energy: -43.932 flat angles P-C4'-P energy: -26.895 tors. eta vs tors. theta energy: -32.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -513.799263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.799263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.799263 (E_RNA) where: Base-Base interactions energy: -308.374 where: short stacking energy: -173.428 Base-Backbone interact. energy: -0.017 local terms energy: -205.408388 where: bonds (distance) C4'-P energy: -42.701 bonds (distance) P-C4' energy: -46.558 flat angles C4'-P-C4' energy: -44.655 flat angles P-C4'-P energy: -30.139 tors. eta vs tors. theta energy: -41.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -363.972609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.972609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.972609 (E_RNA) where: Base-Base interactions energy: -201.966 where: short stacking energy: -131.144 Base-Backbone interact. energy: 1.281 local terms energy: -163.287817 where: bonds (distance) C4'-P energy: -47.087 bonds (distance) P-C4' energy: -37.115 flat angles C4'-P-C4' energy: -32.712 flat angles P-C4'-P energy: -25.883 tors. eta vs tors. theta energy: -20.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -412.373499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.373499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.373499 (E_RNA) where: Base-Base interactions energy: -250.486 where: short stacking energy: -128.502 Base-Backbone interact. energy: 1.339 local terms energy: -163.226524 where: bonds (distance) C4'-P energy: -36.955 bonds (distance) P-C4' energy: -40.307 flat angles C4'-P-C4' energy: -38.772 flat angles P-C4'-P energy: -25.269 tors. eta vs tors. theta energy: -21.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -282.321804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.321804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.321804 (E_RNA) where: Base-Base interactions energy: -147.334 where: short stacking energy: -82.168 Base-Backbone interact. energy: -1.645 local terms energy: -133.342697 where: bonds (distance) C4'-P energy: -36.091 bonds (distance) P-C4' energy: -42.307 flat angles C4'-P-C4' energy: -35.596 flat angles P-C4'-P energy: -19.668 tors. eta vs tors. theta energy: 0.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -316.109225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.109225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.109225 (E_RNA) where: Base-Base interactions energy: -172.558 where: short stacking energy: -111.531 Base-Backbone interact. energy: -1.331 local terms energy: -142.220026 where: bonds (distance) C4'-P energy: -35.639 bonds (distance) P-C4' energy: -31.065 flat angles C4'-P-C4' energy: -38.138 flat angles P-C4'-P energy: -21.362 tors. eta vs tors. theta energy: -16.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -774.825304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.825304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.825304 (E_RNA) where: Base-Base interactions energy: -542.413 where: short stacking energy: -231.180 Base-Backbone interact. energy: -1.831 local terms energy: -230.580991 where: bonds (distance) C4'-P energy: -45.627 bonds (distance) P-C4' energy: -37.506 flat angles C4'-P-C4' energy: -51.099 flat angles P-C4'-P energy: -32.869 tors. eta vs tors. theta energy: -63.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -672.897220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.897220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.897220 (E_RNA) where: Base-Base interactions energy: -436.781 where: short stacking energy: -229.765 Base-Backbone interact. energy: 0.587 local terms energy: -236.703116 where: bonds (distance) C4'-P energy: -41.189 bonds (distance) P-C4' energy: -47.080 flat angles C4'-P-C4' energy: -49.467 flat angles P-C4'-P energy: -33.398 tors. eta vs tors. theta energy: -65.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -682.450134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.450134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.450134 (E_RNA) where: Base-Base interactions energy: -463.372 where: short stacking energy: -204.747 Base-Backbone interact. energy: -0.684 local terms energy: -218.393970 where: bonds (distance) C4'-P energy: -40.567 bonds (distance) P-C4' energy: -53.886 flat angles C4'-P-C4' energy: -52.116 flat angles P-C4'-P energy: -22.173 tors. eta vs tors. theta energy: -49.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -618.190708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.190708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.190708 (E_RNA) where: Base-Base interactions energy: -394.734 where: short stacking energy: -174.897 Base-Backbone interact. energy: -1.304 local terms energy: -222.153268 where: bonds (distance) C4'-P energy: -35.936 bonds (distance) P-C4' energy: -44.835 flat angles C4'-P-C4' energy: -54.391 flat angles P-C4'-P energy: -33.698 tors. eta vs tors. theta energy: -53.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -545.644453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.644453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.644453 (E_RNA) where: Base-Base interactions energy: -343.400 where: short stacking energy: -162.024 Base-Backbone interact. energy: -0.208 local terms energy: -202.036772 where: bonds (distance) C4'-P energy: -40.667 bonds (distance) P-C4' energy: -44.757 flat angles C4'-P-C4' energy: -42.957 flat angles P-C4'-P energy: -30.928 tors. eta vs tors. theta energy: -42.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -511.192559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.192559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.192559 (E_RNA) where: Base-Base interactions energy: -303.932 where: short stacking energy: -163.876 Base-Backbone interact. energy: -1.058 local terms energy: -206.202597 where: bonds (distance) C4'-P energy: -46.406 bonds (distance) P-C4' energy: -45.452 flat angles C4'-P-C4' energy: -45.196 flat angles P-C4'-P energy: -27.678 tors. eta vs tors. theta energy: -41.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -420.167533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.167533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.167533 (E_RNA) where: Base-Base interactions energy: -252.268 where: short stacking energy: -137.157 Base-Backbone interact. energy: -0.219 local terms energy: -167.680715 where: bonds (distance) C4'-P energy: -44.469 bonds (distance) P-C4' energy: -32.378 flat angles C4'-P-C4' energy: -39.706 flat angles P-C4'-P energy: -25.363 tors. eta vs tors. theta energy: -25.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -339.485060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.485060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.485060 (E_RNA) where: Base-Base interactions energy: -175.739 where: short stacking energy: -115.036 Base-Backbone interact. energy: -0.355 local terms energy: -163.391345 where: bonds (distance) C4'-P energy: -36.614 bonds (distance) P-C4' energy: -47.223 flat angles C4'-P-C4' energy: -35.593 flat angles P-C4'-P energy: -26.381 tors. eta vs tors. theta energy: -17.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -377.549454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.549454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.549454 (E_RNA) where: Base-Base interactions energy: -226.195 where: short stacking energy: -104.269 Base-Backbone interact. energy: -1.380 local terms energy: -149.974228 where: bonds (distance) C4'-P energy: -31.749 bonds (distance) P-C4' energy: -44.154 flat angles C4'-P-C4' energy: -37.319 flat angles P-C4'-P energy: -22.896 tors. eta vs tors. theta energy: -13.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -265.195710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.195710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.195710 (E_RNA) where: Base-Base interactions energy: -119.564 where: short stacking energy: -85.203 Base-Backbone interact. energy: 0.056 local terms energy: -145.687734 where: bonds (distance) C4'-P energy: -36.964 bonds (distance) P-C4' energy: -39.089 flat angles C4'-P-C4' energy: -45.776 flat angles P-C4'-P energy: -26.793 tors. eta vs tors. theta energy: 2.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -764.367563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.367563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.367563 (E_RNA) where: Base-Base interactions energy: -525.985 where: short stacking energy: -249.502 Base-Backbone interact. energy: -0.001 local terms energy: -238.381535 where: bonds (distance) C4'-P energy: -50.886 bonds (distance) P-C4' energy: -47.666 flat angles C4'-P-C4' energy: -49.193 flat angles P-C4'-P energy: -28.170 tors. eta vs tors. theta energy: -62.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -663.384930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.384930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.384930 (E_RNA) where: Base-Base interactions energy: -440.499 where: short stacking energy: -210.989 Base-Backbone interact. energy: -0.091 local terms energy: -222.795331 where: bonds (distance) C4'-P energy: -42.902 bonds (distance) P-C4' energy: -39.280 flat angles C4'-P-C4' energy: -50.471 flat angles P-C4'-P energy: -34.159 tors. eta vs tors. theta energy: -55.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -675.521193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.521193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.521193 (E_RNA) where: Base-Base interactions energy: -441.249 where: short stacking energy: -233.282 Base-Backbone interact. energy: 0.066 local terms energy: -234.338922 where: bonds (distance) C4'-P energy: -35.713 bonds (distance) P-C4' energy: -47.299 flat angles C4'-P-C4' energy: -48.128 flat angles P-C4'-P energy: -33.749 tors. eta vs tors. theta energy: -69.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -621.708991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.708991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.708991 (E_RNA) where: Base-Base interactions energy: -421.675 where: short stacking energy: -176.064 Base-Backbone interact. energy: -1.446 local terms energy: -198.588251 where: bonds (distance) C4'-P energy: -33.854 bonds (distance) P-C4' energy: -42.881 flat angles C4'-P-C4' energy: -50.563 flat angles P-C4'-P energy: -24.968 tors. eta vs tors. theta energy: -46.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -561.557541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.557541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.557541 (E_RNA) where: Base-Base interactions energy: -378.345 where: short stacking energy: -177.350 Base-Backbone interact. energy: -0.306 local terms energy: -182.907052 where: bonds (distance) C4'-P energy: -36.089 bonds (distance) P-C4' energy: -38.625 flat angles C4'-P-C4' energy: -51.167 flat angles P-C4'-P energy: -23.671 tors. eta vs tors. theta energy: -33.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -463.634193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.634193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.634193 (E_RNA) where: Base-Base interactions energy: -270.771 where: short stacking energy: -163.167 Base-Backbone interact. energy: 0.921 local terms energy: -193.784058 where: bonds (distance) C4'-P energy: -44.007 bonds (distance) P-C4' energy: -42.324 flat angles C4'-P-C4' energy: -42.153 flat angles P-C4'-P energy: -29.637 tors. eta vs tors. theta energy: -35.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -468.014885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.014885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.014885 (E_RNA) where: Base-Base interactions energy: -284.458 where: short stacking energy: -140.680 Base-Backbone interact. energy: -2.228 local terms energy: -181.328621 where: bonds (distance) C4'-P energy: -43.403 bonds (distance) P-C4' energy: -47.806 flat angles C4'-P-C4' energy: -39.412 flat angles P-C4'-P energy: -24.736 tors. eta vs tors. theta energy: -25.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -460.489606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.489606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.489606 (E_RNA) where: Base-Base interactions energy: -293.201 where: short stacking energy: -122.804 Base-Backbone interact. energy: 0.994 local terms energy: -168.282451 where: bonds (distance) C4'-P energy: -40.717 bonds (distance) P-C4' energy: -43.699 flat angles C4'-P-C4' energy: -38.983 flat angles P-C4'-P energy: -22.595 tors. eta vs tors. theta energy: -22.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -339.868660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.868660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.868660 (E_RNA) where: Base-Base interactions energy: -168.863 where: short stacking energy: -104.900 Base-Backbone interact. energy: 0.152 local terms energy: -171.156886 where: bonds (distance) C4'-P energy: -40.354 bonds (distance) P-C4' energy: -38.083 flat angles C4'-P-C4' energy: -40.974 flat angles P-C4'-P energy: -27.554 tors. eta vs tors. theta energy: -24.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -227.324817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.324817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.324817 (E_RNA) where: Base-Base interactions energy: -111.620 where: short stacking energy: -79.474 Base-Backbone interact. energy: 3.784 local terms energy: -119.488023 where: bonds (distance) C4'-P energy: -24.493 bonds (distance) P-C4' energy: -43.693 flat angles C4'-P-C4' energy: -37.298 flat angles P-C4'-P energy: -16.178 tors. eta vs tors. theta energy: 2.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -763.230313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.230313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.230313 (E_RNA) where: Base-Base interactions energy: -521.883 where: short stacking energy: -230.237 Base-Backbone interact. energy: -0.650 local terms energy: -240.697844 where: bonds (distance) C4'-P energy: -45.218 bonds (distance) P-C4' energy: -44.308 flat angles C4'-P-C4' energy: -49.750 flat angles P-C4'-P energy: -35.767 tors. eta vs tors. theta energy: -65.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -692.819710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.819710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.819710 (E_RNA) where: Base-Base interactions energy: -463.997 where: short stacking energy: -226.011 Base-Backbone interact. energy: 1.268 local terms energy: -230.091188 where: bonds (distance) C4'-P energy: -45.909 bonds (distance) P-C4' energy: -44.069 flat angles C4'-P-C4' energy: -54.857 flat angles P-C4'-P energy: -30.675 tors. eta vs tors. theta energy: -54.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -683.504636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.504636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.504636 (E_RNA) where: Base-Base interactions energy: -471.448 where: short stacking energy: -194.894 Base-Backbone interact. energy: -1.321 local terms energy: -210.735227 where: bonds (distance) C4'-P energy: -45.086 bonds (distance) P-C4' energy: -43.733 flat angles C4'-P-C4' energy: -48.285 flat angles P-C4'-P energy: -23.012 tors. eta vs tors. theta energy: -50.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -617.161677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.161677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.161677 (E_RNA) where: Base-Base interactions energy: -416.752 where: short stacking energy: -213.237 Base-Backbone interact. energy: -0.558 local terms energy: -199.852396 where: bonds (distance) C4'-P energy: -42.089 bonds (distance) P-C4' energy: -42.288 flat angles C4'-P-C4' energy: -36.477 flat angles P-C4'-P energy: -18.258 tors. eta vs tors. theta energy: -60.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -555.064077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.064077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.064077 (E_RNA) where: Base-Base interactions energy: -349.748 where: short stacking energy: -177.141 Base-Backbone interact. energy: -0.943 local terms energy: -204.373722 where: bonds (distance) C4'-P energy: -37.998 bonds (distance) P-C4' energy: -50.076 flat angles C4'-P-C4' energy: -38.145 flat angles P-C4'-P energy: -39.761 tors. eta vs tors. theta energy: -38.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -519.756477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.756477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.756477 (E_RNA) where: Base-Base interactions energy: -332.773 where: short stacking energy: -167.911 Base-Backbone interact. energy: -0.627 local terms energy: -186.355839 where: bonds (distance) C4'-P energy: -41.772 bonds (distance) P-C4' energy: -49.210 flat angles C4'-P-C4' energy: -42.654 flat angles P-C4'-P energy: -18.730 tors. eta vs tors. theta energy: -33.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -457.024920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.024920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.024920 (E_RNA) where: Base-Base interactions energy: -289.889 where: short stacking energy: -130.287 Base-Backbone interact. energy: -2.227 local terms energy: -164.908851 where: bonds (distance) C4'-P energy: -41.889 bonds (distance) P-C4' energy: -44.213 flat angles C4'-P-C4' energy: -39.937 flat angles P-C4'-P energy: -26.636 tors. eta vs tors. theta energy: -12.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -453.857756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.857756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.857756 (E_RNA) where: Base-Base interactions energy: -291.317 where: short stacking energy: -131.809 Base-Backbone interact. energy: 6.150 local terms energy: -168.690930 where: bonds (distance) C4'-P energy: -42.443 bonds (distance) P-C4' energy: -41.525 flat angles C4'-P-C4' energy: -38.589 flat angles P-C4'-P energy: -25.980 tors. eta vs tors. theta energy: -20.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -319.339965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.339965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.339965 (E_RNA) where: Base-Base interactions energy: -165.085 where: short stacking energy: -99.709 Base-Backbone interact. energy: -0.117 local terms energy: -154.138296 where: bonds (distance) C4'-P energy: -43.409 bonds (distance) P-C4' energy: -33.673 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -20.364 tors. eta vs tors. theta energy: -15.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -227.820608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.820608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.820608 (E_RNA) where: Base-Base interactions energy: -94.675 where: short stacking energy: -74.849 Base-Backbone interact. energy: 0.203 local terms energy: -133.348612 where: bonds (distance) C4'-P energy: -32.761 bonds (distance) P-C4' energy: -44.579 flat angles C4'-P-C4' energy: -38.696 flat angles P-C4'-P energy: -16.921 tors. eta vs tors. theta energy: -0.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -756.480434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.480434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.480434 (E_RNA) where: Base-Base interactions energy: -526.233 where: short stacking energy: -234.022 Base-Backbone interact. energy: -1.262 local terms energy: -228.985500 where: bonds (distance) C4'-P energy: -46.629 bonds (distance) P-C4' energy: -40.834 flat angles C4'-P-C4' energy: -45.649 flat angles P-C4'-P energy: -34.964 tors. eta vs tors. theta energy: -60.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -718.735023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.735023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.735023 (E_RNA) where: Base-Base interactions energy: -491.135 where: short stacking energy: -209.707 Base-Backbone interact. energy: -1.005 local terms energy: -226.594702 where: bonds (distance) C4'-P energy: -46.683 bonds (distance) P-C4' energy: -44.881 flat angles C4'-P-C4' energy: -49.230 flat angles P-C4'-P energy: -27.358 tors. eta vs tors. theta energy: -58.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -674.986412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.986412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.986412 (E_RNA) where: Base-Base interactions energy: -442.140 where: short stacking energy: -212.035 Base-Backbone interact. energy: -0.826 local terms energy: -232.021243 where: bonds (distance) C4'-P energy: -44.204 bonds (distance) P-C4' energy: -48.419 flat angles C4'-P-C4' energy: -51.127 flat angles P-C4'-P energy: -33.429 tors. eta vs tors. theta energy: -54.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -637.431897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.431897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.431897 (E_RNA) where: Base-Base interactions energy: -425.534 where: short stacking energy: -203.018 Base-Backbone interact. energy: 0.272 local terms energy: -212.169383 where: bonds (distance) C4'-P energy: -42.822 bonds (distance) P-C4' energy: -41.469 flat angles C4'-P-C4' energy: -49.182 flat angles P-C4'-P energy: -26.145 tors. eta vs tors. theta energy: -52.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -569.250872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.250872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.250872 (E_RNA) where: Base-Base interactions energy: -380.952 where: short stacking energy: -181.722 Base-Backbone interact. energy: 2.347 local terms energy: -190.646345 where: bonds (distance) C4'-P energy: -44.684 bonds (distance) P-C4' energy: -30.677 flat angles C4'-P-C4' energy: -46.147 flat angles P-C4'-P energy: -33.990 tors. eta vs tors. theta energy: -35.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -546.049431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.049431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.049431 (E_RNA) where: Base-Base interactions energy: -376.225 where: short stacking energy: -157.905 Base-Backbone interact. energy: -0.191 local terms energy: -169.632985 where: bonds (distance) C4'-P energy: -30.147 bonds (distance) P-C4' energy: -35.793 flat angles C4'-P-C4' energy: -49.840 flat angles P-C4'-P energy: -28.248 tors. eta vs tors. theta energy: -25.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -453.626507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.626507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.626507 (E_RNA) where: Base-Base interactions energy: -277.819 where: short stacking energy: -132.519 Base-Backbone interact. energy: -0.822 local terms energy: -174.986436 where: bonds (distance) C4'-P energy: -31.003 bonds (distance) P-C4' energy: -49.532 flat angles C4'-P-C4' energy: -39.719 flat angles P-C4'-P energy: -26.451 tors. eta vs tors. theta energy: -28.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -403.921254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.921254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.921254 (E_RNA) where: Base-Base interactions energy: -243.969 where: short stacking energy: -123.886 Base-Backbone interact. energy: 0.671 local terms energy: -160.623154 where: bonds (distance) C4'-P energy: -43.681 bonds (distance) P-C4' energy: -47.875 flat angles C4'-P-C4' energy: -33.570 flat angles P-C4'-P energy: -17.299 tors. eta vs tors. theta energy: -18.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -322.581574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.581574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.581574 (E_RNA) where: Base-Base interactions energy: -178.587 where: short stacking energy: -93.005 Base-Backbone interact. energy: 0.698 local terms energy: -144.693234 where: bonds (distance) C4'-P energy: -38.933 bonds (distance) P-C4' energy: -44.816 flat angles C4'-P-C4' energy: -38.237 flat angles P-C4'-P energy: -18.721 tors. eta vs tors. theta energy: -3.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -221.732419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.732419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.732419 (E_RNA) where: Base-Base interactions energy: -79.043 where: short stacking energy: -71.982 Base-Backbone interact. energy: 1.655 local terms energy: -144.344825 where: bonds (distance) C4'-P energy: -45.415 bonds (distance) P-C4' energy: -37.046 flat angles C4'-P-C4' energy: -34.361 flat angles P-C4'-P energy: -18.471 tors. eta vs tors. theta energy: -9.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -763.959673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.959673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.959673 (E_RNA) where: Base-Base interactions energy: -530.769 where: short stacking energy: -226.617 Base-Backbone interact. energy: -0.173 local terms energy: -233.017778 where: bonds (distance) C4'-P energy: -49.503 bonds (distance) P-C4' energy: -46.723 flat angles C4'-P-C4' energy: -50.144 flat angles P-C4'-P energy: -29.035 tors. eta vs tors. theta energy: -57.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -699.547243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.547243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.547243 (E_RNA) where: Base-Base interactions energy: -477.347 where: short stacking energy: -180.898 Base-Backbone interact. energy: 0.571 local terms energy: -222.771164 where: bonds (distance) C4'-P energy: -44.621 bonds (distance) P-C4' energy: -41.534 flat angles C4'-P-C4' energy: -53.063 flat angles P-C4'-P energy: -30.152 tors. eta vs tors. theta energy: -53.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -663.286842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.286842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.286842 (E_RNA) where: Base-Base interactions energy: -429.274 where: short stacking energy: -204.618 Base-Backbone interact. energy: 0.504 local terms energy: -234.516358 where: bonds (distance) C4'-P energy: -52.955 bonds (distance) P-C4' energy: -45.795 flat angles C4'-P-C4' energy: -51.763 flat angles P-C4'-P energy: -28.993 tors. eta vs tors. theta energy: -55.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -638.080864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.080864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.080864 (E_RNA) where: Base-Base interactions energy: -423.991 where: short stacking energy: -205.211 Base-Backbone interact. energy: -1.417 local terms energy: -212.672522 where: bonds (distance) C4'-P energy: -30.558 bonds (distance) P-C4' energy: -39.462 flat angles C4'-P-C4' energy: -53.030 flat angles P-C4'-P energy: -38.570 tors. eta vs tors. theta energy: -51.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -563.582743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.582743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.582743 (E_RNA) where: Base-Base interactions energy: -362.873 where: short stacking energy: -180.539 Base-Backbone interact. energy: 0.402 local terms energy: -201.111878 where: bonds (distance) C4'-P energy: -38.630 bonds (distance) P-C4' energy: -47.056 flat angles C4'-P-C4' energy: -48.537 flat angles P-C4'-P energy: -23.855 tors. eta vs tors. theta energy: -43.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -562.268188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.268188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.268188 (E_RNA) where: Base-Base interactions energy: -370.410 where: short stacking energy: -161.025 Base-Backbone interact. energy: 2.163 local terms energy: -194.020754 where: bonds (distance) C4'-P energy: -48.160 bonds (distance) P-C4' energy: -37.492 flat angles C4'-P-C4' energy: -44.183 flat angles P-C4'-P energy: -27.264 tors. eta vs tors. theta energy: -36.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -423.083889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.083889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.083889 (E_RNA) where: Base-Base interactions energy: -261.928 where: short stacking energy: -128.426 Base-Backbone interact. energy: -1.072 local terms energy: -160.084440 where: bonds (distance) C4'-P energy: -41.879 bonds (distance) P-C4' energy: -43.149 flat angles C4'-P-C4' energy: -37.836 flat angles P-C4'-P energy: -21.444 tors. eta vs tors. theta energy: -15.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -424.397315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.397315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.397315 (E_RNA) where: Base-Base interactions energy: -263.685 where: short stacking energy: -119.269 Base-Backbone interact. energy: -1.128 local terms energy: -159.583850 where: bonds (distance) C4'-P energy: -37.378 bonds (distance) P-C4' energy: -42.893 flat angles C4'-P-C4' energy: -40.567 flat angles P-C4'-P energy: -17.815 tors. eta vs tors. theta energy: -20.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -311.209084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.209084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.209084 (E_RNA) where: Base-Base interactions energy: -166.342 where: short stacking energy: -99.783 Base-Backbone interact. energy: -0.447 local terms energy: -144.419843 where: bonds (distance) C4'-P energy: -33.384 bonds (distance) P-C4' energy: -43.499 flat angles C4'-P-C4' energy: -26.292 flat angles P-C4'-P energy: -21.629 tors. eta vs tors. theta energy: -19.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -223.825809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.825809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.825809 (E_RNA) where: Base-Base interactions energy: -89.657 where: short stacking energy: -86.738 Base-Backbone interact. energy: -0.443 local terms energy: -133.725876 where: bonds (distance) C4'-P energy: -32.850 bonds (distance) P-C4' energy: -33.522 flat angles C4'-P-C4' energy: -29.998 flat angles P-C4'-P energy: -31.395 tors. eta vs tors. theta energy: -5.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -796.035912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.035912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.035912 (E_RNA) where: Base-Base interactions energy: -565.700 where: short stacking energy: -236.906 Base-Backbone interact. energy: -0.471 local terms energy: -229.865166 where: bonds (distance) C4'-P energy: -40.373 bonds (distance) P-C4' energy: -47.579 flat angles C4'-P-C4' energy: -50.723 flat angles P-C4'-P energy: -29.560 tors. eta vs tors. theta energy: -61.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -692.215315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.215315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.215315 (E_RNA) where: Base-Base interactions energy: -477.205 where: short stacking energy: -201.784 Base-Backbone interact. energy: -0.187 local terms energy: -214.823331 where: bonds (distance) C4'-P energy: -44.255 bonds (distance) P-C4' energy: -47.070 flat angles C4'-P-C4' energy: -43.111 flat angles P-C4'-P energy: -32.145 tors. eta vs tors. theta energy: -48.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -670.396209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.396209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.396209 (E_RNA) where: Base-Base interactions energy: -460.977 where: short stacking energy: -206.601 Base-Backbone interact. energy: -0.044 local terms energy: -209.374709 where: bonds (distance) C4'-P energy: -39.695 bonds (distance) P-C4' energy: -47.179 flat angles C4'-P-C4' energy: -39.412 flat angles P-C4'-P energy: -33.164 tors. eta vs tors. theta energy: -49.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -621.926520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.926520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.926520 (E_RNA) where: Base-Base interactions energy: -422.772 where: short stacking energy: -198.358 Base-Backbone interact. energy: -0.277 local terms energy: -198.878141 where: bonds (distance) C4'-P energy: -28.728 bonds (distance) P-C4' energy: -48.696 flat angles C4'-P-C4' energy: -46.952 flat angles P-C4'-P energy: -26.462 tors. eta vs tors. theta energy: -48.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -565.575796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.575796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.575796 (E_RNA) where: Base-Base interactions energy: -342.625 where: short stacking energy: -181.686 Base-Backbone interact. energy: -1.403 local terms energy: -221.548675 where: bonds (distance) C4'-P energy: -45.798 bonds (distance) P-C4' energy: -46.414 flat angles C4'-P-C4' energy: -48.542 flat angles P-C4'-P energy: -33.499 tors. eta vs tors. theta energy: -47.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -547.303661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.303661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.303661 (E_RNA) where: Base-Base interactions energy: -367.026 where: short stacking energy: -145.390 Base-Backbone interact. energy: -2.307 local terms energy: -177.970812 where: bonds (distance) C4'-P energy: -44.047 bonds (distance) P-C4' energy: -27.928 flat angles C4'-P-C4' energy: -44.517 flat angles P-C4'-P energy: -30.434 tors. eta vs tors. theta energy: -31.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -471.956018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.956018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.956018 (E_RNA) where: Base-Base interactions energy: -295.211 where: short stacking energy: -144.863 Base-Backbone interact. energy: -0.387 local terms energy: -176.357933 where: bonds (distance) C4'-P energy: -42.768 bonds (distance) P-C4' energy: -40.475 flat angles C4'-P-C4' energy: -40.549 flat angles P-C4'-P energy: -27.065 tors. eta vs tors. theta energy: -25.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -415.944573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.944573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.944573 (E_RNA) where: Base-Base interactions energy: -244.492 where: short stacking energy: -124.554 Base-Backbone interact. energy: -0.554 local terms energy: -170.898521 where: bonds (distance) C4'-P energy: -38.757 bonds (distance) P-C4' energy: -45.262 flat angles C4'-P-C4' energy: -38.108 flat angles P-C4'-P energy: -21.459 tors. eta vs tors. theta energy: -27.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -326.733837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.733837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.733837 (E_RNA) where: Base-Base interactions energy: -185.578 where: short stacking energy: -105.394 Base-Backbone interact. energy: -0.314 local terms energy: -140.841897 where: bonds (distance) C4'-P energy: -37.040 bonds (distance) P-C4' energy: -37.620 flat angles C4'-P-C4' energy: -36.629 flat angles P-C4'-P energy: -19.150 tors. eta vs tors. theta energy: -10.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -224.232100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.232100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.232100 (E_RNA) where: Base-Base interactions energy: -87.040 where: short stacking energy: -83.454 Base-Backbone interact. energy: -1.606 local terms energy: -135.585697 where: bonds (distance) C4'-P energy: -33.308 bonds (distance) P-C4' energy: -34.643 flat angles C4'-P-C4' energy: -36.281 flat angles P-C4'-P energy: -24.050 tors. eta vs tors. theta energy: -7.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -790.156862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.156862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.156862 (E_RNA) where: Base-Base interactions energy: -538.495 where: short stacking energy: -230.260 Base-Backbone interact. energy: -1.632 local terms energy: -250.029735 where: bonds (distance) C4'-P energy: -49.866 bonds (distance) P-C4' energy: -39.359 flat angles C4'-P-C4' energy: -53.239 flat angles P-C4'-P energy: -41.573 tors. eta vs tors. theta energy: -65.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -701.295439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.295439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.295439 (E_RNA) where: Base-Base interactions energy: -468.429 where: short stacking energy: -217.586 Base-Backbone interact. energy: -0.641 local terms energy: -232.225709 where: bonds (distance) C4'-P energy: -44.204 bonds (distance) P-C4' energy: -45.083 flat angles C4'-P-C4' energy: -47.572 flat angles P-C4'-P energy: -39.033 tors. eta vs tors. theta energy: -56.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -664.181984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.181984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.181984 (E_RNA) where: Base-Base interactions energy: -443.026 where: short stacking energy: -215.199 Base-Backbone interact. energy: 0.511 local terms energy: -221.666407 where: bonds (distance) C4'-P energy: -42.176 bonds (distance) P-C4' energy: -35.192 flat angles C4'-P-C4' energy: -49.598 flat angles P-C4'-P energy: -34.547 tors. eta vs tors. theta energy: -60.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -639.603760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.603760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.603760 (E_RNA) where: Base-Base interactions energy: -425.900 where: short stacking energy: -206.332 Base-Backbone interact. energy: 0.561 local terms energy: -214.264386 where: bonds (distance) C4'-P energy: -43.951 bonds (distance) P-C4' energy: -46.872 flat angles C4'-P-C4' energy: -47.555 flat angles P-C4'-P energy: -24.632 tors. eta vs tors. theta energy: -51.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -558.431286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.431286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.431286 (E_RNA) where: Base-Base interactions energy: -365.419 where: short stacking energy: -156.942 Base-Backbone interact. energy: 1.531 local terms energy: -194.542967 where: bonds (distance) C4'-P energy: -41.051 bonds (distance) P-C4' energy: -46.122 flat angles C4'-P-C4' energy: -40.882 flat angles P-C4'-P energy: -33.976 tors. eta vs tors. theta energy: -32.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -538.505290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.505290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.505290 (E_RNA) where: Base-Base interactions energy: -344.932 where: short stacking energy: -174.193 Base-Backbone interact. energy: 0.369 local terms energy: -193.941468 where: bonds (distance) C4'-P energy: -43.310 bonds (distance) P-C4' energy: -46.892 flat angles C4'-P-C4' energy: -44.192 flat angles P-C4'-P energy: -23.592 tors. eta vs tors. theta energy: -35.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -468.333983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.333983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.333983 (E_RNA) where: Base-Base interactions energy: -289.053 where: short stacking energy: -152.636 Base-Backbone interact. energy: -0.810 local terms energy: -178.471281 where: bonds (distance) C4'-P energy: -41.257 bonds (distance) P-C4' energy: -43.939 flat angles C4'-P-C4' energy: -42.781 flat angles P-C4'-P energy: -22.570 tors. eta vs tors. theta energy: -27.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -392.135636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.135636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.135636 (E_RNA) where: Base-Base interactions energy: -234.640 where: short stacking energy: -112.503 Base-Backbone interact. energy: -2.231 local terms energy: -155.263948 where: bonds (distance) C4'-P energy: -43.380 bonds (distance) P-C4' energy: -45.358 flat angles C4'-P-C4' energy: -30.689 flat angles P-C4'-P energy: -22.199 tors. eta vs tors. theta energy: -13.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -356.256125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.256125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.256125 (E_RNA) where: Base-Base interactions energy: -204.912 where: short stacking energy: -117.057 Base-Backbone interact. energy: 2.112 local terms energy: -153.455516 where: bonds (distance) C4'-P energy: -37.429 bonds (distance) P-C4' energy: -50.637 flat angles C4'-P-C4' energy: -32.501 flat angles P-C4'-P energy: -14.753 tors. eta vs tors. theta energy: -18.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -215.955225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.955225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.955225 (E_RNA) where: Base-Base interactions energy: -91.398 where: short stacking energy: -76.792 Base-Backbone interact. energy: 0.549 local terms energy: -125.106085 where: bonds (distance) C4'-P energy: -38.760 bonds (distance) P-C4' energy: -33.118 flat angles C4'-P-C4' energy: -36.071 flat angles P-C4'-P energy: -19.188 tors. eta vs tors. theta energy: 2.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -801.735398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.735398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.735398 (E_RNA) where: Base-Base interactions energy: -559.648 where: short stacking energy: -235.069 Base-Backbone interact. energy: -0.807 local terms energy: -241.280350 where: bonds (distance) C4'-P energy: -45.255 bonds (distance) P-C4' energy: -44.436 flat angles C4'-P-C4' energy: -56.456 flat angles P-C4'-P energy: -35.853 tors. eta vs tors. theta energy: -59.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -719.754660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.754660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.754660 (E_RNA) where: Base-Base interactions energy: -480.202 where: short stacking energy: -228.771 Base-Backbone interact. energy: 3.055 local terms energy: -242.607916 where: bonds (distance) C4'-P energy: -40.831 bonds (distance) P-C4' energy: -54.226 flat angles C4'-P-C4' energy: -52.054 flat angles P-C4'-P energy: -36.203 tors. eta vs tors. theta energy: -59.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -668.542159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.542159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.542159 (E_RNA) where: Base-Base interactions energy: -442.679 where: short stacking energy: -210.405 Base-Backbone interact. energy: -0.767 local terms energy: -225.096491 where: bonds (distance) C4'-P energy: -41.327 bonds (distance) P-C4' energy: -51.735 flat angles C4'-P-C4' energy: -46.139 flat angles P-C4'-P energy: -35.792 tors. eta vs tors. theta energy: -50.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -614.232143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.232143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.232143 (E_RNA) where: Base-Base interactions energy: -396.508 where: short stacking energy: -205.866 Base-Backbone interact. energy: -1.439 local terms energy: -216.284906 where: bonds (distance) C4'-P energy: -38.134 bonds (distance) P-C4' energy: -47.667 flat angles C4'-P-C4' energy: -42.948 flat angles P-C4'-P energy: -33.773 tors. eta vs tors. theta energy: -53.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -573.389174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.389174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.389174 (E_RNA) where: Base-Base interactions energy: -376.955 where: short stacking energy: -175.910 Base-Backbone interact. energy: 0.975 local terms energy: -197.409540 where: bonds (distance) C4'-P energy: -36.362 bonds (distance) P-C4' energy: -43.123 flat angles C4'-P-C4' energy: -52.077 flat angles P-C4'-P energy: -29.007 tors. eta vs tors. theta energy: -36.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -529.769807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.769807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.769807 (E_RNA) where: Base-Base interactions energy: -347.780 where: short stacking energy: -172.470 Base-Backbone interact. energy: -1.884 local terms energy: -180.105956 where: bonds (distance) C4'-P energy: -38.502 bonds (distance) P-C4' energy: -39.851 flat angles C4'-P-C4' energy: -31.618 flat angles P-C4'-P energy: -32.206 tors. eta vs tors. theta energy: -37.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -442.352951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.352951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.352951 (E_RNA) where: Base-Base interactions energy: -282.313 where: short stacking energy: -146.653 Base-Backbone interact. energy: -0.883 local terms energy: -159.156389 where: bonds (distance) C4'-P energy: -36.296 bonds (distance) P-C4' energy: -33.468 flat angles C4'-P-C4' energy: -39.697 flat angles P-C4'-P energy: -18.854 tors. eta vs tors. theta energy: -30.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -335.014940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.014940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.014940 (E_RNA) where: Base-Base interactions energy: -192.772 where: short stacking energy: -108.855 Base-Backbone interact. energy: 2.943 local terms energy: -145.186438 where: bonds (distance) C4'-P energy: -40.406 bonds (distance) P-C4' energy: -40.219 flat angles C4'-P-C4' energy: -34.153 flat angles P-C4'-P energy: -15.070 tors. eta vs tors. theta energy: -15.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -403.216724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.216724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.216724 (E_RNA) where: Base-Base interactions energy: -252.058 where: short stacking energy: -125.122 Base-Backbone interact. energy: 1.468 local terms energy: -152.626537 where: bonds (distance) C4'-P energy: -37.580 bonds (distance) P-C4' energy: -33.998 flat angles C4'-P-C4' energy: -36.216 flat angles P-C4'-P energy: -19.120 tors. eta vs tors. theta energy: -25.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -207.120162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.120162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.120162 (E_RNA) where: Base-Base interactions energy: -76.058 where: short stacking energy: -71.954 Base-Backbone interact. energy: 0.100 local terms energy: -131.161346 where: bonds (distance) C4'-P energy: -35.937 bonds (distance) P-C4' energy: -44.070 flat angles C4'-P-C4' energy: -34.424 flat angles P-C4'-P energy: -12.634 tors. eta vs tors. theta energy: -4.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -783.931348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.931348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.931348 (E_RNA) where: Base-Base interactions energy: -548.047 where: short stacking energy: -241.151 Base-Backbone interact. energy: -0.253 local terms energy: -235.631087 where: bonds (distance) C4'-P energy: -51.240 bonds (distance) P-C4' energy: -38.994 flat angles C4'-P-C4' energy: -47.978 flat angles P-C4'-P energy: -36.910 tors. eta vs tors. theta energy: -60.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -696.464946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.464946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.464946 (E_RNA) where: Base-Base interactions energy: -450.583 where: short stacking energy: -222.339 Base-Backbone interact. energy: -1.781 local terms energy: -244.100818 where: bonds (distance) C4'-P energy: -43.688 bonds (distance) P-C4' energy: -49.005 flat angles C4'-P-C4' energy: -56.397 flat angles P-C4'-P energy: -33.048 tors. eta vs tors. theta energy: -61.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -654.631854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.631854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.631854 (E_RNA) where: Base-Base interactions energy: -434.930 where: short stacking energy: -206.534 Base-Backbone interact. energy: -2.405 local terms energy: -217.296750 where: bonds (distance) C4'-P energy: -41.619 bonds (distance) P-C4' energy: -43.081 flat angles C4'-P-C4' energy: -48.598 flat angles P-C4'-P energy: -33.123 tors. eta vs tors. theta energy: -50.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -624.144206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.144206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.144206 (E_RNA) where: Base-Base interactions energy: -405.987 where: short stacking energy: -201.254 Base-Backbone interact. energy: -3.303 local terms energy: -214.853674 where: bonds (distance) C4'-P energy: -38.003 bonds (distance) P-C4' energy: -44.555 flat angles C4'-P-C4' energy: -45.113 flat angles P-C4'-P energy: -28.533 tors. eta vs tors. theta energy: -58.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -595.712142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.712142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.712142 (E_RNA) where: Base-Base interactions energy: -386.491 where: short stacking energy: -181.615 Base-Backbone interact. energy: -0.448 local terms energy: -208.772629 where: bonds (distance) C4'-P energy: -38.683 bonds (distance) P-C4' energy: -44.199 flat angles C4'-P-C4' energy: -57.027 flat angles P-C4'-P energy: -24.101 tors. eta vs tors. theta energy: -44.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -575.446477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.446477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.446477 (E_RNA) where: Base-Base interactions energy: -370.903 where: short stacking energy: -150.939 Base-Backbone interact. energy: -1.089 local terms energy: -203.455111 where: bonds (distance) C4'-P energy: -44.997 bonds (distance) P-C4' energy: -34.652 flat angles C4'-P-C4' energy: -48.740 flat angles P-C4'-P energy: -37.960 tors. eta vs tors. theta energy: -37.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -427.042723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.042723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.042723 (E_RNA) where: Base-Base interactions energy: -288.876 where: short stacking energy: -127.922 Base-Backbone interact. energy: -0.291 local terms energy: -137.875890 where: bonds (distance) C4'-P energy: -27.427 bonds (distance) P-C4' energy: -46.578 flat angles C4'-P-C4' energy: -32.711 flat angles P-C4'-P energy: -14.613 tors. eta vs tors. theta energy: -16.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -344.014768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.014768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.014768 (E_RNA) where: Base-Base interactions energy: -171.276 where: short stacking energy: -96.088 Base-Backbone interact. energy: -0.193 local terms energy: -172.546354 where: bonds (distance) C4'-P energy: -43.500 bonds (distance) P-C4' energy: -35.539 flat angles C4'-P-C4' energy: -49.072 flat angles P-C4'-P energy: -27.881 tors. eta vs tors. theta energy: -16.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -382.887225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.887225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.887225 (E_RNA) where: Base-Base interactions energy: -241.766 where: short stacking energy: -121.775 Base-Backbone interact. energy: -0.585 local terms energy: -140.536324 where: bonds (distance) C4'-P energy: -23.439 bonds (distance) P-C4' energy: -34.152 flat angles C4'-P-C4' energy: -30.602 flat angles P-C4'-P energy: -25.809 tors. eta vs tors. theta energy: -26.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -202.288765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.288765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.288765 (E_RNA) where: Base-Base interactions energy: -81.519 where: short stacking energy: -54.529 Base-Backbone interact. energy: 1.486 local terms energy: -122.255139 where: bonds (distance) C4'-P energy: -42.469 bonds (distance) P-C4' energy: -42.455 flat angles C4'-P-C4' energy: -24.728 flat angles P-C4'-P energy: -24.771 tors. eta vs tors. theta energy: 12.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -800.866854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.866854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.866854 (E_RNA) where: Base-Base interactions energy: -556.422 where: short stacking energy: -245.345 Base-Backbone interact. energy: 0.465 local terms energy: -244.909690 where: bonds (distance) C4'-P energy: -44.812 bonds (distance) P-C4' energy: -42.361 flat angles C4'-P-C4' energy: -55.092 flat angles P-C4'-P energy: -38.725 tors. eta vs tors. theta energy: -63.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -709.329682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.329682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.329682 (E_RNA) where: Base-Base interactions energy: -482.011 where: short stacking energy: -216.251 Base-Backbone interact. energy: -1.539 local terms energy: -225.779274 where: bonds (distance) C4'-P energy: -42.880 bonds (distance) P-C4' energy: -49.555 flat angles C4'-P-C4' energy: -45.164 flat angles P-C4'-P energy: -32.085 tors. eta vs tors. theta energy: -56.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -660.436289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.436289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.436289 (E_RNA) where: Base-Base interactions energy: -447.113 where: short stacking energy: -191.186 Base-Backbone interact. energy: 0.262 local terms energy: -213.585179 where: bonds (distance) C4'-P energy: -46.049 bonds (distance) P-C4' energy: -47.063 flat angles C4'-P-C4' energy: -37.220 flat angles P-C4'-P energy: -32.016 tors. eta vs tors. theta energy: -51.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -656.676677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.676677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.676677 (E_RNA) where: Base-Base interactions energy: -445.944 where: short stacking energy: -206.901 Base-Backbone interact. energy: -0.269 local terms energy: -210.463534 where: bonds (distance) C4'-P energy: -36.830 bonds (distance) P-C4' energy: -40.150 flat angles C4'-P-C4' energy: -52.740 flat angles P-C4'-P energy: -31.337 tors. eta vs tors. theta energy: -49.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -611.310100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.310100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.310100 (E_RNA) where: Base-Base interactions energy: -401.698 where: short stacking energy: -193.413 Base-Backbone interact. energy: -0.941 local terms energy: -208.671195 where: bonds (distance) C4'-P energy: -35.344 bonds (distance) P-C4' energy: -46.018 flat angles C4'-P-C4' energy: -47.118 flat angles P-C4'-P energy: -30.718 tors. eta vs tors. theta energy: -49.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -565.732416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.732416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.732416 (E_RNA) where: Base-Base interactions energy: -383.577 where: short stacking energy: -166.065 Base-Backbone interact. energy: 3.856 local terms energy: -186.011669 where: bonds (distance) C4'-P energy: -45.234 bonds (distance) P-C4' energy: -26.201 flat angles C4'-P-C4' energy: -47.261 flat angles P-C4'-P energy: -26.216 tors. eta vs tors. theta energy: -41.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -458.984237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.984237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.984237 (E_RNA) where: Base-Base interactions energy: -272.438 where: short stacking energy: -137.463 Base-Backbone interact. energy: -0.745 local terms energy: -185.801856 where: bonds (distance) C4'-P energy: -47.859 bonds (distance) P-C4' energy: -43.664 flat angles C4'-P-C4' energy: -39.791 flat angles P-C4'-P energy: -22.589 tors. eta vs tors. theta energy: -31.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -420.206875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.206875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.206875 (E_RNA) where: Base-Base interactions energy: -265.822 where: short stacking energy: -147.679 Base-Backbone interact. energy: 4.308 local terms energy: -158.692133 where: bonds (distance) C4'-P energy: -35.797 bonds (distance) P-C4' energy: -35.114 flat angles C4'-P-C4' energy: -34.686 flat angles P-C4'-P energy: -27.153 tors. eta vs tors. theta energy: -25.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -334.845967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.845967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.845967 (E_RNA) where: Base-Base interactions energy: -176.520 where: short stacking energy: -106.177 Base-Backbone interact. energy: -0.794 local terms energy: -157.531796 where: bonds (distance) C4'-P energy: -37.282 bonds (distance) P-C4' energy: -40.175 flat angles C4'-P-C4' energy: -44.489 flat angles P-C4'-P energy: -22.025 tors. eta vs tors. theta energy: -13.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -213.764266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.764266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.764266 (E_RNA) where: Base-Base interactions energy: -76.896 where: short stacking energy: -71.114 Base-Backbone interact. energy: -0.371 local terms energy: -136.497541 where: bonds (distance) C4'-P energy: -34.729 bonds (distance) P-C4' energy: -42.591 flat angles C4'-P-C4' energy: -40.128 flat angles P-C4'-P energy: -15.547 tors. eta vs tors. theta energy: -3.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -779.979723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.979723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.979723 (E_RNA) where: Base-Base interactions energy: -541.874 where: short stacking energy: -231.734 Base-Backbone interact. energy: -0.889 local terms energy: -237.217114 where: bonds (distance) C4'-P energy: -43.411 bonds (distance) P-C4' energy: -42.534 flat angles C4'-P-C4' energy: -51.140 flat angles P-C4'-P energy: -37.292 tors. eta vs tors. theta energy: -62.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -696.409062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.409062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.409062 (E_RNA) where: Base-Base interactions energy: -471.326 where: short stacking energy: -226.369 Base-Backbone interact. energy: -0.222 local terms energy: -224.861643 where: bonds (distance) C4'-P energy: -34.058 bonds (distance) P-C4' energy: -46.364 flat angles C4'-P-C4' energy: -45.705 flat angles P-C4'-P energy: -36.266 tors. eta vs tors. theta energy: -62.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -664.251491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.251491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.251491 (E_RNA) where: Base-Base interactions energy: -448.340 where: short stacking energy: -197.560 Base-Backbone interact. energy: -1.411 local terms energy: -214.500099 where: bonds (distance) C4'-P energy: -35.157 bonds (distance) P-C4' energy: -45.791 flat angles C4'-P-C4' energy: -47.981 flat angles P-C4'-P energy: -31.451 tors. eta vs tors. theta energy: -54.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -684.524547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.524547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.524547 (E_RNA) where: Base-Base interactions energy: -460.110 where: short stacking energy: -217.600 Base-Backbone interact. energy: -0.143 local terms energy: -224.271814 where: bonds (distance) C4'-P energy: -39.813 bonds (distance) P-C4' energy: -43.507 flat angles C4'-P-C4' energy: -47.990 flat angles P-C4'-P energy: -35.218 tors. eta vs tors. theta energy: -57.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -590.320848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.320848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.320848 (E_RNA) where: Base-Base interactions energy: -387.725 where: short stacking energy: -179.865 Base-Backbone interact. energy: -0.951 local terms energy: -201.644573 where: bonds (distance) C4'-P energy: -38.875 bonds (distance) P-C4' energy: -44.571 flat angles C4'-P-C4' energy: -47.479 flat angles P-C4'-P energy: -32.233 tors. eta vs tors. theta energy: -38.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -592.486674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.486674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.486674 (E_RNA) where: Base-Base interactions energy: -391.669 where: short stacking energy: -203.107 Base-Backbone interact. energy: -0.118 local terms energy: -200.699201 where: bonds (distance) C4'-P energy: -41.808 bonds (distance) P-C4' energy: -41.179 flat angles C4'-P-C4' energy: -46.638 flat angles P-C4'-P energy: -20.601 tors. eta vs tors. theta energy: -50.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -463.761997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.761997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.761997 (E_RNA) where: Base-Base interactions energy: -282.581 where: short stacking energy: -138.735 Base-Backbone interact. energy: -0.875 local terms energy: -180.306279 where: bonds (distance) C4'-P energy: -46.594 bonds (distance) P-C4' energy: -39.575 flat angles C4'-P-C4' energy: -30.471 flat angles P-C4'-P energy: -29.562 tors. eta vs tors. theta energy: -34.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -464.833706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.833706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.833706 (E_RNA) where: Base-Base interactions energy: -287.310 where: short stacking energy: -141.295 Base-Backbone interact. energy: 0.872 local terms energy: -178.395325 where: bonds (distance) C4'-P energy: -29.844 bonds (distance) P-C4' energy: -44.273 flat angles C4'-P-C4' energy: -45.951 flat angles P-C4'-P energy: -29.422 tors. eta vs tors. theta energy: -28.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -325.082736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.082736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.082736 (E_RNA) where: Base-Base interactions energy: -167.051 where: short stacking energy: -91.891 Base-Backbone interact. energy: -1.939 local terms energy: -156.093289 where: bonds (distance) C4'-P energy: -37.914 bonds (distance) P-C4' energy: -35.347 flat angles C4'-P-C4' energy: -40.830 flat angles P-C4'-P energy: -31.606 tors. eta vs tors. theta energy: -10.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -237.914094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.914094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.914094 (E_RNA) where: Base-Base interactions energy: -92.462 where: short stacking energy: -69.923 Base-Backbone interact. energy: 0.085 local terms energy: -145.536475 where: bonds (distance) C4'-P energy: -40.136 bonds (distance) P-C4' energy: -45.421 flat angles C4'-P-C4' energy: -26.941 flat angles P-C4'-P energy: -23.992 tors. eta vs tors. theta energy: -9.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -802.477405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.477405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.477405 (E_RNA) where: Base-Base interactions energy: -552.082 where: short stacking energy: -232.600 Base-Backbone interact. energy: -2.071 local terms energy: -248.324520 where: bonds (distance) C4'-P energy: -46.684 bonds (distance) P-C4' energy: -48.961 flat angles C4'-P-C4' energy: -50.567 flat angles P-C4'-P energy: -32.107 tors. eta vs tors. theta energy: -70.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -688.375908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.375908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.375908 (E_RNA) where: Base-Base interactions energy: -461.031 where: short stacking energy: -211.697 Base-Backbone interact. energy: -1.587 local terms energy: -225.758010 where: bonds (distance) C4'-P energy: -43.951 bonds (distance) P-C4' energy: -47.774 flat angles C4'-P-C4' energy: -47.459 flat angles P-C4'-P energy: -36.513 tors. eta vs tors. theta energy: -50.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -688.485085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.485085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.485085 (E_RNA) where: Base-Base interactions energy: -455.673 where: short stacking energy: -218.519 Base-Backbone interact. energy: -0.383 local terms energy: -232.429068 where: bonds (distance) C4'-P energy: -44.698 bonds (distance) P-C4' energy: -42.697 flat angles C4'-P-C4' energy: -50.686 flat angles P-C4'-P energy: -34.281 tors. eta vs tors. theta energy: -60.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -670.694139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.694139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.694139 (E_RNA) where: Base-Base interactions energy: -447.379 where: short stacking energy: -208.616 Base-Backbone interact. energy: -0.875 local terms energy: -222.440465 where: bonds (distance) C4'-P energy: -42.044 bonds (distance) P-C4' energy: -39.192 flat angles C4'-P-C4' energy: -49.326 flat angles P-C4'-P energy: -32.271 tors. eta vs tors. theta energy: -59.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -609.186521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.186521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.186521 (E_RNA) where: Base-Base interactions energy: -411.136 where: short stacking energy: -187.345 Base-Backbone interact. energy: -1.326 local terms energy: -196.725018 where: bonds (distance) C4'-P energy: -37.061 bonds (distance) P-C4' energy: -33.575 flat angles C4'-P-C4' energy: -46.824 flat angles P-C4'-P energy: -29.695 tors. eta vs tors. theta energy: -49.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -572.960196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.960196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.960196 (E_RNA) where: Base-Base interactions energy: -380.355 where: short stacking energy: -174.441 Base-Backbone interact. energy: -2.008 local terms energy: -190.597115 where: bonds (distance) C4'-P energy: -43.823 bonds (distance) P-C4' energy: -38.778 flat angles C4'-P-C4' energy: -47.445 flat angles P-C4'-P energy: -24.795 tors. eta vs tors. theta energy: -35.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -480.061667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.061667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.061667 (E_RNA) where: Base-Base interactions energy: -320.576 where: short stacking energy: -146.881 Base-Backbone interact. energy: -0.861 local terms energy: -158.624049 where: bonds (distance) C4'-P energy: -39.098 bonds (distance) P-C4' energy: -37.644 flat angles C4'-P-C4' energy: -37.946 flat angles P-C4'-P energy: -19.209 tors. eta vs tors. theta energy: -24.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -437.300244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.300244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.300244 (E_RNA) where: Base-Base interactions energy: -285.134 where: short stacking energy: -131.818 Base-Backbone interact. energy: 0.297 local terms energy: -152.463720 where: bonds (distance) C4'-P energy: -38.798 bonds (distance) P-C4' energy: -34.549 flat angles C4'-P-C4' energy: -37.336 flat angles P-C4'-P energy: -19.212 tors. eta vs tors. theta energy: -22.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -355.960198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.960198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.960198 (E_RNA) where: Base-Base interactions energy: -199.930 where: short stacking energy: -102.549 Base-Backbone interact. energy: -0.828 local terms energy: -155.201795 where: bonds (distance) C4'-P energy: -40.978 bonds (distance) P-C4' energy: -40.179 flat angles C4'-P-C4' energy: -28.865 flat angles P-C4'-P energy: -25.176 tors. eta vs tors. theta energy: -20.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -196.828576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.828576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.828576 (E_RNA) where: Base-Base interactions energy: -87.908 where: short stacking energy: -60.562 Base-Backbone interact. energy: 0.122 local terms energy: -109.042474 where: bonds (distance) C4'-P energy: -28.228 bonds (distance) P-C4' energy: -36.006 flat angles C4'-P-C4' energy: -33.756 flat angles P-C4'-P energy: -24.140 tors. eta vs tors. theta energy: 13.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -795.631594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.631594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.631594 (E_RNA) where: Base-Base interactions energy: -541.348 where: short stacking energy: -237.487 Base-Backbone interact. energy: -1.195 local terms energy: -253.088505 where: bonds (distance) C4'-P energy: -48.123 bonds (distance) P-C4' energy: -45.284 flat angles C4'-P-C4' energy: -55.222 flat angles P-C4'-P energy: -37.422 tors. eta vs tors. theta energy: -67.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -668.067929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.067929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.067929 (E_RNA) where: Base-Base interactions energy: -463.092 where: short stacking energy: -215.744 Base-Backbone interact. energy: 0.704 local terms energy: -205.679542 where: bonds (distance) C4'-P energy: -28.834 bonds (distance) P-C4' energy: -43.630 flat angles C4'-P-C4' energy: -47.175 flat angles P-C4'-P energy: -33.229 tors. eta vs tors. theta energy: -52.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -701.858532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.858532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.858532 (E_RNA) where: Base-Base interactions energy: -462.462 where: short stacking energy: -221.248 Base-Backbone interact. energy: 0.078 local terms energy: -239.474121 where: bonds (distance) C4'-P energy: -45.325 bonds (distance) P-C4' energy: -43.886 flat angles C4'-P-C4' energy: -54.909 flat angles P-C4'-P energy: -35.672 tors. eta vs tors. theta energy: -59.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -684.120858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.120858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.120858 (E_RNA) where: Base-Base interactions energy: -460.083 where: short stacking energy: -211.018 Base-Backbone interact. energy: 0.689 local terms energy: -224.727284 where: bonds (distance) C4'-P energy: -41.799 bonds (distance) P-C4' energy: -49.422 flat angles C4'-P-C4' energy: -47.956 flat angles P-C4'-P energy: -33.492 tors. eta vs tors. theta energy: -52.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -654.793866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.793866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.793866 (E_RNA) where: Base-Base interactions energy: -460.146 where: short stacking energy: -197.976 Base-Backbone interact. energy: -2.204 local terms energy: -192.443577 where: bonds (distance) C4'-P energy: -35.211 bonds (distance) P-C4' energy: -41.104 flat angles C4'-P-C4' energy: -40.801 flat angles P-C4'-P energy: -26.993 tors. eta vs tors. theta energy: -48.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -559.995693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.995693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.995693 (E_RNA) where: Base-Base interactions energy: -373.743 where: short stacking energy: -182.575 Base-Backbone interact. energy: -3.430 local terms energy: -182.822314 where: bonds (distance) C4'-P energy: -33.992 bonds (distance) P-C4' energy: -40.662 flat angles C4'-P-C4' energy: -39.396 flat angles P-C4'-P energy: -31.024 tors. eta vs tors. theta energy: -37.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -482.370595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.370595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.370595 (E_RNA) where: Base-Base interactions energy: -309.460 where: short stacking energy: -143.487 Base-Backbone interact. energy: 0.502 local terms energy: -173.412542 where: bonds (distance) C4'-P energy: -42.426 bonds (distance) P-C4' energy: -39.216 flat angles C4'-P-C4' energy: -38.617 flat angles P-C4'-P energy: -23.865 tors. eta vs tors. theta energy: -29.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -412.729506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.729506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.729506 (E_RNA) where: Base-Base interactions energy: -243.187 where: short stacking energy: -133.761 Base-Backbone interact. energy: 0.040 local terms energy: -169.581639 where: bonds (distance) C4'-P energy: -41.338 bonds (distance) P-C4' energy: -35.614 flat angles C4'-P-C4' energy: -41.806 flat angles P-C4'-P energy: -29.659 tors. eta vs tors. theta energy: -21.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -235.128063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.128063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.128063 (E_RNA) where: Base-Base interactions energy: -90.161 where: short stacking energy: -77.842 Base-Backbone interact. energy: -1.509 local terms energy: -143.458813 where: bonds (distance) C4'-P energy: -42.325 bonds (distance) P-C4' energy: -38.555 flat angles C4'-P-C4' energy: -30.091 flat angles P-C4'-P energy: -24.998 tors. eta vs tors. theta energy: -7.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -307.170676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.170676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.170676 (E_RNA) where: Base-Base interactions energy: -161.444 where: short stacking energy: -86.577 Base-Backbone interact. energy: 3.469 local terms energy: -149.195864 where: bonds (distance) C4'-P energy: -46.007 bonds (distance) P-C4' energy: -34.379 flat angles C4'-P-C4' energy: -37.956 flat angles P-C4'-P energy: -23.721 tors. eta vs tors. theta energy: -7.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -799.254667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.254667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.254667 (E_RNA) where: Base-Base interactions energy: -552.923 where: short stacking energy: -240.061 Base-Backbone interact. energy: 1.240 local terms energy: -247.571275 where: bonds (distance) C4'-P energy: -43.107 bonds (distance) P-C4' energy: -45.278 flat angles C4'-P-C4' energy: -46.793 flat angles P-C4'-P energy: -41.363 tors. eta vs tors. theta energy: -71.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -721.618312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.618312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.618312 (E_RNA) where: Base-Base interactions energy: -494.581 where: short stacking energy: -225.752 Base-Backbone interact. energy: 1.694 local terms energy: -228.731153 where: bonds (distance) C4'-P energy: -47.808 bonds (distance) P-C4' energy: -43.437 flat angles C4'-P-C4' energy: -49.844 flat angles P-C4'-P energy: -32.575 tors. eta vs tors. theta energy: -55.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -658.149675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.149675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.149675 (E_RNA) where: Base-Base interactions energy: -446.211 where: short stacking energy: -200.423 Base-Backbone interact. energy: -0.864 local terms energy: -211.074457 where: bonds (distance) C4'-P energy: -37.781 bonds (distance) P-C4' energy: -39.298 flat angles C4'-P-C4' energy: -49.879 flat angles P-C4'-P energy: -35.180 tors. eta vs tors. theta energy: -48.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -646.518821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.518821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.518821 (E_RNA) where: Base-Base interactions energy: -431.096 where: short stacking energy: -198.883 Base-Backbone interact. energy: -1.316 local terms energy: -214.106841 where: bonds (distance) C4'-P energy: -42.497 bonds (distance) P-C4' energy: -40.835 flat angles C4'-P-C4' energy: -47.016 flat angles P-C4'-P energy: -31.478 tors. eta vs tors. theta energy: -52.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -653.521520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.521520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.521520 (E_RNA) where: Base-Base interactions energy: -448.736 where: short stacking energy: -186.601 Base-Backbone interact. energy: -2.172 local terms energy: -202.614123 where: bonds (distance) C4'-P energy: -41.532 bonds (distance) P-C4' energy: -47.091 flat angles C4'-P-C4' energy: -39.743 flat angles P-C4'-P energy: -25.187 tors. eta vs tors. theta energy: -49.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -526.943981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.943981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.943981 (E_RNA) where: Base-Base interactions energy: -348.771 where: short stacking energy: -168.631 Base-Backbone interact. energy: 0.496 local terms energy: -178.668345 where: bonds (distance) C4'-P energy: -25.909 bonds (distance) P-C4' energy: -45.159 flat angles C4'-P-C4' energy: -48.244 flat angles P-C4'-P energy: -19.169 tors. eta vs tors. theta energy: -40.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -508.689949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.689949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.689949 (E_RNA) where: Base-Base interactions energy: -325.098 where: short stacking energy: -164.603 Base-Backbone interact. energy: -0.321 local terms energy: -183.270993 where: bonds (distance) C4'-P energy: -36.676 bonds (distance) P-C4' energy: -44.955 flat angles C4'-P-C4' energy: -43.033 flat angles P-C4'-P energy: -20.698 tors. eta vs tors. theta energy: -37.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -439.761994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.761994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.761994 (E_RNA) where: Base-Base interactions energy: -280.609 where: short stacking energy: -139.481 Base-Backbone interact. energy: 0.403 local terms energy: -159.556086 where: bonds (distance) C4'-P energy: -46.373 bonds (distance) P-C4' energy: -34.826 flat angles C4'-P-C4' energy: -30.912 flat angles P-C4'-P energy: -17.436 tors. eta vs tors. theta energy: -30.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -224.004722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.004722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.004722 (E_RNA) where: Base-Base interactions energy: -89.058 where: short stacking energy: -69.752 Base-Backbone interact. energy: 0.346 local terms energy: -135.292294 where: bonds (distance) C4'-P energy: -38.600 bonds (distance) P-C4' energy: -34.700 flat angles C4'-P-C4' energy: -31.926 flat angles P-C4'-P energy: -23.815 tors. eta vs tors. theta energy: -6.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -312.362730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.362730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.362730 (E_RNA) where: Base-Base interactions energy: -177.359 where: short stacking energy: -90.868 Base-Backbone interact. energy: 1.058 local terms energy: -136.061809 where: bonds (distance) C4'-P energy: -34.665 bonds (distance) P-C4' energy: -42.906 flat angles C4'-P-C4' energy: -31.819 flat angles P-C4'-P energy: -18.296 tors. eta vs tors. theta energy: -8.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -795.808632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.808632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.808632 (E_RNA) where: Base-Base interactions energy: -535.658 where: short stacking energy: -243.897 Base-Backbone interact. energy: -0.608 local terms energy: -259.542726 where: bonds (distance) C4'-P energy: -46.616 bonds (distance) P-C4' energy: -49.821 flat angles C4'-P-C4' energy: -58.742 flat angles P-C4'-P energy: -34.910 tors. eta vs tors. theta energy: -69.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -698.643846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.643846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.643846 (E_RNA) where: Base-Base interactions energy: -469.409 where: short stacking energy: -226.934 Base-Backbone interact. energy: 1.772 local terms energy: -231.007045 where: bonds (distance) C4'-P energy: -41.123 bonds (distance) P-C4' energy: -50.184 flat angles C4'-P-C4' energy: -50.991 flat angles P-C4'-P energy: -29.309 tors. eta vs tors. theta energy: -59.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -658.754972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.754972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.754972 (E_RNA) where: Base-Base interactions energy: -447.063 where: short stacking energy: -200.479 Base-Backbone interact. energy: -0.444 local terms energy: -211.248289 where: bonds (distance) C4'-P energy: -38.054 bonds (distance) P-C4' energy: -45.623 flat angles C4'-P-C4' energy: -45.907 flat angles P-C4'-P energy: -30.579 tors. eta vs tors. theta energy: -51.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -642.383941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.383941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.383941 (E_RNA) where: Base-Base interactions energy: -431.276 where: short stacking energy: -200.713 Base-Backbone interact. energy: -0.325 local terms energy: -210.783011 where: bonds (distance) C4'-P energy: -44.672 bonds (distance) P-C4' energy: -39.527 flat angles C4'-P-C4' energy: -47.091 flat angles P-C4'-P energy: -27.624 tors. eta vs tors. theta energy: -51.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -560.813152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.813152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.813152 (E_RNA) where: Base-Base interactions energy: -368.052 where: short stacking energy: -169.685 Base-Backbone interact. energy: -1.208 local terms energy: -191.553407 where: bonds (distance) C4'-P energy: -35.726 bonds (distance) P-C4' energy: -39.320 flat angles C4'-P-C4' energy: -43.853 flat angles P-C4'-P energy: -30.097 tors. eta vs tors. theta energy: -42.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -668.563211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.563211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.563211 (E_RNA) where: Base-Base interactions energy: -455.210 where: short stacking energy: -203.725 Base-Backbone interact. energy: -2.128 local terms energy: -211.225432 where: bonds (distance) C4'-P energy: -38.168 bonds (distance) P-C4' energy: -41.219 flat angles C4'-P-C4' energy: -42.596 flat angles P-C4'-P energy: -31.206 tors. eta vs tors. theta energy: -58.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -547.587196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.587196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.587196 (E_RNA) where: Base-Base interactions energy: -346.190 where: short stacking energy: -182.877 Base-Backbone interact. energy: -2.004 local terms energy: -199.392993 where: bonds (distance) C4'-P energy: -43.670 bonds (distance) P-C4' energy: -39.050 flat angles C4'-P-C4' energy: -44.331 flat angles P-C4'-P energy: -26.297 tors. eta vs tors. theta energy: -46.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -407.064421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.064421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.064421 (E_RNA) where: Base-Base interactions energy: -255.752 where: short stacking energy: -125.793 Base-Backbone interact. energy: -1.373 local terms energy: -149.938723 where: bonds (distance) C4'-P energy: -34.948 bonds (distance) P-C4' energy: -30.696 flat angles C4'-P-C4' energy: -42.144 flat angles P-C4'-P energy: -24.851 tors. eta vs tors. theta energy: -17.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -310.470732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.470732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.470732 (E_RNA) where: Base-Base interactions energy: -164.129 where: short stacking energy: -102.193 Base-Backbone interact. energy: -0.608 local terms energy: -145.733484 where: bonds (distance) C4'-P energy: -39.128 bonds (distance) P-C4' energy: -36.787 flat angles C4'-P-C4' energy: -35.677 flat angles P-C4'-P energy: -20.894 tors. eta vs tors. theta energy: -13.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -245.936286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.936286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.936286 (E_RNA) where: Base-Base interactions energy: -96.130 where: short stacking energy: -64.381 Base-Backbone interact. energy: -3.036 local terms energy: -146.769988 where: bonds (distance) C4'-P energy: -46.116 bonds (distance) P-C4' energy: -35.687 flat angles C4'-P-C4' energy: -31.024 flat angles P-C4'-P energy: -29.902 tors. eta vs tors. theta energy: -4.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -797.566183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.566183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.566183 (E_RNA) where: Base-Base interactions energy: -540.974 where: short stacking energy: -227.934 Base-Backbone interact. energy: -0.230 local terms energy: -256.362680 where: bonds (distance) C4'-P energy: -45.113 bonds (distance) P-C4' energy: -49.186 flat angles C4'-P-C4' energy: -51.976 flat angles P-C4'-P energy: -41.095 tors. eta vs tors. theta energy: -68.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -706.829543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.829543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.829543 (E_RNA) where: Base-Base interactions energy: -479.822 where: short stacking energy: -228.663 Base-Backbone interact. energy: -0.106 local terms energy: -226.901031 where: bonds (distance) C4'-P energy: -36.498 bonds (distance) P-C4' energy: -44.152 flat angles C4'-P-C4' energy: -52.869 flat angles P-C4'-P energy: -33.274 tors. eta vs tors. theta energy: -60.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -683.034527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.034527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.034527 (E_RNA) where: Base-Base interactions energy: -454.221 where: short stacking energy: -225.389 Base-Backbone interact. energy: -0.083 local terms energy: -228.730351 where: bonds (distance) C4'-P energy: -40.275 bonds (distance) P-C4' energy: -47.804 flat angles C4'-P-C4' energy: -51.416 flat angles P-C4'-P energy: -30.107 tors. eta vs tors. theta energy: -59.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -677.158649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.158649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.158649 (E_RNA) where: Base-Base interactions energy: -449.459 where: short stacking energy: -217.578 Base-Backbone interact. energy: -0.232 local terms energy: -227.467970 where: bonds (distance) C4'-P energy: -47.800 bonds (distance) P-C4' energy: -38.321 flat angles C4'-P-C4' energy: -43.679 flat angles P-C4'-P energy: -37.508 tors. eta vs tors. theta energy: -60.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -537.178640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.178640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.178640 (E_RNA) where: Base-Base interactions energy: -349.399 where: short stacking energy: -149.766 Base-Backbone interact. energy: -2.374 local terms energy: -185.405917 where: bonds (distance) C4'-P energy: -40.700 bonds (distance) P-C4' energy: -42.027 flat angles C4'-P-C4' energy: -43.059 flat angles P-C4'-P energy: -26.463 tors. eta vs tors. theta energy: -33.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -665.233079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.233079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.233079 (E_RNA) where: Base-Base interactions energy: -465.094 where: short stacking energy: -202.215 Base-Backbone interact. energy: -0.503 local terms energy: -199.636267 where: bonds (distance) C4'-P energy: -28.641 bonds (distance) P-C4' energy: -41.336 flat angles C4'-P-C4' energy: -50.654 flat angles P-C4'-P energy: -24.289 tors. eta vs tors. theta energy: -54.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -537.231575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.231575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.231575 (E_RNA) where: Base-Base interactions energy: -353.328 where: short stacking energy: -170.755 Base-Backbone interact. energy: 1.211 local terms energy: -185.114539 where: bonds (distance) C4'-P energy: -38.951 bonds (distance) P-C4' energy: -46.453 flat angles C4'-P-C4' energy: -32.521 flat angles P-C4'-P energy: -24.327 tors. eta vs tors. theta energy: -42.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -353.193607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.193607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.193607 (E_RNA) where: Base-Base interactions energy: -204.268 where: short stacking energy: -94.175 Base-Backbone interact. energy: -1.046 local terms energy: -147.880380 where: bonds (distance) C4'-P energy: -44.057 bonds (distance) P-C4' energy: -40.880 flat angles C4'-P-C4' energy: -33.706 flat angles P-C4'-P energy: -22.809 tors. eta vs tors. theta energy: -6.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -307.056481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.056481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.056481 (E_RNA) where: Base-Base interactions energy: -162.464 where: short stacking energy: -98.071 Base-Backbone interact. energy: -0.704 local terms energy: -143.889293 where: bonds (distance) C4'-P energy: -32.236 bonds (distance) P-C4' energy: -34.531 flat angles C4'-P-C4' energy: -42.709 flat angles P-C4'-P energy: -26.205 tors. eta vs tors. theta energy: -8.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -232.510460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.510460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.510460 (E_RNA) where: Base-Base interactions energy: -112.820 where: short stacking energy: -63.329 Base-Backbone interact. energy: -0.801 local terms energy: -118.889603 where: bonds (distance) C4'-P energy: -40.013 bonds (distance) P-C4' energy: -28.896 flat angles C4'-P-C4' energy: -30.621 flat angles P-C4'-P energy: -19.982 tors. eta vs tors. theta energy: 0.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -797.660558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.660558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.660558 (E_RNA) where: Base-Base interactions energy: -548.991 where: short stacking energy: -234.506 Base-Backbone interact. energy: 0.797 local terms energy: -249.466732 where: bonds (distance) C4'-P energy: -55.276 bonds (distance) P-C4' energy: -49.195 flat angles C4'-P-C4' energy: -43.923 flat angles P-C4'-P energy: -39.131 tors. eta vs tors. theta energy: -61.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -714.099325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.099325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.099325 (E_RNA) where: Base-Base interactions energy: -462.873 where: short stacking energy: -225.414 Base-Backbone interact. energy: -2.758 local terms energy: -248.468852 where: bonds (distance) C4'-P energy: -45.037 bonds (distance) P-C4' energy: -48.820 flat angles C4'-P-C4' energy: -49.352 flat angles P-C4'-P energy: -38.807 tors. eta vs tors. theta energy: -66.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -694.417333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.417333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.417333 (E_RNA) where: Base-Base interactions energy: -466.850 where: short stacking energy: -221.352 Base-Backbone interact. energy: -0.843 local terms energy: -226.724340 where: bonds (distance) C4'-P energy: -43.305 bonds (distance) P-C4' energy: -34.793 flat angles C4'-P-C4' energy: -54.377 flat angles P-C4'-P energy: -32.030 tors. eta vs tors. theta energy: -62.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -654.371714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.371714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.371714 (E_RNA) where: Base-Base interactions energy: -433.782 where: short stacking energy: -202.057 Base-Backbone interact. energy: -1.053 local terms energy: -219.537287 where: bonds (distance) C4'-P energy: -41.459 bonds (distance) P-C4' energy: -45.879 flat angles C4'-P-C4' energy: -44.279 flat angles P-C4'-P energy: -33.112 tors. eta vs tors. theta energy: -54.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -670.061906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.061906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.061906 (E_RNA) where: Base-Base interactions energy: -452.111 where: short stacking energy: -208.112 Base-Backbone interact. energy: -0.065 local terms energy: -217.885858 where: bonds (distance) C4'-P energy: -48.006 bonds (distance) P-C4' energy: -46.518 flat angles C4'-P-C4' energy: -41.664 flat angles P-C4'-P energy: -21.997 tors. eta vs tors. theta energy: -59.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -549.794116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.794116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.794116 (E_RNA) where: Base-Base interactions energy: -359.349 where: short stacking energy: -178.935 Base-Backbone interact. energy: -0.601 local terms energy: -189.844735 where: bonds (distance) C4'-P energy: -42.429 bonds (distance) P-C4' energy: -28.859 flat angles C4'-P-C4' energy: -45.611 flat angles P-C4'-P energy: -27.753 tors. eta vs tors. theta energy: -45.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -473.798142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.798142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.798142 (E_RNA) where: Base-Base interactions energy: -296.196 where: short stacking energy: -132.981 Base-Backbone interact. energy: -1.151 local terms energy: -176.451930 where: bonds (distance) C4'-P energy: -42.422 bonds (distance) P-C4' energy: -44.649 flat angles C4'-P-C4' energy: -42.836 flat angles P-C4'-P energy: -30.260 tors. eta vs tors. theta energy: -16.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -348.424413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.424413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.424413 (E_RNA) where: Base-Base interactions energy: -208.786 where: short stacking energy: -108.529 Base-Backbone interact. energy: -1.513 local terms energy: -138.125476 where: bonds (distance) C4'-P energy: -43.090 bonds (distance) P-C4' energy: -28.677 flat angles C4'-P-C4' energy: -40.147 flat angles P-C4'-P energy: -20.391 tors. eta vs tors. theta energy: -5.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -337.912491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.912491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.912491 (E_RNA) where: Base-Base interactions energy: -177.920 where: short stacking energy: -112.188 Base-Backbone interact. energy: -0.670 local terms energy: -159.322326 where: bonds (distance) C4'-P energy: -43.804 bonds (distance) P-C4' energy: -38.513 flat angles C4'-P-C4' energy: -34.716 flat angles P-C4'-P energy: -25.803 tors. eta vs tors. theta energy: -16.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -231.914068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.914068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.914068 (E_RNA) where: Base-Base interactions energy: -103.321 where: short stacking energy: -97.466 Base-Backbone interact. energy: 1.930 local terms energy: -130.523618 where: bonds (distance) C4'-P energy: -35.058 bonds (distance) P-C4' energy: -50.642 flat angles C4'-P-C4' energy: -29.548 flat angles P-C4'-P energy: -9.138 tors. eta vs tors. theta energy: -6.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -798.414920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.414920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.414920 (E_RNA) where: Base-Base interactions energy: -546.992 where: short stacking energy: -230.408 Base-Backbone interact. energy: -0.336 local terms energy: -251.086518 where: bonds (distance) C4'-P energy: -45.762 bonds (distance) P-C4' energy: -47.977 flat angles C4'-P-C4' energy: -55.600 flat angles P-C4'-P energy: -34.972 tors. eta vs tors. theta energy: -66.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -717.013708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.013708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.013708 (E_RNA) where: Base-Base interactions energy: -481.441 where: short stacking energy: -240.936 Base-Backbone interact. energy: -0.633 local terms energy: -234.939834 where: bonds (distance) C4'-P energy: -42.616 bonds (distance) P-C4' energy: -47.181 flat angles C4'-P-C4' energy: -47.911 flat angles P-C4'-P energy: -34.615 tors. eta vs tors. theta energy: -62.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -700.016934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.016934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.016934 (E_RNA) where: Base-Base interactions energy: -460.993 where: short stacking energy: -234.611 Base-Backbone interact. energy: -0.883 local terms energy: -238.140977 where: bonds (distance) C4'-P energy: -44.389 bonds (distance) P-C4' energy: -45.739 flat angles C4'-P-C4' energy: -51.471 flat angles P-C4'-P energy: -30.031 tors. eta vs tors. theta energy: -66.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -693.661557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.661557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.661557 (E_RNA) where: Base-Base interactions energy: -468.492 where: short stacking energy: -215.217 Base-Backbone interact. energy: -0.565 local terms energy: -224.604018 where: bonds (distance) C4'-P energy: -41.384 bonds (distance) P-C4' energy: -42.395 flat angles C4'-P-C4' energy: -48.992 flat angles P-C4'-P energy: -36.884 tors. eta vs tors. theta energy: -54.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -639.455663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.455663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.455663 (E_RNA) where: Base-Base interactions energy: -429.898 where: short stacking energy: -211.146 Base-Backbone interact. energy: -1.156 local terms energy: -208.400790 where: bonds (distance) C4'-P energy: -44.357 bonds (distance) P-C4' energy: -33.598 flat angles C4'-P-C4' energy: -47.255 flat angles P-C4'-P energy: -34.836 tors. eta vs tors. theta energy: -48.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -542.711558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.711558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.711558 (E_RNA) where: Base-Base interactions energy: -350.920 where: short stacking energy: -174.928 Base-Backbone interact. energy: -0.092 local terms energy: -191.699456 where: bonds (distance) C4'-P energy: -40.552 bonds (distance) P-C4' energy: -43.126 flat angles C4'-P-C4' energy: -37.302 flat angles P-C4'-P energy: -26.976 tors. eta vs tors. theta energy: -43.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -480.350456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.350456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.350456 (E_RNA) where: Base-Base interactions energy: -293.098 where: short stacking energy: -143.508 Base-Backbone interact. energy: -1.126 local terms energy: -186.126842 where: bonds (distance) C4'-P energy: -41.201 bonds (distance) P-C4' energy: -46.900 flat angles C4'-P-C4' energy: -42.866 flat angles P-C4'-P energy: -18.623 tors. eta vs tors. theta energy: -36.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -422.964944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.964944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.964944 (E_RNA) where: Base-Base interactions energy: -259.194 where: short stacking energy: -131.880 Base-Backbone interact. energy: 0.373 local terms energy: -164.143958 where: bonds (distance) C4'-P energy: -34.133 bonds (distance) P-C4' energy: -45.141 flat angles C4'-P-C4' energy: -41.543 flat angles P-C4'-P energy: -23.046 tors. eta vs tors. theta energy: -20.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -328.188282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.188282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.188282 (E_RNA) where: Base-Base interactions energy: -171.560 where: short stacking energy: -98.591 Base-Backbone interact. energy: 0.110 local terms energy: -156.738587 where: bonds (distance) C4'-P energy: -44.676 bonds (distance) P-C4' energy: -39.404 flat angles C4'-P-C4' energy: -40.287 flat angles P-C4'-P energy: -21.029 tors. eta vs tors. theta energy: -11.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -190.787234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.787234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.787234 (E_RNA) where: Base-Base interactions energy: -68.666 where: short stacking energy: -65.111 Base-Backbone interact. energy: -0.847 local terms energy: -121.274232 where: bonds (distance) C4'-P energy: -27.890 bonds (distance) P-C4' energy: -41.126 flat angles C4'-P-C4' energy: -28.266 flat angles P-C4'-P energy: -24.092 tors. eta vs tors. theta energy: 0.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -806.320610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.320610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.320610 (E_RNA) where: Base-Base interactions energy: -562.835 where: short stacking energy: -243.255 Base-Backbone interact. energy: -1.448 local terms energy: -242.037094 where: bonds (distance) C4'-P energy: -41.982 bonds (distance) P-C4' energy: -47.254 flat angles C4'-P-C4' energy: -50.176 flat angles P-C4'-P energy: -35.061 tors. eta vs tors. theta energy: -67.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -727.216218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.216218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.216218 (E_RNA) where: Base-Base interactions energy: -499.371 where: short stacking energy: -221.919 Base-Backbone interact. energy: 1.004 local terms energy: -228.849185 where: bonds (distance) C4'-P energy: -37.810 bonds (distance) P-C4' energy: -45.015 flat angles C4'-P-C4' energy: -51.016 flat angles P-C4'-P energy: -36.424 tors. eta vs tors. theta energy: -58.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -714.420491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.420491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.420491 (E_RNA) where: Base-Base interactions energy: -485.555 where: short stacking energy: -220.539 Base-Backbone interact. energy: -1.013 local terms energy: -227.851882 where: bonds (distance) C4'-P energy: -33.907 bonds (distance) P-C4' energy: -46.574 flat angles C4'-P-C4' energy: -50.153 flat angles P-C4'-P energy: -37.051 tors. eta vs tors. theta energy: -60.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -690.695750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.695750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.695750 (E_RNA) where: Base-Base interactions energy: -469.996 where: short stacking energy: -207.360 Base-Backbone interact. energy: -0.109 local terms energy: -220.590619 where: bonds (distance) C4'-P energy: -43.232 bonds (distance) P-C4' energy: -44.546 flat angles C4'-P-C4' energy: -43.044 flat angles P-C4'-P energy: -28.468 tors. eta vs tors. theta energy: -61.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -619.159663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.159663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.159663 (E_RNA) where: Base-Base interactions energy: -422.757 where: short stacking energy: -173.693 Base-Backbone interact. energy: -0.901 local terms energy: -195.501607 where: bonds (distance) C4'-P energy: -43.114 bonds (distance) P-C4' energy: -34.390 flat angles C4'-P-C4' energy: -44.108 flat angles P-C4'-P energy: -33.450 tors. eta vs tors. theta energy: -40.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -568.663072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.663072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.663072 (E_RNA) where: Base-Base interactions energy: -374.611 where: short stacking energy: -163.493 Base-Backbone interact. energy: -0.251 local terms energy: -193.801359 where: bonds (distance) C4'-P energy: -42.137 bonds (distance) P-C4' energy: -38.657 flat angles C4'-P-C4' energy: -38.987 flat angles P-C4'-P energy: -34.558 tors. eta vs tors. theta energy: -39.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -492.778513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.778513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.778513 (E_RNA) where: Base-Base interactions energy: -305.565 where: short stacking energy: -140.922 Base-Backbone interact. energy: -0.814 local terms energy: -186.398821 where: bonds (distance) C4'-P energy: -40.294 bonds (distance) P-C4' energy: -36.371 flat angles C4'-P-C4' energy: -42.916 flat angles P-C4'-P energy: -35.305 tors. eta vs tors. theta energy: -31.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -463.358374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.358374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.358374 (E_RNA) where: Base-Base interactions energy: -286.763 where: short stacking energy: -136.864 Base-Backbone interact. energy: -0.596 local terms energy: -176.000340 where: bonds (distance) C4'-P energy: -38.092 bonds (distance) P-C4' energy: -44.043 flat angles C4'-P-C4' energy: -40.588 flat angles P-C4'-P energy: -24.531 tors. eta vs tors. theta energy: -28.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -309.739809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.739809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.739809 (E_RNA) where: Base-Base interactions energy: -164.589 where: short stacking energy: -107.268 Base-Backbone interact. energy: -0.837 local terms energy: -144.313823 where: bonds (distance) C4'-P energy: -30.330 bonds (distance) P-C4' energy: -37.924 flat angles C4'-P-C4' energy: -34.397 flat angles P-C4'-P energy: -27.775 tors. eta vs tors. theta energy: -13.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -229.656543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.656543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.656543 (E_RNA) where: Base-Base interactions energy: -75.431 where: short stacking energy: -75.253 Base-Backbone interact. energy: -0.185 local terms energy: -154.040632 where: bonds (distance) C4'-P energy: -36.502 bonds (distance) P-C4' energy: -48.809 flat angles C4'-P-C4' energy: -39.501 flat angles P-C4'-P energy: -22.756 tors. eta vs tors. theta energy: -6.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -802.200997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.200997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.200997 (E_RNA) where: Base-Base interactions energy: -551.643 where: short stacking energy: -238.274 Base-Backbone interact. energy: 2.300 local terms energy: -252.857962 where: bonds (distance) C4'-P energy: -47.179 bonds (distance) P-C4' energy: -48.317 flat angles C4'-P-C4' energy: -52.870 flat angles P-C4'-P energy: -36.517 tors. eta vs tors. theta energy: -67.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -727.948356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.948356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.948356 (E_RNA) where: Base-Base interactions energy: -486.020 where: short stacking energy: -215.145 Base-Backbone interact. energy: -0.474 local terms energy: -241.454547 where: bonds (distance) C4'-P energy: -47.292 bonds (distance) P-C4' energy: -48.780 flat angles C4'-P-C4' energy: -52.722 flat angles P-C4'-P energy: -35.079 tors. eta vs tors. theta energy: -57.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -720.288838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.288838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.288838 (E_RNA) where: Base-Base interactions energy: -486.300 where: short stacking energy: -213.284 Base-Backbone interact. energy: -0.843 local terms energy: -233.146058 where: bonds (distance) C4'-P energy: -48.471 bonds (distance) P-C4' energy: -51.234 flat angles C4'-P-C4' energy: -44.856 flat angles P-C4'-P energy: -25.652 tors. eta vs tors. theta energy: -62.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -689.905908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.905908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.905908 (E_RNA) where: Base-Base interactions energy: -466.032 where: short stacking energy: -215.025 Base-Backbone interact. energy: -0.178 local terms energy: -223.696102 where: bonds (distance) C4'-P energy: -46.591 bonds (distance) P-C4' energy: -41.976 flat angles C4'-P-C4' energy: -46.003 flat angles P-C4'-P energy: -27.186 tors. eta vs tors. theta energy: -61.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -574.123606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.123606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.123606 (E_RNA) where: Base-Base interactions energy: -383.450 where: short stacking energy: -175.329 Base-Backbone interact. energy: -0.619 local terms energy: -190.054309 where: bonds (distance) C4'-P energy: -39.315 bonds (distance) P-C4' energy: -44.864 flat angles C4'-P-C4' energy: -46.851 flat angles P-C4'-P energy: -23.301 tors. eta vs tors. theta energy: -35.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -614.263781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.263781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.263781 (E_RNA) where: Base-Base interactions energy: -414.626 where: short stacking energy: -181.231 Base-Backbone interact. energy: -0.529 local terms energy: -199.108992 where: bonds (distance) C4'-P energy: -32.960 bonds (distance) P-C4' energy: -43.040 flat angles C4'-P-C4' energy: -46.134 flat angles P-C4'-P energy: -28.511 tors. eta vs tors. theta energy: -48.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -447.903012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.903012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.903012 (E_RNA) where: Base-Base interactions energy: -291.662 where: short stacking energy: -147.380 Base-Backbone interact. energy: 1.661 local terms energy: -157.902622 where: bonds (distance) C4'-P energy: -33.136 bonds (distance) P-C4' energy: -33.952 flat angles C4'-P-C4' energy: -39.908 flat angles P-C4'-P energy: -27.906 tors. eta vs tors. theta energy: -23.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -504.027163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.027163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.027163 (E_RNA) where: Base-Base interactions energy: -318.282 where: short stacking energy: -157.181 Base-Backbone interact. energy: 0.379 local terms energy: -186.124640 where: bonds (distance) C4'-P energy: -43.650 bonds (distance) P-C4' energy: -34.371 flat angles C4'-P-C4' energy: -41.980 flat angles P-C4'-P energy: -25.885 tors. eta vs tors. theta energy: -40.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -363.991766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.991766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.991766 (E_RNA) where: Base-Base interactions energy: -204.049 where: short stacking energy: -119.137 Base-Backbone interact. energy: 0.114 local terms energy: -160.057568 where: bonds (distance) C4'-P energy: -42.464 bonds (distance) P-C4' energy: -37.832 flat angles C4'-P-C4' energy: -40.471 flat angles P-C4'-P energy: -20.825 tors. eta vs tors. theta energy: -18.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -215.872030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.872030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.872030 (E_RNA) where: Base-Base interactions energy: -111.676 where: short stacking energy: -71.486 Base-Backbone interact. energy: -0.514 local terms energy: -103.682345 where: bonds (distance) C4'-P energy: -33.198 bonds (distance) P-C4' energy: -33.701 flat angles C4'-P-C4' energy: -31.939 flat angles P-C4'-P energy: -12.213 tors. eta vs tors. theta energy: 7.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -790.513813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.513813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.513813 (E_RNA) where: Base-Base interactions energy: -533.795 where: short stacking energy: -246.361 Base-Backbone interact. energy: 0.433 local terms energy: -257.151566 where: bonds (distance) C4'-P energy: -51.603 bonds (distance) P-C4' energy: -44.008 flat angles C4'-P-C4' energy: -55.432 flat angles P-C4'-P energy: -30.292 tors. eta vs tors. theta energy: -75.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -723.234486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.234486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.234486 (E_RNA) where: Base-Base interactions energy: -491.938 where: short stacking energy: -224.957 Base-Backbone interact. energy: -1.050 local terms energy: -230.246770 where: bonds (distance) C4'-P energy: -46.013 bonds (distance) P-C4' energy: -39.222 flat angles C4'-P-C4' energy: -50.874 flat angles P-C4'-P energy: -28.482 tors. eta vs tors. theta energy: -65.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -673.756623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.756623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.756623 (E_RNA) where: Base-Base interactions energy: -451.218 where: short stacking energy: -193.178 Base-Backbone interact. energy: -1.202 local terms energy: -221.336779 where: bonds (distance) C4'-P energy: -45.310 bonds (distance) P-C4' energy: -49.564 flat angles C4'-P-C4' energy: -42.913 flat angles P-C4'-P energy: -28.179 tors. eta vs tors. theta energy: -55.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -725.463431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.463431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.463431 (E_RNA) where: Base-Base interactions energy: -517.445 where: short stacking energy: -228.090 Base-Backbone interact. energy: -1.358 local terms energy: -206.660539 where: bonds (distance) C4'-P energy: -37.960 bonds (distance) P-C4' energy: -36.627 flat angles C4'-P-C4' energy: -42.272 flat angles P-C4'-P energy: -30.706 tors. eta vs tors. theta energy: -59.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -592.731633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.731633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.731633 (E_RNA) where: Base-Base interactions energy: -395.301 where: short stacking energy: -156.303 Base-Backbone interact. energy: -2.413 local terms energy: -195.018000 where: bonds (distance) C4'-P energy: -44.709 bonds (distance) P-C4' energy: -37.013 flat angles C4'-P-C4' energy: -43.609 flat angles P-C4'-P energy: -25.490 tors. eta vs tors. theta energy: -44.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -550.066042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.066042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.066042 (E_RNA) where: Base-Base interactions energy: -376.789 where: short stacking energy: -157.623 Base-Backbone interact. energy: -0.302 local terms energy: -172.974200 where: bonds (distance) C4'-P energy: -40.614 bonds (distance) P-C4' energy: -45.935 flat angles C4'-P-C4' energy: -35.922 flat angles P-C4'-P energy: -22.161 tors. eta vs tors. theta energy: -28.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -465.078005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.078005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.078005 (E_RNA) where: Base-Base interactions energy: -300.932 where: short stacking energy: -152.697 Base-Backbone interact. energy: -0.771 local terms energy: -163.374363 where: bonds (distance) C4'-P energy: -35.374 bonds (distance) P-C4' energy: -38.937 flat angles C4'-P-C4' energy: -50.078 flat angles P-C4'-P energy: -7.657 tors. eta vs tors. theta energy: -31.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -451.741750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.741750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.741750 (E_RNA) where: Base-Base interactions energy: -281.890 where: short stacking energy: -126.006 Base-Backbone interact. energy: -1.595 local terms energy: -168.256467 where: bonds (distance) C4'-P energy: -40.680 bonds (distance) P-C4' energy: -39.231 flat angles C4'-P-C4' energy: -35.724 flat angles P-C4'-P energy: -24.580 tors. eta vs tors. theta energy: -28.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -322.315829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.315829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.315829 (E_RNA) where: Base-Base interactions energy: -183.559 where: short stacking energy: -106.986 Base-Backbone interact. energy: -0.515 local terms energy: -138.242265 where: bonds (distance) C4'-P energy: -40.389 bonds (distance) P-C4' energy: -38.018 flat angles C4'-P-C4' energy: -34.418 flat angles P-C4'-P energy: -21.196 tors. eta vs tors. theta energy: -4.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -208.965583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.965583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.965583 (E_RNA) where: Base-Base interactions energy: -92.976 where: short stacking energy: -64.227 Base-Backbone interact. energy: 1.014 local terms energy: -117.003887 where: bonds (distance) C4'-P energy: -35.570 bonds (distance) P-C4' energy: -32.386 flat angles C4'-P-C4' energy: -42.585 flat angles P-C4'-P energy: -10.539 tors. eta vs tors. theta energy: 4.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -786.999638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.999638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.999638 (E_RNA) where: Base-Base interactions energy: -540.261 where: short stacking energy: -246.463 Base-Backbone interact. energy: -0.398 local terms energy: -246.341183 where: bonds (distance) C4'-P energy: -38.489 bonds (distance) P-C4' energy: -45.273 flat angles C4'-P-C4' energy: -54.184 flat angles P-C4'-P energy: -35.336 tors. eta vs tors. theta energy: -73.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -716.824711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.824711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.824711 (E_RNA) where: Base-Base interactions energy: -495.350 where: short stacking energy: -222.492 Base-Backbone interact. energy: -2.162 local terms energy: -219.312503 where: bonds (distance) C4'-P energy: -50.600 bonds (distance) P-C4' energy: -40.069 flat angles C4'-P-C4' energy: -50.845 flat angles P-C4'-P energy: -25.167 tors. eta vs tors. theta energy: -52.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -669.605624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.605624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.605624 (E_RNA) where: Base-Base interactions energy: -440.865 where: short stacking energy: -202.066 Base-Backbone interact. energy: -0.145 local terms energy: -228.595983 where: bonds (distance) C4'-P energy: -40.105 bonds (distance) P-C4' energy: -41.973 flat angles C4'-P-C4' energy: -51.985 flat angles P-C4'-P energy: -35.881 tors. eta vs tors. theta energy: -58.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -741.946912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.946912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.946912 (E_RNA) where: Base-Base interactions energy: -526.099 where: short stacking energy: -224.173 Base-Backbone interact. energy: -1.842 local terms energy: -214.005937 where: bonds (distance) C4'-P energy: -38.591 bonds (distance) P-C4' energy: -42.964 flat angles C4'-P-C4' energy: -44.790 flat angles P-C4'-P energy: -27.478 tors. eta vs tors. theta energy: -60.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -611.817774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.817774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.817774 (E_RNA) where: Base-Base interactions energy: -411.777 where: short stacking energy: -185.223 Base-Backbone interact. energy: -1.350 local terms energy: -198.690959 where: bonds (distance) C4'-P energy: -41.688 bonds (distance) P-C4' energy: -38.783 flat angles C4'-P-C4' energy: -42.126 flat angles P-C4'-P energy: -32.379 tors. eta vs tors. theta energy: -43.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -590.149487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.149487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.149487 (E_RNA) where: Base-Base interactions energy: -403.263 where: short stacking energy: -172.769 Base-Backbone interact. energy: -0.436 local terms energy: -186.450255 where: bonds (distance) C4'-P energy: -32.073 bonds (distance) P-C4' energy: -41.781 flat angles C4'-P-C4' energy: -44.367 flat angles P-C4'-P energy: -26.753 tors. eta vs tors. theta energy: -41.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -547.064154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.064154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.064154 (E_RNA) where: Base-Base interactions energy: -354.693 where: short stacking energy: -164.010 Base-Backbone interact. energy: 0.269 local terms energy: -192.640311 where: bonds (distance) C4'-P energy: -39.730 bonds (distance) P-C4' energy: -40.960 flat angles C4'-P-C4' energy: -45.180 flat angles P-C4'-P energy: -27.172 tors. eta vs tors. theta energy: -39.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -477.539171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.539171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.539171 (E_RNA) where: Base-Base interactions energy: -302.042 where: short stacking energy: -144.037 Base-Backbone interact. energy: -1.629 local terms energy: -173.867879 where: bonds (distance) C4'-P energy: -36.875 bonds (distance) P-C4' energy: -43.067 flat angles C4'-P-C4' energy: -41.234 flat angles P-C4'-P energy: -28.997 tors. eta vs tors. theta energy: -23.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -323.669819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.669819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.669819 (E_RNA) where: Base-Base interactions energy: -174.456 where: short stacking energy: -107.553 Base-Backbone interact. energy: -0.919 local terms energy: -148.294762 where: bonds (distance) C4'-P energy: -36.821 bonds (distance) P-C4' energy: -36.837 flat angles C4'-P-C4' energy: -32.200 flat angles P-C4'-P energy: -28.777 tors. eta vs tors. theta energy: -13.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -209.993575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.993575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.993575 (E_RNA) where: Base-Base interactions energy: -70.487 where: short stacking energy: -68.370 Base-Backbone interact. energy: 0.267 local terms energy: -139.772765 where: bonds (distance) C4'-P energy: -43.345 bonds (distance) P-C4' energy: -43.842 flat angles C4'-P-C4' energy: -38.340 flat angles P-C4'-P energy: -12.579 tors. eta vs tors. theta energy: -1.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -787.332503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.332503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.332503 (E_RNA) where: Base-Base interactions energy: -536.382 where: short stacking energy: -224.462 Base-Backbone interact. energy: -1.798 local terms energy: -249.152763 where: bonds (distance) C4'-P energy: -52.814 bonds (distance) P-C4' energy: -47.743 flat angles C4'-P-C4' energy: -51.045 flat angles P-C4'-P energy: -27.159 tors. eta vs tors. theta energy: -70.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -722.735795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.735795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.735795 (E_RNA) where: Base-Base interactions energy: -480.374 where: short stacking energy: -228.875 Base-Backbone interact. energy: -0.542 local terms energy: -241.819784 where: bonds (distance) C4'-P energy: -43.874 bonds (distance) P-C4' energy: -38.142 flat angles C4'-P-C4' energy: -57.168 flat angles P-C4'-P energy: -36.456 tors. eta vs tors. theta energy: -66.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -751.784911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.784911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.784911 (E_RNA) where: Base-Base interactions energy: -504.928 where: short stacking energy: -227.940 Base-Backbone interact. energy: -2.684 local terms energy: -244.172631 where: bonds (distance) C4'-P energy: -46.952 bonds (distance) P-C4' energy: -46.359 flat angles C4'-P-C4' energy: -46.684 flat angles P-C4'-P energy: -33.819 tors. eta vs tors. theta energy: -70.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -673.597439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.597439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.597439 (E_RNA) where: Base-Base interactions energy: -462.753 where: short stacking energy: -217.477 Base-Backbone interact. energy: 0.412 local terms energy: -211.256747 where: bonds (distance) C4'-P energy: -39.491 bonds (distance) P-C4' energy: -44.861 flat angles C4'-P-C4' energy: -46.475 flat angles P-C4'-P energy: -20.438 tors. eta vs tors. theta energy: -59.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -579.886592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.886592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.886592 (E_RNA) where: Base-Base interactions energy: -380.783 where: short stacking energy: -165.695 Base-Backbone interact. energy: -0.456 local terms energy: -198.647900 where: bonds (distance) C4'-P energy: -34.441 bonds (distance) P-C4' energy: -46.854 flat angles C4'-P-C4' energy: -48.686 flat angles P-C4'-P energy: -34.125 tors. eta vs tors. theta energy: -34.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -583.580912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.580912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.580912 (E_RNA) where: Base-Base interactions energy: -389.291 where: short stacking energy: -178.111 Base-Backbone interact. energy: 1.657 local terms energy: -195.946150 where: bonds (distance) C4'-P energy: -37.625 bonds (distance) P-C4' energy: -48.583 flat angles C4'-P-C4' energy: -41.158 flat angles P-C4'-P energy: -31.020 tors. eta vs tors. theta energy: -37.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -546.917363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.917363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.917363 (E_RNA) where: Base-Base interactions energy: -353.770 where: short stacking energy: -169.581 Base-Backbone interact. energy: -1.693 local terms energy: -191.454433 where: bonds (distance) C4'-P energy: -44.997 bonds (distance) P-C4' energy: -45.638 flat angles C4'-P-C4' energy: -34.244 flat angles P-C4'-P energy: -28.453 tors. eta vs tors. theta energy: -38.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -449.264003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.264003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.264003 (E_RNA) where: Base-Base interactions energy: -273.626 where: short stacking energy: -135.982 Base-Backbone interact. energy: 0.012 local terms energy: -175.650311 where: bonds (distance) C4'-P energy: -45.481 bonds (distance) P-C4' energy: -34.243 flat angles C4'-P-C4' energy: -47.332 flat angles P-C4'-P energy: -20.626 tors. eta vs tors. theta energy: -27.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -310.975531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.975531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.975531 (E_RNA) where: Base-Base interactions energy: -181.998 where: short stacking energy: -101.584 Base-Backbone interact. energy: -0.185 local terms energy: -128.792788 where: bonds (distance) C4'-P energy: -42.434 bonds (distance) P-C4' energy: -31.182 flat angles C4'-P-C4' energy: -22.822 flat angles P-C4'-P energy: -19.785 tors. eta vs tors. theta energy: -12.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -227.517171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.517171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.517171 (E_RNA) where: Base-Base interactions energy: -83.404 where: short stacking energy: -83.384 Base-Backbone interact. energy: 0.549 local terms energy: -144.661847 where: bonds (distance) C4'-P energy: -41.950 bonds (distance) P-C4' energy: -40.198 flat angles C4'-P-C4' energy: -36.187 flat angles P-C4'-P energy: -22.570 tors. eta vs tors. theta energy: -3.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -779.133969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.133969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.133969 (E_RNA) where: Base-Base interactions energy: -527.240 where: short stacking energy: -234.255 Base-Backbone interact. energy: -0.349 local terms energy: -251.544811 where: bonds (distance) C4'-P energy: -42.904 bonds (distance) P-C4' energy: -53.620 flat angles C4'-P-C4' energy: -52.136 flat angles P-C4'-P energy: -33.949 tors. eta vs tors. theta energy: -68.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -773.523524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.523524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.523524 (E_RNA) where: Base-Base interactions energy: -537.265 where: short stacking energy: -236.335 Base-Backbone interact. energy: -1.812 local terms energy: -234.446388 where: bonds (distance) C4'-P energy: -37.114 bonds (distance) P-C4' energy: -44.213 flat angles C4'-P-C4' energy: -51.422 flat angles P-C4'-P energy: -41.234 tors. eta vs tors. theta energy: -60.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -703.433083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.433083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.433083 (E_RNA) where: Base-Base interactions energy: -472.171 where: short stacking energy: -216.467 Base-Backbone interact. energy: -1.464 local terms energy: -229.798874 where: bonds (distance) C4'-P energy: -46.437 bonds (distance) P-C4' energy: -47.624 flat angles C4'-P-C4' energy: -53.586 flat angles P-C4'-P energy: -21.968 tors. eta vs tors. theta energy: -60.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -655.137118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.137118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.137118 (E_RNA) where: Base-Base interactions energy: -431.179 where: short stacking energy: -197.112 Base-Backbone interact. energy: -0.159 local terms energy: -223.799522 where: bonds (distance) C4'-P energy: -45.176 bonds (distance) P-C4' energy: -50.573 flat angles C4'-P-C4' energy: -44.632 flat angles P-C4'-P energy: -29.550 tors. eta vs tors. theta energy: -53.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -576.494220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.494220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.494220 (E_RNA) where: Base-Base interactions energy: -382.957 where: short stacking energy: -166.529 Base-Backbone interact. energy: -0.105 local terms energy: -193.431874 where: bonds (distance) C4'-P energy: -36.613 bonds (distance) P-C4' energy: -50.732 flat angles C4'-P-C4' energy: -36.168 flat angles P-C4'-P energy: -26.026 tors. eta vs tors. theta energy: -43.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -585.789874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.789874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.789874 (E_RNA) where: Base-Base interactions energy: -391.678 where: short stacking energy: -196.479 Base-Backbone interact. energy: -0.584 local terms energy: -193.528209 where: bonds (distance) C4'-P energy: -38.362 bonds (distance) P-C4' energy: -35.519 flat angles C4'-P-C4' energy: -43.236 flat angles P-C4'-P energy: -30.876 tors. eta vs tors. theta energy: -45.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -559.980343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.980343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.980343 (E_RNA) where: Base-Base interactions energy: -376.047 where: short stacking energy: -160.359 Base-Backbone interact. energy: -1.466 local terms energy: -182.466980 where: bonds (distance) C4'-P energy: -37.487 bonds (distance) P-C4' energy: -39.482 flat angles C4'-P-C4' energy: -34.648 flat angles P-C4'-P energy: -27.508 tors. eta vs tors. theta energy: -43.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -413.506249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.506249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.506249 (E_RNA) where: Base-Base interactions energy: -252.189 where: short stacking energy: -127.651 Base-Backbone interact. energy: -0.639 local terms energy: -160.677828 where: bonds (distance) C4'-P energy: -44.668 bonds (distance) P-C4' energy: -34.976 flat angles C4'-P-C4' energy: -37.433 flat angles P-C4'-P energy: -13.204 tors. eta vs tors. theta energy: -30.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -292.169159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.169159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.169159 (E_RNA) where: Base-Base interactions energy: -140.235 where: short stacking energy: -85.383 Base-Backbone interact. energy: 0.660 local terms energy: -152.593811 where: bonds (distance) C4'-P energy: -38.025 bonds (distance) P-C4' energy: -42.306 flat angles C4'-P-C4' energy: -37.301 flat angles P-C4'-P energy: -21.898 tors. eta vs tors. theta energy: -13.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -215.643536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.643536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.643536 (E_RNA) where: Base-Base interactions energy: -89.579 where: short stacking energy: -81.961 Base-Backbone interact. energy: 0.103 local terms energy: -126.167553 where: bonds (distance) C4'-P energy: -39.952 bonds (distance) P-C4' energy: -37.772 flat angles C4'-P-C4' energy: -27.965 flat angles P-C4'-P energy: -19.910 tors. eta vs tors. theta energy: -0.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -785.285616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.285616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.285616 (E_RNA) where: Base-Base interactions energy: -552.437 where: short stacking energy: -246.903 Base-Backbone interact. energy: -1.356 local terms energy: -231.491796 where: bonds (distance) C4'-P energy: -44.613 bonds (distance) P-C4' energy: -38.742 flat angles C4'-P-C4' energy: -48.092 flat angles P-C4'-P energy: -37.581 tors. eta vs tors. theta energy: -62.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -778.064002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.064002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.064002 (E_RNA) where: Base-Base interactions energy: -529.397 where: short stacking energy: -235.941 Base-Backbone interact. energy: -0.847 local terms energy: -247.819399 where: bonds (distance) C4'-P energy: -46.334 bonds (distance) P-C4' energy: -45.844 flat angles C4'-P-C4' energy: -50.926 flat angles P-C4'-P energy: -31.708 tors. eta vs tors. theta energy: -73.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -693.692439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.692439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.692439 (E_RNA) where: Base-Base interactions energy: -458.953 where: short stacking energy: -221.064 Base-Backbone interact. energy: -0.320 local terms energy: -234.419258 where: bonds (distance) C4'-P energy: -48.898 bonds (distance) P-C4' energy: -48.706 flat angles C4'-P-C4' energy: -48.208 flat angles P-C4'-P energy: -28.226 tors. eta vs tors. theta energy: -60.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -667.093701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.093701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.093701 (E_RNA) where: Base-Base interactions energy: -442.189 where: short stacking energy: -198.833 Base-Backbone interact. energy: 1.985 local terms energy: -226.889042 where: bonds (distance) C4'-P energy: -47.083 bonds (distance) P-C4' energy: -45.039 flat angles C4'-P-C4' energy: -45.249 flat angles P-C4'-P energy: -35.466 tors. eta vs tors. theta energy: -54.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -597.807116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.807116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.807116 (E_RNA) where: Base-Base interactions energy: -397.488 where: short stacking energy: -179.474 Base-Backbone interact. energy: -0.354 local terms energy: -199.964969 where: bonds (distance) C4'-P energy: -42.533 bonds (distance) P-C4' energy: -38.197 flat angles C4'-P-C4' energy: -50.359 flat angles P-C4'-P energy: -25.143 tors. eta vs tors. theta energy: -43.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -601.012989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.012989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.012989 (E_RNA) where: Base-Base interactions energy: -391.576 where: short stacking energy: -191.304 Base-Backbone interact. energy: 2.965 local terms energy: -212.401397 where: bonds (distance) C4'-P energy: -38.800 bonds (distance) P-C4' energy: -50.028 flat angles C4'-P-C4' energy: -47.714 flat angles P-C4'-P energy: -28.594 tors. eta vs tors. theta energy: -47.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -578.451655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.451655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.451655 (E_RNA) where: Base-Base interactions energy: -370.817 where: short stacking energy: -169.153 Base-Backbone interact. energy: 0.294 local terms energy: -207.928899 where: bonds (distance) C4'-P energy: -40.514 bonds (distance) P-C4' energy: -44.952 flat angles C4'-P-C4' energy: -45.568 flat angles P-C4'-P energy: -32.515 tors. eta vs tors. theta energy: -44.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -426.857617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.857617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.857617 (E_RNA) where: Base-Base interactions energy: -262.574 where: short stacking energy: -113.875 Base-Backbone interact. energy: -0.776 local terms energy: -163.507516 where: bonds (distance) C4'-P energy: -37.316 bonds (distance) P-C4' energy: -42.673 flat angles C4'-P-C4' energy: -34.191 flat angles P-C4'-P energy: -26.503 tors. eta vs tors. theta energy: -22.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -304.341426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.341426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.341426 (E_RNA) where: Base-Base interactions energy: -161.597 where: short stacking energy: -93.451 Base-Backbone interact. energy: -1.060 local terms energy: -141.684598 where: bonds (distance) C4'-P energy: -40.232 bonds (distance) P-C4' energy: -43.395 flat angles C4'-P-C4' energy: -27.584 flat angles P-C4'-P energy: -18.269 tors. eta vs tors. theta energy: -12.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -218.506550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.506550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.506550 (E_RNA) where: Base-Base interactions energy: -80.932 where: short stacking energy: -71.867 Base-Backbone interact. energy: -1.491 local terms energy: -136.082968 where: bonds (distance) C4'-P energy: -38.852 bonds (distance) P-C4' energy: -38.706 flat angles C4'-P-C4' energy: -36.577 flat angles P-C4'-P energy: -19.548 tors. eta vs tors. theta energy: -2.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -791.788137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.788137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.788137 (E_RNA) where: Base-Base interactions energy: -552.321 where: short stacking energy: -243.619 Base-Backbone interact. energy: -0.698 local terms energy: -238.769471 where: bonds (distance) C4'-P energy: -44.418 bonds (distance) P-C4' energy: -41.698 flat angles C4'-P-C4' energy: -52.369 flat angles P-C4'-P energy: -37.459 tors. eta vs tors. theta energy: -62.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -777.390296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.390296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.390296 (E_RNA) where: Base-Base interactions energy: -530.512 where: short stacking energy: -240.592 Base-Backbone interact. energy: -1.809 local terms energy: -245.069321 where: bonds (distance) C4'-P energy: -42.609 bonds (distance) P-C4' energy: -48.969 flat angles C4'-P-C4' energy: -52.646 flat angles P-C4'-P energy: -29.482 tors. eta vs tors. theta energy: -71.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -697.576368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.576368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.576368 (E_RNA) where: Base-Base interactions energy: -470.768 where: short stacking energy: -209.044 Base-Backbone interact. energy: 0.256 local terms energy: -227.064946 where: bonds (distance) C4'-P energy: -34.395 bonds (distance) P-C4' energy: -54.208 flat angles C4'-P-C4' energy: -47.698 flat angles P-C4'-P energy: -36.239 tors. eta vs tors. theta energy: -54.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -659.428856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.428856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.428856 (E_RNA) where: Base-Base interactions energy: -452.546 where: short stacking energy: -198.955 Base-Backbone interact. energy: -2.675 local terms energy: -204.208137 where: bonds (distance) C4'-P energy: -35.740 bonds (distance) P-C4' energy: -41.766 flat angles C4'-P-C4' energy: -43.623 flat angles P-C4'-P energy: -32.462 tors. eta vs tors. theta energy: -50.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -588.301623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.301623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.301623 (E_RNA) where: Base-Base interactions energy: -403.038 where: short stacking energy: -178.945 Base-Backbone interact. energy: -0.941 local terms energy: -184.323461 where: bonds (distance) C4'-P energy: -43.917 bonds (distance) P-C4' energy: -32.635 flat angles C4'-P-C4' energy: -42.038 flat angles P-C4'-P energy: -21.579 tors. eta vs tors. theta energy: -44.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -549.274859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.274859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.274859 (E_RNA) where: Base-Base interactions energy: -378.045 where: short stacking energy: -163.642 Base-Backbone interact. energy: -0.096 local terms energy: -171.133801 where: bonds (distance) C4'-P energy: -36.916 bonds (distance) P-C4' energy: -41.889 flat angles C4'-P-C4' energy: -41.221 flat angles P-C4'-P energy: -21.620 tors. eta vs tors. theta energy: -29.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -572.603447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.603447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.603447 (E_RNA) where: Base-Base interactions energy: -365.708 where: short stacking energy: -171.140 Base-Backbone interact. energy: -0.245 local terms energy: -206.650067 where: bonds (distance) C4'-P energy: -37.594 bonds (distance) P-C4' energy: -43.465 flat angles C4'-P-C4' energy: -48.315 flat angles P-C4'-P energy: -27.032 tors. eta vs tors. theta energy: -50.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -469.448835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.448835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.448835 (E_RNA) where: Base-Base interactions energy: -292.382 where: short stacking energy: -135.605 Base-Backbone interact. energy: 0.342 local terms energy: -177.409150 where: bonds (distance) C4'-P energy: -39.869 bonds (distance) P-C4' energy: -41.104 flat angles C4'-P-C4' energy: -45.475 flat angles P-C4'-P energy: -28.081 tors. eta vs tors. theta energy: -22.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -328.798809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.798809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.798809 (E_RNA) where: Base-Base interactions energy: -176.357 where: short stacking energy: -106.468 Base-Backbone interact. energy: 1.740 local terms energy: -154.181873 where: bonds (distance) C4'-P energy: -45.312 bonds (distance) P-C4' energy: -37.798 flat angles C4'-P-C4' energy: -35.430 flat angles P-C4'-P energy: -27.947 tors. eta vs tors. theta energy: -7.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -212.264838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.264838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.264838 (E_RNA) where: Base-Base interactions energy: -73.734 where: short stacking energy: -68.368 Base-Backbone interact. energy: -0.792 local terms energy: -137.739438 where: bonds (distance) C4'-P energy: -39.564 bonds (distance) P-C4' energy: -37.437 flat angles C4'-P-C4' energy: -43.772 flat angles P-C4'-P energy: -12.708 tors. eta vs tors. theta energy: -4.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -790.318105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.318105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.318105 (E_RNA) where: Base-Base interactions energy: -530.929 where: short stacking energy: -247.280 Base-Backbone interact. energy: 0.822 local terms energy: -260.211719 where: bonds (distance) C4'-P energy: -46.971 bonds (distance) P-C4' energy: -47.543 flat angles C4'-P-C4' energy: -49.919 flat angles P-C4'-P energy: -40.997 tors. eta vs tors. theta energy: -74.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -769.669057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.669057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.669057 (E_RNA) where: Base-Base interactions energy: -539.930 where: short stacking energy: -231.870 Base-Backbone interact. energy: -1.230 local terms energy: -228.509310 where: bonds (distance) C4'-P energy: -38.269 bonds (distance) P-C4' energy: -44.993 flat angles C4'-P-C4' energy: -45.108 flat angles P-C4'-P energy: -35.625 tors. eta vs tors. theta energy: -64.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -705.657315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.657315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.657315 (E_RNA) where: Base-Base interactions energy: -474.919 where: short stacking energy: -206.906 Base-Backbone interact. energy: -0.820 local terms energy: -229.918864 where: bonds (distance) C4'-P energy: -45.081 bonds (distance) P-C4' energy: -40.479 flat angles C4'-P-C4' energy: -51.749 flat angles P-C4'-P energy: -31.999 tors. eta vs tors. theta energy: -60.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -639.306699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.306699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.306699 (E_RNA) where: Base-Base interactions energy: -438.822 where: short stacking energy: -204.664 Base-Backbone interact. energy: -0.988 local terms energy: -199.497190 where: bonds (distance) C4'-P energy: -26.451 bonds (distance) P-C4' energy: -45.427 flat angles C4'-P-C4' energy: -52.847 flat angles P-C4'-P energy: -32.831 tors. eta vs tors. theta energy: -41.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -618.833077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.833077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.833077 (E_RNA) where: Base-Base interactions energy: -415.515 where: short stacking energy: -179.430 Base-Backbone interact. energy: -3.275 local terms energy: -200.043410 where: bonds (distance) C4'-P energy: -44.275 bonds (distance) P-C4' energy: -42.301 flat angles C4'-P-C4' energy: -41.128 flat angles P-C4'-P energy: -31.954 tors. eta vs tors. theta energy: -40.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -576.567999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.567999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.567999 (E_RNA) where: Base-Base interactions energy: -374.448 where: short stacking energy: -188.430 Base-Backbone interact. energy: 0.853 local terms energy: -202.973710 where: bonds (distance) C4'-P energy: -33.408 bonds (distance) P-C4' energy: -44.712 flat angles C4'-P-C4' energy: -49.576 flat angles P-C4'-P energy: -33.541 tors. eta vs tors. theta energy: -41.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -565.612618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.612618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.612618 (E_RNA) where: Base-Base interactions energy: -366.599 where: short stacking energy: -156.061 Base-Backbone interact. energy: -0.786 local terms energy: -198.228252 where: bonds (distance) C4'-P energy: -44.205 bonds (distance) P-C4' energy: -37.086 flat angles C4'-P-C4' energy: -50.187 flat angles P-C4'-P energy: -24.703 tors. eta vs tors. theta energy: -42.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -412.401600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.401600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.401600 (E_RNA) where: Base-Base interactions energy: -268.783 where: short stacking energy: -143.148 Base-Backbone interact. energy: -0.457 local terms energy: -143.161607 where: bonds (distance) C4'-P energy: -22.779 bonds (distance) P-C4' energy: -41.105 flat angles C4'-P-C4' energy: -35.395 flat angles P-C4'-P energy: -17.782 tors. eta vs tors. theta energy: -26.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -360.387076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.387076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.387076 (E_RNA) where: Base-Base interactions energy: -229.463 where: short stacking energy: -111.581 Base-Backbone interact. energy: -0.907 local terms energy: -130.016951 where: bonds (distance) C4'-P energy: -31.337 bonds (distance) P-C4' energy: -39.055 flat angles C4'-P-C4' energy: -33.320 flat angles P-C4'-P energy: -13.755 tors. eta vs tors. theta energy: -12.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -199.648868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.648868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.648868 (E_RNA) where: Base-Base interactions energy: -74.677 where: short stacking energy: -66.220 Base-Backbone interact. energy: 3.575 local terms energy: -128.547445 where: bonds (distance) C4'-P energy: -40.447 bonds (distance) P-C4' energy: -41.142 flat angles C4'-P-C4' energy: -29.380 flat angles P-C4'-P energy: -16.968 tors. eta vs tors. theta energy: -0.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -785.508823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.508823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.508823 (E_RNA) where: Base-Base interactions energy: -533.294 where: short stacking energy: -241.085 Base-Backbone interact. energy: -1.704 local terms energy: -250.510950 where: bonds (distance) C4'-P energy: -48.451 bonds (distance) P-C4' energy: -43.366 flat angles C4'-P-C4' energy: -54.015 flat angles P-C4'-P energy: -33.576 tors. eta vs tors. theta energy: -71.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -775.851762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.851762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.851762 (E_RNA) where: Base-Base interactions energy: -537.058 where: short stacking energy: -247.231 Base-Backbone interact. energy: -2.881 local terms energy: -235.912944 where: bonds (distance) C4'-P energy: -48.457 bonds (distance) P-C4' energy: -39.519 flat angles C4'-P-C4' energy: -49.860 flat angles P-C4'-P energy: -32.386 tors. eta vs tors. theta energy: -65.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -712.725734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.725734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.725734 (E_RNA) where: Base-Base interactions energy: -474.021 where: short stacking energy: -214.143 Base-Backbone interact. energy: -2.211 local terms energy: -236.493565 where: bonds (distance) C4'-P energy: -43.796 bonds (distance) P-C4' energy: -46.391 flat angles C4'-P-C4' energy: -53.498 flat angles P-C4'-P energy: -37.731 tors. eta vs tors. theta energy: -55.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -636.322317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.322317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.322317 (E_RNA) where: Base-Base interactions energy: -434.964 where: short stacking energy: -189.265 Base-Backbone interact. energy: -3.168 local terms energy: -198.189380 where: bonds (distance) C4'-P energy: -45.668 bonds (distance) P-C4' energy: -35.031 flat angles C4'-P-C4' energy: -46.240 flat angles P-C4'-P energy: -21.696 tors. eta vs tors. theta energy: -49.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -567.316044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.316044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.316044 (E_RNA) where: Base-Base interactions energy: -379.691 where: short stacking energy: -150.111 Base-Backbone interact. energy: -0.207 local terms energy: -187.417611 where: bonds (distance) C4'-P energy: -41.163 bonds (distance) P-C4' energy: -43.222 flat angles C4'-P-C4' energy: -46.668 flat angles P-C4'-P energy: -25.681 tors. eta vs tors. theta energy: -30.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -543.033160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.033160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.033160 (E_RNA) where: Base-Base interactions energy: -350.482 where: short stacking energy: -160.093 Base-Backbone interact. energy: 0.666 local terms energy: -193.217435 where: bonds (distance) C4'-P energy: -37.082 bonds (distance) P-C4' energy: -41.137 flat angles C4'-P-C4' energy: -43.984 flat angles P-C4'-P energy: -30.192 tors. eta vs tors. theta energy: -40.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -564.345685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.345685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.345685 (E_RNA) where: Base-Base interactions energy: -373.385 where: short stacking energy: -183.662 Base-Backbone interact. energy: -0.104 local terms energy: -190.856300 where: bonds (distance) C4'-P energy: -33.456 bonds (distance) P-C4' energy: -39.255 flat angles C4'-P-C4' energy: -48.747 flat angles P-C4'-P energy: -29.399 tors. eta vs tors. theta energy: -40.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -431.028610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.028610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.028610 (E_RNA) where: Base-Base interactions energy: -266.148 where: short stacking energy: -125.204 Base-Backbone interact. energy: -1.466 local terms energy: -163.414022 where: bonds (distance) C4'-P energy: -31.961 bonds (distance) P-C4' energy: -40.135 flat angles C4'-P-C4' energy: -36.323 flat angles P-C4'-P energy: -25.142 tors. eta vs tors. theta energy: -29.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -406.257987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.257987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.257987 (E_RNA) where: Base-Base interactions energy: -245.573 where: short stacking energy: -124.499 Base-Backbone interact. energy: -2.244 local terms energy: -158.440927 where: bonds (distance) C4'-P energy: -37.078 bonds (distance) P-C4' energy: -49.517 flat angles C4'-P-C4' energy: -27.979 flat angles P-C4'-P energy: -28.049 tors. eta vs tors. theta energy: -15.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -206.266752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.266752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.266752 (E_RNA) where: Base-Base interactions energy: -75.896 where: short stacking energy: -75.865 Base-Backbone interact. energy: -0.513 local terms energy: -129.857504 where: bonds (distance) C4'-P energy: -30.918 bonds (distance) P-C4' energy: -44.403 flat angles C4'-P-C4' energy: -31.544 flat angles P-C4'-P energy: -22.704 tors. eta vs tors. theta energy: -0.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -782.073005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.073005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.073005 (E_RNA) where: Base-Base interactions energy: -537.084 where: short stacking energy: -223.178 Base-Backbone interact. energy: 1.422 local terms energy: -246.410856 where: bonds (distance) C4'-P energy: -43.965 bonds (distance) P-C4' energy: -46.696 flat angles C4'-P-C4' energy: -53.750 flat angles P-C4'-P energy: -36.532 tors. eta vs tors. theta energy: -65.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -770.947960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.947960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.947960 (E_RNA) where: Base-Base interactions energy: -550.329 where: short stacking energy: -242.691 Base-Backbone interact. energy: -2.259 local terms energy: -218.360027 where: bonds (distance) C4'-P energy: -43.530 bonds (distance) P-C4' energy: -40.066 flat angles C4'-P-C4' energy: -42.393 flat angles P-C4'-P energy: -26.276 tors. eta vs tors. theta energy: -66.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -708.916674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.916674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.916674 (E_RNA) where: Base-Base interactions energy: -483.394 where: short stacking energy: -206.497 Base-Backbone interact. energy: -1.542 local terms energy: -223.980868 where: bonds (distance) C4'-P energy: -36.567 bonds (distance) P-C4' energy: -49.416 flat angles C4'-P-C4' energy: -46.807 flat angles P-C4'-P energy: -36.445 tors. eta vs tors. theta energy: -54.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -624.456430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.456430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.456430 (E_RNA) where: Base-Base interactions energy: -409.304 where: short stacking energy: -195.098 Base-Backbone interact. energy: -1.972 local terms energy: -213.180545 where: bonds (distance) C4'-P energy: -42.724 bonds (distance) P-C4' energy: -40.368 flat angles C4'-P-C4' energy: -50.927 flat angles P-C4'-P energy: -31.576 tors. eta vs tors. theta energy: -47.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -555.649537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.649537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.649537 (E_RNA) where: Base-Base interactions energy: -361.299 where: short stacking energy: -169.292 Base-Backbone interact. energy: -2.069 local terms energy: -192.281472 where: bonds (distance) C4'-P energy: -40.636 bonds (distance) P-C4' energy: -41.819 flat angles C4'-P-C4' energy: -42.127 flat angles P-C4'-P energy: -26.678 tors. eta vs tors. theta energy: -41.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -551.641346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.641346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.641346 (E_RNA) where: Base-Base interactions energy: -362.733 where: short stacking energy: -158.401 Base-Backbone interact. energy: -0.651 local terms energy: -188.257285 where: bonds (distance) C4'-P energy: -46.428 bonds (distance) P-C4' energy: -45.581 flat angles C4'-P-C4' energy: -39.355 flat angles P-C4'-P energy: -21.683 tors. eta vs tors. theta energy: -35.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -550.911644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.911644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.911644 (E_RNA) where: Base-Base interactions energy: -358.384 where: short stacking energy: -153.711 Base-Backbone interact. energy: -0.549 local terms energy: -191.978912 where: bonds (distance) C4'-P energy: -43.433 bonds (distance) P-C4' energy: -42.406 flat angles C4'-P-C4' energy: -39.465 flat angles P-C4'-P energy: -30.013 tors. eta vs tors. theta energy: -36.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -387.314040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.314040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.314040 (E_RNA) where: Base-Base interactions energy: -242.167 where: short stacking energy: -120.738 Base-Backbone interact. energy: 0.825 local terms energy: -145.972148 where: bonds (distance) C4'-P energy: -37.200 bonds (distance) P-C4' energy: -48.844 flat angles C4'-P-C4' energy: -36.708 flat angles P-C4'-P energy: -15.376 tors. eta vs tors. theta energy: -7.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -416.407985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.407985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.407985 (E_RNA) where: Base-Base interactions energy: -251.501 where: short stacking energy: -123.515 Base-Backbone interact. energy: -0.895 local terms energy: -164.011776 where: bonds (distance) C4'-P energy: -42.207 bonds (distance) P-C4' energy: -46.264 flat angles C4'-P-C4' energy: -40.391 flat angles P-C4'-P energy: -21.965 tors. eta vs tors. theta energy: -13.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -209.643788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.643788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.643788 (E_RNA) where: Base-Base interactions energy: -87.212 where: short stacking energy: -75.861 Base-Backbone interact. energy: -0.909 local terms energy: -121.522523 where: bonds (distance) C4'-P energy: -41.494 bonds (distance) P-C4' energy: -25.677 flat angles C4'-P-C4' energy: -29.851 flat angles P-C4'-P energy: -19.889 tors. eta vs tors. theta energy: -4.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -786.044781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.044781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.044781 (E_RNA) where: Base-Base interactions energy: -544.276 where: short stacking energy: -244.936 Base-Backbone interact. energy: -1.431 local terms energy: -240.337460 where: bonds (distance) C4'-P energy: -37.123 bonds (distance) P-C4' energy: -43.929 flat angles C4'-P-C4' energy: -54.593 flat angles P-C4'-P energy: -32.584 tors. eta vs tors. theta energy: -72.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -768.343927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.343927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.343927 (E_RNA) where: Base-Base interactions energy: -527.490 where: short stacking energy: -234.618 Base-Backbone interact. energy: -0.771 local terms energy: -240.082167 where: bonds (distance) C4'-P energy: -42.285 bonds (distance) P-C4' energy: -41.502 flat angles C4'-P-C4' energy: -54.147 flat angles P-C4'-P energy: -36.097 tors. eta vs tors. theta energy: -66.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -707.085104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.085104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.085104 (E_RNA) where: Base-Base interactions energy: -478.783 where: short stacking energy: -210.583 Base-Backbone interact. energy: -0.242 local terms energy: -228.059575 where: bonds (distance) C4'-P energy: -48.815 bonds (distance) P-C4' energy: -45.783 flat angles C4'-P-C4' energy: -40.642 flat angles P-C4'-P energy: -39.323 tors. eta vs tors. theta energy: -53.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -648.936052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.936052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.936052 (E_RNA) where: Base-Base interactions energy: -436.628 where: short stacking energy: -197.894 Base-Backbone interact. energy: -1.277 local terms energy: -211.030944 where: bonds (distance) C4'-P energy: -39.903 bonds (distance) P-C4' energy: -46.444 flat angles C4'-P-C4' energy: -45.185 flat angles P-C4'-P energy: -30.607 tors. eta vs tors. theta energy: -48.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -597.319562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.319562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.319562 (E_RNA) where: Base-Base interactions energy: -401.389 where: short stacking energy: -186.492 Base-Backbone interact. energy: 1.976 local terms energy: -197.907027 where: bonds (distance) C4'-P energy: -42.470 bonds (distance) P-C4' energy: -36.442 flat angles C4'-P-C4' energy: -52.193 flat angles P-C4'-P energy: -28.804 tors. eta vs tors. theta energy: -37.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -554.935870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.935870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.935870 (E_RNA) where: Base-Base interactions energy: -369.561 where: short stacking energy: -178.462 Base-Backbone interact. energy: -0.571 local terms energy: -184.804116 where: bonds (distance) C4'-P energy: -48.254 bonds (distance) P-C4' energy: -30.872 flat angles C4'-P-C4' energy: -44.964 flat angles P-C4'-P energy: -24.165 tors. eta vs tors. theta energy: -36.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -529.276537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.276537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.276537 (E_RNA) where: Base-Base interactions energy: -342.494 where: short stacking energy: -155.070 Base-Backbone interact. energy: -0.598 local terms energy: -186.183686 where: bonds (distance) C4'-P energy: -41.444 bonds (distance) P-C4' energy: -41.423 flat angles C4'-P-C4' energy: -47.276 flat angles P-C4'-P energy: -31.582 tors. eta vs tors. theta energy: -24.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -447.189085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.189085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.189085 (E_RNA) where: Base-Base interactions energy: -277.822 where: short stacking energy: -130.018 Base-Backbone interact. energy: -4.171 local terms energy: -165.196262 where: bonds (distance) C4'-P energy: -39.486 bonds (distance) P-C4' energy: -44.879 flat angles C4'-P-C4' energy: -33.875 flat angles P-C4'-P energy: -22.802 tors. eta vs tors. theta energy: -24.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -466.091092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.091092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.091092 (E_RNA) where: Base-Base interactions energy: -295.061 where: short stacking energy: -141.751 Base-Backbone interact. energy: 1.220 local terms energy: -172.249837 where: bonds (distance) C4'-P energy: -38.957 bonds (distance) P-C4' energy: -37.317 flat angles C4'-P-C4' energy: -43.425 flat angles P-C4'-P energy: -28.006 tors. eta vs tors. theta energy: -24.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -214.590576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.590576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.590576 (E_RNA) where: Base-Base interactions energy: -74.493 where: short stacking energy: -74.493 Base-Backbone interact. energy: 0.209 local terms energy: -140.307023 where: bonds (distance) C4'-P energy: -40.347 bonds (distance) P-C4' energy: -43.995 flat angles C4'-P-C4' energy: -37.353 flat angles P-C4'-P energy: -15.212 tors. eta vs tors. theta energy: -3.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -785.066412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.066412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.066412 (E_RNA) where: Base-Base interactions energy: -535.393 where: short stacking energy: -249.140 Base-Backbone interact. energy: -2.840 local terms energy: -246.833898 where: bonds (distance) C4'-P energy: -49.018 bonds (distance) P-C4' energy: -49.578 flat angles C4'-P-C4' energy: -47.534 flat angles P-C4'-P energy: -29.422 tors. eta vs tors. theta energy: -71.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -759.639060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.639060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.639060 (E_RNA) where: Base-Base interactions energy: -519.596 where: short stacking energy: -221.382 Base-Backbone interact. energy: -1.680 local terms energy: -238.362394 where: bonds (distance) C4'-P energy: -41.981 bonds (distance) P-C4' energy: -45.304 flat angles C4'-P-C4' energy: -50.797 flat angles P-C4'-P energy: -36.058 tors. eta vs tors. theta energy: -64.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -701.582280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.582280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.582280 (E_RNA) where: Base-Base interactions energy: -474.953 where: short stacking energy: -204.963 Base-Backbone interact. energy: -1.369 local terms energy: -225.259600 where: bonds (distance) C4'-P energy: -43.547 bonds (distance) P-C4' energy: -47.073 flat angles C4'-P-C4' energy: -44.294 flat angles P-C4'-P energy: -35.194 tors. eta vs tors. theta energy: -55.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -643.651207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.651207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.651207 (E_RNA) where: Base-Base interactions energy: -439.602 where: short stacking energy: -206.796 Base-Backbone interact. energy: 5.335 local terms energy: -209.384054 where: bonds (distance) C4'-P energy: -42.376 bonds (distance) P-C4' energy: -46.751 flat angles C4'-P-C4' energy: -41.137 flat angles P-C4'-P energy: -33.555 tors. eta vs tors. theta energy: -45.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -608.819806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.819806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.819806 (E_RNA) where: Base-Base interactions energy: -405.401 where: short stacking energy: -176.199 Base-Backbone interact. energy: 1.070 local terms energy: -204.488798 where: bonds (distance) C4'-P energy: -42.808 bonds (distance) P-C4' energy: -47.993 flat angles C4'-P-C4' energy: -45.982 flat angles P-C4'-P energy: -23.327 tors. eta vs tors. theta energy: -44.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -584.145373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.145373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.145373 (E_RNA) where: Base-Base interactions energy: -374.572 where: short stacking energy: -185.857 Base-Backbone interact. energy: -0.133 local terms energy: -209.440593 where: bonds (distance) C4'-P energy: -43.691 bonds (distance) P-C4' energy: -50.064 flat angles C4'-P-C4' energy: -40.881 flat angles P-C4'-P energy: -27.031 tors. eta vs tors. theta energy: -47.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -506.809372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.809372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.809372 (E_RNA) where: Base-Base interactions energy: -342.886 where: short stacking energy: -150.572 Base-Backbone interact. energy: -1.651 local terms energy: -162.272297 where: bonds (distance) C4'-P energy: -33.447 bonds (distance) P-C4' energy: -38.577 flat angles C4'-P-C4' energy: -37.485 flat angles P-C4'-P energy: -27.659 tors. eta vs tors. theta energy: -25.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -449.891890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.891890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.891890 (E_RNA) where: Base-Base interactions energy: -285.134 where: short stacking energy: -140.563 Base-Backbone interact. energy: -0.754 local terms energy: -164.003649 where: bonds (distance) C4'-P energy: -39.493 bonds (distance) P-C4' energy: -34.514 flat angles C4'-P-C4' energy: -33.591 flat angles P-C4'-P energy: -29.114 tors. eta vs tors. theta energy: -27.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -471.243669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.243669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.243669 (E_RNA) where: Base-Base interactions energy: -294.610 where: short stacking energy: -136.938 Base-Backbone interact. energy: 0.442 local terms energy: -177.075618 where: bonds (distance) C4'-P energy: -37.221 bonds (distance) P-C4' energy: -48.266 flat angles C4'-P-C4' energy: -43.449 flat angles P-C4'-P energy: -25.785 tors. eta vs tors. theta energy: -22.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -206.888545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.888545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.888545 (E_RNA) where: Base-Base interactions energy: -84.230 where: short stacking energy: -82.717 Base-Backbone interact. energy: 0.375 local terms energy: -123.033387 where: bonds (distance) C4'-P energy: -31.486 bonds (distance) P-C4' energy: -31.814 flat angles C4'-P-C4' energy: -31.267 flat angles P-C4'-P energy: -22.644 tors. eta vs tors. theta energy: -5.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -787.857438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.857438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.857438 (E_RNA) where: Base-Base interactions energy: -537.663 where: short stacking energy: -254.868 Base-Backbone interact. energy: -0.961 local terms energy: -249.233088 where: bonds (distance) C4'-P energy: -44.780 bonds (distance) P-C4' energy: -47.560 flat angles C4'-P-C4' energy: -49.111 flat angles P-C4'-P energy: -34.770 tors. eta vs tors. theta energy: -73.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -728.501986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.501986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.501986 (E_RNA) where: Base-Base interactions energy: -507.957 where: short stacking energy: -212.838 Base-Backbone interact. energy: -1.418 local terms energy: -219.127176 where: bonds (distance) C4'-P energy: -38.928 bonds (distance) P-C4' energy: -46.039 flat angles C4'-P-C4' energy: -48.885 flat angles P-C4'-P energy: -24.898 tors. eta vs tors. theta energy: -60.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -681.721256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.721256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.721256 (E_RNA) where: Base-Base interactions energy: -454.042 where: short stacking energy: -201.188 Base-Backbone interact. energy: -0.428 local terms energy: -227.251290 where: bonds (distance) C4'-P energy: -46.312 bonds (distance) P-C4' energy: -41.983 flat angles C4'-P-C4' energy: -49.321 flat angles P-C4'-P energy: -31.947 tors. eta vs tors. theta energy: -57.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -660.327601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.327601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.327601 (E_RNA) where: Base-Base interactions energy: -464.107 where: short stacking energy: -208.510 Base-Backbone interact. energy: -1.004 local terms energy: -195.216779 where: bonds (distance) C4'-P energy: -37.827 bonds (distance) P-C4' energy: -34.138 flat angles C4'-P-C4' energy: -42.262 flat angles P-C4'-P energy: -25.516 tors. eta vs tors. theta energy: -55.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -616.236866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.236866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.236866 (E_RNA) where: Base-Base interactions energy: -407.855 where: short stacking energy: -198.240 Base-Backbone interact. energy: -1.220 local terms energy: -207.161910 where: bonds (distance) C4'-P energy: -41.646 bonds (distance) P-C4' energy: -45.239 flat angles C4'-P-C4' energy: -37.757 flat angles P-C4'-P energy: -31.041 tors. eta vs tors. theta energy: -51.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -588.015104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.015104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.015104 (E_RNA) where: Base-Base interactions energy: -387.439 where: short stacking energy: -187.956 Base-Backbone interact. energy: -0.881 local terms energy: -199.695423 where: bonds (distance) C4'-P energy: -30.120 bonds (distance) P-C4' energy: -47.077 flat angles C4'-P-C4' energy: -49.003 flat angles P-C4'-P energy: -26.332 tors. eta vs tors. theta energy: -47.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -509.678228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.678228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.678228 (E_RNA) where: Base-Base interactions energy: -333.517 where: short stacking energy: -134.409 Base-Backbone interact. energy: -1.800 local terms energy: -174.361454 where: bonds (distance) C4'-P energy: -32.502 bonds (distance) P-C4' energy: -40.497 flat angles C4'-P-C4' energy: -50.000 flat angles P-C4'-P energy: -23.211 tors. eta vs tors. theta energy: -28.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -429.553172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.553172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.553172 (E_RNA) where: Base-Base interactions energy: -278.848 where: short stacking energy: -129.530 Base-Backbone interact. energy: -0.056 local terms energy: -150.649298 where: bonds (distance) C4'-P energy: -33.299 bonds (distance) P-C4' energy: -36.759 flat angles C4'-P-C4' energy: -36.729 flat angles P-C4'-P energy: -23.429 tors. eta vs tors. theta energy: -20.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -374.469365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.469365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.469365 (E_RNA) where: Base-Base interactions energy: -223.008 where: short stacking energy: -106.732 Base-Backbone interact. energy: -1.935 local terms energy: -149.525706 where: bonds (distance) C4'-P energy: -35.970 bonds (distance) P-C4' energy: -36.418 flat angles C4'-P-C4' energy: -31.711 flat angles P-C4'-P energy: -24.898 tors. eta vs tors. theta energy: -20.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -263.839166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.839166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.839166 (E_RNA) where: Base-Base interactions energy: -131.307 where: short stacking energy: -90.380 Base-Backbone interact. energy: -0.583 local terms energy: -131.949783 where: bonds (distance) C4'-P energy: -28.974 bonds (distance) P-C4' energy: -41.680 flat angles C4'-P-C4' energy: -33.208 flat angles P-C4'-P energy: -15.273 tors. eta vs tors. theta energy: -12.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -795.978623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.978623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.978623 (E_RNA) where: Base-Base interactions energy: -553.368 where: short stacking energy: -253.987 Base-Backbone interact. energy: -0.788 local terms energy: -241.823310 where: bonds (distance) C4'-P energy: -46.129 bonds (distance) P-C4' energy: -39.372 flat angles C4'-P-C4' energy: -50.855 flat angles P-C4'-P energy: -35.387 tors. eta vs tors. theta energy: -70.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -744.157500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.157500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.157500 (E_RNA) where: Base-Base interactions energy: -504.980 where: short stacking energy: -237.067 Base-Backbone interact. energy: -0.231 local terms energy: -238.946470 where: bonds (distance) C4'-P energy: -43.535 bonds (distance) P-C4' energy: -44.782 flat angles C4'-P-C4' energy: -51.731 flat angles P-C4'-P energy: -36.635 tors. eta vs tors. theta energy: -62.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -705.412096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.412096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.412096 (E_RNA) where: Base-Base interactions energy: -471.202 where: short stacking energy: -216.589 Base-Backbone interact. energy: -1.722 local terms energy: -232.488054 where: bonds (distance) C4'-P energy: -46.797 bonds (distance) P-C4' energy: -46.970 flat angles C4'-P-C4' energy: -48.247 flat angles P-C4'-P energy: -25.128 tors. eta vs tors. theta energy: -65.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -664.393721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.393721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.393721 (E_RNA) where: Base-Base interactions energy: -448.715 where: short stacking energy: -213.674 Base-Backbone interact. energy: -1.553 local terms energy: -214.125912 where: bonds (distance) C4'-P energy: -43.342 bonds (distance) P-C4' energy: -45.909 flat angles C4'-P-C4' energy: -47.942 flat angles P-C4'-P energy: -22.813 tors. eta vs tors. theta energy: -54.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -597.718229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.718229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.718229 (E_RNA) where: Base-Base interactions energy: -401.287 where: short stacking energy: -170.466 Base-Backbone interact. energy: 0.645 local terms energy: -197.076809 where: bonds (distance) C4'-P energy: -38.694 bonds (distance) P-C4' energy: -38.812 flat angles C4'-P-C4' energy: -43.475 flat angles P-C4'-P energy: -26.193 tors. eta vs tors. theta energy: -49.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -597.312444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.312444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.312444 (E_RNA) where: Base-Base interactions energy: -406.904 where: short stacking energy: -176.032 Base-Backbone interact. energy: 0.257 local terms energy: -190.665702 where: bonds (distance) C4'-P energy: -39.752 bonds (distance) P-C4' energy: -44.508 flat angles C4'-P-C4' energy: -40.500 flat angles P-C4'-P energy: -21.158 tors. eta vs tors. theta energy: -44.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -505.676519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.676519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.676519 (E_RNA) where: Base-Base interactions energy: -341.092 where: short stacking energy: -133.249 Base-Backbone interact. energy: -1.238 local terms energy: -163.347267 where: bonds (distance) C4'-P energy: -36.849 bonds (distance) P-C4' energy: -30.814 flat angles C4'-P-C4' energy: -41.272 flat angles P-C4'-P energy: -21.502 tors. eta vs tors. theta energy: -32.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -497.642328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.642328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.642328 (E_RNA) where: Base-Base interactions energy: -318.033 where: short stacking energy: -142.435 Base-Backbone interact. energy: -0.575 local terms energy: -179.034279 where: bonds (distance) C4'-P energy: -41.190 bonds (distance) P-C4' energy: -40.605 flat angles C4'-P-C4' energy: -37.294 flat angles P-C4'-P energy: -31.223 tors. eta vs tors. theta energy: -28.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -340.868543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.868543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.868543 (E_RNA) where: Base-Base interactions energy: -188.274 where: short stacking energy: -91.914 Base-Backbone interact. energy: 0.854 local terms energy: -153.448578 where: bonds (distance) C4'-P energy: -51.540 bonds (distance) P-C4' energy: -46.994 flat angles C4'-P-C4' energy: -19.625 flat angles P-C4'-P energy: -27.992 tors. eta vs tors. theta energy: -7.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -208.584844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.584844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.584844 (E_RNA) where: Base-Base interactions energy: -73.862 where: short stacking energy: -67.042 Base-Backbone interact. energy: -0.774 local terms energy: -133.948804 where: bonds (distance) C4'-P energy: -46.823 bonds (distance) P-C4' energy: -34.617 flat angles C4'-P-C4' energy: -37.081 flat angles P-C4'-P energy: -15.700 tors. eta vs tors. theta energy: 0.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -785.650220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.650220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.650220 (E_RNA) where: Base-Base interactions energy: -544.268 where: short stacking energy: -251.527 Base-Backbone interact. energy: -0.755 local terms energy: -240.627326 where: bonds (distance) C4'-P energy: -45.986 bonds (distance) P-C4' energy: -47.666 flat angles C4'-P-C4' energy: -49.716 flat angles P-C4'-P energy: -28.636 tors. eta vs tors. theta energy: -68.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -721.618452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.618452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.618452 (E_RNA) where: Base-Base interactions energy: -490.920 where: short stacking energy: -223.430 Base-Backbone interact. energy: -1.589 local terms energy: -229.109559 where: bonds (distance) C4'-P energy: -46.794 bonds (distance) P-C4' energy: -40.415 flat angles C4'-P-C4' energy: -47.877 flat angles P-C4'-P energy: -32.630 tors. eta vs tors. theta energy: -61.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -723.312835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.312835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.312835 (E_RNA) where: Base-Base interactions energy: -486.597 where: short stacking energy: -223.051 Base-Backbone interact. energy: -0.395 local terms energy: -236.321518 where: bonds (distance) C4'-P energy: -44.248 bonds (distance) P-C4' energy: -44.753 flat angles C4'-P-C4' energy: -45.607 flat angles P-C4'-P energy: -38.223 tors. eta vs tors. theta energy: -63.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -630.821760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.821760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.821760 (E_RNA) where: Base-Base interactions energy: -425.599 where: short stacking energy: -188.108 Base-Backbone interact. energy: -2.337 local terms energy: -202.886479 where: bonds (distance) C4'-P energy: -47.035 bonds (distance) P-C4' energy: -47.227 flat angles C4'-P-C4' energy: -39.072 flat angles P-C4'-P energy: -24.198 tors. eta vs tors. theta energy: -45.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -669.633919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.633919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.633919 (E_RNA) where: Base-Base interactions energy: -466.460 where: short stacking energy: -211.972 Base-Backbone interact. energy: -2.236 local terms energy: -200.938042 where: bonds (distance) C4'-P energy: -41.583 bonds (distance) P-C4' energy: -38.934 flat angles C4'-P-C4' energy: -40.359 flat angles P-C4'-P energy: -29.820 tors. eta vs tors. theta energy: -50.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -588.102545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.102545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.102545 (E_RNA) where: Base-Base interactions energy: -390.290 where: short stacking energy: -169.641 Base-Backbone interact. energy: -2.130 local terms energy: -195.682821 where: bonds (distance) C4'-P energy: -38.329 bonds (distance) P-C4' energy: -44.241 flat angles C4'-P-C4' energy: -50.202 flat angles P-C4'-P energy: -27.629 tors. eta vs tors. theta energy: -35.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -479.276853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.276853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.276853 (E_RNA) where: Base-Base interactions energy: -310.703 where: short stacking energy: -134.935 Base-Backbone interact. energy: -0.121 local terms energy: -168.453340 where: bonds (distance) C4'-P energy: -41.416 bonds (distance) P-C4' energy: -44.783 flat angles C4'-P-C4' energy: -34.307 flat angles P-C4'-P energy: -20.575 tors. eta vs tors. theta energy: -27.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -490.854716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.854716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.854716 (E_RNA) where: Base-Base interactions energy: -326.879 where: short stacking energy: -156.419 Base-Backbone interact. energy: -0.603 local terms energy: -163.372072 where: bonds (distance) C4'-P energy: -31.889 bonds (distance) P-C4' energy: -35.416 flat angles C4'-P-C4' energy: -33.736 flat angles P-C4'-P energy: -26.509 tors. eta vs tors. theta energy: -35.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -397.173781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.173781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.173781 (E_RNA) where: Base-Base interactions energy: -238.218 where: short stacking energy: -122.592 Base-Backbone interact. energy: -2.146 local terms energy: -156.809963 where: bonds (distance) C4'-P energy: -38.265 bonds (distance) P-C4' energy: -46.421 flat angles C4'-P-C4' energy: -33.523 flat angles P-C4'-P energy: -22.443 tors. eta vs tors. theta energy: -16.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -201.156325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.156325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.156325 (E_RNA) where: Base-Base interactions energy: -69.460 where: short stacking energy: -63.802 Base-Backbone interact. energy: -0.191 local terms energy: -131.504394 where: bonds (distance) C4'-P energy: -41.711 bonds (distance) P-C4' energy: -40.878 flat angles C4'-P-C4' energy: -35.746 flat angles P-C4'-P energy: -22.190 tors. eta vs tors. theta energy: 9.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -783.245899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.245899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.245899 (E_RNA) where: Base-Base interactions energy: -529.760 where: short stacking energy: -237.319 Base-Backbone interact. energy: -0.279 local terms energy: -253.206744 where: bonds (distance) C4'-P energy: -49.846 bonds (distance) P-C4' energy: -46.296 flat angles C4'-P-C4' energy: -50.567 flat angles P-C4'-P energy: -40.008 tors. eta vs tors. theta energy: -66.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -718.444903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.444903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.444903 (E_RNA) where: Base-Base interactions energy: -486.725 where: short stacking energy: -233.526 Base-Backbone interact. energy: -1.196 local terms energy: -230.523770 where: bonds (distance) C4'-P energy: -40.098 bonds (distance) P-C4' energy: -42.076 flat angles C4'-P-C4' energy: -49.872 flat angles P-C4'-P energy: -31.376 tors. eta vs tors. theta energy: -67.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -755.589004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.589004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.589004 (E_RNA) where: Base-Base interactions energy: -515.841 where: short stacking energy: -230.225 Base-Backbone interact. energy: -0.525 local terms energy: -239.223731 where: bonds (distance) C4'-P energy: -43.550 bonds (distance) P-C4' energy: -46.249 flat angles C4'-P-C4' energy: -46.189 flat angles P-C4'-P energy: -38.955 tors. eta vs tors. theta energy: -64.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -639.554463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.554463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.554463 (E_RNA) where: Base-Base interactions energy: -427.252 where: short stacking energy: -193.771 Base-Backbone interact. energy: 2.299 local terms energy: -214.601259 where: bonds (distance) C4'-P energy: -36.828 bonds (distance) P-C4' energy: -39.820 flat angles C4'-P-C4' energy: -48.357 flat angles P-C4'-P energy: -34.420 tors. eta vs tors. theta energy: -55.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -672.199902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.199902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.199902 (E_RNA) where: Base-Base interactions energy: -456.782 where: short stacking energy: -216.684 Base-Backbone interact. energy: -1.289 local terms energy: -214.128395 where: bonds (distance) C4'-P energy: -45.068 bonds (distance) P-C4' energy: -37.707 flat angles C4'-P-C4' energy: -45.769 flat angles P-C4'-P energy: -31.692 tors. eta vs tors. theta energy: -53.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -592.555837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.555837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.555837 (E_RNA) where: Base-Base interactions energy: -405.841 where: short stacking energy: -180.365 Base-Backbone interact. energy: -1.587 local terms energy: -185.128226 where: bonds (distance) C4'-P energy: -34.515 bonds (distance) P-C4' energy: -38.614 flat angles C4'-P-C4' energy: -42.935 flat angles P-C4'-P energy: -25.203 tors. eta vs tors. theta energy: -43.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -482.761339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.761339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.761339 (E_RNA) where: Base-Base interactions energy: -311.045 where: short stacking energy: -138.315 Base-Backbone interact. energy: -0.904 local terms energy: -170.812349 where: bonds (distance) C4'-P energy: -40.429 bonds (distance) P-C4' energy: -42.445 flat angles C4'-P-C4' energy: -41.364 flat angles P-C4'-P energy: -22.699 tors. eta vs tors. theta energy: -23.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -493.006731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.006731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.006731 (E_RNA) where: Base-Base interactions energy: -334.473 where: short stacking energy: -134.911 Base-Backbone interact. energy: -1.493 local terms energy: -157.040883 where: bonds (distance) C4'-P energy: -38.507 bonds (distance) P-C4' energy: -36.057 flat angles C4'-P-C4' energy: -34.334 flat angles P-C4'-P energy: -21.146 tors. eta vs tors. theta energy: -26.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -361.251807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.251807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.251807 (E_RNA) where: Base-Base interactions energy: -222.298 where: short stacking energy: -110.979 Base-Backbone interact. energy: -0.588 local terms energy: -138.365734 where: bonds (distance) C4'-P energy: -40.088 bonds (distance) P-C4' energy: -40.742 flat angles C4'-P-C4' energy: -39.915 flat angles P-C4'-P energy: -8.374 tors. eta vs tors. theta energy: -9.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -241.280160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.280160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.280160 (E_RNA) where: Base-Base interactions energy: -95.556 where: short stacking energy: -89.800 Base-Backbone interact. energy: -0.575 local terms energy: -145.148590 where: bonds (distance) C4'-P energy: -36.934 bonds (distance) P-C4' energy: -43.775 flat angles C4'-P-C4' energy: -38.034 flat angles P-C4'-P energy: -16.916 tors. eta vs tors. theta energy: -9.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -792.628532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.628532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.628532 (E_RNA) where: Base-Base interactions energy: -549.317 where: short stacking energy: -249.423 Base-Backbone interact. energy: -0.689 local terms energy: -242.623069 where: bonds (distance) C4'-P energy: -46.804 bonds (distance) P-C4' energy: -42.317 flat angles C4'-P-C4' energy: -50.068 flat angles P-C4'-P energy: -33.618 tors. eta vs tors. theta energy: -69.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -771.139029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.139029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.139029 (E_RNA) where: Base-Base interactions energy: -525.956 where: short stacking energy: -251.416 Base-Backbone interact. energy: -0.458 local terms energy: -244.725136 where: bonds (distance) C4'-P energy: -43.905 bonds (distance) P-C4' energy: -46.025 flat angles C4'-P-C4' energy: -50.556 flat angles P-C4'-P energy: -36.927 tors. eta vs tors. theta energy: -67.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -698.589209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.589209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.589209 (E_RNA) where: Base-Base interactions energy: -461.458 where: short stacking energy: -217.373 Base-Backbone interact. energy: -2.068 local terms energy: -235.063144 where: bonds (distance) C4'-P energy: -40.600 bonds (distance) P-C4' energy: -48.576 flat angles C4'-P-C4' energy: -50.134 flat angles P-C4'-P energy: -31.971 tors. eta vs tors. theta energy: -63.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -662.856002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.856002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.856002 (E_RNA) where: Base-Base interactions energy: -448.742 where: short stacking energy: -190.370 Base-Backbone interact. energy: -1.445 local terms energy: -212.668611 where: bonds (distance) C4'-P energy: -39.406 bonds (distance) P-C4' energy: -48.147 flat angles C4'-P-C4' energy: -44.055 flat angles P-C4'-P energy: -29.597 tors. eta vs tors. theta energy: -51.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -636.420145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.420145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.420145 (E_RNA) where: Base-Base interactions energy: -438.143 where: short stacking energy: -164.967 Base-Backbone interact. energy: -2.422 local terms energy: -195.855285 where: bonds (distance) C4'-P energy: -39.532 bonds (distance) P-C4' energy: -43.324 flat angles C4'-P-C4' energy: -47.179 flat angles P-C4'-P energy: -28.604 tors. eta vs tors. theta energy: -37.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -577.007063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.007063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.007063 (E_RNA) where: Base-Base interactions energy: -373.192 where: short stacking energy: -168.981 Base-Backbone interact. energy: 0.821 local terms energy: -204.635715 where: bonds (distance) C4'-P energy: -41.590 bonds (distance) P-C4' energy: -41.745 flat angles C4'-P-C4' energy: -45.929 flat angles P-C4'-P energy: -24.605 tors. eta vs tors. theta energy: -50.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -490.370360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.370360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.370360 (E_RNA) where: Base-Base interactions energy: -316.806 where: short stacking energy: -146.606 Base-Backbone interact. energy: 0.367 local terms energy: -173.931617 where: bonds (distance) C4'-P energy: -32.034 bonds (distance) P-C4' energy: -42.743 flat angles C4'-P-C4' energy: -39.183 flat angles P-C4'-P energy: -31.627 tors. eta vs tors. theta energy: -28.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -483.941688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.941688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.941688 (E_RNA) where: Base-Base interactions energy: -309.670 where: short stacking energy: -140.460 Base-Backbone interact. energy: -1.255 local terms energy: -173.017161 where: bonds (distance) C4'-P energy: -38.686 bonds (distance) P-C4' energy: -34.411 flat angles C4'-P-C4' energy: -43.602 flat angles P-C4'-P energy: -30.180 tors. eta vs tors. theta energy: -26.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -399.094627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.094627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.094627 (E_RNA) where: Base-Base interactions energy: -250.457 where: short stacking energy: -127.920 Base-Backbone interact. energy: -1.394 local terms energy: -147.243923 where: bonds (distance) C4'-P energy: -29.391 bonds (distance) P-C4' energy: -37.909 flat angles C4'-P-C4' energy: -38.850 flat angles P-C4'-P energy: -22.346 tors. eta vs tors. theta energy: -18.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -209.025356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.025356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.025356 (E_RNA) where: Base-Base interactions energy: -82.598 where: short stacking energy: -80.872 Base-Backbone interact. energy: -1.408 local terms energy: -125.019399 where: bonds (distance) C4'-P energy: -36.339 bonds (distance) P-C4' energy: -35.216 flat angles C4'-P-C4' energy: -28.176 flat angles P-C4'-P energy: -19.140 tors. eta vs tors. theta energy: -6.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -787.411422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.411422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.411422 (E_RNA) where: Base-Base interactions energy: -543.916 where: short stacking energy: -251.217 Base-Backbone interact. energy: -0.066 local terms energy: -243.429940 where: bonds (distance) C4'-P energy: -44.265 bonds (distance) P-C4' energy: -39.788 flat angles C4'-P-C4' energy: -53.253 flat angles P-C4'-P energy: -36.083 tors. eta vs tors. theta energy: -70.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -772.442501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.442501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.442501 (E_RNA) where: Base-Base interactions energy: -540.708 where: short stacking energy: -247.654 Base-Backbone interact. energy: 1.003 local terms energy: -232.737549 where: bonds (distance) C4'-P energy: -44.806 bonds (distance) P-C4' energy: -44.128 flat angles C4'-P-C4' energy: -42.928 flat angles P-C4'-P energy: -33.437 tors. eta vs tors. theta energy: -67.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -703.255342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.255342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.255342 (E_RNA) where: Base-Base interactions energy: -473.880 where: short stacking energy: -235.644 Base-Backbone interact. energy: -0.966 local terms energy: -228.410052 where: bonds (distance) C4'-P energy: -43.803 bonds (distance) P-C4' energy: -37.658 flat angles C4'-P-C4' energy: -48.354 flat angles P-C4'-P energy: -29.380 tors. eta vs tors. theta energy: -69.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -689.768581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.768581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.768581 (E_RNA) where: Base-Base interactions energy: -454.910 where: short stacking energy: -215.072 Base-Backbone interact. energy: -1.062 local terms energy: -233.796164 where: bonds (distance) C4'-P energy: -41.562 bonds (distance) P-C4' energy: -43.474 flat angles C4'-P-C4' energy: -54.874 flat angles P-C4'-P energy: -33.883 tors. eta vs tors. theta energy: -60.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -637.087178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.087178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.087178 (E_RNA) where: Base-Base interactions energy: -443.927 where: short stacking energy: -180.803 Base-Backbone interact. energy: -2.082 local terms energy: -191.079016 where: bonds (distance) C4'-P energy: -35.447 bonds (distance) P-C4' energy: -38.509 flat angles C4'-P-C4' energy: -43.416 flat angles P-C4'-P energy: -31.399 tors. eta vs tors. theta energy: -42.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -575.654661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.654661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.654661 (E_RNA) where: Base-Base interactions energy: -379.815 where: short stacking energy: -172.681 Base-Backbone interact. energy: -0.485 local terms energy: -195.354698 where: bonds (distance) C4'-P energy: -27.814 bonds (distance) P-C4' energy: -50.604 flat angles C4'-P-C4' energy: -36.345 flat angles P-C4'-P energy: -27.025 tors. eta vs tors. theta energy: -53.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -455.348355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.348355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.348355 (E_RNA) where: Base-Base interactions energy: -286.310 where: short stacking energy: -132.168 Base-Backbone interact. energy: 1.753 local terms energy: -170.791025 where: bonds (distance) C4'-P energy: -43.005 bonds (distance) P-C4' energy: -29.861 flat angles C4'-P-C4' energy: -46.124 flat angles P-C4'-P energy: -27.442 tors. eta vs tors. theta energy: -24.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -478.279486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.279486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.279486 (E_RNA) where: Base-Base interactions energy: -302.067 where: short stacking energy: -147.719 Base-Backbone interact. energy: -2.482 local terms energy: -173.730582 where: bonds (distance) C4'-P energy: -40.598 bonds (distance) P-C4' energy: -45.596 flat angles C4'-P-C4' energy: -30.499 flat angles P-C4'-P energy: -23.739 tors. eta vs tors. theta energy: -33.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -368.988769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.988769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.988769 (E_RNA) where: Base-Base interactions energy: -210.611 where: short stacking energy: -100.380 Base-Backbone interact. energy: -0.263 local terms energy: -158.114025 where: bonds (distance) C4'-P energy: -29.280 bonds (distance) P-C4' energy: -43.001 flat angles C4'-P-C4' energy: -38.951 flat angles P-C4'-P energy: -23.308 tors. eta vs tors. theta energy: -23.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -229.614123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.614123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.614123 (E_RNA) where: Base-Base interactions energy: -101.958 where: short stacking energy: -86.410 Base-Backbone interact. energy: -0.497 local terms energy: -127.159053 where: bonds (distance) C4'-P energy: -31.881 bonds (distance) P-C4' energy: -34.934 flat angles C4'-P-C4' energy: -35.266 flat angles P-C4'-P energy: -12.952 tors. eta vs tors. theta energy: -12.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -792.694696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.694696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.694696 (E_RNA) where: Base-Base interactions energy: -546.941 where: short stacking energy: -252.610 Base-Backbone interact. energy: 2.612 local terms energy: -248.366074 where: bonds (distance) C4'-P energy: -46.510 bonds (distance) P-C4' energy: -41.644 flat angles C4'-P-C4' energy: -51.577 flat angles P-C4'-P energy: -35.278 tors. eta vs tors. theta energy: -73.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -767.296537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.296537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.296537 (E_RNA) where: Base-Base interactions energy: -532.035 where: short stacking energy: -231.469 Base-Backbone interact. energy: 0.648 local terms energy: -235.909095 where: bonds (distance) C4'-P energy: -41.307 bonds (distance) P-C4' energy: -39.383 flat angles C4'-P-C4' energy: -55.777 flat angles P-C4'-P energy: -34.938 tors. eta vs tors. theta energy: -64.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -701.836495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.836495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.836495 (E_RNA) where: Base-Base interactions energy: -483.798 where: short stacking energy: -228.320 Base-Backbone interact. energy: 1.380 local terms energy: -219.419312 where: bonds (distance) C4'-P energy: -44.440 bonds (distance) P-C4' energy: -46.245 flat angles C4'-P-C4' energy: -52.066 flat angles P-C4'-P energy: -22.015 tors. eta vs tors. theta energy: -54.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -702.586497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.586497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.586497 (E_RNA) where: Base-Base interactions energy: -482.774 where: short stacking energy: -215.830 Base-Backbone interact. energy: 1.630 local terms energy: -221.442057 where: bonds (distance) C4'-P energy: -45.896 bonds (distance) P-C4' energy: -46.832 flat angles C4'-P-C4' energy: -45.399 flat angles P-C4'-P energy: -31.768 tors. eta vs tors. theta energy: -51.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -642.654025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.654025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.654025 (E_RNA) where: Base-Base interactions energy: -438.661 where: short stacking energy: -180.994 Base-Backbone interact. energy: -1.832 local terms energy: -202.161344 where: bonds (distance) C4'-P energy: -30.534 bonds (distance) P-C4' energy: -44.286 flat angles C4'-P-C4' energy: -50.710 flat angles P-C4'-P energy: -29.352 tors. eta vs tors. theta energy: -47.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -587.639739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.639739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.639739 (E_RNA) where: Base-Base interactions energy: -388.286 where: short stacking energy: -177.151 Base-Backbone interact. energy: -0.531 local terms energy: -198.822693 where: bonds (distance) C4'-P energy: -36.474 bonds (distance) P-C4' energy: -31.212 flat angles C4'-P-C4' energy: -48.645 flat angles P-C4'-P energy: -39.409 tors. eta vs tors. theta energy: -43.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -502.033996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.033996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.033996 (E_RNA) where: Base-Base interactions energy: -321.227 where: short stacking energy: -142.238 Base-Backbone interact. energy: -1.024 local terms energy: -179.783026 where: bonds (distance) C4'-P energy: -32.249 bonds (distance) P-C4' energy: -40.505 flat angles C4'-P-C4' energy: -44.868 flat angles P-C4'-P energy: -28.922 tors. eta vs tors. theta energy: -33.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -500.246233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.246233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.246233 (E_RNA) where: Base-Base interactions energy: -323.596 where: short stacking energy: -150.111 Base-Backbone interact. energy: -1.679 local terms energy: -174.970735 where: bonds (distance) C4'-P energy: -34.414 bonds (distance) P-C4' energy: -39.384 flat angles C4'-P-C4' energy: -45.576 flat angles P-C4'-P energy: -23.897 tors. eta vs tors. theta energy: -31.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -354.618345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.618345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.618345 (E_RNA) where: Base-Base interactions energy: -208.925 where: short stacking energy: -91.645 Base-Backbone interact. energy: 0.780 local terms energy: -146.473074 where: bonds (distance) C4'-P energy: -42.327 bonds (distance) P-C4' energy: -24.692 flat angles C4'-P-C4' energy: -38.043 flat angles P-C4'-P energy: -29.675 tors. eta vs tors. theta energy: -11.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -219.864619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.864619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.864619 (E_RNA) where: Base-Base interactions energy: -101.787 where: short stacking energy: -64.323 Base-Backbone interact. energy: -0.239 local terms energy: -117.838976 where: bonds (distance) C4'-P energy: -40.603 bonds (distance) P-C4' energy: -28.404 flat angles C4'-P-C4' energy: -23.002 flat angles P-C4'-P energy: -23.584 tors. eta vs tors. theta energy: -2.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -792.864242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.864242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.864242 (E_RNA) where: Base-Base interactions energy: -540.497 where: short stacking energy: -258.877 Base-Backbone interact. energy: -0.354 local terms energy: -252.013407 where: bonds (distance) C4'-P energy: -39.307 bonds (distance) P-C4' energy: -47.276 flat angles C4'-P-C4' energy: -54.568 flat angles P-C4'-P energy: -36.732 tors. eta vs tors. theta energy: -74.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -765.119564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.119564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.119564 (E_RNA) where: Base-Base interactions energy: -528.262 where: short stacking energy: -233.605 Base-Backbone interact. energy: -0.609 local terms energy: -236.248398 where: bonds (distance) C4'-P energy: -46.458 bonds (distance) P-C4' energy: -46.672 flat angles C4'-P-C4' energy: -53.024 flat angles P-C4'-P energy: -25.186 tors. eta vs tors. theta energy: -64.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -735.340871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.340871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.340871 (E_RNA) where: Base-Base interactions energy: -497.164 where: short stacking energy: -228.725 Base-Backbone interact. energy: 1.810 local terms energy: -239.987256 where: bonds (distance) C4'-P energy: -47.163 bonds (distance) P-C4' energy: -41.269 flat angles C4'-P-C4' energy: -55.934 flat angles P-C4'-P energy: -29.516 tors. eta vs tors. theta energy: -66.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -643.770991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.770991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.770991 (E_RNA) where: Base-Base interactions energy: -437.091 where: short stacking energy: -193.990 Base-Backbone interact. energy: -0.789 local terms energy: -205.891236 where: bonds (distance) C4'-P energy: -39.643 bonds (distance) P-C4' energy: -43.404 flat angles C4'-P-C4' energy: -43.873 flat angles P-C4'-P energy: -28.170 tors. eta vs tors. theta energy: -50.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -644.136444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.136444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.136444 (E_RNA) where: Base-Base interactions energy: -451.198 where: short stacking energy: -198.411 Base-Backbone interact. energy: -2.066 local terms energy: -190.872561 where: bonds (distance) C4'-P energy: -34.540 bonds (distance) P-C4' energy: -29.928 flat angles C4'-P-C4' energy: -44.794 flat angles P-C4'-P energy: -31.981 tors. eta vs tors. theta energy: -49.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -567.570672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.570672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.570672 (E_RNA) where: Base-Base interactions energy: -376.846 where: short stacking energy: -171.879 Base-Backbone interact. energy: -0.364 local terms energy: -190.359911 where: bonds (distance) C4'-P energy: -29.969 bonds (distance) P-C4' energy: -44.788 flat angles C4'-P-C4' energy: -45.757 flat angles P-C4'-P energy: -23.236 tors. eta vs tors. theta energy: -46.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -506.442802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.442802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.442802 (E_RNA) where: Base-Base interactions energy: -338.251 where: short stacking energy: -143.537 Base-Backbone interact. energy: -0.774 local terms energy: -167.418648 where: bonds (distance) C4'-P energy: -43.128 bonds (distance) P-C4' energy: -39.843 flat angles C4'-P-C4' energy: -35.799 flat angles P-C4'-P energy: -28.455 tors. eta vs tors. theta energy: -20.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -527.017662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.017662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.017662 (E_RNA) where: Base-Base interactions energy: -346.303 where: short stacking energy: -151.981 Base-Backbone interact. energy: -0.721 local terms energy: -179.993641 where: bonds (distance) C4'-P energy: -31.476 bonds (distance) P-C4' energy: -48.756 flat angles C4'-P-C4' energy: -40.194 flat angles P-C4'-P energy: -26.640 tors. eta vs tors. theta energy: -32.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -348.030483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.030483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.030483 (E_RNA) where: Base-Base interactions energy: -201.281 where: short stacking energy: -89.101 Base-Backbone interact. energy: -1.657 local terms energy: -145.092568 where: bonds (distance) C4'-P energy: -37.112 bonds (distance) P-C4' energy: -47.370 flat angles C4'-P-C4' energy: -46.055 flat angles P-C4'-P energy: -13.826 tors. eta vs tors. theta energy: -0.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -229.406409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.406409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.406409 (E_RNA) where: Base-Base interactions energy: -85.399 where: short stacking energy: -80.553 Base-Backbone interact. energy: 0.941 local terms energy: -144.948508 where: bonds (distance) C4'-P energy: -37.133 bonds (distance) P-C4' energy: -49.829 flat angles C4'-P-C4' energy: -31.688 flat angles P-C4'-P energy: -18.393 tors. eta vs tors. theta energy: -7.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -799.276326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.276326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.276326 (E_RNA) where: Base-Base interactions energy: -541.264 where: short stacking energy: -236.060 Base-Backbone interact. energy: -0.773 local terms energy: -257.239112 where: bonds (distance) C4'-P energy: -44.324 bonds (distance) P-C4' energy: -47.811 flat angles C4'-P-C4' energy: -51.854 flat angles P-C4'-P energy: -40.365 tors. eta vs tors. theta energy: -72.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -763.089733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.089733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.089733 (E_RNA) where: Base-Base interactions energy: -530.764 where: short stacking energy: -219.731 Base-Backbone interact. energy: 0.275 local terms energy: -232.600586 where: bonds (distance) C4'-P energy: -43.931 bonds (distance) P-C4' energy: -52.908 flat angles C4'-P-C4' energy: -47.609 flat angles P-C4'-P energy: -29.117 tors. eta vs tors. theta energy: -59.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -713.024175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.024175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.024175 (E_RNA) where: Base-Base interactions energy: -492.329 where: short stacking energy: -224.760 Base-Backbone interact. energy: -2.695 local terms energy: -218.000798 where: bonds (distance) C4'-P energy: -39.986 bonds (distance) P-C4' energy: -38.316 flat angles C4'-P-C4' energy: -47.810 flat angles P-C4'-P energy: -35.567 tors. eta vs tors. theta energy: -56.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -666.604883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.604883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.604883 (E_RNA) where: Base-Base interactions energy: -461.617 where: short stacking energy: -200.219 Base-Backbone interact. energy: -0.532 local terms energy: -204.455961 where: bonds (distance) C4'-P energy: -42.225 bonds (distance) P-C4' energy: -37.001 flat angles C4'-P-C4' energy: -45.292 flat angles P-C4'-P energy: -30.820 tors. eta vs tors. theta energy: -49.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -629.168020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.168020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.168020 (E_RNA) where: Base-Base interactions energy: -406.723 where: short stacking energy: -173.807 Base-Backbone interact. energy: -0.513 local terms energy: -221.931742 where: bonds (distance) C4'-P energy: -43.259 bonds (distance) P-C4' energy: -48.265 flat angles C4'-P-C4' energy: -40.200 flat angles P-C4'-P energy: -34.323 tors. eta vs tors. theta energy: -55.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -577.290126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.290126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.290126 (E_RNA) where: Base-Base interactions energy: -392.382 where: short stacking energy: -173.416 Base-Backbone interact. energy: -0.997 local terms energy: -183.911330 where: bonds (distance) C4'-P energy: -35.790 bonds (distance) P-C4' energy: -37.482 flat angles C4'-P-C4' energy: -45.169 flat angles P-C4'-P energy: -26.784 tors. eta vs tors. theta energy: -38.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -501.071238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.071238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.071238 (E_RNA) where: Base-Base interactions energy: -315.912 where: short stacking energy: -151.620 Base-Backbone interact. energy: -0.809 local terms energy: -184.350347 where: bonds (distance) C4'-P energy: -41.284 bonds (distance) P-C4' energy: -38.731 flat angles C4'-P-C4' energy: -43.451 flat angles P-C4'-P energy: -33.061 tors. eta vs tors. theta energy: -27.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -487.774461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.774461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.774461 (E_RNA) where: Base-Base interactions energy: -317.184 where: short stacking energy: -159.034 Base-Backbone interact. energy: 1.193 local terms energy: -171.782616 where: bonds (distance) C4'-P energy: -41.856 bonds (distance) P-C4' energy: -30.920 flat angles C4'-P-C4' energy: -41.504 flat angles P-C4'-P energy: -27.054 tors. eta vs tors. theta energy: -30.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -367.454128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.454128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.454128 (E_RNA) where: Base-Base interactions energy: -202.913 where: short stacking energy: -116.605 Base-Backbone interact. energy: -0.951 local terms energy: -163.590319 where: bonds (distance) C4'-P energy: -39.327 bonds (distance) P-C4' energy: -43.495 flat angles C4'-P-C4' energy: -36.148 flat angles P-C4'-P energy: -23.521 tors. eta vs tors. theta energy: -21.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -203.550674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.550674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.550674 (E_RNA) where: Base-Base interactions energy: -85.541 where: short stacking energy: -68.932 Base-Backbone interact. energy: -0.944 local terms energy: -117.065015 where: bonds (distance) C4'-P energy: -41.360 bonds (distance) P-C4' energy: -37.493 flat angles C4'-P-C4' energy: -33.224 flat angles P-C4'-P energy: -1.264 tors. eta vs tors. theta energy: -3.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -781.858461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.858461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.858461 (E_RNA) where: Base-Base interactions energy: -532.037 where: short stacking energy: -238.513 Base-Backbone interact. energy: -1.238 local terms energy: -248.584184 where: bonds (distance) C4'-P energy: -50.373 bonds (distance) P-C4' energy: -41.107 flat angles C4'-P-C4' energy: -51.898 flat angles P-C4'-P energy: -41.461 tors. eta vs tors. theta energy: -63.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -778.022723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.022723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.022723 (E_RNA) where: Base-Base interactions energy: -534.984 where: short stacking energy: -247.996 Base-Backbone interact. energy: 1.536 local terms energy: -244.574238 where: bonds (distance) C4'-P energy: -41.789 bonds (distance) P-C4' energy: -44.567 flat angles C4'-P-C4' energy: -52.541 flat angles P-C4'-P energy: -35.880 tors. eta vs tors. theta energy: -69.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -694.836215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.836215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.836215 (E_RNA) where: Base-Base interactions energy: -475.546 where: short stacking energy: -204.589 Base-Backbone interact. energy: -0.694 local terms energy: -218.596154 where: bonds (distance) C4'-P energy: -46.399 bonds (distance) P-C4' energy: -42.423 flat angles C4'-P-C4' energy: -42.717 flat angles P-C4'-P energy: -34.886 tors. eta vs tors. theta energy: -52.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -694.608170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.608170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.608170 (E_RNA) where: Base-Base interactions energy: -470.738 where: short stacking energy: -197.041 Base-Backbone interact. energy: -2.226 local terms energy: -221.643825 where: bonds (distance) C4'-P energy: -39.902 bonds (distance) P-C4' energy: -43.046 flat angles C4'-P-C4' energy: -49.962 flat angles P-C4'-P energy: -32.022 tors. eta vs tors. theta energy: -56.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -591.809879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.809879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.809879 (E_RNA) where: Base-Base interactions energy: -387.213 where: short stacking energy: -175.278 Base-Backbone interact. energy: -1.180 local terms energy: -203.416903 where: bonds (distance) C4'-P energy: -44.211 bonds (distance) P-C4' energy: -44.888 flat angles C4'-P-C4' energy: -41.213 flat angles P-C4'-P energy: -31.201 tors. eta vs tors. theta energy: -41.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -606.088698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.088698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.088698 (E_RNA) where: Base-Base interactions energy: -409.164 where: short stacking energy: -183.218 Base-Backbone interact. energy: -0.530 local terms energy: -196.394320 where: bonds (distance) C4'-P energy: -37.947 bonds (distance) P-C4' energy: -42.122 flat angles C4'-P-C4' energy: -47.449 flat angles P-C4'-P energy: -21.604 tors. eta vs tors. theta energy: -47.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -502.705252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.705252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.705252 (E_RNA) where: Base-Base interactions energy: -327.650 where: short stacking energy: -137.735 Base-Backbone interact. energy: -1.810 local terms energy: -173.245480 where: bonds (distance) C4'-P energy: -42.949 bonds (distance) P-C4' energy: -39.894 flat angles C4'-P-C4' energy: -39.303 flat angles P-C4'-P energy: -16.056 tors. eta vs tors. theta energy: -35.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -499.270369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.270369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.270369 (E_RNA) where: Base-Base interactions energy: -327.154 where: short stacking energy: -155.959 Base-Backbone interact. energy: -0.229 local terms energy: -171.887037 where: bonds (distance) C4'-P energy: -42.617 bonds (distance) P-C4' energy: -33.275 flat angles C4'-P-C4' energy: -34.278 flat angles P-C4'-P energy: -20.522 tors. eta vs tors. theta energy: -41.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -383.616670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.616670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.616670 (E_RNA) where: Base-Base interactions energy: -246.371 where: short stacking energy: -105.650 Base-Backbone interact. energy: -0.801 local terms energy: -136.445162 where: bonds (distance) C4'-P energy: -34.630 bonds (distance) P-C4' energy: -46.704 flat angles C4'-P-C4' energy: -31.338 flat angles P-C4'-P energy: -17.099 tors. eta vs tors. theta energy: -6.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -201.078996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.078996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.078996 (E_RNA) where: Base-Base interactions energy: -74.995 where: short stacking energy: -60.331 Base-Backbone interact. energy: 0.231 local terms energy: -126.314583 where: bonds (distance) C4'-P energy: -28.747 bonds (distance) P-C4' energy: -39.134 flat angles C4'-P-C4' energy: -41.434 flat angles P-C4'-P energy: -22.036 tors. eta vs tors. theta energy: 5.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -781.004304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.004304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.004304 (E_RNA) where: Base-Base interactions energy: -534.851 where: short stacking energy: -246.516 Base-Backbone interact. energy: -2.329 local terms energy: -243.823624 where: bonds (distance) C4'-P energy: -51.031 bonds (distance) P-C4' energy: -45.780 flat angles C4'-P-C4' energy: -46.512 flat angles P-C4'-P energy: -35.449 tors. eta vs tors. theta energy: -65.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -771.150575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.150575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.150575 (E_RNA) where: Base-Base interactions energy: -525.741 where: short stacking energy: -240.824 Base-Backbone interact. energy: -1.199 local terms energy: -244.210456 where: bonds (distance) C4'-P energy: -47.536 bonds (distance) P-C4' energy: -37.785 flat angles C4'-P-C4' energy: -50.420 flat angles P-C4'-P energy: -36.376 tors. eta vs tors. theta energy: -72.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -716.017299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.017299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.017299 (E_RNA) where: Base-Base interactions energy: -496.825 where: short stacking energy: -219.710 Base-Backbone interact. energy: 4.359 local terms energy: -223.551454 where: bonds (distance) C4'-P energy: -39.443 bonds (distance) P-C4' energy: -48.825 flat angles C4'-P-C4' energy: -48.446 flat angles P-C4'-P energy: -32.802 tors. eta vs tors. theta energy: -54.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -688.168974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.168974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.168974 (E_RNA) where: Base-Base interactions energy: -477.223 where: short stacking energy: -195.826 Base-Backbone interact. energy: -0.688 local terms energy: -210.257837 where: bonds (distance) C4'-P energy: -46.965 bonds (distance) P-C4' energy: -44.340 flat angles C4'-P-C4' energy: -45.210 flat angles P-C4'-P energy: -26.217 tors. eta vs tors. theta energy: -47.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -590.880253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.880253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.880253 (E_RNA) where: Base-Base interactions energy: -388.819 where: short stacking energy: -185.415 Base-Backbone interact. energy: -0.924 local terms energy: -201.138183 where: bonds (distance) C4'-P energy: -39.807 bonds (distance) P-C4' energy: -47.287 flat angles C4'-P-C4' energy: -42.618 flat angles P-C4'-P energy: -22.441 tors. eta vs tors. theta energy: -48.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -582.503595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.503595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.503595 (E_RNA) where: Base-Base interactions energy: -388.822 where: short stacking energy: -158.871 Base-Backbone interact. energy: -0.578 local terms energy: -193.103774 where: bonds (distance) C4'-P energy: -40.542 bonds (distance) P-C4' energy: -39.302 flat angles C4'-P-C4' energy: -41.621 flat angles P-C4'-P energy: -26.367 tors. eta vs tors. theta energy: -45.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -527.695114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.695114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.695114 (E_RNA) where: Base-Base interactions energy: -342.617 where: short stacking energy: -162.873 Base-Backbone interact. energy: -0.621 local terms energy: -184.456394 where: bonds (distance) C4'-P energy: -39.446 bonds (distance) P-C4' energy: -42.508 flat angles C4'-P-C4' energy: -44.945 flat angles P-C4'-P energy: -20.928 tors. eta vs tors. theta energy: -36.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -481.701440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.701440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.701440 (E_RNA) where: Base-Base interactions energy: -305.292 where: short stacking energy: -157.166 Base-Backbone interact. energy: 1.428 local terms energy: -177.837987 where: bonds (distance) C4'-P energy: -36.178 bonds (distance) P-C4' energy: -42.292 flat angles C4'-P-C4' energy: -34.074 flat angles P-C4'-P energy: -29.985 tors. eta vs tors. theta energy: -35.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -347.626740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.626740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.626740 (E_RNA) where: Base-Base interactions energy: -200.304 where: short stacking energy: -92.702 Base-Backbone interact. energy: 0.172 local terms energy: -147.495416 where: bonds (distance) C4'-P energy: -28.226 bonds (distance) P-C4' energy: -43.621 flat angles C4'-P-C4' energy: -45.929 flat angles P-C4'-P energy: -14.292 tors. eta vs tors. theta energy: -15.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -210.480683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.480683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.480683 (E_RNA) where: Base-Base interactions energy: -81.339 where: short stacking energy: -79.425 Base-Backbone interact. energy: 0.025 local terms energy: -129.166693 where: bonds (distance) C4'-P energy: -22.707 bonds (distance) P-C4' energy: -45.184 flat angles C4'-P-C4' energy: -37.407 flat angles P-C4'-P energy: -21.128 tors. eta vs tors. theta energy: -2.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -818.602462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.602462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.602462 (E_RNA) where: Base-Base interactions energy: -572.137 where: short stacking energy: -253.871 Base-Backbone interact. energy: -1.208 local terms energy: -245.257496 where: bonds (distance) C4'-P energy: -38.876 bonds (distance) P-C4' energy: -44.564 flat angles C4'-P-C4' energy: -51.774 flat angles P-C4'-P energy: -35.443 tors. eta vs tors. theta energy: -74.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -771.890995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.890995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.890995 (E_RNA) where: Base-Base interactions energy: -523.382 where: short stacking energy: -243.487 Base-Backbone interact. energy: -0.777 local terms energy: -247.731826 where: bonds (distance) C4'-P energy: -49.484 bonds (distance) P-C4' energy: -48.513 flat angles C4'-P-C4' energy: -53.444 flat angles P-C4'-P energy: -34.532 tors. eta vs tors. theta energy: -61.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -728.690184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.690184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.690184 (E_RNA) where: Base-Base interactions energy: -502.495 where: short stacking energy: -228.233 Base-Backbone interact. energy: -0.288 local terms energy: -225.907209 where: bonds (distance) C4'-P energy: -48.049 bonds (distance) P-C4' energy: -43.294 flat angles C4'-P-C4' energy: -46.270 flat angles P-C4'-P energy: -36.886 tors. eta vs tors. theta energy: -51.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -649.594957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.594957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.594957 (E_RNA) where: Base-Base interactions energy: -433.927 where: short stacking energy: -187.234 Base-Backbone interact. energy: 0.481 local terms energy: -216.149067 where: bonds (distance) C4'-P energy: -43.283 bonds (distance) P-C4' energy: -43.530 flat angles C4'-P-C4' energy: -47.395 flat angles P-C4'-P energy: -27.407 tors. eta vs tors. theta energy: -54.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -610.961061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.961061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.961061 (E_RNA) where: Base-Base interactions energy: -395.648 where: short stacking energy: -180.373 Base-Backbone interact. energy: -0.340 local terms energy: -214.973731 where: bonds (distance) C4'-P energy: -37.369 bonds (distance) P-C4' energy: -48.546 flat angles C4'-P-C4' energy: -46.314 flat angles P-C4'-P energy: -33.039 tors. eta vs tors. theta energy: -49.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -661.884604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.884604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.884604 (E_RNA) where: Base-Base interactions energy: -462.438 where: short stacking energy: -209.696 Base-Backbone interact. energy: -0.891 local terms energy: -198.555556 where: bonds (distance) C4'-P energy: -36.475 bonds (distance) P-C4' energy: -40.943 flat angles C4'-P-C4' energy: -47.987 flat angles P-C4'-P energy: -27.519 tors. eta vs tors. theta energy: -45.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -496.009918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.009918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.009918 (E_RNA) where: Base-Base interactions energy: -316.882 where: short stacking energy: -145.507 Base-Backbone interact. energy: 0.238 local terms energy: -179.365900 where: bonds (distance) C4'-P energy: -32.623 bonds (distance) P-C4' energy: -48.646 flat angles C4'-P-C4' energy: -34.623 flat angles P-C4'-P energy: -31.146 tors. eta vs tors. theta energy: -32.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -468.052144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.052144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.052144 (E_RNA) where: Base-Base interactions energy: -298.439 where: short stacking energy: -146.393 Base-Backbone interact. energy: -0.247 local terms energy: -169.366041 where: bonds (distance) C4'-P energy: -43.574 bonds (distance) P-C4' energy: -36.719 flat angles C4'-P-C4' energy: -41.095 flat angles P-C4'-P energy: -25.961 tors. eta vs tors. theta energy: -22.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -350.031036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.031036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.031036 (E_RNA) where: Base-Base interactions energy: -209.260 where: short stacking energy: -114.664 Base-Backbone interact. energy: -2.097 local terms energy: -138.674497 where: bonds (distance) C4'-P energy: -40.582 bonds (distance) P-C4' energy: -42.673 flat angles C4'-P-C4' energy: -36.324 flat angles P-C4'-P energy: -11.631 tors. eta vs tors. theta energy: -7.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -208.310583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.310583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.310583 (E_RNA) where: Base-Base interactions energy: -85.627 where: short stacking energy: -82.548 Base-Backbone interact. energy: 2.352 local terms energy: -125.036061 where: bonds (distance) C4'-P energy: -36.512 bonds (distance) P-C4' energy: -45.796 flat angles C4'-P-C4' energy: -32.954 flat angles P-C4'-P energy: -15.265 tors. eta vs tors. theta energy: 5.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -826.946133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.946133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.946133 (E_RNA) where: Base-Base interactions energy: -570.865 where: short stacking energy: -254.315 Base-Backbone interact. energy: -1.663 local terms energy: -254.418047 where: bonds (distance) C4'-P energy: -47.763 bonds (distance) P-C4' energy: -48.559 flat angles C4'-P-C4' energy: -51.806 flat angles P-C4'-P energy: -32.025 tors. eta vs tors. theta energy: -74.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -756.065893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.065893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.065893 (E_RNA) where: Base-Base interactions energy: -503.590 where: short stacking energy: -224.744 Base-Backbone interact. energy: -1.277 local terms energy: -251.199295 where: bonds (distance) C4'-P energy: -49.069 bonds (distance) P-C4' energy: -45.111 flat angles C4'-P-C4' energy: -51.790 flat angles P-C4'-P energy: -39.287 tors. eta vs tors. theta energy: -65.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -740.298277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.298277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.298277 (E_RNA) where: Base-Base interactions energy: -515.201 where: short stacking energy: -224.138 Base-Backbone interact. energy: 0.726 local terms energy: -225.823639 where: bonds (distance) C4'-P energy: -42.728 bonds (distance) P-C4' energy: -50.735 flat angles C4'-P-C4' energy: -47.632 flat angles P-C4'-P energy: -33.293 tors. eta vs tors. theta energy: -51.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -649.432990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.432990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.432990 (E_RNA) where: Base-Base interactions energy: -439.730 where: short stacking energy: -196.581 Base-Backbone interact. energy: -1.885 local terms energy: -207.817767 where: bonds (distance) C4'-P energy: -40.979 bonds (distance) P-C4' energy: -39.822 flat angles C4'-P-C4' energy: -43.451 flat angles P-C4'-P energy: -32.934 tors. eta vs tors. theta energy: -50.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -654.266550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.266550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.266550 (E_RNA) where: Base-Base interactions energy: -433.591 where: short stacking energy: -213.453 Base-Backbone interact. energy: -0.540 local terms energy: -220.134732 where: bonds (distance) C4'-P energy: -36.207 bonds (distance) P-C4' energy: -43.164 flat angles C4'-P-C4' energy: -47.252 flat angles P-C4'-P energy: -32.452 tors. eta vs tors. theta energy: -61.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -659.964173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.964173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.964173 (E_RNA) where: Base-Base interactions energy: -454.264 where: short stacking energy: -199.788 Base-Backbone interact. energy: -0.417 local terms energy: -205.283151 where: bonds (distance) C4'-P energy: -45.846 bonds (distance) P-C4' energy: -39.828 flat angles C4'-P-C4' energy: -40.307 flat angles P-C4'-P energy: -31.386 tors. eta vs tors. theta energy: -47.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -494.259973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.259973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.259973 (E_RNA) where: Base-Base interactions energy: -329.006 where: short stacking energy: -148.167 Base-Backbone interact. energy: -0.551 local terms energy: -164.702400 where: bonds (distance) C4'-P energy: -42.199 bonds (distance) P-C4' energy: -46.132 flat angles C4'-P-C4' energy: -28.696 flat angles P-C4'-P energy: -12.494 tors. eta vs tors. theta energy: -35.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -461.646005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.646005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.646005 (E_RNA) where: Base-Base interactions energy: -297.117 where: short stacking energy: -144.649 Base-Backbone interact. energy: 1.261 local terms energy: -165.790010 where: bonds (distance) C4'-P energy: -35.040 bonds (distance) P-C4' energy: -40.701 flat angles C4'-P-C4' energy: -33.224 flat angles P-C4'-P energy: -26.925 tors. eta vs tors. theta energy: -29.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -385.850564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.850564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.850564 (E_RNA) where: Base-Base interactions energy: -236.112 where: short stacking energy: -121.747 Base-Backbone interact. energy: -0.278 local terms energy: -149.460106 where: bonds (distance) C4'-P energy: -33.222 bonds (distance) P-C4' energy: -40.027 flat angles C4'-P-C4' energy: -34.477 flat angles P-C4'-P energy: -28.542 tors. eta vs tors. theta energy: -13.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -209.161406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.161406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.161406 (E_RNA) where: Base-Base interactions energy: -76.392 where: short stacking energy: -65.042 Base-Backbone interact. energy: -1.187 local terms energy: -131.582233 where: bonds (distance) C4'-P energy: -24.924 bonds (distance) P-C4' energy: -41.853 flat angles C4'-P-C4' energy: -36.346 flat angles P-C4'-P energy: -24.834 tors. eta vs tors. theta energy: -3.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -804.815065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.815065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.815065 (E_RNA) where: Base-Base interactions energy: -569.171 where: short stacking energy: -237.427 Base-Backbone interact. energy: 0.438 local terms energy: -236.082548 where: bonds (distance) C4'-P energy: -44.821 bonds (distance) P-C4' energy: -45.737 flat angles C4'-P-C4' energy: -47.504 flat angles P-C4'-P energy: -28.246 tors. eta vs tors. theta energy: -69.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -765.392626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.392626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.392626 (E_RNA) where: Base-Base interactions energy: -516.445 where: short stacking energy: -234.181 Base-Backbone interact. energy: -0.449 local terms energy: -248.498579 where: bonds (distance) C4'-P energy: -48.636 bonds (distance) P-C4' energy: -44.157 flat angles C4'-P-C4' energy: -54.076 flat angles P-C4'-P energy: -35.728 tors. eta vs tors. theta energy: -65.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -719.996798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.996798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.996798 (E_RNA) where: Base-Base interactions energy: -486.615 where: short stacking energy: -210.816 Base-Backbone interact. energy: -1.050 local terms energy: -232.331480 where: bonds (distance) C4'-P energy: -50.839 bonds (distance) P-C4' energy: -43.162 flat angles C4'-P-C4' energy: -48.868 flat angles P-C4'-P energy: -32.143 tors. eta vs tors. theta energy: -57.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -654.018558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.018558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.018558 (E_RNA) where: Base-Base interactions energy: -443.470 where: short stacking energy: -177.321 Base-Backbone interact. energy: -1.157 local terms energy: -209.391765 where: bonds (distance) C4'-P energy: -39.222 bonds (distance) P-C4' energy: -47.043 flat angles C4'-P-C4' energy: -52.216 flat angles P-C4'-P energy: -28.857 tors. eta vs tors. theta energy: -42.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -686.574117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.574117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.574117 (E_RNA) where: Base-Base interactions energy: -470.609 where: short stacking energy: -213.593 Base-Backbone interact. energy: -0.892 local terms energy: -215.072923 where: bonds (distance) C4'-P energy: -37.496 bonds (distance) P-C4' energy: -42.246 flat angles C4'-P-C4' energy: -50.256 flat angles P-C4'-P energy: -29.706 tors. eta vs tors. theta energy: -55.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -609.145649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.145649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.145649 (E_RNA) where: Base-Base interactions energy: -402.205 where: short stacking energy: -178.829 Base-Backbone interact. energy: -0.694 local terms energy: -206.247043 where: bonds (distance) C4'-P energy: -41.809 bonds (distance) P-C4' energy: -33.595 flat angles C4'-P-C4' energy: -49.827 flat angles P-C4'-P energy: -31.458 tors. eta vs tors. theta energy: -49.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -487.747821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.747821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.747821 (E_RNA) where: Base-Base interactions energy: -304.811 where: short stacking energy: -156.286 Base-Backbone interact. energy: 1.667 local terms energy: -184.603511 where: bonds (distance) C4'-P energy: -44.303 bonds (distance) P-C4' energy: -28.759 flat angles C4'-P-C4' energy: -43.888 flat angles P-C4'-P energy: -23.422 tors. eta vs tors. theta energy: -44.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -446.962692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.962692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.962692 (E_RNA) where: Base-Base interactions energy: -286.041 where: short stacking energy: -146.013 Base-Backbone interact. energy: -0.038 local terms energy: -160.883858 where: bonds (distance) C4'-P energy: -41.360 bonds (distance) P-C4' energy: -36.798 flat angles C4'-P-C4' energy: -27.274 flat angles P-C4'-P energy: -30.770 tors. eta vs tors. theta energy: -24.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -375.757497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.757497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.757497 (E_RNA) where: Base-Base interactions energy: -242.418 where: short stacking energy: -135.153 Base-Backbone interact. energy: -0.098 local terms energy: -133.241701 where: bonds (distance) C4'-P energy: -27.733 bonds (distance) P-C4' energy: -35.244 flat angles C4'-P-C4' energy: -33.338 flat angles P-C4'-P energy: -21.339 tors. eta vs tors. theta energy: -15.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -221.299930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.299930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.299930 (E_RNA) where: Base-Base interactions energy: -83.328 where: short stacking energy: -60.137 Base-Backbone interact. energy: -3.312 local terms energy: -134.660061 where: bonds (distance) C4'-P energy: -38.636 bonds (distance) P-C4' energy: -41.136 flat angles C4'-P-C4' energy: -37.713 flat angles P-C4'-P energy: -22.039 tors. eta vs tors. theta energy: 4.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -816.347595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.347595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.347595 (E_RNA) where: Base-Base interactions energy: -575.530 where: short stacking energy: -232.352 Base-Backbone interact. energy: -0.997 local terms energy: -239.819937 where: bonds (distance) C4'-P energy: -45.634 bonds (distance) P-C4' energy: -40.589 flat angles C4'-P-C4' energy: -44.579 flat angles P-C4'-P energy: -38.658 tors. eta vs tors. theta energy: -70.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -735.983340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.983340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.983340 (E_RNA) where: Base-Base interactions energy: -499.288 where: short stacking energy: -230.484 Base-Backbone interact. energy: -0.734 local terms energy: -235.960874 where: bonds (distance) C4'-P energy: -45.528 bonds (distance) P-C4' energy: -46.852 flat angles C4'-P-C4' energy: -48.356 flat angles P-C4'-P energy: -30.741 tors. eta vs tors. theta energy: -64.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -751.262141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.262141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.262141 (E_RNA) where: Base-Base interactions energy: -529.232 where: short stacking energy: -222.499 Base-Backbone interact. energy: -0.717 local terms energy: -221.313255 where: bonds (distance) C4'-P energy: -43.876 bonds (distance) P-C4' energy: -37.934 flat angles C4'-P-C4' energy: -48.749 flat angles P-C4'-P energy: -33.580 tors. eta vs tors. theta energy: -57.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -703.852654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.852654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.852654 (E_RNA) where: Base-Base interactions energy: -474.670 where: short stacking energy: -219.529 Base-Backbone interact. energy: -0.052 local terms energy: -229.130159 where: bonds (distance) C4'-P energy: -40.001 bonds (distance) P-C4' energy: -44.579 flat angles C4'-P-C4' energy: -55.343 flat angles P-C4'-P energy: -28.449 tors. eta vs tors. theta energy: -60.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -611.267676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.267676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.267676 (E_RNA) where: Base-Base interactions energy: -412.210 where: short stacking energy: -187.208 Base-Backbone interact. energy: -0.805 local terms energy: -198.252885 where: bonds (distance) C4'-P energy: -34.991 bonds (distance) P-C4' energy: -43.935 flat angles C4'-P-C4' energy: -46.228 flat angles P-C4'-P energy: -25.371 tors. eta vs tors. theta energy: -47.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -521.095403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.095403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.095403 (E_RNA) where: Base-Base interactions energy: -325.320 where: short stacking energy: -162.024 Base-Backbone interact. energy: 0.070 local terms energy: -195.845450 where: bonds (distance) C4'-P energy: -46.904 bonds (distance) P-C4' energy: -40.603 flat angles C4'-P-C4' energy: -37.993 flat angles P-C4'-P energy: -31.501 tors. eta vs tors. theta energy: -38.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -613.649567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.649567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.649567 (E_RNA) where: Base-Base interactions energy: -413.748 where: short stacking energy: -188.802 Base-Backbone interact. energy: -1.690 local terms energy: -198.210903 where: bonds (distance) C4'-P energy: -35.615 bonds (distance) P-C4' energy: -34.298 flat angles C4'-P-C4' energy: -47.026 flat angles P-C4'-P energy: -31.583 tors. eta vs tors. theta energy: -49.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -436.925097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.925097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.925097 (E_RNA) where: Base-Base interactions energy: -253.266 where: short stacking energy: -136.026 Base-Backbone interact. energy: -0.525 local terms energy: -183.134655 where: bonds (distance) C4'-P energy: -49.166 bonds (distance) P-C4' energy: -37.982 flat angles C4'-P-C4' energy: -42.660 flat angles P-C4'-P energy: -23.654 tors. eta vs tors. theta energy: -29.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -374.114717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.114717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.114717 (E_RNA) where: Base-Base interactions energy: -217.958 where: short stacking energy: -120.906 Base-Backbone interact. energy: -0.253 local terms energy: -155.903574 where: bonds (distance) C4'-P energy: -33.883 bonds (distance) P-C4' energy: -37.212 flat angles C4'-P-C4' energy: -34.671 flat angles P-C4'-P energy: -26.173 tors. eta vs tors. theta energy: -23.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -202.602724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.602724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.602724 (E_RNA) where: Base-Base interactions energy: -73.266 where: short stacking energy: -56.494 Base-Backbone interact. energy: -0.864 local terms energy: -128.472656 where: bonds (distance) C4'-P energy: -31.761 bonds (distance) P-C4' energy: -34.467 flat angles C4'-P-C4' energy: -38.255 flat angles P-C4'-P energy: -25.717 tors. eta vs tors. theta energy: 1.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -814.040624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.040624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.040624 (E_RNA) where: Base-Base interactions energy: -560.019 where: short stacking energy: -242.997 Base-Backbone interact. energy: 0.056 local terms energy: -254.077497 where: bonds (distance) C4'-P energy: -47.553 bonds (distance) P-C4' energy: -50.277 flat angles C4'-P-C4' energy: -54.129 flat angles P-C4'-P energy: -32.368 tors. eta vs tors. theta energy: -69.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -726.029529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.029529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.029529 (E_RNA) where: Base-Base interactions energy: -495.685 where: short stacking energy: -212.975 Base-Backbone interact. energy: 0.548 local terms energy: -230.891699 where: bonds (distance) C4'-P energy: -39.503 bonds (distance) P-C4' energy: -50.530 flat angles C4'-P-C4' energy: -52.411 flat angles P-C4'-P energy: -34.111 tors. eta vs tors. theta energy: -54.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -744.859115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.859115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.859115 (E_RNA) where: Base-Base interactions energy: -501.698 where: short stacking energy: -244.999 Base-Backbone interact. energy: -0.538 local terms energy: -242.623242 where: bonds (distance) C4'-P energy: -42.164 bonds (distance) P-C4' energy: -43.884 flat angles C4'-P-C4' energy: -51.522 flat angles P-C4'-P energy: -36.606 tors. eta vs tors. theta energy: -68.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -718.806813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.806813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.806813 (E_RNA) where: Base-Base interactions energy: -487.126 where: short stacking energy: -230.520 Base-Backbone interact. energy: -0.294 local terms energy: -231.387170 where: bonds (distance) C4'-P energy: -35.849 bonds (distance) P-C4' energy: -47.104 flat angles C4'-P-C4' energy: -50.210 flat angles P-C4'-P energy: -33.826 tors. eta vs tors. theta energy: -64.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -599.397923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.397923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.397923 (E_RNA) where: Base-Base interactions energy: -399.158 where: short stacking energy: -165.596 Base-Backbone interact. energy: -1.896 local terms energy: -198.344138 where: bonds (distance) C4'-P energy: -37.955 bonds (distance) P-C4' energy: -38.075 flat angles C4'-P-C4' energy: -47.089 flat angles P-C4'-P energy: -32.043 tors. eta vs tors. theta energy: -43.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -538.622471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.622471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.622471 (E_RNA) where: Base-Base interactions energy: -353.548 where: short stacking energy: -176.358 Base-Backbone interact. energy: -0.547 local terms energy: -184.527391 where: bonds (distance) C4'-P energy: -44.482 bonds (distance) P-C4' energy: -39.746 flat angles C4'-P-C4' energy: -42.283 flat angles P-C4'-P energy: -16.809 tors. eta vs tors. theta energy: -41.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -589.535072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.535072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.535072 (E_RNA) where: Base-Base interactions energy: -381.551 where: short stacking energy: -199.445 Base-Backbone interact. energy: -0.929 local terms energy: -207.055629 where: bonds (distance) C4'-P energy: -34.384 bonds (distance) P-C4' energy: -40.960 flat angles C4'-P-C4' energy: -44.070 flat angles P-C4'-P energy: -34.001 tors. eta vs tors. theta energy: -53.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -438.717690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.717690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.717690 (E_RNA) where: Base-Base interactions energy: -284.763 where: short stacking energy: -153.519 Base-Backbone interact. energy: -1.396 local terms energy: -152.558126 where: bonds (distance) C4'-P energy: -24.952 bonds (distance) P-C4' energy: -38.080 flat angles C4'-P-C4' energy: -35.674 flat angles P-C4'-P energy: -25.572 tors. eta vs tors. theta energy: -28.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -403.869025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.869025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.869025 (E_RNA) where: Base-Base interactions energy: -248.984 where: short stacking energy: -115.422 Base-Backbone interact. energy: 1.834 local terms energy: -156.719302 where: bonds (distance) C4'-P energy: -27.182 bonds (distance) P-C4' energy: -44.029 flat angles C4'-P-C4' energy: -40.869 flat angles P-C4'-P energy: -23.686 tors. eta vs tors. theta energy: -20.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -206.993954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.993954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.993954 (E_RNA) where: Base-Base interactions energy: -97.320 where: short stacking energy: -83.972 Base-Backbone interact. energy: 0.819 local terms energy: -110.493541 where: bonds (distance) C4'-P energy: -29.456 bonds (distance) P-C4' energy: -30.468 flat angles C4'-P-C4' energy: -22.190 flat angles P-C4'-P energy: -18.986 tors. eta vs tors. theta energy: -9.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -812.253522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.253522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.253522 (E_RNA) where: Base-Base interactions energy: -573.299 where: short stacking energy: -253.655 Base-Backbone interact. energy: -1.617 local terms energy: -237.337433 where: bonds (distance) C4'-P energy: -40.458 bonds (distance) P-C4' energy: -43.082 flat angles C4'-P-C4' energy: -52.259 flat angles P-C4'-P energy: -31.647 tors. eta vs tors. theta energy: -69.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -758.684071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.684071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.684071 (E_RNA) where: Base-Base interactions energy: -511.611 where: short stacking energy: -234.484 Base-Backbone interact. energy: -0.195 local terms energy: -246.878115 where: bonds (distance) C4'-P energy: -48.009 bonds (distance) P-C4' energy: -40.041 flat angles C4'-P-C4' energy: -52.636 flat angles P-C4'-P energy: -40.078 tors. eta vs tors. theta energy: -66.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -740.790020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.790020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.790020 (E_RNA) where: Base-Base interactions energy: -525.960 where: short stacking energy: -232.835 Base-Backbone interact. energy: -0.228 local terms energy: -214.601961 where: bonds (distance) C4'-P energy: -29.809 bonds (distance) P-C4' energy: -50.938 flat angles C4'-P-C4' energy: -49.768 flat angles P-C4'-P energy: -27.263 tors. eta vs tors. theta energy: -56.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -720.386497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.386497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.386497 (E_RNA) where: Base-Base interactions energy: -492.898 where: short stacking energy: -218.330 Base-Backbone interact. energy: -1.307 local terms energy: -226.181687 where: bonds (distance) C4'-P energy: -38.193 bonds (distance) P-C4' energy: -41.081 flat angles C4'-P-C4' energy: -46.984 flat angles P-C4'-P energy: -35.549 tors. eta vs tors. theta energy: -64.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -626.014705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.014705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.014705 (E_RNA) where: Base-Base interactions energy: -415.274 where: short stacking energy: -178.466 Base-Backbone interact. energy: -1.948 local terms energy: -208.792788 where: bonds (distance) C4'-P energy: -40.032 bonds (distance) P-C4' energy: -42.002 flat angles C4'-P-C4' energy: -46.487 flat angles P-C4'-P energy: -35.650 tors. eta vs tors. theta energy: -44.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -611.681726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.681726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.681726 (E_RNA) where: Base-Base interactions energy: -410.644 where: short stacking energy: -174.847 Base-Backbone interact. energy: -0.466 local terms energy: -200.572275 where: bonds (distance) C4'-P energy: -37.970 bonds (distance) P-C4' energy: -43.698 flat angles C4'-P-C4' energy: -45.611 flat angles P-C4'-P energy: -24.408 tors. eta vs tors. theta energy: -48.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -501.925463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.925463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.925463 (E_RNA) where: Base-Base interactions energy: -315.763 where: short stacking energy: -139.641 Base-Backbone interact. energy: -1.711 local terms energy: -184.451299 where: bonds (distance) C4'-P energy: -31.052 bonds (distance) P-C4' energy: -45.275 flat angles C4'-P-C4' energy: -42.266 flat angles P-C4'-P energy: -32.062 tors. eta vs tors. theta energy: -33.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -434.628112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.628112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.628112 (E_RNA) where: Base-Base interactions energy: -261.526 where: short stacking energy: -132.439 Base-Backbone interact. energy: -0.182 local terms energy: -172.920058 where: bonds (distance) C4'-P energy: -39.418 bonds (distance) P-C4' energy: -42.889 flat angles C4'-P-C4' energy: -41.099 flat angles P-C4'-P energy: -29.976 tors. eta vs tors. theta energy: -19.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -442.162091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.162091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.162091 (E_RNA) where: Base-Base interactions energy: -281.098 where: short stacking energy: -142.995 Base-Backbone interact. energy: 0.744 local terms energy: -161.808209 where: bonds (distance) C4'-P energy: -40.202 bonds (distance) P-C4' energy: -38.766 flat angles C4'-P-C4' energy: -39.909 flat angles P-C4'-P energy: -18.751 tors. eta vs tors. theta energy: -24.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -193.691783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.691783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.691783 (E_RNA) where: Base-Base interactions energy: -64.866 where: short stacking energy: -59.617 Base-Backbone interact. energy: -1.868 local terms energy: -126.958210 where: bonds (distance) C4'-P energy: -26.941 bonds (distance) P-C4' energy: -40.922 flat angles C4'-P-C4' energy: -35.578 flat angles P-C4'-P energy: -25.283 tors. eta vs tors. theta energy: 1.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -804.987943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.987943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.987943 (E_RNA) where: Base-Base interactions energy: -568.359 where: short stacking energy: -233.107 Base-Backbone interact. energy: 2.610 local terms energy: -239.238864 where: bonds (distance) C4'-P energy: -41.140 bonds (distance) P-C4' energy: -47.483 flat angles C4'-P-C4' energy: -46.719 flat angles P-C4'-P energy: -35.286 tors. eta vs tors. theta energy: -68.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -748.009983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.009983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.009983 (E_RNA) where: Base-Base interactions energy: -502.083 where: short stacking energy: -241.868 Base-Backbone interact. energy: -0.423 local terms energy: -245.503247 where: bonds (distance) C4'-P energy: -51.971 bonds (distance) P-C4' energy: -50.030 flat angles C4'-P-C4' energy: -46.687 flat angles P-C4'-P energy: -27.497 tors. eta vs tors. theta energy: -69.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -736.188890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.188890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.188890 (E_RNA) where: Base-Base interactions energy: -503.424 where: short stacking energy: -227.932 Base-Backbone interact. energy: -0.894 local terms energy: -231.870492 where: bonds (distance) C4'-P energy: -42.910 bonds (distance) P-C4' energy: -48.946 flat angles C4'-P-C4' energy: -52.168 flat angles P-C4'-P energy: -31.805 tors. eta vs tors. theta energy: -56.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -711.895246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.895246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.895246 (E_RNA) where: Base-Base interactions energy: -488.122 where: short stacking energy: -215.925 Base-Backbone interact. energy: -1.385 local terms energy: -222.387710 where: bonds (distance) C4'-P energy: -41.139 bonds (distance) P-C4' energy: -45.132 flat angles C4'-P-C4' energy: -45.721 flat angles P-C4'-P energy: -31.835 tors. eta vs tors. theta energy: -58.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -630.544057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.544057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.544057 (E_RNA) where: Base-Base interactions energy: -422.457 where: short stacking energy: -178.227 Base-Backbone interact. energy: -0.734 local terms energy: -207.352828 where: bonds (distance) C4'-P energy: -39.729 bonds (distance) P-C4' energy: -45.007 flat angles C4'-P-C4' energy: -41.503 flat angles P-C4'-P energy: -27.827 tors. eta vs tors. theta energy: -53.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -622.977357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.977357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.977357 (E_RNA) where: Base-Base interactions energy: -429.085 where: short stacking energy: -187.343 Base-Backbone interact. energy: -0.608 local terms energy: -193.285150 where: bonds (distance) C4'-P energy: -39.396 bonds (distance) P-C4' energy: -34.531 flat angles C4'-P-C4' energy: -41.358 flat angles P-C4'-P energy: -21.838 tors. eta vs tors. theta energy: -56.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -497.910177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.910177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.910177 (E_RNA) where: Base-Base interactions energy: -312.868 where: short stacking energy: -153.712 Base-Backbone interact. energy: -1.001 local terms energy: -184.041233 where: bonds (distance) C4'-P energy: -42.372 bonds (distance) P-C4' energy: -36.832 flat angles C4'-P-C4' energy: -46.303 flat angles P-C4'-P energy: -21.046 tors. eta vs tors. theta energy: -37.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -462.854504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.854504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.854504 (E_RNA) where: Base-Base interactions energy: -278.519 where: short stacking energy: -131.912 Base-Backbone interact. energy: 0.381 local terms energy: -184.716516 where: bonds (distance) C4'-P energy: -41.828 bonds (distance) P-C4' energy: -44.967 flat angles C4'-P-C4' energy: -44.788 flat angles P-C4'-P energy: -24.280 tors. eta vs tors. theta energy: -28.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -454.150198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.150198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.150198 (E_RNA) where: Base-Base interactions energy: -301.961 where: short stacking energy: -145.964 Base-Backbone interact. energy: -1.650 local terms energy: -150.538826 where: bonds (distance) C4'-P energy: -35.989 bonds (distance) P-C4' energy: -35.016 flat angles C4'-P-C4' energy: -30.449 flat angles P-C4'-P energy: -21.816 tors. eta vs tors. theta energy: -27.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -246.801681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.801681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.801681 (E_RNA) where: Base-Base interactions energy: -121.096 where: short stacking energy: -74.718 Base-Backbone interact. energy: -0.985 local terms energy: -124.720455 where: bonds (distance) C4'-P energy: -35.064 bonds (distance) P-C4' energy: -39.032 flat angles C4'-P-C4' energy: -30.160 flat angles P-C4'-P energy: -20.016 tors. eta vs tors. theta energy: -0.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -808.168813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.168813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.168813 (E_RNA) where: Base-Base interactions energy: -559.018 where: short stacking energy: -248.424 Base-Backbone interact. energy: -0.697 local terms energy: -248.454736 where: bonds (distance) C4'-P energy: -49.222 bonds (distance) P-C4' energy: -48.578 flat angles C4'-P-C4' energy: -50.772 flat angles P-C4'-P energy: -26.376 tors. eta vs tors. theta energy: -73.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -753.617529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.617529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.617529 (E_RNA) where: Base-Base interactions energy: -506.523 where: short stacking energy: -232.772 Base-Backbone interact. energy: -0.684 local terms energy: -246.410875 where: bonds (distance) C4'-P energy: -42.503 bonds (distance) P-C4' energy: -48.220 flat angles C4'-P-C4' energy: -50.798 flat angles P-C4'-P energy: -33.102 tors. eta vs tors. theta energy: -71.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -722.195859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.195859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.195859 (E_RNA) where: Base-Base interactions energy: -485.342 where: short stacking energy: -227.453 Base-Backbone interact. energy: -0.588 local terms energy: -236.265057 where: bonds (distance) C4'-P energy: -36.694 bonds (distance) P-C4' energy: -42.468 flat angles C4'-P-C4' energy: -57.692 flat angles P-C4'-P energy: -37.581 tors. eta vs tors. theta energy: -61.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -700.558451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.558451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.558451 (E_RNA) where: Base-Base interactions energy: -466.589 where: short stacking energy: -237.955 Base-Backbone interact. energy: -0.689 local terms energy: -233.280289 where: bonds (distance) C4'-P energy: -45.920 bonds (distance) P-C4' energy: -44.273 flat angles C4'-P-C4' energy: -48.186 flat angles P-C4'-P energy: -28.730 tors. eta vs tors. theta energy: -66.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -621.519665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.519665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.519665 (E_RNA) where: Base-Base interactions energy: -418.742 where: short stacking energy: -194.305 Base-Backbone interact. energy: -0.092 local terms energy: -202.685515 where: bonds (distance) C4'-P energy: -37.171 bonds (distance) P-C4' energy: -41.947 flat angles C4'-P-C4' energy: -49.270 flat angles P-C4'-P energy: -30.763 tors. eta vs tors. theta energy: -43.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -634.536339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.536339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.536339 (E_RNA) where: Base-Base interactions energy: -445.227 where: short stacking energy: -203.399 Base-Backbone interact. energy: -0.585 local terms energy: -188.724080 where: bonds (distance) C4'-P energy: -32.645 bonds (distance) P-C4' energy: -35.276 flat angles C4'-P-C4' energy: -47.773 flat angles P-C4'-P energy: -16.023 tors. eta vs tors. theta energy: -57.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -495.979417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.979417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.979417 (E_RNA) where: Base-Base interactions energy: -309.364 where: short stacking energy: -156.709 Base-Backbone interact. energy: 0.520 local terms energy: -187.134781 where: bonds (distance) C4'-P energy: -40.316 bonds (distance) P-C4' energy: -48.544 flat angles C4'-P-C4' energy: -38.144 flat angles P-C4'-P energy: -26.252 tors. eta vs tors. theta energy: -33.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -510.055417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.055417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.055417 (E_RNA) where: Base-Base interactions energy: -340.163 where: short stacking energy: -135.548 Base-Backbone interact. energy: -0.665 local terms energy: -169.227248 where: bonds (distance) C4'-P energy: -36.644 bonds (distance) P-C4' energy: -50.283 flat angles C4'-P-C4' energy: -38.034 flat angles P-C4'-P energy: -22.582 tors. eta vs tors. theta energy: -21.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -471.846491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.846491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.846491 (E_RNA) where: Base-Base interactions energy: -302.856 where: short stacking energy: -160.654 Base-Backbone interact. energy: -0.099 local terms energy: -168.891111 where: bonds (distance) C4'-P energy: -37.414 bonds (distance) P-C4' energy: -45.044 flat angles C4'-P-C4' energy: -32.407 flat angles P-C4'-P energy: -24.707 tors. eta vs tors. theta energy: -29.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -232.972171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.972171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.972171 (E_RNA) where: Base-Base interactions energy: -107.261 where: short stacking energy: -60.626 Base-Backbone interact. energy: 0.292 local terms energy: -126.002926 where: bonds (distance) C4'-P energy: -36.324 bonds (distance) P-C4' energy: -37.868 flat angles C4'-P-C4' energy: -30.779 flat angles P-C4'-P energy: -21.880 tors. eta vs tors. theta energy: 0.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -803.239312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.239312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.239312 (E_RNA) where: Base-Base interactions energy: -548.944 where: short stacking energy: -249.598 Base-Backbone interact. energy: -0.094 local terms energy: -254.201595 where: bonds (distance) C4'-P energy: -43.133 bonds (distance) P-C4' energy: -42.759 flat angles C4'-P-C4' energy: -57.004 flat angles P-C4'-P energy: -35.662 tors. eta vs tors. theta energy: -75.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -746.762535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.762535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.762535 (E_RNA) where: Base-Base interactions energy: -506.995 where: short stacking energy: -227.636 Base-Backbone interact. energy: 0.021 local terms energy: -239.789198 where: bonds (distance) C4'-P energy: -42.550 bonds (distance) P-C4' energy: -48.611 flat angles C4'-P-C4' energy: -51.331 flat angles P-C4'-P energy: -41.206 tors. eta vs tors. theta energy: -56.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -724.393926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.393926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.393926 (E_RNA) where: Base-Base interactions energy: -484.752 where: short stacking energy: -215.430 Base-Backbone interact. energy: -1.218 local terms energy: -238.424308 where: bonds (distance) C4'-P energy: -39.877 bonds (distance) P-C4' energy: -51.352 flat angles C4'-P-C4' energy: -49.011 flat angles P-C4'-P energy: -34.739 tors. eta vs tors. theta energy: -63.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -715.560280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.560280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.560280 (E_RNA) where: Base-Base interactions energy: -491.615 where: short stacking energy: -224.743 Base-Backbone interact. energy: -1.305 local terms energy: -222.639946 where: bonds (distance) C4'-P energy: -41.960 bonds (distance) P-C4' energy: -39.216 flat angles C4'-P-C4' energy: -53.049 flat angles P-C4'-P energy: -31.086 tors. eta vs tors. theta energy: -57.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -653.222646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.222646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.222646 (E_RNA) where: Base-Base interactions energy: -436.434 where: short stacking energy: -190.587 Base-Backbone interact. energy: -1.134 local terms energy: -215.654338 where: bonds (distance) C4'-P energy: -37.521 bonds (distance) P-C4' energy: -44.409 flat angles C4'-P-C4' energy: -44.767 flat angles P-C4'-P energy: -28.458 tors. eta vs tors. theta energy: -60.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -640.878675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.878675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.878675 (E_RNA) where: Base-Base interactions energy: -425.892 where: short stacking energy: -199.061 Base-Backbone interact. energy: -0.701 local terms energy: -214.285634 where: bonds (distance) C4'-P energy: -45.597 bonds (distance) P-C4' energy: -43.731 flat angles C4'-P-C4' energy: -48.999 flat angles P-C4'-P energy: -27.422 tors. eta vs tors. theta energy: -48.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -508.459497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.459497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.459497 (E_RNA) where: Base-Base interactions energy: -332.614 where: short stacking energy: -138.721 Base-Backbone interact. energy: -0.142 local terms energy: -175.703263 where: bonds (distance) C4'-P energy: -34.213 bonds (distance) P-C4' energy: -45.319 flat angles C4'-P-C4' energy: -46.275 flat angles P-C4'-P energy: -20.073 tors. eta vs tors. theta energy: -29.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -468.334486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.334486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.334486 (E_RNA) where: Base-Base interactions energy: -313.726 where: short stacking energy: -139.958 Base-Backbone interact. energy: 1.258 local terms energy: -155.867106 where: bonds (distance) C4'-P energy: -25.481 bonds (distance) P-C4' energy: -33.554 flat angles C4'-P-C4' energy: -42.298 flat angles P-C4'-P energy: -25.416 tors. eta vs tors. theta energy: -29.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -490.989559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.989559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.989559 (E_RNA) where: Base-Base interactions energy: -319.216 where: short stacking energy: -151.316 Base-Backbone interact. energy: -2.769 local terms energy: -169.004134 where: bonds (distance) C4'-P energy: -28.594 bonds (distance) P-C4' energy: -35.314 flat angles C4'-P-C4' energy: -34.622 flat angles P-C4'-P energy: -31.909 tors. eta vs tors. theta energy: -38.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -212.094755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.094755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.094755 (E_RNA) where: Base-Base interactions energy: -76.068 where: short stacking energy: -68.958 Base-Backbone interact. energy: 0.013 local terms energy: -136.039586 where: bonds (distance) C4'-P energy: -45.013 bonds (distance) P-C4' energy: -38.519 flat angles C4'-P-C4' energy: -26.438 flat angles P-C4'-P energy: -14.386 tors. eta vs tors. theta energy: -11.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -780.672748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.672748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.672748 (E_RNA) where: Base-Base interactions energy: -534.961 where: short stacking energy: -244.228 Base-Backbone interact. energy: -0.487 local terms energy: -245.224314 where: bonds (distance) C4'-P energy: -40.961 bonds (distance) P-C4' energy: -52.963 flat angles C4'-P-C4' energy: -50.024 flat angles P-C4'-P energy: -28.977 tors. eta vs tors. theta energy: -72.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -741.362433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.362433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.362433 (E_RNA) where: Base-Base interactions energy: -494.780 where: short stacking energy: -235.089 Base-Backbone interact. energy: -0.854 local terms energy: -245.728887 where: bonds (distance) C4'-P energy: -36.806 bonds (distance) P-C4' energy: -51.397 flat angles C4'-P-C4' energy: -56.501 flat angles P-C4'-P energy: -35.508 tors. eta vs tors. theta energy: -65.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -734.500823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.500823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.500823 (E_RNA) where: Base-Base interactions energy: -508.019 where: short stacking energy: -229.363 Base-Backbone interact. energy: -1.823 local terms energy: -224.658853 where: bonds (distance) C4'-P energy: -41.973 bonds (distance) P-C4' energy: -40.765 flat angles C4'-P-C4' energy: -50.655 flat angles P-C4'-P energy: -31.039 tors. eta vs tors. theta energy: -60.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -722.842380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.842380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.842380 (E_RNA) where: Base-Base interactions energy: -489.262 where: short stacking energy: -225.924 Base-Backbone interact. energy: -0.648 local terms energy: -232.932618 where: bonds (distance) C4'-P energy: -39.686 bonds (distance) P-C4' energy: -45.819 flat angles C4'-P-C4' energy: -51.158 flat angles P-C4'-P energy: -29.634 tors. eta vs tors. theta energy: -66.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -627.562600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.562600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.562600 (E_RNA) where: Base-Base interactions energy: -410.937 where: short stacking energy: -193.258 Base-Backbone interact. energy: -0.123 local terms energy: -216.502327 where: bonds (distance) C4'-P energy: -44.197 bonds (distance) P-C4' energy: -40.691 flat angles C4'-P-C4' energy: -50.973 flat angles P-C4'-P energy: -33.278 tors. eta vs tors. theta energy: -47.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -603.622939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.622939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.622939 (E_RNA) where: Base-Base interactions energy: -410.911 where: short stacking energy: -185.669 Base-Backbone interact. energy: -1.308 local terms energy: -191.404204 where: bonds (distance) C4'-P energy: -29.156 bonds (distance) P-C4' energy: -39.628 flat angles C4'-P-C4' energy: -41.703 flat angles P-C4'-P energy: -26.265 tors. eta vs tors. theta energy: -54.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -551.297405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.297405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.297405 (E_RNA) where: Base-Base interactions energy: -365.280 where: short stacking energy: -179.129 Base-Backbone interact. energy: -0.491 local terms energy: -185.526560 where: bonds (distance) C4'-P energy: -32.727 bonds (distance) P-C4' energy: -45.720 flat angles C4'-P-C4' energy: -39.085 flat angles P-C4'-P energy: -26.401 tors. eta vs tors. theta energy: -41.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -490.625940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.625940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.625940 (E_RNA) where: Base-Base interactions energy: -310.548 where: short stacking energy: -150.886 Base-Backbone interact. energy: -0.964 local terms energy: -179.113399 where: bonds (distance) C4'-P energy: -42.515 bonds (distance) P-C4' energy: -41.474 flat angles C4'-P-C4' energy: -41.305 flat angles P-C4'-P energy: -18.221 tors. eta vs tors. theta energy: -35.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -439.479197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.479197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.479197 (E_RNA) where: Base-Base interactions energy: -292.148 where: short stacking energy: -150.738 Base-Backbone interact. energy: 1.615 local terms energy: -148.946123 where: bonds (distance) C4'-P energy: -24.560 bonds (distance) P-C4' energy: -34.759 flat angles C4'-P-C4' energy: -36.456 flat angles P-C4'-P energy: -24.024 tors. eta vs tors. theta energy: -29.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -229.476053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.476053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.476053 (E_RNA) where: Base-Base interactions energy: -85.637 where: short stacking energy: -77.706 Base-Backbone interact. energy: -0.366 local terms energy: -143.472547 where: bonds (distance) C4'-P energy: -32.209 bonds (distance) P-C4' energy: -47.676 flat angles C4'-P-C4' energy: -42.100 flat angles P-C4'-P energy: -19.807 tors. eta vs tors. theta energy: -1.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -789.852355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.852355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.852355 (E_RNA) where: Base-Base interactions energy: -545.881 where: short stacking energy: -234.591 Base-Backbone interact. energy: -2.044 local terms energy: -241.927315 where: bonds (distance) C4'-P energy: -49.896 bonds (distance) P-C4' energy: -46.749 flat angles C4'-P-C4' energy: -48.713 flat angles P-C4'-P energy: -35.229 tors. eta vs tors. theta energy: -61.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -751.591027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.591027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.591027 (E_RNA) where: Base-Base interactions energy: -513.848 where: short stacking energy: -246.076 Base-Backbone interact. energy: 0.623 local terms energy: -238.365375 where: bonds (distance) C4'-P energy: -39.360 bonds (distance) P-C4' energy: -44.622 flat angles C4'-P-C4' energy: -49.600 flat angles P-C4'-P energy: -32.047 tors. eta vs tors. theta energy: -72.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -732.752172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.752172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.752172 (E_RNA) where: Base-Base interactions energy: -508.718 where: short stacking energy: -226.175 Base-Backbone interact. energy: -0.008 local terms energy: -224.026222 where: bonds (distance) C4'-P energy: -37.295 bonds (distance) P-C4' energy: -36.264 flat angles C4'-P-C4' energy: -50.946 flat angles P-C4'-P energy: -38.354 tors. eta vs tors. theta energy: -61.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -703.643593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.643593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.643593 (E_RNA) where: Base-Base interactions energy: -481.211 where: short stacking energy: -212.883 Base-Backbone interact. energy: 0.216 local terms energy: -222.648350 where: bonds (distance) C4'-P energy: -44.936 bonds (distance) P-C4' energy: -43.246 flat angles C4'-P-C4' energy: -46.889 flat angles P-C4'-P energy: -31.128 tors. eta vs tors. theta energy: -56.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -637.054569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.054569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.054569 (E_RNA) where: Base-Base interactions energy: -430.078 where: short stacking energy: -180.823 Base-Backbone interact. energy: -1.007 local terms energy: -205.969062 where: bonds (distance) C4'-P energy: -44.195 bonds (distance) P-C4' energy: -43.847 flat angles C4'-P-C4' energy: -45.248 flat angles P-C4'-P energy: -23.401 tors. eta vs tors. theta energy: -49.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -589.194513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.194513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.194513 (E_RNA) where: Base-Base interactions energy: -401.025 where: short stacking energy: -167.628 Base-Backbone interact. energy: -1.445 local terms energy: -186.724721 where: bonds (distance) C4'-P energy: -37.108 bonds (distance) P-C4' energy: -43.068 flat angles C4'-P-C4' energy: -44.852 flat angles P-C4'-P energy: -25.669 tors. eta vs tors. theta energy: -36.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -508.831755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.831755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.831755 (E_RNA) where: Base-Base interactions energy: -334.973 where: short stacking energy: -160.688 Base-Backbone interact. energy: -0.418 local terms energy: -173.440503 where: bonds (distance) C4'-P energy: -42.093 bonds (distance) P-C4' energy: -33.591 flat angles C4'-P-C4' energy: -38.350 flat angles P-C4'-P energy: -20.337 tors. eta vs tors. theta energy: -39.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -509.484490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.484490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.484490 (E_RNA) where: Base-Base interactions energy: -329.066 where: short stacking energy: -156.534 Base-Backbone interact. energy: -0.793 local terms energy: -179.625588 where: bonds (distance) C4'-P energy: -38.121 bonds (distance) P-C4' energy: -43.881 flat angles C4'-P-C4' energy: -46.394 flat angles P-C4'-P energy: -17.603 tors. eta vs tors. theta energy: -33.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -509.127865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.127865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.127865 (E_RNA) where: Base-Base interactions energy: -351.717 where: short stacking energy: -144.838 Base-Backbone interact. energy: -1.758 local terms energy: -155.652252 where: bonds (distance) C4'-P energy: -34.817 bonds (distance) P-C4' energy: -39.896 flat angles C4'-P-C4' energy: -37.761 flat angles P-C4'-P energy: -21.627 tors. eta vs tors. theta energy: -21.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -239.068261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.068261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.068261 (E_RNA) where: Base-Base interactions energy: -118.058 where: short stacking energy: -96.947 Base-Backbone interact. energy: 1.700 local terms energy: -122.709787 where: bonds (distance) C4'-P energy: -34.072 bonds (distance) P-C4' energy: -41.726 flat angles C4'-P-C4' energy: -25.181 flat angles P-C4'-P energy: -16.204 tors. eta vs tors. theta energy: -5.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -784.663121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.663121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.663121 (E_RNA) where: Base-Base interactions energy: -533.873 where: short stacking energy: -239.304 Base-Backbone interact. energy: -1.515 local terms energy: -249.275545 where: bonds (distance) C4'-P energy: -50.580 bonds (distance) P-C4' energy: -45.391 flat angles C4'-P-C4' energy: -50.312 flat angles P-C4'-P energy: -39.927 tors. eta vs tors. theta energy: -63.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -779.345567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.345567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.345567 (E_RNA) where: Base-Base interactions energy: -522.585 where: short stacking energy: -251.731 Base-Backbone interact. energy: -1.420 local terms energy: -255.341097 where: bonds (distance) C4'-P energy: -44.195 bonds (distance) P-C4' energy: -50.557 flat angles C4'-P-C4' energy: -50.021 flat angles P-C4'-P energy: -40.164 tors. eta vs tors. theta energy: -70.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -728.975054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.975054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.975054 (E_RNA) where: Base-Base interactions energy: -516.536 where: short stacking energy: -221.076 Base-Backbone interact. energy: -1.895 local terms energy: -210.543583 where: bonds (distance) C4'-P energy: -37.316 bonds (distance) P-C4' energy: -39.600 flat angles C4'-P-C4' energy: -54.392 flat angles P-C4'-P energy: -24.205 tors. eta vs tors. theta energy: -55.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -707.495616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.495616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.495616 (E_RNA) where: Base-Base interactions energy: -492.001 where: short stacking energy: -222.716 Base-Backbone interact. energy: -0.602 local terms energy: -214.891965 where: bonds (distance) C4'-P energy: -43.529 bonds (distance) P-C4' energy: -37.424 flat angles C4'-P-C4' energy: -50.200 flat angles P-C4'-P energy: -28.094 tors. eta vs tors. theta energy: -55.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -638.886272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.886272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.886272 (E_RNA) where: Base-Base interactions energy: -433.803 where: short stacking energy: -194.084 Base-Backbone interact. energy: -1.777 local terms energy: -203.305827 where: bonds (distance) C4'-P energy: -36.670 bonds (distance) P-C4' energy: -40.954 flat angles C4'-P-C4' energy: -45.736 flat angles P-C4'-P energy: -31.238 tors. eta vs tors. theta energy: -48.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -565.440677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.440677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.440677 (E_RNA) where: Base-Base interactions energy: -381.039 where: short stacking energy: -151.011 Base-Backbone interact. energy: 0.196 local terms energy: -184.598325 where: bonds (distance) C4'-P energy: -46.352 bonds (distance) P-C4' energy: -42.143 flat angles C4'-P-C4' energy: -41.444 flat angles P-C4'-P energy: -21.955 tors. eta vs tors. theta energy: -32.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -470.052610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.052610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.052610 (E_RNA) where: Base-Base interactions energy: -302.132 where: short stacking energy: -139.893 Base-Backbone interact. energy: 0.071 local terms energy: -167.991547 where: bonds (distance) C4'-P energy: -42.909 bonds (distance) P-C4' energy: -46.487 flat angles C4'-P-C4' energy: -34.699 flat angles P-C4'-P energy: -21.687 tors. eta vs tors. theta energy: -22.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -553.065638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.065638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.065638 (E_RNA) where: Base-Base interactions energy: -384.020 where: short stacking energy: -162.649 Base-Backbone interact. energy: -2.069 local terms energy: -166.976758 where: bonds (distance) C4'-P energy: -38.594 bonds (distance) P-C4' energy: -34.914 flat angles C4'-P-C4' energy: -38.173 flat angles P-C4'-P energy: -22.734 tors. eta vs tors. theta energy: -32.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -487.251105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.251105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.251105 (E_RNA) where: Base-Base interactions energy: -307.555 where: short stacking energy: -162.804 Base-Backbone interact. energy: 0.482 local terms energy: -180.177667 where: bonds (distance) C4'-P energy: -37.157 bonds (distance) P-C4' energy: -41.159 flat angles C4'-P-C4' energy: -42.876 flat angles P-C4'-P energy: -15.100 tors. eta vs tors. theta energy: -43.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -223.557579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.557579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.557579 (E_RNA) where: Base-Base interactions energy: -94.339 where: short stacking energy: -70.413 Base-Backbone interact. energy: 2.746 local terms energy: -131.964678 where: bonds (distance) C4'-P energy: -30.440 bonds (distance) P-C4' energy: -45.945 flat angles C4'-P-C4' energy: -35.336 flat angles P-C4'-P energy: -22.213 tors. eta vs tors. theta energy: 1.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -791.842164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.842164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.842164 (E_RNA) where: Base-Base interactions energy: -541.511 where: short stacking energy: -248.816 Base-Backbone interact. energy: -0.508 local terms energy: -249.823149 where: bonds (distance) C4'-P energy: -47.219 bonds (distance) P-C4' energy: -46.711 flat angles C4'-P-C4' energy: -50.526 flat angles P-C4'-P energy: -33.064 tors. eta vs tors. theta energy: -72.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -778.699673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.699673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.699673 (E_RNA) where: Base-Base interactions energy: -516.857 where: short stacking energy: -253.769 Base-Backbone interact. energy: -0.489 local terms energy: -261.353455 where: bonds (distance) C4'-P energy: -46.176 bonds (distance) P-C4' energy: -49.500 flat angles C4'-P-C4' energy: -50.267 flat angles P-C4'-P energy: -38.686 tors. eta vs tors. theta energy: -76.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -725.181512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.181512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.181512 (E_RNA) where: Base-Base interactions energy: -491.900 where: short stacking energy: -215.591 Base-Backbone interact. energy: -1.580 local terms energy: -231.701078 where: bonds (distance) C4'-P energy: -41.337 bonds (distance) P-C4' energy: -48.874 flat angles C4'-P-C4' energy: -49.854 flat angles P-C4'-P energy: -33.554 tors. eta vs tors. theta energy: -58.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -712.333802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.333802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.333802 (E_RNA) where: Base-Base interactions energy: -490.481 where: short stacking energy: -212.476 Base-Backbone interact. energy: -1.697 local terms energy: -220.156239 where: bonds (distance) C4'-P energy: -42.677 bonds (distance) P-C4' energy: -40.778 flat angles C4'-P-C4' energy: -49.794 flat angles P-C4'-P energy: -31.561 tors. eta vs tors. theta energy: -55.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -636.517209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.517209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.517209 (E_RNA) where: Base-Base interactions energy: -435.111 where: short stacking energy: -198.925 Base-Backbone interact. energy: -1.709 local terms energy: -199.697775 where: bonds (distance) C4'-P energy: -30.052 bonds (distance) P-C4' energy: -45.028 flat angles C4'-P-C4' energy: -46.562 flat angles P-C4'-P energy: -27.384 tors. eta vs tors. theta energy: -50.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -584.026585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.026585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.026585 (E_RNA) where: Base-Base interactions energy: -388.635 where: short stacking energy: -156.713 Base-Backbone interact. energy: -1.513 local terms energy: -193.877740 where: bonds (distance) C4'-P energy: -43.805 bonds (distance) P-C4' energy: -39.216 flat angles C4'-P-C4' energy: -41.307 flat angles P-C4'-P energy: -30.795 tors. eta vs tors. theta energy: -38.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -612.473560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.473560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.473560 (E_RNA) where: Base-Base interactions energy: -423.656 where: short stacking energy: -172.820 Base-Backbone interact. energy: -0.806 local terms energy: -188.011587 where: bonds (distance) C4'-P energy: -38.116 bonds (distance) P-C4' energy: -36.929 flat angles C4'-P-C4' energy: -44.100 flat angles P-C4'-P energy: -28.151 tors. eta vs tors. theta energy: -40.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -511.148117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.148117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.148117 (E_RNA) where: Base-Base interactions energy: -337.535 where: short stacking energy: -162.070 Base-Backbone interact. energy: -0.706 local terms energy: -172.907261 where: bonds (distance) C4'-P energy: -24.137 bonds (distance) P-C4' energy: -43.310 flat angles C4'-P-C4' energy: -45.222 flat angles P-C4'-P energy: -24.640 tors. eta vs tors. theta energy: -35.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -380.052973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.052973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.052973 (E_RNA) where: Base-Base interactions energy: -214.417 where: short stacking energy: -114.829 Base-Backbone interact. energy: -0.847 local terms energy: -164.789337 where: bonds (distance) C4'-P energy: -46.075 bonds (distance) P-C4' energy: -40.995 flat angles C4'-P-C4' energy: -42.049 flat angles P-C4'-P energy: -29.264 tors. eta vs tors. theta energy: -6.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -199.504514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.504514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.504514 (E_RNA) where: Base-Base interactions energy: -89.077 where: short stacking energy: -56.008 Base-Backbone interact. energy: -1.947 local terms energy: -108.480241 where: bonds (distance) C4'-P energy: -29.431 bonds (distance) P-C4' energy: -39.914 flat angles C4'-P-C4' energy: -32.291 flat angles P-C4'-P energy: -21.431 tors. eta vs tors. theta energy: 14.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -788.049858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.049858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.049858 (E_RNA) where: Base-Base interactions energy: -543.173 where: short stacking energy: -249.473 Base-Backbone interact. energy: -1.414 local terms energy: -243.463093 where: bonds (distance) C4'-P energy: -42.019 bonds (distance) P-C4' energy: -47.791 flat angles C4'-P-C4' energy: -48.773 flat angles P-C4'-P energy: -30.972 tors. eta vs tors. theta energy: -73.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -773.861733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.861733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.861733 (E_RNA) where: Base-Base interactions energy: -511.922 where: short stacking energy: -259.952 Base-Backbone interact. energy: -0.058 local terms energy: -261.881788 where: bonds (distance) C4'-P energy: -45.125 bonds (distance) P-C4' energy: -46.731 flat angles C4'-P-C4' energy: -56.123 flat angles P-C4'-P energy: -38.703 tors. eta vs tors. theta energy: -75.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -737.941548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.941548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.941548 (E_RNA) where: Base-Base interactions energy: -506.443 where: short stacking energy: -235.413 Base-Backbone interact. energy: -0.925 local terms energy: -230.573014 where: bonds (distance) C4'-P energy: -38.335 bonds (distance) P-C4' energy: -44.855 flat angles C4'-P-C4' energy: -51.733 flat angles P-C4'-P energy: -32.060 tors. eta vs tors. theta energy: -63.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -685.024156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.024156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.024156 (E_RNA) where: Base-Base interactions energy: -469.892 where: short stacking energy: -204.501 Base-Backbone interact. energy: -1.682 local terms energy: -213.450225 where: bonds (distance) C4'-P energy: -40.831 bonds (distance) P-C4' energy: -41.253 flat angles C4'-P-C4' energy: -44.264 flat angles P-C4'-P energy: -29.524 tors. eta vs tors. theta energy: -57.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -655.999935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.999935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.999935 (E_RNA) where: Base-Base interactions energy: -448.812 where: short stacking energy: -199.580 Base-Backbone interact. energy: 0.609 local terms energy: -207.797124 where: bonds (distance) C4'-P energy: -44.000 bonds (distance) P-C4' energy: -35.048 flat angles C4'-P-C4' energy: -41.635 flat angles P-C4'-P energy: -31.706 tors. eta vs tors. theta energy: -55.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -619.178145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.178145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.178145 (E_RNA) where: Base-Base interactions energy: -409.567 where: short stacking energy: -184.108 Base-Backbone interact. energy: -1.145 local terms energy: -208.466676 where: bonds (distance) C4'-P energy: -45.784 bonds (distance) P-C4' energy: -39.278 flat angles C4'-P-C4' energy: -42.916 flat angles P-C4'-P energy: -35.761 tors. eta vs tors. theta energy: -44.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -543.969905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.969905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.969905 (E_RNA) where: Base-Base interactions energy: -357.552 where: short stacking energy: -148.033 Base-Backbone interact. energy: -0.644 local terms energy: -185.773949 where: bonds (distance) C4'-P energy: -37.672 bonds (distance) P-C4' energy: -41.594 flat angles C4'-P-C4' energy: -41.446 flat angles P-C4'-P energy: -32.190 tors. eta vs tors. theta energy: -32.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -551.818068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.818068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.818068 (E_RNA) where: Base-Base interactions energy: -363.035 where: short stacking energy: -171.883 Base-Backbone interact. energy: -2.112 local terms energy: -186.671178 where: bonds (distance) C4'-P energy: -33.875 bonds (distance) P-C4' energy: -38.847 flat angles C4'-P-C4' energy: -49.396 flat angles P-C4'-P energy: -25.320 tors. eta vs tors. theta energy: -39.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -305.078749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.078749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.078749 (E_RNA) where: Base-Base interactions energy: -150.896 where: short stacking energy: -90.580 Base-Backbone interact. energy: -0.630 local terms energy: -153.553292 where: bonds (distance) C4'-P energy: -42.227 bonds (distance) P-C4' energy: -45.435 flat angles C4'-P-C4' energy: -37.758 flat angles P-C4'-P energy: -23.951 tors. eta vs tors. theta energy: -4.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -225.093055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.093055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.093055 (E_RNA) where: Base-Base interactions energy: -99.045 where: short stacking energy: -53.463 Base-Backbone interact. energy: 1.145 local terms energy: -127.192704 where: bonds (distance) C4'-P energy: -28.352 bonds (distance) P-C4' energy: -49.633 flat angles C4'-P-C4' energy: -34.993 flat angles P-C4'-P energy: -19.263 tors. eta vs tors. theta energy: 5.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -781.371505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.371505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.371505 (E_RNA) where: Base-Base interactions energy: -524.263 where: short stacking energy: -252.600 Base-Backbone interact. energy: -1.288 local terms energy: -255.821380 where: bonds (distance) C4'-P energy: -50.473 bonds (distance) P-C4' energy: -40.182 flat angles C4'-P-C4' energy: -58.022 flat angles P-C4'-P energy: -35.875 tors. eta vs tors. theta energy: -71.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -759.854706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.854706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.854706 (E_RNA) where: Base-Base interactions energy: -517.278 where: short stacking energy: -227.534 Base-Backbone interact. energy: -0.975 local terms energy: -241.601718 where: bonds (distance) C4'-P energy: -38.210 bonds (distance) P-C4' energy: -47.831 flat angles C4'-P-C4' energy: -56.001 flat angles P-C4'-P energy: -33.245 tors. eta vs tors. theta energy: -66.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -750.385477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.385477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.385477 (E_RNA) where: Base-Base interactions energy: -512.982 where: short stacking energy: -229.999 Base-Backbone interact. energy: -0.205 local terms energy: -237.199353 where: bonds (distance) C4'-P energy: -50.222 bonds (distance) P-C4' energy: -47.877 flat angles C4'-P-C4' energy: -48.944 flat angles P-C4'-P energy: -31.266 tors. eta vs tors. theta energy: -58.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -697.372821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.372821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.372821 (E_RNA) where: Base-Base interactions energy: -476.110 where: short stacking energy: -213.279 Base-Backbone interact. energy: -1.997 local terms energy: -219.265711 where: bonds (distance) C4'-P energy: -40.732 bonds (distance) P-C4' energy: -37.719 flat angles C4'-P-C4' energy: -46.993 flat angles P-C4'-P energy: -29.473 tors. eta vs tors. theta energy: -64.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -638.796232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.796232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.796232 (E_RNA) where: Base-Base interactions energy: -449.330 where: short stacking energy: -208.357 Base-Backbone interact. energy: -0.234 local terms energy: -189.231756 where: bonds (distance) C4'-P energy: -29.175 bonds (distance) P-C4' energy: -31.674 flat angles C4'-P-C4' energy: -45.918 flat angles P-C4'-P energy: -27.305 tors. eta vs tors. theta energy: -55.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -620.319741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.319741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.319741 (E_RNA) where: Base-Base interactions energy: -423.560 where: short stacking energy: -179.038 Base-Backbone interact. energy: -0.205 local terms energy: -196.555259 where: bonds (distance) C4'-P energy: -38.780 bonds (distance) P-C4' energy: -48.928 flat angles C4'-P-C4' energy: -48.819 flat angles P-C4'-P energy: -16.438 tors. eta vs tors. theta energy: -43.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -513.942864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.942864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.942864 (E_RNA) where: Base-Base interactions energy: -336.086 where: short stacking energy: -143.718 Base-Backbone interact. energy: -1.465 local terms energy: -176.392161 where: bonds (distance) C4'-P energy: -36.579 bonds (distance) P-C4' energy: -32.721 flat angles C4'-P-C4' energy: -41.604 flat angles P-C4'-P energy: -29.881 tors. eta vs tors. theta energy: -35.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -461.563171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.563171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.563171 (E_RNA) where: Base-Base interactions energy: -292.149 where: short stacking energy: -138.284 Base-Backbone interact. energy: 0.246 local terms energy: -169.660580 where: bonds (distance) C4'-P energy: -40.973 bonds (distance) P-C4' energy: -36.325 flat angles C4'-P-C4' energy: -41.962 flat angles P-C4'-P energy: -20.799 tors. eta vs tors. theta energy: -29.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -315.088039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.088039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.088039 (E_RNA) where: Base-Base interactions energy: -178.765 where: short stacking energy: -110.942 Base-Backbone interact. energy: -0.064 local terms energy: -136.258231 where: bonds (distance) C4'-P energy: -33.330 bonds (distance) P-C4' energy: -34.402 flat angles C4'-P-C4' energy: -35.864 flat angles P-C4'-P energy: -24.523 tors. eta vs tors. theta energy: -8.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -206.562740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.562740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.562740 (E_RNA) where: Base-Base interactions energy: -72.648 where: short stacking energy: -66.232 Base-Backbone interact. energy: -0.591 local terms energy: -133.324302 where: bonds (distance) C4'-P energy: -35.551 bonds (distance) P-C4' energy: -45.849 flat angles C4'-P-C4' energy: -30.858 flat angles P-C4'-P energy: -15.002 tors. eta vs tors. theta energy: -6.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -785.660241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.660241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.660241 (E_RNA) where: Base-Base interactions energy: -524.469 where: short stacking energy: -247.936 Base-Backbone interact. energy: -0.693 local terms energy: -260.497650 where: bonds (distance) C4'-P energy: -48.526 bonds (distance) P-C4' energy: -47.254 flat angles C4'-P-C4' energy: -59.579 flat angles P-C4'-P energy: -32.172 tors. eta vs tors. theta energy: -72.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -772.235531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.235531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.235531 (E_RNA) where: Base-Base interactions energy: -524.490 where: short stacking energy: -242.726 Base-Backbone interact. energy: -0.740 local terms energy: -247.005098 where: bonds (distance) C4'-P energy: -37.077 bonds (distance) P-C4' energy: -45.472 flat angles C4'-P-C4' energy: -55.736 flat angles P-C4'-P energy: -33.484 tors. eta vs tors. theta energy: -75.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -729.630598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.630598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.630598 (E_RNA) where: Base-Base interactions energy: -493.101 where: short stacking energy: -219.303 Base-Backbone interact. energy: -0.076 local terms energy: -236.453723 where: bonds (distance) C4'-P energy: -47.947 bonds (distance) P-C4' energy: -45.014 flat angles C4'-P-C4' energy: -51.514 flat angles P-C4'-P energy: -36.633 tors. eta vs tors. theta energy: -55.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -694.382679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.382679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.382679 (E_RNA) where: Base-Base interactions energy: -476.488 where: short stacking energy: -203.695 Base-Backbone interact. energy: -3.460 local terms energy: -214.434601 where: bonds (distance) C4'-P energy: -38.427 bonds (distance) P-C4' energy: -44.207 flat angles C4'-P-C4' energy: -49.732 flat angles P-C4'-P energy: -34.080 tors. eta vs tors. theta energy: -47.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -657.818400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.818400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.818400 (E_RNA) where: Base-Base interactions energy: -449.214 where: short stacking energy: -208.488 Base-Backbone interact. energy: -0.050 local terms energy: -208.554048 where: bonds (distance) C4'-P energy: -41.420 bonds (distance) P-C4' energy: -43.888 flat angles C4'-P-C4' energy: -47.456 flat angles P-C4'-P energy: -22.404 tors. eta vs tors. theta energy: -53.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -575.464260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.464260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.464260 (E_RNA) where: Base-Base interactions energy: -387.272 where: short stacking energy: -180.213 Base-Backbone interact. energy: 3.274 local terms energy: -191.467060 where: bonds (distance) C4'-P energy: -41.251 bonds (distance) P-C4' energy: -37.216 flat angles C4'-P-C4' energy: -41.910 flat angles P-C4'-P energy: -30.567 tors. eta vs tors. theta energy: -40.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -513.967103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.967103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.967103 (E_RNA) where: Base-Base interactions energy: -336.731 where: short stacking energy: -141.723 Base-Backbone interact. energy: 0.920 local terms energy: -178.155934 where: bonds (distance) C4'-P energy: -42.519 bonds (distance) P-C4' energy: -42.922 flat angles C4'-P-C4' energy: -34.756 flat angles P-C4'-P energy: -32.505 tors. eta vs tors. theta energy: -25.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -491.120206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.120206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.120206 (E_RNA) where: Base-Base interactions energy: -331.451 where: short stacking energy: -175.636 Base-Backbone interact. energy: -0.340 local terms energy: -159.328959 where: bonds (distance) C4'-P energy: -12.953 bonds (distance) P-C4' energy: -41.440 flat angles C4'-P-C4' energy: -40.448 flat angles P-C4'-P energy: -23.570 tors. eta vs tors. theta energy: -40.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -294.461487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.461487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.461487 (E_RNA) where: Base-Base interactions energy: -151.641 where: short stacking energy: -89.571 Base-Backbone interact. energy: 0.145 local terms energy: -142.965301 where: bonds (distance) C4'-P energy: -32.825 bonds (distance) P-C4' energy: -36.736 flat angles C4'-P-C4' energy: -35.820 flat angles P-C4'-P energy: -29.356 tors. eta vs tors. theta energy: -8.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -216.856113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.856113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.856113 (E_RNA) where: Base-Base interactions energy: -99.072 where: short stacking energy: -81.847 Base-Backbone interact. energy: -0.054 local terms energy: -117.730602 where: bonds (distance) C4'-P energy: -30.434 bonds (distance) P-C4' energy: -39.650 flat angles C4'-P-C4' energy: -25.769 flat angles P-C4'-P energy: -22.106 tors. eta vs tors. theta energy: 0.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -780.254405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.254405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.254405 (E_RNA) where: Base-Base interactions energy: -537.575 where: short stacking energy: -236.600 Base-Backbone interact. energy: 0.635 local terms energy: -243.313793 where: bonds (distance) C4'-P energy: -40.525 bonds (distance) P-C4' energy: -50.681 flat angles C4'-P-C4' energy: -47.665 flat angles P-C4'-P energy: -31.504 tors. eta vs tors. theta energy: -72.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -762.244386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.244386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.244386 (E_RNA) where: Base-Base interactions energy: -514.756 where: short stacking energy: -250.380 Base-Backbone interact. energy: -1.558 local terms energy: -245.930459 where: bonds (distance) C4'-P energy: -45.079 bonds (distance) P-C4' energy: -43.558 flat angles C4'-P-C4' energy: -50.969 flat angles P-C4'-P energy: -36.278 tors. eta vs tors. theta energy: -70.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -719.266572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.266572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.266572 (E_RNA) where: Base-Base interactions energy: -496.323 where: short stacking energy: -216.489 Base-Backbone interact. energy: 1.256 local terms energy: -224.199761 where: bonds (distance) C4'-P energy: -41.144 bonds (distance) P-C4' energy: -47.648 flat angles C4'-P-C4' energy: -50.440 flat angles P-C4'-P energy: -30.337 tors. eta vs tors. theta energy: -54.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -730.923518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.923518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.923518 (E_RNA) where: Base-Base interactions energy: -504.692 where: short stacking energy: -219.044 Base-Backbone interact. energy: -1.126 local terms energy: -225.105466 where: bonds (distance) C4'-P energy: -44.389 bonds (distance) P-C4' energy: -37.351 flat angles C4'-P-C4' energy: -51.641 flat angles P-C4'-P energy: -32.198 tors. eta vs tors. theta energy: -59.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -650.363428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.363428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.363428 (E_RNA) where: Base-Base interactions energy: -432.883 where: short stacking energy: -206.250 Base-Backbone interact. energy: 0.828 local terms energy: -218.308206 where: bonds (distance) C4'-P energy: -41.754 bonds (distance) P-C4' energy: -40.529 flat angles C4'-P-C4' energy: -49.593 flat angles P-C4'-P energy: -31.885 tors. eta vs tors. theta energy: -54.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -591.286558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.286558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.286558 (E_RNA) where: Base-Base interactions energy: -400.107 where: short stacking energy: -165.833 Base-Backbone interact. energy: 0.118 local terms energy: -191.298117 where: bonds (distance) C4'-P energy: -36.409 bonds (distance) P-C4' energy: -38.541 flat angles C4'-P-C4' energy: -46.213 flat angles P-C4'-P energy: -31.511 tors. eta vs tors. theta energy: -38.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -484.726594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.726594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.726594 (E_RNA) where: Base-Base interactions energy: -307.767 where: short stacking energy: -137.928 Base-Backbone interact. energy: -1.033 local terms energy: -175.925826 where: bonds (distance) C4'-P energy: -37.716 bonds (distance) P-C4' energy: -32.647 flat angles C4'-P-C4' energy: -45.515 flat angles P-C4'-P energy: -26.998 tors. eta vs tors. theta energy: -33.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -504.831304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.831304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.831304 (E_RNA) where: Base-Base interactions energy: -349.762 where: short stacking energy: -151.975 Base-Backbone interact. energy: -0.374 local terms energy: -154.694894 where: bonds (distance) C4'-P energy: -37.158 bonds (distance) P-C4' energy: -27.582 flat angles C4'-P-C4' energy: -33.862 flat angles P-C4'-P energy: -23.244 tors. eta vs tors. theta energy: -32.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -301.932238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.932238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.932238 (E_RNA) where: Base-Base interactions energy: -150.046 where: short stacking energy: -88.077 Base-Backbone interact. energy: -1.987 local terms energy: -149.899552 where: bonds (distance) C4'-P energy: -42.708 bonds (distance) P-C4' energy: -39.118 flat angles C4'-P-C4' energy: -34.130 flat angles P-C4'-P energy: -18.199 tors. eta vs tors. theta energy: -15.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -205.143657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.143657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.143657 (E_RNA) where: Base-Base interactions energy: -75.549 where: short stacking energy: -64.913 Base-Backbone interact. energy: -1.032 local terms energy: -128.562935 where: bonds (distance) C4'-P energy: -40.058 bonds (distance) P-C4' energy: -44.296 flat angles C4'-P-C4' energy: -31.094 flat angles P-C4'-P energy: -15.849 tors. eta vs tors. theta energy: 2.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -778.500571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.500571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.500571 (E_RNA) where: Base-Base interactions energy: -525.902 where: short stacking energy: -235.872 Base-Backbone interact. energy: -1.590 local terms energy: -251.008090 where: bonds (distance) C4'-P energy: -42.392 bonds (distance) P-C4' energy: -47.687 flat angles C4'-P-C4' energy: -55.609 flat angles P-C4'-P energy: -37.181 tors. eta vs tors. theta energy: -68.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -759.105608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.105608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.105608 (E_RNA) where: Base-Base interactions energy: -505.263 where: short stacking energy: -236.510 Base-Backbone interact. energy: -0.620 local terms energy: -253.222184 where: bonds (distance) C4'-P energy: -49.697 bonds (distance) P-C4' energy: -48.462 flat angles C4'-P-C4' energy: -47.238 flat angles P-C4'-P energy: -38.273 tors. eta vs tors. theta energy: -69.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -727.091603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.091603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.091603 (E_RNA) where: Base-Base interactions energy: -509.323 where: short stacking energy: -223.268 Base-Backbone interact. energy: -0.713 local terms energy: -217.055747 where: bonds (distance) C4'-P energy: -38.518 bonds (distance) P-C4' energy: -45.667 flat angles C4'-P-C4' energy: -55.424 flat angles P-C4'-P energy: -24.804 tors. eta vs tors. theta energy: -52.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -725.085521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.085521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.085521 (E_RNA) where: Base-Base interactions energy: -511.422 where: short stacking energy: -230.816 Base-Backbone interact. energy: -1.112 local terms energy: -212.551910 where: bonds (distance) C4'-P energy: -35.166 bonds (distance) P-C4' energy: -44.869 flat angles C4'-P-C4' energy: -44.509 flat angles P-C4'-P energy: -26.853 tors. eta vs tors. theta energy: -61.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -639.660884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.660884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.660884 (E_RNA) where: Base-Base interactions energy: -423.609 where: short stacking energy: -196.923 Base-Backbone interact. energy: -2.024 local terms energy: -214.028315 where: bonds (distance) C4'-P energy: -42.549 bonds (distance) P-C4' energy: -49.588 flat angles C4'-P-C4' energy: -48.460 flat angles P-C4'-P energy: -29.811 tors. eta vs tors. theta energy: -43.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -631.543442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.543442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.543442 (E_RNA) where: Base-Base interactions energy: -445.380 where: short stacking energy: -202.601 Base-Backbone interact. energy: -0.374 local terms energy: -185.789705 where: bonds (distance) C4'-P energy: -37.641 bonds (distance) P-C4' energy: -33.826 flat angles C4'-P-C4' energy: -37.666 flat angles P-C4'-P energy: -29.891 tors. eta vs tors. theta energy: -46.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -528.850361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.850361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.850361 (E_RNA) where: Base-Base interactions energy: -350.717 where: short stacking energy: -173.690 Base-Backbone interact. energy: -0.121 local terms energy: -178.012656 where: bonds (distance) C4'-P energy: -28.804 bonds (distance) P-C4' energy: -38.184 flat angles C4'-P-C4' energy: -45.277 flat angles P-C4'-P energy: -22.384 tors. eta vs tors. theta energy: -43.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -457.993008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.993008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.993008 (E_RNA) where: Base-Base interactions energy: -279.702 where: short stacking energy: -133.220 Base-Backbone interact. energy: -1.472 local terms energy: -176.819429 where: bonds (distance) C4'-P energy: -37.114 bonds (distance) P-C4' energy: -44.673 flat angles C4'-P-C4' energy: -40.489 flat angles P-C4'-P energy: -29.878 tors. eta vs tors. theta energy: -24.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -315.940068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.940068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.940068 (E_RNA) where: Base-Base interactions energy: -166.463 where: short stacking energy: -101.520 Base-Backbone interact. energy: 1.549 local terms energy: -151.026374 where: bonds (distance) C4'-P energy: -41.649 bonds (distance) P-C4' energy: -35.000 flat angles C4'-P-C4' energy: -37.492 flat angles P-C4'-P energy: -28.046 tors. eta vs tors. theta energy: -8.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -246.171394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.171394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.171394 (E_RNA) where: Base-Base interactions energy: -118.547 where: short stacking energy: -84.317 Base-Backbone interact. energy: 0.110 local terms energy: -127.734850 where: bonds (distance) C4'-P energy: -36.598 bonds (distance) P-C4' energy: -47.109 flat angles C4'-P-C4' energy: -28.961 flat angles P-C4'-P energy: -17.604 tors. eta vs tors. theta energy: 2.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -784.445813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.445813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.445813 (E_RNA) where: Base-Base interactions energy: -543.107 where: short stacking energy: -241.026 Base-Backbone interact. energy: 0.437 local terms energy: -241.776129 where: bonds (distance) C4'-P energy: -46.214 bonds (distance) P-C4' energy: -34.882 flat angles C4'-P-C4' energy: -48.762 flat angles P-C4'-P energy: -36.894 tors. eta vs tors. theta energy: -75.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -762.737928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.737928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.737928 (E_RNA) where: Base-Base interactions energy: -521.794 where: short stacking energy: -254.047 Base-Backbone interact. energy: 0.440 local terms energy: -241.383500 where: bonds (distance) C4'-P energy: -39.101 bonds (distance) P-C4' energy: -43.910 flat angles C4'-P-C4' energy: -51.689 flat angles P-C4'-P energy: -33.197 tors. eta vs tors. theta energy: -73.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -731.817255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.817255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.817255 (E_RNA) where: Base-Base interactions energy: -504.886 where: short stacking energy: -229.916 Base-Backbone interact. energy: -1.855 local terms energy: -225.076016 where: bonds (distance) C4'-P energy: -43.918 bonds (distance) P-C4' energy: -35.292 flat angles C4'-P-C4' energy: -44.818 flat angles P-C4'-P energy: -35.348 tors. eta vs tors. theta energy: -65.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -709.184159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.184159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.184159 (E_RNA) where: Base-Base interactions energy: -491.269 where: short stacking energy: -218.034 Base-Backbone interact. energy: -0.464 local terms energy: -217.451063 where: bonds (distance) C4'-P energy: -42.002 bonds (distance) P-C4' energy: -40.090 flat angles C4'-P-C4' energy: -48.989 flat angles P-C4'-P energy: -24.268 tors. eta vs tors. theta energy: -62.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -647.704232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.704232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.704232 (E_RNA) where: Base-Base interactions energy: -445.450 where: short stacking energy: -191.837 Base-Backbone interact. energy: -2.054 local terms energy: -200.200687 where: bonds (distance) C4'-P energy: -40.209 bonds (distance) P-C4' energy: -41.941 flat angles C4'-P-C4' energy: -49.042 flat angles P-C4'-P energy: -26.746 tors. eta vs tors. theta energy: -42.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -572.170120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.170120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.170120 (E_RNA) where: Base-Base interactions energy: -386.799 where: short stacking energy: -175.146 Base-Backbone interact. energy: 0.767 local terms energy: -186.138692 where: bonds (distance) C4'-P energy: -41.919 bonds (distance) P-C4' energy: -26.141 flat angles C4'-P-C4' energy: -50.151 flat angles P-C4'-P energy: -29.886 tors. eta vs tors. theta energy: -38.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -508.225548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.225548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.225548 (E_RNA) where: Base-Base interactions energy: -331.032 where: short stacking energy: -151.959 Base-Backbone interact. energy: 3.197 local terms energy: -180.390915 where: bonds (distance) C4'-P energy: -31.080 bonds (distance) P-C4' energy: -46.114 flat angles C4'-P-C4' energy: -41.052 flat angles P-C4'-P energy: -29.542 tors. eta vs tors. theta energy: -32.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -459.234255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.234255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.234255 (E_RNA) where: Base-Base interactions energy: -279.959 where: short stacking energy: -136.784 Base-Backbone interact. energy: -1.376 local terms energy: -177.899185 where: bonds (distance) C4'-P energy: -32.656 bonds (distance) P-C4' energy: -41.006 flat angles C4'-P-C4' energy: -40.875 flat angles P-C4'-P energy: -29.174 tors. eta vs tors. theta energy: -34.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -295.428673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.428673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.428673 (E_RNA) where: Base-Base interactions energy: -157.958 where: short stacking energy: -93.312 Base-Backbone interact. energy: 0.345 local terms energy: -137.816250 where: bonds (distance) C4'-P energy: -33.798 bonds (distance) P-C4' energy: -45.227 flat angles C4'-P-C4' energy: -25.394 flat angles P-C4'-P energy: -25.745 tors. eta vs tors. theta energy: -7.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -295.728374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.728374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.728374 (E_RNA) where: Base-Base interactions energy: -148.953 where: short stacking energy: -67.012 Base-Backbone interact. energy: -1.648 local terms energy: -145.127226 where: bonds (distance) C4'-P energy: -47.009 bonds (distance) P-C4' energy: -41.217 flat angles C4'-P-C4' energy: -42.515 flat angles P-C4'-P energy: -15.675 tors. eta vs tors. theta energy: 1.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -784.760285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.760285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.760285 (E_RNA) where: Base-Base interactions energy: -532.480 where: short stacking energy: -249.026 Base-Backbone interact. energy: -1.371 local terms energy: -250.909883 where: bonds (distance) C4'-P energy: -42.822 bonds (distance) P-C4' energy: -52.462 flat angles C4'-P-C4' energy: -50.019 flat angles P-C4'-P energy: -31.998 tors. eta vs tors. theta energy: -73.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -767.422373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.422373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.422373 (E_RNA) where: Base-Base interactions energy: -509.915 where: short stacking energy: -241.049 Base-Backbone interact. energy: -1.035 local terms energy: -256.472190 where: bonds (distance) C4'-P energy: -52.178 bonds (distance) P-C4' energy: -38.957 flat angles C4'-P-C4' energy: -53.900 flat angles P-C4'-P energy: -38.035 tors. eta vs tors. theta energy: -73.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -724.547164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.547164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.547164 (E_RNA) where: Base-Base interactions energy: -488.559 where: short stacking energy: -219.478 Base-Backbone interact. energy: -2.074 local terms energy: -233.913421 where: bonds (distance) C4'-P energy: -36.524 bonds (distance) P-C4' energy: -46.199 flat angles C4'-P-C4' energy: -50.107 flat angles P-C4'-P energy: -36.301 tors. eta vs tors. theta energy: -64.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -686.581346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.581346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.581346 (E_RNA) where: Base-Base interactions energy: -489.412 where: short stacking energy: -224.499 Base-Backbone interact. energy: -1.338 local terms energy: -195.830690 where: bonds (distance) C4'-P energy: -37.987 bonds (distance) P-C4' energy: -33.935 flat angles C4'-P-C4' energy: -52.842 flat angles P-C4'-P energy: -22.772 tors. eta vs tors. theta energy: -48.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -651.115784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.115784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.115784 (E_RNA) where: Base-Base interactions energy: -440.735 where: short stacking energy: -199.934 Base-Backbone interact. energy: -0.448 local terms energy: -209.933184 where: bonds (distance) C4'-P energy: -41.604 bonds (distance) P-C4' energy: -41.216 flat angles C4'-P-C4' energy: -54.443 flat angles P-C4'-P energy: -26.028 tors. eta vs tors. theta energy: -46.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -636.826370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.826370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.826370 (E_RNA) where: Base-Base interactions energy: -433.593 where: short stacking energy: -189.264 Base-Backbone interact. energy: -0.932 local terms energy: -202.301607 where: bonds (distance) C4'-P energy: -40.275 bonds (distance) P-C4' energy: -40.167 flat angles C4'-P-C4' energy: -41.997 flat angles P-C4'-P energy: -26.936 tors. eta vs tors. theta energy: -52.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -498.265027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.265027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.265027 (E_RNA) where: Base-Base interactions energy: -308.280 where: short stacking energy: -164.992 Base-Backbone interact. energy: -0.070 local terms energy: -189.915399 where: bonds (distance) C4'-P energy: -37.575 bonds (distance) P-C4' energy: -44.138 flat angles C4'-P-C4' energy: -46.680 flat angles P-C4'-P energy: -30.206 tors. eta vs tors. theta energy: -31.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -471.595568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.595568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.595568 (E_RNA) where: Base-Base interactions energy: -304.391 where: short stacking energy: -148.308 Base-Backbone interact. energy: -2.721 local terms energy: -164.483546 where: bonds (distance) C4'-P energy: -35.829 bonds (distance) P-C4' energy: -42.714 flat angles C4'-P-C4' energy: -38.792 flat angles P-C4'-P energy: -12.260 tors. eta vs tors. theta energy: -34.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -293.478124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.478124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.478124 (E_RNA) where: Base-Base interactions energy: -148.718 where: short stacking energy: -108.853 Base-Backbone interact. energy: -0.632 local terms energy: -144.128831 where: bonds (distance) C4'-P energy: -34.067 bonds (distance) P-C4' energy: -42.185 flat angles C4'-P-C4' energy: -33.624 flat angles P-C4'-P energy: -26.517 tors. eta vs tors. theta energy: -7.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -304.679195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.679195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.679195 (E_RNA) where: Base-Base interactions energy: -164.749 where: short stacking energy: -98.687 Base-Backbone interact. energy: -1.098 local terms energy: -138.831548 where: bonds (distance) C4'-P energy: -29.628 bonds (distance) P-C4' energy: -41.929 flat angles C4'-P-C4' energy: -44.400 flat angles P-C4'-P energy: -21.610 tors. eta vs tors. theta energy: -1.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -790.709846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.709846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.709846 (E_RNA) where: Base-Base interactions energy: -563.969 where: short stacking energy: -239.299 Base-Backbone interact. energy: -0.903 local terms energy: -225.837954 where: bonds (distance) C4'-P energy: -43.935 bonds (distance) P-C4' energy: -37.034 flat angles C4'-P-C4' energy: -46.685 flat angles P-C4'-P energy: -30.856 tors. eta vs tors. theta energy: -67.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -780.161754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.161754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.161754 (E_RNA) where: Base-Base interactions energy: -528.069 where: short stacking energy: -245.483 Base-Backbone interact. energy: -0.337 local terms energy: -251.756307 where: bonds (distance) C4'-P energy: -43.002 bonds (distance) P-C4' energy: -45.023 flat angles C4'-P-C4' energy: -57.432 flat angles P-C4'-P energy: -37.562 tors. eta vs tors. theta energy: -68.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -707.867191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.867191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.867191 (E_RNA) where: Base-Base interactions energy: -496.591 where: short stacking energy: -218.233 Base-Backbone interact. energy: -0.496 local terms energy: -210.779947 where: bonds (distance) C4'-P energy: -41.247 bonds (distance) P-C4' energy: -42.187 flat angles C4'-P-C4' energy: -46.513 flat angles P-C4'-P energy: -32.453 tors. eta vs tors. theta energy: -48.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -707.282645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.282645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.282645 (E_RNA) where: Base-Base interactions energy: -497.449 where: short stacking energy: -215.611 Base-Backbone interact. energy: -1.903 local terms energy: -207.929932 where: bonds (distance) C4'-P energy: -26.724 bonds (distance) P-C4' energy: -37.980 flat angles C4'-P-C4' energy: -51.286 flat angles P-C4'-P energy: -26.512 tors. eta vs tors. theta energy: -65.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -654.828917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.828917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.828917 (E_RNA) where: Base-Base interactions energy: -453.737 where: short stacking energy: -188.165 Base-Backbone interact. energy: 0.098 local terms energy: -201.189917 where: bonds (distance) C4'-P energy: -45.976 bonds (distance) P-C4' energy: -46.039 flat angles C4'-P-C4' energy: -38.835 flat angles P-C4'-P energy: -26.731 tors. eta vs tors. theta energy: -43.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -600.435556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.435556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.435556 (E_RNA) where: Base-Base interactions energy: -406.991 where: short stacking energy: -191.613 Base-Backbone interact. energy: 0.601 local terms energy: -194.045302 where: bonds (distance) C4'-P energy: -37.813 bonds (distance) P-C4' energy: -34.975 flat angles C4'-P-C4' energy: -45.484 flat angles P-C4'-P energy: -27.924 tors. eta vs tors. theta energy: -47.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -482.669223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.669223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.669223 (E_RNA) where: Base-Base interactions energy: -328.317 where: short stacking energy: -143.575 Base-Backbone interact. energy: -0.912 local terms energy: -153.440390 where: bonds (distance) C4'-P energy: -30.139 bonds (distance) P-C4' energy: -33.508 flat angles C4'-P-C4' energy: -44.633 flat angles P-C4'-P energy: -19.046 tors. eta vs tors. theta energy: -26.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -460.287521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.287521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.287521 (E_RNA) where: Base-Base interactions energy: -290.337 where: short stacking energy: -141.272 Base-Backbone interact. energy: -1.915 local terms energy: -168.036110 where: bonds (distance) C4'-P energy: -37.386 bonds (distance) P-C4' energy: -40.862 flat angles C4'-P-C4' energy: -42.507 flat angles P-C4'-P energy: -19.863 tors. eta vs tors. theta energy: -27.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -264.440414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.440414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.440414 (E_RNA) where: Base-Base interactions energy: -138.960 where: short stacking energy: -90.473 Base-Backbone interact. energy: -0.881 local terms energy: -124.599024 where: bonds (distance) C4'-P energy: -32.264 bonds (distance) P-C4' energy: -37.614 flat angles C4'-P-C4' energy: -38.848 flat angles P-C4'-P energy: -10.078 tors. eta vs tors. theta energy: -5.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -305.517364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.517364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.517364 (E_RNA) where: Base-Base interactions energy: -156.755 where: short stacking energy: -95.468 Base-Backbone interact. energy: 0.915 local terms energy: -149.677834 where: bonds (distance) C4'-P energy: -38.177 bonds (distance) P-C4' energy: -40.218 flat angles C4'-P-C4' energy: -35.213 flat angles P-C4'-P energy: -26.949 tors. eta vs tors. theta energy: -9.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -782.705030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.705030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.705030 (E_RNA) where: Base-Base interactions energy: -546.465 where: short stacking energy: -250.172 Base-Backbone interact. energy: -0.610 local terms energy: -235.630275 where: bonds (distance) C4'-P energy: -39.403 bonds (distance) P-C4' energy: -47.065 flat angles C4'-P-C4' energy: -51.974 flat angles P-C4'-P energy: -31.674 tors. eta vs tors. theta energy: -65.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -759.206373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.206373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.206373 (E_RNA) where: Base-Base interactions energy: -505.765 where: short stacking energy: -235.609 Base-Backbone interact. energy: -0.365 local terms energy: -253.076114 where: bonds (distance) C4'-P energy: -40.654 bonds (distance) P-C4' energy: -53.041 flat angles C4'-P-C4' energy: -47.402 flat angles P-C4'-P energy: -41.962 tors. eta vs tors. theta energy: -70.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -747.161413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.161413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.161413 (E_RNA) where: Base-Base interactions energy: -520.330 where: short stacking energy: -235.511 Base-Backbone interact. energy: -0.122 local terms energy: -226.709124 where: bonds (distance) C4'-P energy: -43.187 bonds (distance) P-C4' energy: -43.589 flat angles C4'-P-C4' energy: -45.551 flat angles P-C4'-P energy: -36.958 tors. eta vs tors. theta energy: -57.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -746.936780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.936780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.936780 (E_RNA) where: Base-Base interactions energy: -521.261 where: short stacking energy: -235.000 Base-Backbone interact. energy: -0.157 local terms energy: -225.518791 where: bonds (distance) C4'-P energy: -42.958 bonds (distance) P-C4' energy: -45.562 flat angles C4'-P-C4' energy: -38.311 flat angles P-C4'-P energy: -29.497 tors. eta vs tors. theta energy: -69.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -668.034891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.034891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.034891 (E_RNA) where: Base-Base interactions energy: -459.092 where: short stacking energy: -187.223 Base-Backbone interact. energy: -0.209 local terms energy: -208.734015 where: bonds (distance) C4'-P energy: -38.153 bonds (distance) P-C4' energy: -42.928 flat angles C4'-P-C4' energy: -48.485 flat angles P-C4'-P energy: -37.290 tors. eta vs tors. theta energy: -41.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -630.655005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.655005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.655005 (E_RNA) where: Base-Base interactions energy: -431.287 where: short stacking energy: -187.621 Base-Backbone interact. energy: -2.128 local terms energy: -197.239397 where: bonds (distance) C4'-P energy: -42.641 bonds (distance) P-C4' energy: -39.017 flat angles C4'-P-C4' energy: -45.037 flat angles P-C4'-P energy: -25.007 tors. eta vs tors. theta energy: -45.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -453.428170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.428170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.428170 (E_RNA) where: Base-Base interactions energy: -284.347 where: short stacking energy: -133.808 Base-Backbone interact. energy: 0.787 local terms energy: -169.867761 where: bonds (distance) C4'-P energy: -40.411 bonds (distance) P-C4' energy: -36.980 flat angles C4'-P-C4' energy: -41.400 flat angles P-C4'-P energy: -24.501 tors. eta vs tors. theta energy: -26.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -476.987291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.987291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.987291 (E_RNA) where: Base-Base interactions energy: -310.639 where: short stacking energy: -140.996 Base-Backbone interact. energy: 2.181 local terms energy: -168.529403 where: bonds (distance) C4'-P energy: -35.462 bonds (distance) P-C4' energy: -43.123 flat angles C4'-P-C4' energy: -41.196 flat angles P-C4'-P energy: -21.891 tors. eta vs tors. theta energy: -26.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -256.701600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.701600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.701600 (E_RNA) where: Base-Base interactions energy: -121.896 where: short stacking energy: -79.184 Base-Backbone interact. energy: 0.322 local terms energy: -135.127549 where: bonds (distance) C4'-P energy: -35.008 bonds (distance) P-C4' energy: -30.093 flat angles C4'-P-C4' energy: -42.105 flat angles P-C4'-P energy: -19.695 tors. eta vs tors. theta energy: -8.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -319.885686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.885686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.885686 (E_RNA) where: Base-Base interactions energy: -163.661 where: short stacking energy: -100.381 Base-Backbone interact. energy: -0.338 local terms energy: -155.886960 where: bonds (distance) C4'-P energy: -43.255 bonds (distance) P-C4' energy: -39.696 flat angles C4'-P-C4' energy: -45.666 flat angles P-C4'-P energy: -19.775 tors. eta vs tors. theta energy: -7.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -780.280774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.280774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.280774 (E_RNA) where: Base-Base interactions energy: -541.164 where: short stacking energy: -255.532 Base-Backbone interact. energy: -0.543 local terms energy: -238.574415 where: bonds (distance) C4'-P energy: -37.946 bonds (distance) P-C4' energy: -42.871 flat angles C4'-P-C4' energy: -50.038 flat angles P-C4'-P energy: -35.951 tors. eta vs tors. theta energy: -71.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -780.952459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.952459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.952459 (E_RNA) where: Base-Base interactions energy: -531.404 where: short stacking energy: -252.378 Base-Backbone interact. energy: -0.203 local terms energy: -249.345308 where: bonds (distance) C4'-P energy: -45.052 bonds (distance) P-C4' energy: -42.620 flat angles C4'-P-C4' energy: -57.064 flat angles P-C4'-P energy: -27.027 tors. eta vs tors. theta energy: -77.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -746.725393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.725393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.725393 (E_RNA) where: Base-Base interactions energy: -522.384 where: short stacking energy: -226.361 Base-Backbone interact. energy: -0.225 local terms energy: -224.116051 where: bonds (distance) C4'-P energy: -44.186 bonds (distance) P-C4' energy: -36.840 flat angles C4'-P-C4' energy: -43.324 flat angles P-C4'-P energy: -31.289 tors. eta vs tors. theta energy: -68.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -722.058072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.058072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.058072 (E_RNA) where: Base-Base interactions energy: -510.042 where: short stacking energy: -223.261 Base-Backbone interact. energy: -0.904 local terms energy: -211.112029 where: bonds (distance) C4'-P energy: -29.229 bonds (distance) P-C4' energy: -45.152 flat angles C4'-P-C4' energy: -41.552 flat angles P-C4'-P energy: -37.418 tors. eta vs tors. theta energy: -57.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -684.496158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.496158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.496158 (E_RNA) where: Base-Base interactions energy: -474.698 where: short stacking energy: -186.409 Base-Backbone interact. energy: -1.340 local terms energy: -208.458368 where: bonds (distance) C4'-P energy: -38.653 bonds (distance) P-C4' energy: -42.933 flat angles C4'-P-C4' energy: -46.594 flat angles P-C4'-P energy: -30.421 tors. eta vs tors. theta energy: -49.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -625.934906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.934906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.934906 (E_RNA) where: Base-Base interactions energy: -420.777 where: short stacking energy: -177.451 Base-Backbone interact. energy: -0.342 local terms energy: -204.816221 where: bonds (distance) C4'-P energy: -38.737 bonds (distance) P-C4' energy: -41.097 flat angles C4'-P-C4' energy: -48.185 flat angles P-C4'-P energy: -30.672 tors. eta vs tors. theta energy: -46.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -477.433345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.433345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.433345 (E_RNA) where: Base-Base interactions energy: -296.200 where: short stacking energy: -151.266 Base-Backbone interact. energy: 0.824 local terms energy: -182.056593 where: bonds (distance) C4'-P energy: -38.910 bonds (distance) P-C4' energy: -48.080 flat angles C4'-P-C4' energy: -38.106 flat angles P-C4'-P energy: -22.538 tors. eta vs tors. theta energy: -34.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -463.779959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.779959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.779959 (E_RNA) where: Base-Base interactions energy: -289.866 where: short stacking energy: -135.929 Base-Backbone interact. energy: -2.159 local terms energy: -171.754805 where: bonds (distance) C4'-P energy: -37.525 bonds (distance) P-C4' energy: -34.810 flat angles C4'-P-C4' energy: -44.337 flat angles P-C4'-P energy: -25.283 tors. eta vs tors. theta energy: -29.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -311.001601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.001601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.001601 (E_RNA) where: Base-Base interactions energy: -147.029 where: short stacking energy: -89.285 Base-Backbone interact. energy: -0.303 local terms energy: -163.668989 where: bonds (distance) C4'-P energy: -47.491 bonds (distance) P-C4' energy: -49.491 flat angles C4'-P-C4' energy: -37.285 flat angles P-C4'-P energy: -17.355 tors. eta vs tors. theta energy: -12.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -255.462170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.462170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.462170 (E_RNA) where: Base-Base interactions energy: -103.126 where: short stacking energy: -63.904 Base-Backbone interact. energy: -1.666 local terms energy: -150.669781 where: bonds (distance) C4'-P energy: -43.109 bonds (distance) P-C4' energy: -45.240 flat angles C4'-P-C4' energy: -37.633 flat angles P-C4'-P energy: -22.643 tors. eta vs tors. theta energy: -2.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -781.417921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.417921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.417921 (E_RNA) where: Base-Base interactions energy: -529.591 where: short stacking energy: -256.809 Base-Backbone interact. energy: -2.386 local terms energy: -249.440462 where: bonds (distance) C4'-P energy: -39.608 bonds (distance) P-C4' energy: -45.282 flat angles C4'-P-C4' energy: -50.839 flat angles P-C4'-P energy: -40.646 tors. eta vs tors. theta energy: -73.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -768.483325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.483325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.483325 (E_RNA) where: Base-Base interactions energy: -535.910 where: short stacking energy: -246.124 Base-Backbone interact. energy: -2.671 local terms energy: -229.902768 where: bonds (distance) C4'-P energy: -39.253 bonds (distance) P-C4' energy: -42.854 flat angles C4'-P-C4' energy: -49.359 flat angles P-C4'-P energy: -29.249 tors. eta vs tors. theta energy: -69.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -759.988102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.988102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.988102 (E_RNA) where: Base-Base interactions energy: -530.771 where: short stacking energy: -236.283 Base-Backbone interact. energy: -1.287 local terms energy: -227.929628 where: bonds (distance) C4'-P energy: -36.321 bonds (distance) P-C4' energy: -47.136 flat angles C4'-P-C4' energy: -47.143 flat angles P-C4'-P energy: -32.359 tors. eta vs tors. theta energy: -64.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -727.259204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.259204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.259204 (E_RNA) where: Base-Base interactions energy: -506.835 where: short stacking energy: -218.959 Base-Backbone interact. energy: -0.278 local terms energy: -220.145974 where: bonds (distance) C4'-P energy: -38.289 bonds (distance) P-C4' energy: -46.330 flat angles C4'-P-C4' energy: -49.664 flat angles P-C4'-P energy: -36.095 tors. eta vs tors. theta energy: -49.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -703.368975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.368975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.368975 (E_RNA) where: Base-Base interactions energy: -476.431 where: short stacking energy: -215.442 Base-Backbone interact. energy: -1.111 local terms energy: -225.827031 where: bonds (distance) C4'-P energy: -39.046 bonds (distance) P-C4' energy: -44.633 flat angles C4'-P-C4' energy: -48.545 flat angles P-C4'-P energy: -32.110 tors. eta vs tors. theta energy: -61.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -638.684360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.684360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.684360 (E_RNA) where: Base-Base interactions energy: -434.625 where: short stacking energy: -206.443 Base-Backbone interact. energy: 0.188 local terms energy: -204.247746 where: bonds (distance) C4'-P energy: -42.589 bonds (distance) P-C4' energy: -38.672 flat angles C4'-P-C4' energy: -47.577 flat angles P-C4'-P energy: -24.228 tors. eta vs tors. theta energy: -51.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -451.882864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.882864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.882864 (E_RNA) where: Base-Base interactions energy: -274.990 where: short stacking energy: -147.943 Base-Backbone interact. energy: -0.778 local terms energy: -176.115707 where: bonds (distance) C4'-P energy: -39.233 bonds (distance) P-C4' energy: -35.470 flat angles C4'-P-C4' energy: -42.352 flat angles P-C4'-P energy: -26.346 tors. eta vs tors. theta energy: -32.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -433.452041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.452041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.452041 (E_RNA) where: Base-Base interactions energy: -269.978 where: short stacking energy: -139.958 Base-Backbone interact. energy: -1.570 local terms energy: -161.904151 where: bonds (distance) C4'-P energy: -30.618 bonds (distance) P-C4' energy: -39.519 flat angles C4'-P-C4' energy: -42.251 flat angles P-C4'-P energy: -21.102 tors. eta vs tors. theta energy: -28.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -316.709460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.709460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.709460 (E_RNA) where: Base-Base interactions energy: -161.035 where: short stacking energy: -97.645 Base-Backbone interact. energy: -1.140 local terms energy: -154.534229 where: bonds (distance) C4'-P energy: -41.614 bonds (distance) P-C4' energy: -44.515 flat angles C4'-P-C4' energy: -32.480 flat angles P-C4'-P energy: -25.412 tors. eta vs tors. theta energy: -10.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -240.155891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.155891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.155891 (E_RNA) where: Base-Base interactions energy: -101.320 where: short stacking energy: -66.758 Base-Backbone interact. energy: -1.654 local terms energy: -137.181845 where: bonds (distance) C4'-P energy: -31.043 bonds (distance) P-C4' energy: -38.568 flat angles C4'-P-C4' energy: -27.073 flat angles P-C4'-P energy: -31.253 tors. eta vs tors. theta energy: -9.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -772.199328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.199328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.199328 (E_RNA) where: Base-Base interactions energy: -521.214 where: short stacking energy: -246.532 Base-Backbone interact. energy: -0.977 local terms energy: -250.007705 where: bonds (distance) C4'-P energy: -45.593 bonds (distance) P-C4' energy: -47.101 flat angles C4'-P-C4' energy: -52.350 flat angles P-C4'-P energy: -32.472 tors. eta vs tors. theta energy: -72.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -771.375632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.375632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.375632 (E_RNA) where: Base-Base interactions energy: -522.883 where: short stacking energy: -240.740 Base-Backbone interact. energy: -0.450 local terms energy: -248.043155 where: bonds (distance) C4'-P energy: -41.085 bonds (distance) P-C4' energy: -51.584 flat angles C4'-P-C4' energy: -51.853 flat angles P-C4'-P energy: -37.752 tors. eta vs tors. theta energy: -65.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -761.974204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.974204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.974204 (E_RNA) where: Base-Base interactions energy: -532.127 where: short stacking energy: -245.574 Base-Backbone interact. energy: 0.523 local terms energy: -230.370191 where: bonds (distance) C4'-P energy: -34.117 bonds (distance) P-C4' energy: -41.969 flat angles C4'-P-C4' energy: -53.206 flat angles P-C4'-P energy: -32.525 tors. eta vs tors. theta energy: -68.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -741.440026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.440026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.440026 (E_RNA) where: Base-Base interactions energy: -509.702 where: short stacking energy: -218.120 Base-Backbone interact. energy: -0.317 local terms energy: -231.421271 where: bonds (distance) C4'-P energy: -40.924 bonds (distance) P-C4' energy: -42.682 flat angles C4'-P-C4' energy: -51.986 flat angles P-C4'-P energy: -36.555 tors. eta vs tors. theta energy: -59.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -686.159477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.159477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.159477 (E_RNA) where: Base-Base interactions energy: -465.990 where: short stacking energy: -181.505 Base-Backbone interact. energy: -1.751 local terms energy: -218.418958 where: bonds (distance) C4'-P energy: -42.648 bonds (distance) P-C4' energy: -50.527 flat angles C4'-P-C4' energy: -48.159 flat angles P-C4'-P energy: -29.652 tors. eta vs tors. theta energy: -47.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -637.662560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.662560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.662560 (E_RNA) where: Base-Base interactions energy: -427.032 where: short stacking energy: -200.549 Base-Backbone interact. energy: 0.274 local terms energy: -210.904207 where: bonds (distance) C4'-P energy: -31.726 bonds (distance) P-C4' energy: -52.406 flat angles C4'-P-C4' energy: -44.467 flat angles P-C4'-P energy: -30.716 tors. eta vs tors. theta energy: -51.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -438.576241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.576241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.576241 (E_RNA) where: Base-Base interactions energy: -271.003 where: short stacking energy: -136.458 Base-Backbone interact. energy: -0.660 local terms energy: -166.912402 where: bonds (distance) C4'-P energy: -29.616 bonds (distance) P-C4' energy: -33.392 flat angles C4'-P-C4' energy: -44.376 flat angles P-C4'-P energy: -34.411 tors. eta vs tors. theta energy: -25.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -456.423303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.423303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.423303 (E_RNA) where: Base-Base interactions energy: -269.065 where: short stacking energy: -132.185 Base-Backbone interact. energy: -1.811 local terms energy: -185.547255 where: bonds (distance) C4'-P energy: -44.219 bonds (distance) P-C4' energy: -44.211 flat angles C4'-P-C4' energy: -43.590 flat angles P-C4'-P energy: -27.433 tors. eta vs tors. theta energy: -26.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -351.592584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.592584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.592584 (E_RNA) where: Base-Base interactions energy: -182.036 where: short stacking energy: -115.383 Base-Backbone interact. energy: 1.450 local terms energy: -171.006104 where: bonds (distance) C4'-P energy: -39.421 bonds (distance) P-C4' energy: -40.500 flat angles C4'-P-C4' energy: -41.188 flat angles P-C4'-P energy: -25.901 tors. eta vs tors. theta energy: -23.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -232.586898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.586898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.586898 (E_RNA) where: Base-Base interactions energy: -110.078 where: short stacking energy: -69.080 Base-Backbone interact. energy: 0.062 local terms energy: -122.570536 where: bonds (distance) C4'-P energy: -38.968 bonds (distance) P-C4' energy: -37.062 flat angles C4'-P-C4' energy: -27.087 flat angles P-C4'-P energy: -23.651 tors. eta vs tors. theta energy: 4.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -780.405825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.405825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.405825 (E_RNA) where: Base-Base interactions energy: -532.342 where: short stacking energy: -248.699 Base-Backbone interact. energy: -0.137 local terms energy: -247.926932 where: bonds (distance) C4'-P energy: -44.336 bonds (distance) P-C4' energy: -44.981 flat angles C4'-P-C4' energy: -49.632 flat angles P-C4'-P energy: -36.570 tors. eta vs tors. theta energy: -72.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -782.000079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.000079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.000079 (E_RNA) where: Base-Base interactions energy: -533.165 where: short stacking energy: -235.582 Base-Backbone interact. energy: -1.344 local terms energy: -247.490794 where: bonds (distance) C4'-P energy: -46.224 bonds (distance) P-C4' energy: -41.634 flat angles C4'-P-C4' energy: -45.811 flat angles P-C4'-P energy: -44.187 tors. eta vs tors. theta energy: -69.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -742.737962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.737962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.737962 (E_RNA) where: Base-Base interactions energy: -533.078 where: short stacking energy: -219.619 Base-Backbone interact. energy: -0.752 local terms energy: -208.907901 where: bonds (distance) C4'-P energy: -37.160 bonds (distance) P-C4' energy: -36.794 flat angles C4'-P-C4' energy: -42.944 flat angles P-C4'-P energy: -29.390 tors. eta vs tors. theta energy: -62.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -736.568447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.568447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.568447 (E_RNA) where: Base-Base interactions energy: -518.391 where: short stacking energy: -231.593 Base-Backbone interact. energy: -1.534 local terms energy: -216.643330 where: bonds (distance) C4'-P energy: -42.696 bonds (distance) P-C4' energy: -44.876 flat angles C4'-P-C4' energy: -48.830 flat angles P-C4'-P energy: -27.670 tors. eta vs tors. theta energy: -52.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -683.428757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.428757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.428757 (E_RNA) where: Base-Base interactions energy: -454.717 where: short stacking energy: -204.850 Base-Backbone interact. energy: -1.395 local terms energy: -227.317214 where: bonds (distance) C4'-P energy: -44.916 bonds (distance) P-C4' energy: -40.463 flat angles C4'-P-C4' energy: -50.869 flat angles P-C4'-P energy: -33.878 tors. eta vs tors. theta energy: -57.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -580.434852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.434852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.434852 (E_RNA) where: Base-Base interactions energy: -392.787 where: short stacking energy: -163.849 Base-Backbone interact. energy: -1.113 local terms energy: -186.534582 where: bonds (distance) C4'-P energy: -42.632 bonds (distance) P-C4' energy: -39.905 flat angles C4'-P-C4' energy: -41.675 flat angles P-C4'-P energy: -27.873 tors. eta vs tors. theta energy: -34.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -450.740259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.740259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.740259 (E_RNA) where: Base-Base interactions energy: -299.970 where: short stacking energy: -136.340 Base-Backbone interact. energy: 3.826 local terms energy: -154.595564 where: bonds (distance) C4'-P energy: -41.947 bonds (distance) P-C4' energy: -38.472 flat angles C4'-P-C4' energy: -36.376 flat angles P-C4'-P energy: -17.499 tors. eta vs tors. theta energy: -20.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -445.827109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.827109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.827109 (E_RNA) where: Base-Base interactions energy: -291.503 where: short stacking energy: -140.680 Base-Backbone interact. energy: -0.797 local terms energy: -153.526536 where: bonds (distance) C4'-P energy: -35.724 bonds (distance) P-C4' energy: -34.350 flat angles C4'-P-C4' energy: -39.367 flat angles P-C4'-P energy: -18.989 tors. eta vs tors. theta energy: -25.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -341.231833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.231833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.231833 (E_RNA) where: Base-Base interactions energy: -195.056 where: short stacking energy: -119.346 Base-Backbone interact. energy: -0.715 local terms energy: -145.460381 where: bonds (distance) C4'-P energy: -35.942 bonds (distance) P-C4' energy: -38.553 flat angles C4'-P-C4' energy: -28.010 flat angles P-C4'-P energy: -20.162 tors. eta vs tors. theta energy: -22.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -248.737305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.737305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.737305 (E_RNA) where: Base-Base interactions energy: -126.011 where: short stacking energy: -80.968 Base-Backbone interact. energy: -2.233 local terms energy: -120.493573 where: bonds (distance) C4'-P energy: -33.205 bonds (distance) P-C4' energy: -34.123 flat angles C4'-P-C4' energy: -33.648 flat angles P-C4'-P energy: -20.865 tors. eta vs tors. theta energy: 1.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -815.599967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.599967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.599967 (E_RNA) where: Base-Base interactions energy: -574.564 where: short stacking energy: -244.540 Base-Backbone interact. energy: -1.903 local terms energy: -239.132876 where: bonds (distance) C4'-P energy: -46.421 bonds (distance) P-C4' energy: -47.032 flat angles C4'-P-C4' energy: -44.077 flat angles P-C4'-P energy: -35.438 tors. eta vs tors. theta energy: -66.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -775.507179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.507179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.507179 (E_RNA) where: Base-Base interactions energy: -522.327 where: short stacking energy: -244.366 Base-Backbone interact. energy: -0.693 local terms energy: -252.486871 where: bonds (distance) C4'-P energy: -42.593 bonds (distance) P-C4' energy: -49.237 flat angles C4'-P-C4' energy: -55.810 flat angles P-C4'-P energy: -35.017 tors. eta vs tors. theta energy: -69.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -744.523848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.523848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.523848 (E_RNA) where: Base-Base interactions energy: -516.885 where: short stacking energy: -212.077 Base-Backbone interact. energy: -0.745 local terms energy: -226.894450 where: bonds (distance) C4'-P energy: -43.550 bonds (distance) P-C4' energy: -44.585 flat angles C4'-P-C4' energy: -42.260 flat angles P-C4'-P energy: -37.003 tors. eta vs tors. theta energy: -59.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -740.729744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.729744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.729744 (E_RNA) where: Base-Base interactions energy: -499.251 where: short stacking energy: -220.731 Base-Backbone interact. energy: -0.384 local terms energy: -241.094423 where: bonds (distance) C4'-P energy: -35.119 bonds (distance) P-C4' energy: -50.689 flat angles C4'-P-C4' energy: -50.024 flat angles P-C4'-P energy: -38.581 tors. eta vs tors. theta energy: -66.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -690.076273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.076273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.076273 (E_RNA) where: Base-Base interactions energy: -476.448 where: short stacking energy: -201.782 Base-Backbone interact. energy: -1.160 local terms energy: -212.467738 where: bonds (distance) C4'-P energy: -44.752 bonds (distance) P-C4' energy: -34.678 flat angles C4'-P-C4' energy: -46.771 flat angles P-C4'-P energy: -29.531 tors. eta vs tors. theta energy: -56.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -626.494266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.494266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.494266 (E_RNA) where: Base-Base interactions energy: -414.147 where: short stacking energy: -175.493 Base-Backbone interact. energy: -0.921 local terms energy: -211.426195 where: bonds (distance) C4'-P energy: -34.976 bonds (distance) P-C4' energy: -44.376 flat angles C4'-P-C4' energy: -48.145 flat angles P-C4'-P energy: -29.696 tors. eta vs tors. theta energy: -54.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -463.260426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.260426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.260426 (E_RNA) where: Base-Base interactions energy: -281.166 where: short stacking energy: -133.602 Base-Backbone interact. energy: -0.197 local terms energy: -181.897408 where: bonds (distance) C4'-P energy: -37.270 bonds (distance) P-C4' energy: -47.436 flat angles C4'-P-C4' energy: -45.333 flat angles P-C4'-P energy: -16.158 tors. eta vs tors. theta energy: -35.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -477.634526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.634526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.634526 (E_RNA) where: Base-Base interactions energy: -311.004 where: short stacking energy: -140.897 Base-Backbone interact. energy: -1.185 local terms energy: -165.445375 where: bonds (distance) C4'-P energy: -38.182 bonds (distance) P-C4' energy: -42.157 flat angles C4'-P-C4' energy: -34.388 flat angles P-C4'-P energy: -25.501 tors. eta vs tors. theta energy: -25.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -316.778074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.778074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.778074 (E_RNA) where: Base-Base interactions energy: -155.840 where: short stacking energy: -105.021 Base-Backbone interact. energy: 0.133 local terms energy: -161.070474 where: bonds (distance) C4'-P energy: -44.280 bonds (distance) P-C4' energy: -39.764 flat angles C4'-P-C4' energy: -39.966 flat angles P-C4'-P energy: -17.436 tors. eta vs tors. theta energy: -19.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -258.275329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.275329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.275329 (E_RNA) where: Base-Base interactions energy: -114.447 where: short stacking energy: -59.359 Base-Backbone interact. energy: -1.225 local terms energy: -142.603479 where: bonds (distance) C4'-P energy: -47.725 bonds (distance) P-C4' energy: -37.725 flat angles C4'-P-C4' energy: -30.779 flat angles P-C4'-P energy: -21.499 tors. eta vs tors. theta energy: -4.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -791.281412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.281412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.281412 (E_RNA) where: Base-Base interactions energy: -538.484 where: short stacking energy: -242.880 Base-Backbone interact. energy: -0.848 local terms energy: -251.949155 where: bonds (distance) C4'-P energy: -39.814 bonds (distance) P-C4' energy: -48.555 flat angles C4'-P-C4' energy: -51.865 flat angles P-C4'-P energy: -38.459 tors. eta vs tors. theta energy: -73.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -775.891125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.891125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.891125 (E_RNA) where: Base-Base interactions energy: -517.951 where: short stacking energy: -240.772 Base-Backbone interact. energy: -0.347 local terms energy: -257.593604 where: bonds (distance) C4'-P energy: -50.039 bonds (distance) P-C4' energy: -47.186 flat angles C4'-P-C4' energy: -47.963 flat angles P-C4'-P energy: -41.128 tors. eta vs tors. theta energy: -71.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -749.658467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.658467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.658467 (E_RNA) where: Base-Base interactions energy: -519.006 where: short stacking energy: -233.738 Base-Backbone interact. energy: -0.297 local terms energy: -230.356281 where: bonds (distance) C4'-P energy: -39.323 bonds (distance) P-C4' energy: -48.311 flat angles C4'-P-C4' energy: -49.818 flat angles P-C4'-P energy: -35.271 tors. eta vs tors. theta energy: -57.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -746.483313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.483313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.483313 (E_RNA) where: Base-Base interactions energy: -512.402 where: short stacking energy: -205.897 Base-Backbone interact. energy: -0.135 local terms energy: -233.946803 where: bonds (distance) C4'-P energy: -37.767 bonds (distance) P-C4' energy: -44.120 flat angles C4'-P-C4' energy: -49.492 flat angles P-C4'-P energy: -35.464 tors. eta vs tors. theta energy: -67.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -680.992638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.992638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.992638 (E_RNA) where: Base-Base interactions energy: -462.296 where: short stacking energy: -205.629 Base-Backbone interact. energy: -0.403 local terms energy: -218.293359 where: bonds (distance) C4'-P energy: -40.708 bonds (distance) P-C4' energy: -43.896 flat angles C4'-P-C4' energy: -41.083 flat angles P-C4'-P energy: -38.263 tors. eta vs tors. theta energy: -54.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -607.580690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.580690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.580690 (E_RNA) where: Base-Base interactions energy: -413.882 where: short stacking energy: -179.404 Base-Backbone interact. energy: 1.073 local terms energy: -194.772242 where: bonds (distance) C4'-P energy: -42.084 bonds (distance) P-C4' energy: -38.792 flat angles C4'-P-C4' energy: -43.854 flat angles P-C4'-P energy: -23.135 tors. eta vs tors. theta energy: -46.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -455.958638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.958638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.958638 (E_RNA) where: Base-Base interactions energy: -284.249 where: short stacking energy: -146.444 Base-Backbone interact. energy: 0.321 local terms energy: -172.030449 where: bonds (distance) C4'-P energy: -36.828 bonds (distance) P-C4' energy: -41.746 flat angles C4'-P-C4' energy: -48.399 flat angles P-C4'-P energy: -17.666 tors. eta vs tors. theta energy: -27.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -438.312573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.312573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.312573 (E_RNA) where: Base-Base interactions energy: -269.174 where: short stacking energy: -138.121 Base-Backbone interact. energy: -1.220 local terms energy: -167.918712 where: bonds (distance) C4'-P energy: -48.959 bonds (distance) P-C4' energy: -41.376 flat angles C4'-P-C4' energy: -35.120 flat angles P-C4'-P energy: -19.109 tors. eta vs tors. theta energy: -23.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -326.938260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.938260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.938260 (E_RNA) where: Base-Base interactions energy: -188.988 where: short stacking energy: -103.310 Base-Backbone interact. energy: -0.558 local terms energy: -137.393096 where: bonds (distance) C4'-P energy: -33.857 bonds (distance) P-C4' energy: -38.534 flat angles C4'-P-C4' energy: -32.756 flat angles P-C4'-P energy: -16.701 tors. eta vs tors. theta energy: -15.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -253.621962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.621962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.621962 (E_RNA) where: Base-Base interactions energy: -130.581 where: short stacking energy: -77.053 Base-Backbone interact. energy: 0.430 local terms energy: -123.471540 where: bonds (distance) C4'-P energy: -37.644 bonds (distance) P-C4' energy: -16.706 flat angles C4'-P-C4' energy: -38.574 flat angles P-C4'-P energy: -18.471 tors. eta vs tors. theta energy: -12.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -797.231974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.231974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.231974 (E_RNA) where: Base-Base interactions energy: -549.041 where: short stacking energy: -243.054 Base-Backbone interact. energy: -0.437 local terms energy: -247.753580 where: bonds (distance) C4'-P energy: -45.330 bonds (distance) P-C4' energy: -45.739 flat angles C4'-P-C4' energy: -48.413 flat angles P-C4'-P energy: -40.486 tors. eta vs tors. theta energy: -67.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -750.365828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.365828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.365828 (E_RNA) where: Base-Base interactions energy: -515.260 where: short stacking energy: -239.774 Base-Backbone interact. energy: -0.297 local terms energy: -234.808846 where: bonds (distance) C4'-P energy: -39.592 bonds (distance) P-C4' energy: -46.608 flat angles C4'-P-C4' energy: -47.211 flat angles P-C4'-P energy: -31.705 tors. eta vs tors. theta energy: -69.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -763.210986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.210986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.210986 (E_RNA) where: Base-Base interactions energy: -527.392 where: short stacking energy: -237.746 Base-Backbone interact. energy: -0.837 local terms energy: -234.982255 where: bonds (distance) C4'-P energy: -47.271 bonds (distance) P-C4' energy: -43.409 flat angles C4'-P-C4' energy: -49.264 flat angles P-C4'-P energy: -36.249 tors. eta vs tors. theta energy: -58.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -731.434170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.434170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.434170 (E_RNA) where: Base-Base interactions energy: -496.421 where: short stacking energy: -226.264 Base-Backbone interact. energy: 0.066 local terms energy: -235.079269 where: bonds (distance) C4'-P energy: -47.714 bonds (distance) P-C4' energy: -40.081 flat angles C4'-P-C4' energy: -51.268 flat angles P-C4'-P energy: -31.637 tors. eta vs tors. theta energy: -64.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -593.482091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.482091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.482091 (E_RNA) where: Base-Base interactions energy: -396.392 where: short stacking energy: -178.899 Base-Backbone interact. energy: 0.721 local terms energy: -197.810357 where: bonds (distance) C4'-P energy: -46.158 bonds (distance) P-C4' energy: -41.449 flat angles C4'-P-C4' energy: -41.731 flat angles P-C4'-P energy: -24.477 tors. eta vs tors. theta energy: -43.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -644.551801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.551801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.551801 (E_RNA) where: Base-Base interactions energy: -460.165 where: short stacking energy: -203.764 Base-Backbone interact. energy: -0.067 local terms energy: -184.319986 where: bonds (distance) C4'-P energy: -24.288 bonds (distance) P-C4' energy: -39.955 flat angles C4'-P-C4' energy: -34.285 flat angles P-C4'-P energy: -28.495 tors. eta vs tors. theta energy: -57.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -451.934217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.934217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.934217 (E_RNA) where: Base-Base interactions energy: -287.533 where: short stacking energy: -147.344 Base-Backbone interact. energy: 0.724 local terms energy: -165.125717 where: bonds (distance) C4'-P energy: -37.056 bonds (distance) P-C4' energy: -37.110 flat angles C4'-P-C4' energy: -38.010 flat angles P-C4'-P energy: -32.000 tors. eta vs tors. theta energy: -20.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -416.944577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.944577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.944577 (E_RNA) where: Base-Base interactions energy: -258.789 where: short stacking energy: -125.665 Base-Backbone interact. energy: 5.493 local terms energy: -163.648566 where: bonds (distance) C4'-P energy: -35.627 bonds (distance) P-C4' energy: -45.764 flat angles C4'-P-C4' energy: -38.731 flat angles P-C4'-P energy: -25.822 tors. eta vs tors. theta energy: -17.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -340.433751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.433751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.433751 (E_RNA) where: Base-Base interactions energy: -184.616 where: short stacking energy: -123.188 Base-Backbone interact. energy: -0.374 local terms energy: -155.444049 where: bonds (distance) C4'-P energy: -32.589 bonds (distance) P-C4' energy: -37.433 flat angles C4'-P-C4' energy: -43.855 flat angles P-C4'-P energy: -21.127 tors. eta vs tors. theta energy: -20.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -276.894337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.894337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.894337 (E_RNA) where: Base-Base interactions energy: -143.115 where: short stacking energy: -93.919 Base-Backbone interact. energy: -1.254 local terms energy: -132.524557 where: bonds (distance) C4'-P energy: -38.035 bonds (distance) P-C4' energy: -28.600 flat angles C4'-P-C4' energy: -35.873 flat angles P-C4'-P energy: -22.667 tors. eta vs tors. theta energy: -7.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -807.773466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.773466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.773466 (E_RNA) where: Base-Base interactions energy: -561.081 where: short stacking energy: -246.392 Base-Backbone interact. energy: -0.174 local terms energy: -246.518528 where: bonds (distance) C4'-P energy: -46.571 bonds (distance) P-C4' energy: -40.289 flat angles C4'-P-C4' energy: -53.397 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -69.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -778.704383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.704383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.704383 (E_RNA) where: Base-Base interactions energy: -545.061 where: short stacking energy: -227.172 Base-Backbone interact. energy: 0.307 local terms energy: -233.950763 where: bonds (distance) C4'-P energy: -47.764 bonds (distance) P-C4' energy: -43.680 flat angles C4'-P-C4' energy: -49.519 flat angles P-C4'-P energy: -34.817 tors. eta vs tors. theta energy: -58.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -742.730925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.730925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.730925 (E_RNA) where: Base-Base interactions energy: -504.573 where: short stacking energy: -237.203 Base-Backbone interact. energy: -0.258 local terms energy: -237.899451 where: bonds (distance) C4'-P energy: -37.593 bonds (distance) P-C4' energy: -50.244 flat angles C4'-P-C4' energy: -52.335 flat angles P-C4'-P energy: -29.863 tors. eta vs tors. theta energy: -67.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -725.550927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.550927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.550927 (E_RNA) where: Base-Base interactions energy: -494.941 where: short stacking energy: -226.401 Base-Backbone interact. energy: 0.517 local terms energy: -231.126300 where: bonds (distance) C4'-P energy: -39.176 bonds (distance) P-C4' energy: -52.060 flat angles C4'-P-C4' energy: -44.651 flat angles P-C4'-P energy: -26.199 tors. eta vs tors. theta energy: -69.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -604.389278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.389278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.389278 (E_RNA) where: Base-Base interactions energy: -408.225 where: short stacking energy: -174.884 Base-Backbone interact. energy: -1.960 local terms energy: -194.204017 where: bonds (distance) C4'-P energy: -43.015 bonds (distance) P-C4' energy: -44.233 flat angles C4'-P-C4' energy: -46.430 flat angles P-C4'-P energy: -20.700 tors. eta vs tors. theta energy: -39.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -650.919799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.919799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.919799 (E_RNA) where: Base-Base interactions energy: -451.284 where: short stacking energy: -196.478 Base-Backbone interact. energy: 0.478 local terms energy: -200.113552 where: bonds (distance) C4'-P energy: -33.634 bonds (distance) P-C4' energy: -40.477 flat angles C4'-P-C4' energy: -43.519 flat angles P-C4'-P energy: -32.896 tors. eta vs tors. theta energy: -49.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -462.436873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.436873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.436873 (E_RNA) where: Base-Base interactions energy: -282.618 where: short stacking energy: -133.680 Base-Backbone interact. energy: -1.044 local terms energy: -178.775355 where: bonds (distance) C4'-P energy: -39.052 bonds (distance) P-C4' energy: -41.342 flat angles C4'-P-C4' energy: -38.726 flat angles P-C4'-P energy: -34.513 tors. eta vs tors. theta energy: -25.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -424.447173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.447173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.447173 (E_RNA) where: Base-Base interactions energy: -262.016 where: short stacking energy: -131.659 Base-Backbone interact. energy: 1.697 local terms energy: -164.128330 where: bonds (distance) C4'-P energy: -39.463 bonds (distance) P-C4' energy: -40.428 flat angles C4'-P-C4' energy: -45.148 flat angles P-C4'-P energy: -20.589 tors. eta vs tors. theta energy: -18.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -311.290186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.290186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.290186 (E_RNA) where: Base-Base interactions energy: -170.704 where: short stacking energy: -116.837 Base-Backbone interact. energy: 1.165 local terms energy: -141.751454 where: bonds (distance) C4'-P energy: -36.506 bonds (distance) P-C4' energy: -34.983 flat angles C4'-P-C4' energy: -36.358 flat angles P-C4'-P energy: -23.695 tors. eta vs tors. theta energy: -10.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -268.636347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.636347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.636347 (E_RNA) where: Base-Base interactions energy: -128.498 where: short stacking energy: -77.507 Base-Backbone interact. energy: -0.904 local terms energy: -139.234736 where: bonds (distance) C4'-P energy: -34.425 bonds (distance) P-C4' energy: -36.921 flat angles C4'-P-C4' energy: -45.009 flat angles P-C4'-P energy: -13.463 tors. eta vs tors. theta energy: -9.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -810.617967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.617967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.617967 (E_RNA) where: Base-Base interactions energy: -547.017 where: short stacking energy: -253.313 Base-Backbone interact. energy: -0.975 local terms energy: -262.625429 where: bonds (distance) C4'-P energy: -46.647 bonds (distance) P-C4' energy: -51.447 flat angles C4'-P-C4' energy: -53.225 flat angles P-C4'-P energy: -36.666 tors. eta vs tors. theta energy: -74.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -776.722434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.722434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.722434 (E_RNA) where: Base-Base interactions energy: -530.205 where: short stacking energy: -228.338 Base-Backbone interact. energy: -1.135 local terms energy: -245.382435 where: bonds (distance) C4'-P energy: -43.110 bonds (distance) P-C4' energy: -49.960 flat angles C4'-P-C4' energy: -53.643 flat angles P-C4'-P energy: -31.212 tors. eta vs tors. theta energy: -67.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -758.260174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.260174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.260174 (E_RNA) where: Base-Base interactions energy: -511.072 where: short stacking energy: -232.901 Base-Backbone interact. energy: -0.705 local terms energy: -246.483424 where: bonds (distance) C4'-P energy: -45.673 bonds (distance) P-C4' energy: -45.116 flat angles C4'-P-C4' energy: -53.200 flat angles P-C4'-P energy: -32.811 tors. eta vs tors. theta energy: -69.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -728.053555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.053555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.053555 (E_RNA) where: Base-Base interactions energy: -498.226 where: short stacking energy: -227.558 Base-Backbone interact. energy: -0.472 local terms energy: -229.355935 where: bonds (distance) C4'-P energy: -43.007 bonds (distance) P-C4' energy: -36.051 flat angles C4'-P-C4' energy: -52.250 flat angles P-C4'-P energy: -35.464 tors. eta vs tors. theta energy: -62.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -646.227925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.227925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.227925 (E_RNA) where: Base-Base interactions energy: -432.724 where: short stacking energy: -194.167 Base-Backbone interact. energy: -0.242 local terms energy: -213.262187 where: bonds (distance) C4'-P energy: -39.690 bonds (distance) P-C4' energy: -48.152 flat angles C4'-P-C4' energy: -44.235 flat angles P-C4'-P energy: -30.655 tors. eta vs tors. theta energy: -50.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -638.193865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.193865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.193865 (E_RNA) where: Base-Base interactions energy: -441.485 where: short stacking energy: -195.432 Base-Backbone interact. energy: 1.919 local terms energy: -198.627397 where: bonds (distance) C4'-P energy: -44.851 bonds (distance) P-C4' energy: -28.815 flat angles C4'-P-C4' energy: -45.327 flat angles P-C4'-P energy: -29.904 tors. eta vs tors. theta energy: -49.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -575.042557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.042557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.042557 (E_RNA) where: Base-Base interactions energy: -381.680 where: short stacking energy: -180.131 Base-Backbone interact. energy: -0.762 local terms energy: -192.599624 where: bonds (distance) C4'-P energy: -46.616 bonds (distance) P-C4' energy: -38.549 flat angles C4'-P-C4' energy: -42.965 flat angles P-C4'-P energy: -28.591 tors. eta vs tors. theta energy: -35.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -453.130433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.130433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.130433 (E_RNA) where: Base-Base interactions energy: -293.669 where: short stacking energy: -140.636 Base-Backbone interact. energy: -0.016 local terms energy: -159.445914 where: bonds (distance) C4'-P energy: -30.345 bonds (distance) P-C4' energy: -25.729 flat angles C4'-P-C4' energy: -35.198 flat angles P-C4'-P energy: -31.902 tors. eta vs tors. theta energy: -36.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -283.967673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.967673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.967673 (E_RNA) where: Base-Base interactions energy: -143.969 where: short stacking energy: -85.798 Base-Backbone interact. energy: -1.152 local terms energy: -138.846998 where: bonds (distance) C4'-P energy: -40.666 bonds (distance) P-C4' energy: -40.978 flat angles C4'-P-C4' energy: -34.347 flat angles P-C4'-P energy: -23.195 tors. eta vs tors. theta energy: 0.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -334.460051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.460051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.460051 (E_RNA) where: Base-Base interactions energy: -171.310 where: short stacking energy: -82.080 Base-Backbone interact. energy: -0.756 local terms energy: -162.394392 where: bonds (distance) C4'-P energy: -44.095 bonds (distance) P-C4' energy: -42.875 flat angles C4'-P-C4' energy: -34.117 flat angles P-C4'-P energy: -24.427 tors. eta vs tors. theta energy: -16.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -794.754519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.754519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.754519 (E_RNA) where: Base-Base interactions energy: -537.493 where: short stacking energy: -246.156 Base-Backbone interact. energy: 0.550 local terms energy: -257.811050 where: bonds (distance) C4'-P energy: -42.658 bonds (distance) P-C4' energy: -51.814 flat angles C4'-P-C4' energy: -52.665 flat angles P-C4'-P energy: -38.213 tors. eta vs tors. theta energy: -72.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -787.162008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.162008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.162008 (E_RNA) where: Base-Base interactions energy: -546.066 where: short stacking energy: -237.561 Base-Backbone interact. energy: -0.980 local terms energy: -240.116065 where: bonds (distance) C4'-P energy: -35.240 bonds (distance) P-C4' energy: -43.626 flat angles C4'-P-C4' energy: -57.274 flat angles P-C4'-P energy: -39.496 tors. eta vs tors. theta energy: -64.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -766.482152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.482152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.482152 (E_RNA) where: Base-Base interactions energy: -534.157 where: short stacking energy: -247.680 Base-Backbone interact. energy: -1.223 local terms energy: -231.102296 where: bonds (distance) C4'-P energy: -39.669 bonds (distance) P-C4' energy: -38.227 flat angles C4'-P-C4' energy: -50.383 flat angles P-C4'-P energy: -30.004 tors. eta vs tors. theta energy: -72.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -746.429283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.429283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.429283 (E_RNA) where: Base-Base interactions energy: -512.292 where: short stacking energy: -229.203 Base-Backbone interact. energy: -1.594 local terms energy: -232.542897 where: bonds (distance) C4'-P energy: -47.469 bonds (distance) P-C4' energy: -47.001 flat angles C4'-P-C4' energy: -47.935 flat angles P-C4'-P energy: -32.771 tors. eta vs tors. theta energy: -57.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -642.670859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.670859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.670859 (E_RNA) where: Base-Base interactions energy: -439.996 where: short stacking energy: -200.779 Base-Backbone interact. energy: -0.449 local terms energy: -202.225091 where: bonds (distance) C4'-P energy: -36.925 bonds (distance) P-C4' energy: -37.229 flat angles C4'-P-C4' energy: -44.415 flat angles P-C4'-P energy: -36.423 tors. eta vs tors. theta energy: -47.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -661.645590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.645590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.645590 (E_RNA) where: Base-Base interactions energy: -454.901 where: short stacking energy: -195.343 Base-Backbone interact. energy: -1.074 local terms energy: -205.670201 where: bonds (distance) C4'-P energy: -37.359 bonds (distance) P-C4' energy: -45.596 flat angles C4'-P-C4' energy: -51.248 flat angles P-C4'-P energy: -26.559 tors. eta vs tors. theta energy: -44.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -576.064960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.064960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.064960 (E_RNA) where: Base-Base interactions energy: -368.151 where: short stacking energy: -180.965 Base-Backbone interact. energy: -1.444 local terms energy: -206.470064 where: bonds (distance) C4'-P energy: -44.964 bonds (distance) P-C4' energy: -36.050 flat angles C4'-P-C4' energy: -43.940 flat angles P-C4'-P energy: -34.587 tors. eta vs tors. theta energy: -46.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -479.903626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.903626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.903626 (E_RNA) where: Base-Base interactions energy: -298.850 where: short stacking energy: -153.718 Base-Backbone interact. energy: 4.020 local terms energy: -185.073411 where: bonds (distance) C4'-P energy: -44.951 bonds (distance) P-C4' energy: -48.684 flat angles C4'-P-C4' energy: -32.522 flat angles P-C4'-P energy: -22.302 tors. eta vs tors. theta energy: -36.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -302.206721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.206721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.206721 (E_RNA) where: Base-Base interactions energy: -160.459 where: short stacking energy: -87.763 Base-Backbone interact. energy: 2.530 local terms energy: -144.277839 where: bonds (distance) C4'-P energy: -37.889 bonds (distance) P-C4' energy: -39.306 flat angles C4'-P-C4' energy: -40.702 flat angles P-C4'-P energy: -22.092 tors. eta vs tors. theta energy: -4.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -289.722473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.722473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.722473 (E_RNA) where: Base-Base interactions energy: -150.398 where: short stacking energy: -100.774 Base-Backbone interact. energy: 1.350 local terms energy: -140.674362 where: bonds (distance) C4'-P energy: -42.833 bonds (distance) P-C4' energy: -41.090 flat angles C4'-P-C4' energy: -38.072 flat angles P-C4'-P energy: -15.068 tors. eta vs tors. theta energy: -3.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 8 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 8971776 moves confirmed later: 10224171 all moves confirmed: 19195947 percent of confirmed moves: 11.997467 current total energy: -739.165512 recalc. total energy: -739.165512 replica 6 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 7282278 moves confirmed later: 8037138 all moves confirmed: 15319416 percent of confirmed moves: 9.574635 current total energy: -726.853512 recalc. total energy: -726.853512 replica 9 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 8818554 moves confirmed later: 9929666 all moves confirmed: 18748220 percent of confirmed moves: 11.717638 current total energy: -679.089113 recalc. total energy: -679.089113 replica 7 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 9205454 moves confirmed later: 10566744 all moves confirmed: 19772198 percent of confirmed moves: 12.357624 current total energy: -653.970717 recalc. total energy: -653.970717 replica 4 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 12289799 moves confirmed later: 14576364 all moves confirmed: 26866163 percent of confirmed moves: 16.791352 current total energy: -617.577421 recalc. total energy: -617.577421 replica 1 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 8381817 moves confirmed later: 9414798 all moves confirmed: 17796615 percent of confirmed moves: 11.122884 current total energy: -520.688416 recalc. total energy: -520.688416 replica 2 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 11893166 moves confirmed later: 13984642 all moves confirmed: 25877808 percent of confirmed moves: 16.173630 current total energy: -492.487428 recalc. total energy: -492.487428 replica 10 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 11419872 moves confirmed later: 13393345 all moves confirmed: 24813217 percent of confirmed moves: 15.508261 current total energy: -381.992125 recalc. total energy: -381.992125 replica 5 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 10850746 moves confirmed later: 12693217 all moves confirmed: 23543963 percent of confirmed moves: 14.714977 current total energy: -222.564929 recalc. total energy: -222.564929 replica 3 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 15398554 moves confirmed later: 18616276 all moves confirmed: 34014830 percent of confirmed moves: 21.259269 current total energy: -195.912703 recalc. total energy: -195.912703 out arg RESULTS//1/Tetraloop_10_steps-77393f2a_01 Time of doing 1600000 iterations: 1991.000 seconds