SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-66ff36fb/inputs/seq.fa: 1 curr_seq: _AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGUUUGGCCUCAAAAGAAACGCGGUAAUCGGACUCAACCUCUACUGUGGGGGGGCCGGCUUGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACUUUUGGCUACGGAGAAGGAGGCCUCGGCCCGGCGAGAGAUAGGGGGAGGGGAGGCCGGCGCGGUGAUUGGCGGAAGCGCCGGCGCAAGCCCCCCGUCCACCCUCACGCCAGACUCCCGGAGGGUCGCGCGGCCGCCGCCCAUUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1021.234979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.234979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.234979 (E_RNA) where: Base-Base interactions energy: -59.956 where: short stacking energy: -59.956 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1226.228874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.228874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.228874 (E_RNA) where: Base-Base interactions energy: -546.201 where: short stacking energy: -539.831 Base-Backbone interact. energy: -0.188 local terms energy: -679.839180 where: bonds (distance) C4'-P energy: -157.515 bonds (distance) P-C4' energy: -151.241 flat angles C4'-P-C4' energy: -153.264 flat angles P-C4'-P energy: -100.906 tors. eta vs tors. theta energy: -116.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1204.728334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.728334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.728334 (E_RNA) where: Base-Base interactions energy: -533.394 where: short stacking energy: -527.815 Base-Backbone interact. energy: 0.148 local terms energy: -671.482284 where: bonds (distance) C4'-P energy: -150.636 bonds (distance) P-C4' energy: -168.779 flat angles C4'-P-C4' energy: -147.762 flat angles P-C4'-P energy: -92.923 tors. eta vs tors. theta energy: -111.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1204.931621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.931621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.931621 (E_RNA) where: Base-Base interactions energy: -534.774 where: short stacking energy: -529.042 Base-Backbone interact. energy: -0.151 local terms energy: -670.006260 where: bonds (distance) C4'-P energy: -143.300 bonds (distance) P-C4' energy: -153.306 flat angles C4'-P-C4' energy: -161.559 flat angles P-C4'-P energy: -88.157 tors. eta vs tors. theta energy: -123.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1076.315346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.315346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.315346 (E_RNA) where: Base-Base interactions energy: -438.962 where: short stacking energy: -433.812 Base-Backbone interact. energy: -0.974 local terms energy: -636.379168 where: bonds (distance) C4'-P energy: -152.931 bonds (distance) P-C4' energy: -158.498 flat angles C4'-P-C4' energy: -134.631 flat angles P-C4'-P energy: -99.966 tors. eta vs tors. theta energy: -90.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1021.243209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.243209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.243209 (E_RNA) where: Base-Base interactions energy: -72.459 where: short stacking energy: -72.459 Base-Backbone interact. energy: -0.000 local terms energy: -948.783815 where: bonds (distance) C4'-P energy: -234.279 bonds (distance) P-C4' energy: -217.358 flat angles C4'-P-C4' energy: -178.842 flat angles P-C4'-P energy: -205.764 tors. eta vs tors. theta energy: -112.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1020.623213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.623213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.623213 (E_RNA) where: Base-Base interactions energy: -59.685 where: short stacking energy: -59.685 Base-Backbone interact. energy: -0.000 local terms energy: -960.938356 where: bonds (distance) C4'-P energy: -239.864 bonds (distance) P-C4' energy: -221.867 flat angles C4'-P-C4' energy: -181.057 flat angles P-C4'-P energy: -207.375 tors. eta vs tors. theta energy: -110.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1022.057025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.057025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.057025 (E_RNA) where: Base-Base interactions energy: -69.250 where: short stacking energy: -69.250 Base-Backbone interact. energy: -0.000 local terms energy: -952.807151 where: bonds (distance) C4'-P energy: -236.938 bonds (distance) P-C4' energy: -218.143 flat angles C4'-P-C4' energy: -179.371 flat angles P-C4'-P energy: -205.944 tors. eta vs tors. theta energy: -112.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1020.988999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.988999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.988999 (E_RNA) where: Base-Base interactions energy: -62.800 where: short stacking energy: -62.800 Base-Backbone interact. energy: -0.000 local terms energy: -958.188680 where: bonds (distance) C4'-P energy: -238.527 bonds (distance) P-C4' energy: -220.663 flat angles C4'-P-C4' energy: -180.491 flat angles P-C4'-P energy: -206.792 tors. eta vs tors. theta energy: -111.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1020.372302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.372302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.372302 (E_RNA) where: Base-Base interactions energy: -59.685 where: short stacking energy: -59.685 Base-Backbone interact. energy: -0.000 local terms energy: -960.687445 where: bonds (distance) C4'-P energy: -239.864 bonds (distance) P-C4' energy: -221.867 flat angles C4'-P-C4' energy: -180.769 flat angles P-C4'-P energy: -207.412 tors. eta vs tors. theta energy: -110.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1023.412403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.412403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.412403 (E_RNA) where: Base-Base interactions energy: -65.743 where: short stacking energy: -65.743 Base-Backbone interact. energy: -0.000 local terms energy: -957.669166 where: bonds (distance) C4'-P energy: -238.535 bonds (distance) P-C4' energy: -219.077 flat angles C4'-P-C4' energy: -181.818 flat angles P-C4'-P energy: -206.899 tors. eta vs tors. theta energy: -111.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1317.861217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.861217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.861217 (E_RNA) where: Base-Base interactions energy: -594.012 where: short stacking energy: -588.181 Base-Backbone interact. energy: -0.449 local terms energy: -723.400252 where: bonds (distance) C4'-P energy: -149.377 bonds (distance) P-C4' energy: -159.119 flat angles C4'-P-C4' energy: -173.329 flat angles P-C4'-P energy: -105.803 tors. eta vs tors. theta energy: -135.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1269.414810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.414810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.414810 (E_RNA) where: Base-Base interactions energy: -557.610 where: short stacking energy: -553.591 Base-Backbone interact. energy: 0.126 local terms energy: -711.930960 where: bonds (distance) C4'-P energy: -150.318 bonds (distance) P-C4' energy: -154.933 flat angles C4'-P-C4' energy: -157.901 flat angles P-C4'-P energy: -107.661 tors. eta vs tors. theta energy: -141.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1210.794592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.794592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.794592 (E_RNA) where: Base-Base interactions energy: -557.637 where: short stacking energy: -546.252 Base-Backbone interact. energy: 0.465 local terms energy: -653.622562 where: bonds (distance) C4'-P energy: -129.166 bonds (distance) P-C4' energy: -141.666 flat angles C4'-P-C4' energy: -155.160 flat angles P-C4'-P energy: -91.323 tors. eta vs tors. theta energy: -136.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1037.447419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.447419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.447419 (E_RNA) where: Base-Base interactions energy: -458.049 where: short stacking energy: -418.133 Base-Backbone interact. energy: -2.037 local terms energy: -577.361594 where: bonds (distance) C4'-P energy: -135.794 bonds (distance) P-C4' energy: -142.861 flat angles C4'-P-C4' energy: -137.952 flat angles P-C4'-P energy: -83.439 tors. eta vs tors. theta energy: -77.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -966.609887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.609887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.609887 (E_RNA) where: Base-Base interactions energy: -410.788 where: short stacking energy: -404.191 Base-Backbone interact. energy: -0.803 local terms energy: -555.018304 where: bonds (distance) C4'-P energy: -131.821 bonds (distance) P-C4' energy: -144.259 flat angles C4'-P-C4' energy: -137.473 flat angles P-C4'-P energy: -75.720 tors. eta vs tors. theta energy: -65.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -922.768382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.768382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.768382 (E_RNA) where: Base-Base interactions energy: -372.719 where: short stacking energy: -371.784 Base-Backbone interact. energy: 0.204 local terms energy: -550.253580 where: bonds (distance) C4'-P energy: -135.650 bonds (distance) P-C4' energy: -145.331 flat angles C4'-P-C4' energy: -143.733 flat angles P-C4'-P energy: -53.239 tors. eta vs tors. theta energy: -72.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -818.382816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.382816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.382816 (E_RNA) where: Base-Base interactions energy: -323.896 where: short stacking energy: -310.046 Base-Backbone interact. energy: 5.917 local terms energy: -500.404058 where: bonds (distance) C4'-P energy: -123.334 bonds (distance) P-C4' energy: -134.948 flat angles C4'-P-C4' energy: -125.831 flat angles P-C4'-P energy: -64.437 tors. eta vs tors. theta energy: -51.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -749.382111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.382111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.382111 (E_RNA) where: Base-Base interactions energy: -301.883 where: short stacking energy: -277.060 Base-Backbone interact. energy: 9.243 local terms energy: -456.741940 where: bonds (distance) C4'-P energy: -126.197 bonds (distance) P-C4' energy: -125.184 flat angles C4'-P-C4' energy: -113.909 flat angles P-C4'-P energy: -69.621 tors. eta vs tors. theta energy: -21.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -702.275994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.275994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.275994 (E_RNA) where: Base-Base interactions energy: -253.645 where: short stacking energy: -222.594 Base-Backbone interact. energy: -0.688 local terms energy: -447.942293 where: bonds (distance) C4'-P energy: -116.802 bonds (distance) P-C4' energy: -121.054 flat angles C4'-P-C4' energy: -124.306 flat angles P-C4'-P energy: -70.381 tors. eta vs tors. theta energy: -15.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -727.566573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.566573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.566573 (E_RNA) where: Base-Base interactions energy: -303.184 where: short stacking energy: -238.271 Base-Backbone interact. energy: 0.631 local terms energy: -425.013776 where: bonds (distance) C4'-P energy: -131.151 bonds (distance) P-C4' energy: -117.805 flat angles C4'-P-C4' energy: -110.627 flat angles P-C4'-P energy: -55.187 tors. eta vs tors. theta energy: -10.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1382.643159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.643159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.643159 (E_RNA) where: Base-Base interactions energy: -670.296 where: short stacking energy: -639.155 Base-Backbone interact. energy: 0.054 local terms energy: -712.401513 where: bonds (distance) C4'-P energy: -153.763 bonds (distance) P-C4' energy: -146.067 flat angles C4'-P-C4' energy: -150.389 flat angles P-C4'-P energy: -109.051 tors. eta vs tors. theta energy: -153.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1303.593943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.593943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.593943 (E_RNA) where: Base-Base interactions energy: -574.907 where: short stacking energy: -570.206 Base-Backbone interact. energy: -0.399 local terms energy: -728.287572 where: bonds (distance) C4'-P energy: -153.750 bonds (distance) P-C4' energy: -152.368 flat angles C4'-P-C4' energy: -165.101 flat angles P-C4'-P energy: -109.936 tors. eta vs tors. theta energy: -147.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1153.744832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.744832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.744832 (E_RNA) where: Base-Base interactions energy: -488.942 where: short stacking energy: -474.453 Base-Backbone interact. energy: -1.246 local terms energy: -663.556793 where: bonds (distance) C4'-P energy: -149.271 bonds (distance) P-C4' energy: -160.749 flat angles C4'-P-C4' energy: -154.121 flat angles P-C4'-P energy: -86.103 tors. eta vs tors. theta energy: -113.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1094.379822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.379822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.379822 (E_RNA) where: Base-Base interactions energy: -519.033 where: short stacking energy: -405.234 Base-Backbone interact. energy: 1.097 local terms energy: -576.443408 where: bonds (distance) C4'-P energy: -133.307 bonds (distance) P-C4' energy: -141.816 flat angles C4'-P-C4' energy: -146.280 flat angles P-C4'-P energy: -86.661 tors. eta vs tors. theta energy: -68.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -966.175099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.175099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.175099 (E_RNA) where: Base-Base interactions energy: -432.916 where: short stacking energy: -386.784 Base-Backbone interact. energy: -1.853 local terms energy: -531.406110 where: bonds (distance) C4'-P energy: -115.226 bonds (distance) P-C4' energy: -144.582 flat angles C4'-P-C4' energy: -130.008 flat angles P-C4'-P energy: -84.488 tors. eta vs tors. theta energy: -57.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -986.222385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.222385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.222385 (E_RNA) where: Base-Base interactions energy: -441.869 where: short stacking energy: -370.805 Base-Backbone interact. energy: -0.813 local terms energy: -543.540531 where: bonds (distance) C4'-P energy: -131.889 bonds (distance) P-C4' energy: -149.514 flat angles C4'-P-C4' energy: -114.417 flat angles P-C4'-P energy: -81.187 tors. eta vs tors. theta energy: -66.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -815.179252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.179252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.179252 (E_RNA) where: Base-Base interactions energy: -316.077 where: short stacking energy: -289.786 Base-Backbone interact. energy: -3.050 local terms energy: -496.052462 where: bonds (distance) C4'-P energy: -124.887 bonds (distance) P-C4' energy: -137.375 flat angles C4'-P-C4' energy: -114.600 flat angles P-C4'-P energy: -88.985 tors. eta vs tors. theta energy: -30.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -734.170151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.170151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.170151 (E_RNA) where: Base-Base interactions energy: -293.308 where: short stacking energy: -272.992 Base-Backbone interact. energy: 2.272 local terms energy: -443.135093 where: bonds (distance) C4'-P energy: -133.121 bonds (distance) P-C4' energy: -144.269 flat angles C4'-P-C4' energy: -101.010 flat angles P-C4'-P energy: -58.739 tors. eta vs tors. theta energy: -5.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -789.593853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.593853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.593853 (E_RNA) where: Base-Base interactions energy: -352.957 where: short stacking energy: -279.773 Base-Backbone interact. energy: 0.856 local terms energy: -437.492503 where: bonds (distance) C4'-P energy: -103.392 bonds (distance) P-C4' energy: -117.636 flat angles C4'-P-C4' energy: -138.754 flat angles P-C4'-P energy: -66.127 tors. eta vs tors. theta energy: -11.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -689.742142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.742142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.742142 (E_RNA) where: Base-Base interactions energy: -329.678 where: short stacking energy: -216.052 Base-Backbone interact. energy: -0.466 local terms energy: -359.598227 where: bonds (distance) C4'-P energy: -125.596 bonds (distance) P-C4' energy: -119.213 flat angles C4'-P-C4' energy: -105.084 flat angles P-C4'-P energy: -40.649 tors. eta vs tors. theta energy: 30.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1376.015162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.015162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.015162 (E_RNA) where: Base-Base interactions energy: -645.382 where: short stacking energy: -622.771 Base-Backbone interact. energy: -0.699 local terms energy: -729.934592 where: bonds (distance) C4'-P energy: -150.526 bonds (distance) P-C4' energy: -159.580 flat angles C4'-P-C4' energy: -162.947 flat angles P-C4'-P energy: -105.269 tors. eta vs tors. theta energy: -151.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1322.134097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.134097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.134097 (E_RNA) where: Base-Base interactions energy: -602.144 where: short stacking energy: -584.091 Base-Backbone interact. energy: -1.437 local terms energy: -718.553806 where: bonds (distance) C4'-P energy: -143.445 bonds (distance) P-C4' energy: -165.190 flat angles C4'-P-C4' energy: -154.702 flat angles P-C4'-P energy: -99.063 tors. eta vs tors. theta energy: -156.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1152.209832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.209832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.209832 (E_RNA) where: Base-Base interactions energy: -496.060 where: short stacking energy: -470.500 Base-Backbone interact. energy: -1.353 local terms energy: -654.797384 where: bonds (distance) C4'-P energy: -145.988 bonds (distance) P-C4' energy: -153.023 flat angles C4'-P-C4' energy: -159.814 flat angles P-C4'-P energy: -89.381 tors. eta vs tors. theta energy: -106.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1249.801647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.801647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.801647 (E_RNA) where: Base-Base interactions energy: -659.194 where: short stacking energy: -406.817 Base-Backbone interact. energy: 0.406 local terms energy: -591.013156 where: bonds (distance) C4'-P energy: -129.408 bonds (distance) P-C4' energy: -137.891 flat angles C4'-P-C4' energy: -153.194 flat angles P-C4'-P energy: -93.235 tors. eta vs tors. theta energy: -77.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -989.108254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.108254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.108254 (E_RNA) where: Base-Base interactions energy: -416.905 where: short stacking energy: -415.036 Base-Backbone interact. energy: 1.322 local terms energy: -573.524571 where: bonds (distance) C4'-P energy: -144.617 bonds (distance) P-C4' energy: -142.666 flat angles C4'-P-C4' energy: -126.585 flat angles P-C4'-P energy: -88.293 tors. eta vs tors. theta energy: -71.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -943.693850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.693850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.693850 (E_RNA) where: Base-Base interactions energy: -412.572 where: short stacking energy: -324.445 Base-Backbone interact. energy: -2.137 local terms energy: -528.984399 where: bonds (distance) C4'-P energy: -130.574 bonds (distance) P-C4' energy: -154.921 flat angles C4'-P-C4' energy: -129.638 flat angles P-C4'-P energy: -79.181 tors. eta vs tors. theta energy: -34.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -837.617993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.617993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.617993 (E_RNA) where: Base-Base interactions energy: -371.400 where: short stacking energy: -324.991 Base-Backbone interact. energy: -1.598 local terms energy: -464.620730 where: bonds (distance) C4'-P energy: -140.953 bonds (distance) P-C4' energy: -131.374 flat angles C4'-P-C4' energy: -126.312 flat angles P-C4'-P energy: -48.754 tors. eta vs tors. theta energy: -17.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -826.951608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.951608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.951608 (E_RNA) where: Base-Base interactions energy: -395.809 where: short stacking energy: -285.705 Base-Backbone interact. energy: 2.053 local terms energy: -433.196351 where: bonds (distance) C4'-P energy: -101.162 bonds (distance) P-C4' energy: -134.964 flat angles C4'-P-C4' energy: -110.080 flat angles P-C4'-P energy: -83.930 tors. eta vs tors. theta energy: -3.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -791.684847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.684847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.684847 (E_RNA) where: Base-Base interactions energy: -345.117 where: short stacking energy: -267.729 Base-Backbone interact. energy: 0.274 local terms energy: -446.841827 where: bonds (distance) C4'-P energy: -119.484 bonds (distance) P-C4' energy: -123.554 flat angles C4'-P-C4' energy: -105.096 flat angles P-C4'-P energy: -73.725 tors. eta vs tors. theta energy: -24.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -774.982296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.982296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.982296 (E_RNA) where: Base-Base interactions energy: -374.985 where: short stacking energy: -249.520 Base-Backbone interact. energy: 1.097 local terms energy: -401.093660 where: bonds (distance) C4'-P energy: -111.226 bonds (distance) P-C4' energy: -115.562 flat angles C4'-P-C4' energy: -106.653 flat angles P-C4'-P energy: -71.993 tors. eta vs tors. theta energy: 4.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1501.801507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.801507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.801507 (E_RNA) where: Base-Base interactions energy: -731.484 where: short stacking energy: -634.395 Base-Backbone interact. energy: -2.015 local terms energy: -768.302323 where: bonds (distance) C4'-P energy: -160.453 bonds (distance) P-C4' energy: -159.260 flat angles C4'-P-C4' energy: -163.773 flat angles P-C4'-P energy: -122.474 tors. eta vs tors. theta energy: -162.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1305.503741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.503741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.503741 (E_RNA) where: Base-Base interactions energy: -635.233 where: short stacking energy: -570.598 Base-Backbone interact. energy: -1.257 local terms energy: -669.014139 where: bonds (distance) C4'-P energy: -150.189 bonds (distance) P-C4' energy: -151.793 flat angles C4'-P-C4' energy: -161.031 flat angles P-C4'-P energy: -85.650 tors. eta vs tors. theta energy: -120.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1517.929538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.929538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.929538 (E_RNA) where: Base-Base interactions energy: -850.879 where: short stacking energy: -537.981 Base-Backbone interact. energy: -4.326 local terms energy: -662.724520 where: bonds (distance) C4'-P energy: -154.716 bonds (distance) P-C4' energy: -137.626 flat angles C4'-P-C4' energy: -154.096 flat angles P-C4'-P energy: -88.102 tors. eta vs tors. theta energy: -128.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1165.445894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.445894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.445894 (E_RNA) where: Base-Base interactions energy: -525.595 where: short stacking energy: -488.841 Base-Backbone interact. energy: 1.051 local terms energy: -640.902396 where: bonds (distance) C4'-P energy: -148.608 bonds (distance) P-C4' energy: -137.768 flat angles C4'-P-C4' energy: -154.585 flat angles P-C4'-P energy: -86.395 tors. eta vs tors. theta energy: -113.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1044.234275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.234275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.234275 (E_RNA) where: Base-Base interactions energy: -519.222 where: short stacking energy: -396.903 Base-Backbone interact. energy: 2.851 local terms energy: -527.863773 where: bonds (distance) C4'-P energy: -133.768 bonds (distance) P-C4' energy: -122.519 flat angles C4'-P-C4' energy: -123.945 flat angles P-C4'-P energy: -83.792 tors. eta vs tors. theta energy: -63.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -985.730421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.730421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.730421 (E_RNA) where: Base-Base interactions energy: -481.779 where: short stacking energy: -310.772 Base-Backbone interact. energy: -0.655 local terms energy: -503.296110 where: bonds (distance) C4'-P energy: -111.115 bonds (distance) P-C4' energy: -144.121 flat angles C4'-P-C4' energy: -123.749 flat angles P-C4'-P energy: -86.259 tors. eta vs tors. theta energy: -38.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -809.070724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.070724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.070724 (E_RNA) where: Base-Base interactions energy: -328.692 where: short stacking energy: -312.774 Base-Backbone interact. energy: 2.788 local terms energy: -483.166711 where: bonds (distance) C4'-P energy: -120.441 bonds (distance) P-C4' energy: -132.861 flat angles C4'-P-C4' energy: -130.425 flat angles P-C4'-P energy: -75.640 tors. eta vs tors. theta energy: -23.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -875.871999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.871999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.871999 (E_RNA) where: Base-Base interactions energy: -413.200 where: short stacking energy: -300.038 Base-Backbone interact. energy: 3.588 local terms energy: -466.260821 where: bonds (distance) C4'-P energy: -116.732 bonds (distance) P-C4' energy: -136.389 flat angles C4'-P-C4' energy: -130.527 flat angles P-C4'-P energy: -75.010 tors. eta vs tors. theta energy: -7.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -837.211359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.211359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.211359 (E_RNA) where: Base-Base interactions energy: -407.401 where: short stacking energy: -288.279 Base-Backbone interact. energy: 0.729 local terms energy: -430.539405 where: bonds (distance) C4'-P energy: -120.149 bonds (distance) P-C4' energy: -116.053 flat angles C4'-P-C4' energy: -110.672 flat angles P-C4'-P energy: -72.793 tors. eta vs tors. theta energy: -10.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -763.309764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.309764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.309764 (E_RNA) where: Base-Base interactions energy: -366.241 where: short stacking energy: -231.514 Base-Backbone interact. energy: -0.276 local terms energy: -396.792076 where: bonds (distance) C4'-P energy: -104.360 bonds (distance) P-C4' energy: -122.637 flat angles C4'-P-C4' energy: -116.214 flat angles P-C4'-P energy: -56.199 tors. eta vs tors. theta energy: 2.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1451.439358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.439358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.439358 (E_RNA) where: Base-Base interactions energy: -715.221 where: short stacking energy: -606.594 Base-Backbone interact. energy: -1.159 local terms energy: -735.059085 where: bonds (distance) C4'-P energy: -154.740 bonds (distance) P-C4' energy: -155.358 flat angles C4'-P-C4' energy: -162.638 flat angles P-C4'-P energy: -112.580 tors. eta vs tors. theta energy: -149.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1673.942059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.942059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.942059 (E_RNA) where: Base-Base interactions energy: -978.335 where: short stacking energy: -608.213 Base-Backbone interact. energy: -2.722 local terms energy: -692.885358 where: bonds (distance) C4'-P energy: -133.263 bonds (distance) P-C4' energy: -151.797 flat angles C4'-P-C4' energy: -165.911 flat angles P-C4'-P energy: -92.361 tors. eta vs tors. theta energy: -149.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1264.856203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.856203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.856203 (E_RNA) where: Base-Base interactions energy: -616.644 where: short stacking energy: -554.676 Base-Backbone interact. energy: 0.960 local terms energy: -649.171493 where: bonds (distance) C4'-P energy: -145.144 bonds (distance) P-C4' energy: -139.653 flat angles C4'-P-C4' energy: -161.816 flat angles P-C4'-P energy: -87.060 tors. eta vs tors. theta energy: -115.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1140.991253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.991253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.991253 (E_RNA) where: Base-Base interactions energy: -540.591 where: short stacking energy: -461.224 Base-Backbone interact. energy: -2.467 local terms energy: -597.933196 where: bonds (distance) C4'-P energy: -149.180 bonds (distance) P-C4' energy: -146.087 flat angles C4'-P-C4' energy: -139.969 flat angles P-C4'-P energy: -81.175 tors. eta vs tors. theta energy: -81.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1086.990188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.990188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.990188 (E_RNA) where: Base-Base interactions energy: -547.070 where: short stacking energy: -382.097 Base-Backbone interact. energy: -1.095 local terms energy: -538.825564 where: bonds (distance) C4'-P energy: -139.359 bonds (distance) P-C4' energy: -147.312 flat angles C4'-P-C4' energy: -139.055 flat angles P-C4'-P energy: -69.846 tors. eta vs tors. theta energy: -43.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -966.891768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.891768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.891768 (E_RNA) where: Base-Base interactions energy: -452.992 where: short stacking energy: -363.391 Base-Backbone interact. energy: -3.215 local terms energy: -510.684703 where: bonds (distance) C4'-P energy: -128.917 bonds (distance) P-C4' energy: -129.446 flat angles C4'-P-C4' energy: -133.567 flat angles P-C4'-P energy: -77.118 tors. eta vs tors. theta energy: -41.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -845.479456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.479456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.479456 (E_RNA) where: Base-Base interactions energy: -358.350 where: short stacking energy: -286.386 Base-Backbone interact. energy: -0.593 local terms energy: -486.536697 where: bonds (distance) C4'-P energy: -132.082 bonds (distance) P-C4' energy: -127.478 flat angles C4'-P-C4' energy: -117.814 flat angles P-C4'-P energy: -79.530 tors. eta vs tors. theta energy: -29.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -953.823241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.823241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.823241 (E_RNA) where: Base-Base interactions energy: -502.104 where: short stacking energy: -355.993 Base-Backbone interact. energy: -3.969 local terms energy: -447.750604 where: bonds (distance) C4'-P energy: -125.350 bonds (distance) P-C4' energy: -120.759 flat angles C4'-P-C4' energy: -99.919 flat angles P-C4'-P energy: -71.477 tors. eta vs tors. theta energy: -30.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -794.005099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.005099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.005099 (E_RNA) where: Base-Base interactions energy: -372.635 where: short stacking energy: -248.160 Base-Backbone interact. energy: 6.671 local terms energy: -428.041350 where: bonds (distance) C4'-P energy: -123.866 bonds (distance) P-C4' energy: -129.908 flat angles C4'-P-C4' energy: -99.984 flat angles P-C4'-P energy: -76.161 tors. eta vs tors. theta energy: 1.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -787.052461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.052461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.052461 (E_RNA) where: Base-Base interactions energy: -389.055 where: short stacking energy: -256.646 Base-Backbone interact. energy: 5.637 local terms energy: -403.634821 where: bonds (distance) C4'-P energy: -134.788 bonds (distance) P-C4' energy: -140.437 flat angles C4'-P-C4' energy: -90.633 flat angles P-C4'-P energy: -35.981 tors. eta vs tors. theta energy: -1.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1806.658590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.658590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.658590 (E_RNA) where: Base-Base interactions energy: -1073.814 where: short stacking energy: -669.381 Base-Backbone interact. energy: -4.854 local terms energy: -727.990597 where: bonds (distance) C4'-P energy: -163.505 bonds (distance) P-C4' energy: -147.642 flat angles C4'-P-C4' energy: -161.158 flat angles P-C4'-P energy: -93.879 tors. eta vs tors. theta energy: -161.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1390.885114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.885114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.885114 (E_RNA) where: Base-Base interactions energy: -699.740 where: short stacking energy: -576.794 Base-Backbone interact. energy: -0.197 local terms energy: -690.948098 where: bonds (distance) C4'-P energy: -149.514 bonds (distance) P-C4' energy: -150.204 flat angles C4'-P-C4' energy: -148.557 flat angles P-C4'-P energy: -104.587 tors. eta vs tors. theta energy: -138.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1340.218338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.218338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.218338 (E_RNA) where: Base-Base interactions energy: -700.621 where: short stacking energy: -529.528 Base-Backbone interact. energy: -3.270 local terms energy: -636.327154 where: bonds (distance) C4'-P energy: -129.212 bonds (distance) P-C4' energy: -157.380 flat angles C4'-P-C4' energy: -140.219 flat angles P-C4'-P energy: -95.379 tors. eta vs tors. theta energy: -114.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1165.708556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.708556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.708556 (E_RNA) where: Base-Base interactions energy: -569.405 where: short stacking energy: -492.224 Base-Backbone interact. energy: 4.320 local terms energy: -600.623518 where: bonds (distance) C4'-P energy: -122.306 bonds (distance) P-C4' energy: -157.173 flat angles C4'-P-C4' energy: -137.371 flat angles P-C4'-P energy: -87.888 tors. eta vs tors. theta energy: -95.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1214.685453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.685453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.685453 (E_RNA) where: Base-Base interactions energy: -657.307 where: short stacking energy: -486.857 Base-Backbone interact. energy: 7.312 local terms energy: -564.690264 where: bonds (distance) C4'-P energy: -111.305 bonds (distance) P-C4' energy: -154.704 flat angles C4'-P-C4' energy: -132.449 flat angles P-C4'-P energy: -75.147 tors. eta vs tors. theta energy: -91.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1001.661710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.661710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.661710 (E_RNA) where: Base-Base interactions energy: -479.518 where: short stacking energy: -346.990 Base-Backbone interact. energy: 0.611 local terms energy: -522.754011 where: bonds (distance) C4'-P energy: -127.150 bonds (distance) P-C4' energy: -139.504 flat angles C4'-P-C4' energy: -128.768 flat angles P-C4'-P energy: -77.864 tors. eta vs tors. theta energy: -49.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -999.538275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.538275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.538275 (E_RNA) where: Base-Base interactions energy: -484.309 where: short stacking energy: -375.008 Base-Backbone interact. energy: 4.026 local terms energy: -519.254787 where: bonds (distance) C4'-P energy: -128.327 bonds (distance) P-C4' energy: -136.121 flat angles C4'-P-C4' energy: -113.679 flat angles P-C4'-P energy: -80.368 tors. eta vs tors. theta energy: -60.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -882.533196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.533196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.533196 (E_RNA) where: Base-Base interactions energy: -430.655 where: short stacking energy: -276.089 Base-Backbone interact. energy: 1.255 local terms energy: -453.133145 where: bonds (distance) C4'-P energy: -130.853 bonds (distance) P-C4' energy: -120.436 flat angles C4'-P-C4' energy: -95.930 flat angles P-C4'-P energy: -75.302 tors. eta vs tors. theta energy: -30.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -829.829179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.829179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.829179 (E_RNA) where: Base-Base interactions energy: -396.653 where: short stacking energy: -245.712 Base-Backbone interact. energy: -0.226 local terms energy: -432.949745 where: bonds (distance) C4'-P energy: -119.568 bonds (distance) P-C4' energy: -144.049 flat angles C4'-P-C4' energy: -116.932 flat angles P-C4'-P energy: -56.280 tors. eta vs tors. theta energy: 3.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -745.048414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.048414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.048414 (E_RNA) where: Base-Base interactions energy: -360.129 where: short stacking energy: -261.232 Base-Backbone interact. energy: 2.352 local terms energy: -387.272117 where: bonds (distance) C4'-P energy: -124.468 bonds (distance) P-C4' energy: -112.084 flat angles C4'-P-C4' energy: -106.559 flat angles P-C4'-P energy: -53.008 tors. eta vs tors. theta energy: 8.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1806.525101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.525101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.525101 (E_RNA) where: Base-Base interactions energy: -1066.712 where: short stacking energy: -658.229 Base-Backbone interact. energy: -4.209 local terms energy: -735.604535 where: bonds (distance) C4'-P energy: -149.629 bonds (distance) P-C4' energy: -159.213 flat angles C4'-P-C4' energy: -159.973 flat angles P-C4'-P energy: -104.953 tors. eta vs tors. theta energy: -161.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1457.836914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.836914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.836914 (E_RNA) where: Base-Base interactions energy: -751.020 where: short stacking energy: -606.704 Base-Backbone interact. energy: -1.289 local terms energy: -705.528401 where: bonds (distance) C4'-P energy: -157.571 bonds (distance) P-C4' energy: -141.681 flat angles C4'-P-C4' energy: -155.931 flat angles P-C4'-P energy: -108.067 tors. eta vs tors. theta energy: -142.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1384.060686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.060686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.060686 (E_RNA) where: Base-Base interactions energy: -729.851 where: short stacking energy: -535.321 Base-Backbone interact. energy: -2.750 local terms energy: -651.459689 where: bonds (distance) C4'-P energy: -134.418 bonds (distance) P-C4' energy: -156.101 flat angles C4'-P-C4' energy: -153.973 flat angles P-C4'-P energy: -94.363 tors. eta vs tors. theta energy: -112.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1267.334719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.334719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.334719 (E_RNA) where: Base-Base interactions energy: -684.535 where: short stacking energy: -452.561 Base-Backbone interact. energy: -2.376 local terms energy: -580.423787 where: bonds (distance) C4'-P energy: -136.227 bonds (distance) P-C4' energy: -122.661 flat angles C4'-P-C4' energy: -139.938 flat angles P-C4'-P energy: -102.938 tors. eta vs tors. theta energy: -78.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1074.706858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.706858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.706858 (E_RNA) where: Base-Base interactions energy: -455.758 where: short stacking energy: -387.019 Base-Backbone interact. energy: -1.885 local terms energy: -617.063807 where: bonds (distance) C4'-P energy: -143.051 bonds (distance) P-C4' energy: -149.835 flat angles C4'-P-C4' energy: -152.925 flat angles P-C4'-P energy: -98.856 tors. eta vs tors. theta energy: -72.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1041.623491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.623491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.623491 (E_RNA) where: Base-Base interactions energy: -526.082 where: short stacking energy: -364.008 Base-Backbone interact. energy: -1.469 local terms energy: -514.072648 where: bonds (distance) C4'-P energy: -124.698 bonds (distance) P-C4' energy: -137.869 flat angles C4'-P-C4' energy: -122.582 flat angles P-C4'-P energy: -80.963 tors. eta vs tors. theta energy: -47.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1125.972549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.972549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.972549 (E_RNA) where: Base-Base interactions energy: -602.247 where: short stacking energy: -371.689 Base-Backbone interact. energy: 4.238 local terms energy: -527.964482 where: bonds (distance) C4'-P energy: -142.728 bonds (distance) P-C4' energy: -124.341 flat angles C4'-P-C4' energy: -113.326 flat angles P-C4'-P energy: -88.476 tors. eta vs tors. theta energy: -59.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -924.968586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.968586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.968586 (E_RNA) where: Base-Base interactions energy: -445.125 where: short stacking energy: -288.823 Base-Backbone interact. energy: 3.792 local terms energy: -483.635092 where: bonds (distance) C4'-P energy: -137.101 bonds (distance) P-C4' energy: -133.811 flat angles C4'-P-C4' energy: -126.772 flat angles P-C4'-P energy: -67.648 tors. eta vs tors. theta energy: -18.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -929.065673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.065673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.065673 (E_RNA) where: Base-Base interactions energy: -452.141 where: short stacking energy: -305.070 Base-Backbone interact. energy: 1.469 local terms energy: -478.393594 where: bonds (distance) C4'-P energy: -101.721 bonds (distance) P-C4' energy: -138.469 flat angles C4'-P-C4' energy: -130.662 flat angles P-C4'-P energy: -77.592 tors. eta vs tors. theta energy: -29.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -735.587391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.587391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.587391 (E_RNA) where: Base-Base interactions energy: -341.994 where: short stacking energy: -213.940 Base-Backbone interact. energy: 8.581 local terms energy: -402.173968 where: bonds (distance) C4'-P energy: -129.121 bonds (distance) P-C4' energy: -115.701 flat angles C4'-P-C4' energy: -104.839 flat angles P-C4'-P energy: -59.800 tors. eta vs tors. theta energy: 7.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1856.769401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1856.769401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1856.769401 (E_RNA) where: Base-Base interactions energy: -1133.643 where: short stacking energy: -685.778 Base-Backbone interact. energy: -1.772 local terms energy: -721.354099 where: bonds (distance) C4'-P energy: -153.382 bonds (distance) P-C4' energy: -150.754 flat angles C4'-P-C4' energy: -150.241 flat angles P-C4'-P energy: -94.669 tors. eta vs tors. theta energy: -172.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1473.436799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.436799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.436799 (E_RNA) where: Base-Base interactions energy: -780.065 where: short stacking energy: -602.891 Base-Backbone interact. energy: -1.412 local terms energy: -691.959491 where: bonds (distance) C4'-P energy: -155.316 bonds (distance) P-C4' energy: -145.337 flat angles C4'-P-C4' energy: -153.271 flat angles P-C4'-P energy: -94.922 tors. eta vs tors. theta energy: -143.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1484.283900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.283900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.283900 (E_RNA) where: Base-Base interactions energy: -832.049 where: short stacking energy: -525.816 Base-Backbone interact. energy: -5.029 local terms energy: -647.206230 where: bonds (distance) C4'-P energy: -144.458 bonds (distance) P-C4' energy: -136.945 flat angles C4'-P-C4' energy: -155.080 flat angles P-C4'-P energy: -94.673 tors. eta vs tors. theta energy: -116.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1442.252164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.252164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.252164 (E_RNA) where: Base-Base interactions energy: -855.089 where: short stacking energy: -491.941 Base-Backbone interact. energy: 1.556 local terms energy: -588.719385 where: bonds (distance) C4'-P energy: -129.473 bonds (distance) P-C4' energy: -126.318 flat angles C4'-P-C4' energy: -141.683 flat angles P-C4'-P energy: -101.361 tors. eta vs tors. theta energy: -89.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1091.101864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.101864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.101864 (E_RNA) where: Base-Base interactions energy: -546.744 where: short stacking energy: -442.993 Base-Backbone interact. energy: 4.127 local terms energy: -548.484825 where: bonds (distance) C4'-P energy: -122.800 bonds (distance) P-C4' energy: -134.650 flat angles C4'-P-C4' energy: -126.557 flat angles P-C4'-P energy: -82.962 tors. eta vs tors. theta energy: -81.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1117.191199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.191199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.191199 (E_RNA) where: Base-Base interactions energy: -570.704 where: short stacking energy: -366.068 Base-Backbone interact. energy: -0.803 local terms energy: -545.683878 where: bonds (distance) C4'-P energy: -138.095 bonds (distance) P-C4' energy: -137.507 flat angles C4'-P-C4' energy: -127.564 flat angles P-C4'-P energy: -84.552 tors. eta vs tors. theta energy: -57.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1148.118518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.118518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.118518 (E_RNA) where: Base-Base interactions energy: -637.970 where: short stacking energy: -398.880 Base-Backbone interact. energy: -1.816 local terms energy: -508.332805 where: bonds (distance) C4'-P energy: -137.208 bonds (distance) P-C4' energy: -135.615 flat angles C4'-P-C4' energy: -128.583 flat angles P-C4'-P energy: -61.872 tors. eta vs tors. theta energy: -45.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -927.334993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.334993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.334993 (E_RNA) where: Base-Base interactions energy: -463.928 where: short stacking energy: -298.984 Base-Backbone interact. energy: -3.020 local terms energy: -460.386784 where: bonds (distance) C4'-P energy: -124.109 bonds (distance) P-C4' energy: -128.935 flat angles C4'-P-C4' energy: -109.224 flat angles P-C4'-P energy: -60.823 tors. eta vs tors. theta energy: -37.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -980.234307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.234307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.234307 (E_RNA) where: Base-Base interactions energy: -481.824 where: short stacking energy: -293.226 Base-Backbone interact. energy: -0.734 local terms energy: -497.676544 where: bonds (distance) C4'-P energy: -123.480 bonds (distance) P-C4' energy: -117.441 flat angles C4'-P-C4' energy: -135.530 flat angles P-C4'-P energy: -93.231 tors. eta vs tors. theta energy: -27.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -750.503210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.503210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.503210 (E_RNA) where: Base-Base interactions energy: -369.434 where: short stacking energy: -249.310 Base-Backbone interact. energy: 1.998 local terms energy: -383.067338 where: bonds (distance) C4'-P energy: -110.893 bonds (distance) P-C4' energy: -112.305 flat angles C4'-P-C4' energy: -102.009 flat angles P-C4'-P energy: -43.152 tors. eta vs tors. theta energy: -14.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1957.954860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1957.954860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.954860 (E_RNA) where: Base-Base interactions energy: -1202.473 where: short stacking energy: -690.834 Base-Backbone interact. energy: -6.313 local terms energy: -749.169581 where: bonds (distance) C4'-P energy: -148.941 bonds (distance) P-C4' energy: -156.295 flat angles C4'-P-C4' energy: -162.412 flat angles P-C4'-P energy: -105.819 tors. eta vs tors. theta energy: -175.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1546.574261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.574261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.574261 (E_RNA) where: Base-Base interactions energy: -889.608 where: short stacking energy: -559.730 Base-Backbone interact. energy: -1.852 local terms energy: -655.114282 where: bonds (distance) C4'-P energy: -147.139 bonds (distance) P-C4' energy: -153.886 flat angles C4'-P-C4' energy: -147.197 flat angles P-C4'-P energy: -92.371 tors. eta vs tors. theta energy: -114.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1442.914480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.914480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.914480 (E_RNA) where: Base-Base interactions energy: -798.512 where: short stacking energy: -568.020 Base-Backbone interact. energy: -1.045 local terms energy: -643.357095 where: bonds (distance) C4'-P energy: -131.985 bonds (distance) P-C4' energy: -159.364 flat angles C4'-P-C4' energy: -137.159 flat angles P-C4'-P energy: -96.260 tors. eta vs tors. theta energy: -118.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1506.017867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.017867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.017867 (E_RNA) where: Base-Base interactions energy: -908.499 where: short stacking energy: -541.853 Base-Backbone interact. energy: -2.066 local terms energy: -595.452926 where: bonds (distance) C4'-P energy: -113.881 bonds (distance) P-C4' energy: -143.316 flat angles C4'-P-C4' energy: -130.688 flat angles P-C4'-P energy: -89.570 tors. eta vs tors. theta energy: -117.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1132.842956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.842956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.842956 (E_RNA) where: Base-Base interactions energy: -533.243 where: short stacking energy: -426.998 Base-Backbone interact. energy: -0.863 local terms energy: -598.737697 where: bonds (distance) C4'-P energy: -137.661 bonds (distance) P-C4' energy: -138.687 flat angles C4'-P-C4' energy: -141.287 flat angles P-C4'-P energy: -103.629 tors. eta vs tors. theta energy: -77.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1205.323052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.323052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1205.323052 (E_RNA) where: Base-Base interactions energy: -642.374 where: short stacking energy: -429.722 Base-Backbone interact. energy: 0.868 local terms energy: -563.817619 where: bonds (distance) C4'-P energy: -123.180 bonds (distance) P-C4' energy: -152.674 flat angles C4'-P-C4' energy: -142.777 flat angles P-C4'-P energy: -66.538 tors. eta vs tors. theta energy: -78.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1054.143451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.143451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.143451 (E_RNA) where: Base-Base interactions energy: -574.303 where: short stacking energy: -376.305 Base-Backbone interact. energy: 0.179 local terms energy: -480.019962 where: bonds (distance) C4'-P energy: -118.992 bonds (distance) P-C4' energy: -121.503 flat angles C4'-P-C4' energy: -125.481 flat angles P-C4'-P energy: -68.933 tors. eta vs tors. theta energy: -45.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1064.501132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.501132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.501132 (E_RNA) where: Base-Base interactions energy: -617.743 where: short stacking energy: -331.000 Base-Backbone interact. energy: 2.450 local terms energy: -449.208155 where: bonds (distance) C4'-P energy: -109.815 bonds (distance) P-C4' energy: -135.055 flat angles C4'-P-C4' energy: -105.372 flat angles P-C4'-P energy: -70.141 tors. eta vs tors. theta energy: -28.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1039.911980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.911980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.911980 (E_RNA) where: Base-Base interactions energy: -597.671 where: short stacking energy: -316.152 Base-Backbone interact. energy: -2.523 local terms energy: -439.717809 where: bonds (distance) C4'-P energy: -100.226 bonds (distance) P-C4' energy: -113.384 flat angles C4'-P-C4' energy: -121.908 flat angles P-C4'-P energy: -71.099 tors. eta vs tors. theta energy: -33.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -809.701373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.701373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.701373 (E_RNA) where: Base-Base interactions energy: -410.622 where: short stacking energy: -246.332 Base-Backbone interact. energy: -4.577 local terms energy: -394.501602 where: bonds (distance) C4'-P energy: -116.079 bonds (distance) P-C4' energy: -117.523 flat angles C4'-P-C4' energy: -110.910 flat angles P-C4'-P energy: -63.515 tors. eta vs tors. theta energy: 13.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -2010.129597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2010.129597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2010.129597 (E_RNA) where: Base-Base interactions energy: -1236.430 where: short stacking energy: -712.923 Base-Backbone interact. energy: 0.880 local terms energy: -774.579507 where: bonds (distance) C4'-P energy: -150.743 bonds (distance) P-C4' energy: -170.033 flat angles C4'-P-C4' energy: -159.145 flat angles P-C4'-P energy: -113.812 tors. eta vs tors. theta energy: -180.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1544.776306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.776306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.776306 (E_RNA) where: Base-Base interactions energy: -875.664 where: short stacking energy: -554.388 Base-Backbone interact. energy: -3.046 local terms energy: -666.066556 where: bonds (distance) C4'-P energy: -145.351 bonds (distance) P-C4' energy: -150.439 flat angles C4'-P-C4' energy: -164.430 flat angles P-C4'-P energy: -93.131 tors. eta vs tors. theta energy: -112.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1644.271643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.271643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.271643 (E_RNA) where: Base-Base interactions energy: -993.528 where: short stacking energy: -555.658 Base-Backbone interact. energy: -3.611 local terms energy: -647.132621 where: bonds (distance) C4'-P energy: -135.627 bonds (distance) P-C4' energy: -147.037 flat angles C4'-P-C4' energy: -144.384 flat angles P-C4'-P energy: -90.027 tors. eta vs tors. theta energy: -130.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1338.471127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.471127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.471127 (E_RNA) where: Base-Base interactions energy: -755.926 where: short stacking energy: -501.563 Base-Backbone interact. energy: 1.794 local terms energy: -584.338622 where: bonds (distance) C4'-P energy: -139.965 bonds (distance) P-C4' energy: -127.522 flat angles C4'-P-C4' energy: -144.835 flat angles P-C4'-P energy: -78.666 tors. eta vs tors. theta energy: -93.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1288.992505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.992505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.992505 (E_RNA) where: Base-Base interactions energy: -666.238 where: short stacking energy: -436.613 Base-Backbone interact. energy: 1.578 local terms energy: -624.333210 where: bonds (distance) C4'-P energy: -131.655 bonds (distance) P-C4' energy: -153.826 flat angles C4'-P-C4' energy: -161.656 flat angles P-C4'-P energy: -96.150 tors. eta vs tors. theta energy: -81.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1030.994254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.994254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.994254 (E_RNA) where: Base-Base interactions energy: -507.735 where: short stacking energy: -358.585 Base-Backbone interact. energy: 0.648 local terms energy: -523.906792 where: bonds (distance) C4'-P energy: -124.464 bonds (distance) P-C4' energy: -139.258 flat angles C4'-P-C4' energy: -138.398 flat angles P-C4'-P energy: -61.194 tors. eta vs tors. theta energy: -60.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1156.518732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.518732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.518732 (E_RNA) where: Base-Base interactions energy: -655.849 where: short stacking energy: -354.028 Base-Backbone interact. energy: -1.511 local terms energy: -499.159254 where: bonds (distance) C4'-P energy: -124.601 bonds (distance) P-C4' energy: -128.303 flat angles C4'-P-C4' energy: -128.751 flat angles P-C4'-P energy: -69.706 tors. eta vs tors. theta energy: -47.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1018.274576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.274576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.274576 (E_RNA) where: Base-Base interactions energy: -569.737 where: short stacking energy: -349.290 Base-Backbone interact. energy: 5.404 local terms energy: -453.941404 where: bonds (distance) C4'-P energy: -100.958 bonds (distance) P-C4' energy: -149.711 flat angles C4'-P-C4' energy: -101.618 flat angles P-C4'-P energy: -52.874 tors. eta vs tors. theta energy: -48.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1060.897446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.897446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.897446 (E_RNA) where: Base-Base interactions energy: -582.304 where: short stacking energy: -345.610 Base-Backbone interact. energy: -1.760 local terms energy: -476.833712 where: bonds (distance) C4'-P energy: -124.411 bonds (distance) P-C4' energy: -127.377 flat angles C4'-P-C4' energy: -93.409 flat angles P-C4'-P energy: -83.084 tors. eta vs tors. theta energy: -48.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -803.405331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.405331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.405331 (E_RNA) where: Base-Base interactions energy: -397.166 where: short stacking energy: -234.978 Base-Backbone interact. energy: 4.044 local terms energy: -410.283804 where: bonds (distance) C4'-P energy: -109.513 bonds (distance) P-C4' energy: -127.461 flat angles C4'-P-C4' energy: -97.704 flat angles P-C4'-P energy: -78.587 tors. eta vs tors. theta energy: 2.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -2041.773934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.773934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2041.773934 (E_RNA) where: Base-Base interactions energy: -1275.792 where: short stacking energy: -701.392 Base-Backbone interact. energy: -3.072 local terms energy: -762.909972 where: bonds (distance) C4'-P energy: -137.846 bonds (distance) P-C4' energy: -163.637 flat angles C4'-P-C4' energy: -166.789 flat angles P-C4'-P energy: -107.731 tors. eta vs tors. theta energy: -186.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1838.295040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1838.295040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.295040 (E_RNA) where: Base-Base interactions energy: -1138.956 where: short stacking energy: -605.389 Base-Backbone interact. energy: -0.845 local terms energy: -698.493321 where: bonds (distance) C4'-P energy: -149.804 bonds (distance) P-C4' energy: -151.737 flat angles C4'-P-C4' energy: -158.023 flat angles P-C4'-P energy: -103.150 tors. eta vs tors. theta energy: -135.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1501.931743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.931743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.931743 (E_RNA) where: Base-Base interactions energy: -846.290 where: short stacking energy: -553.577 Base-Backbone interact. energy: 0.618 local terms energy: -656.260036 where: bonds (distance) C4'-P energy: -141.240 bonds (distance) P-C4' energy: -155.026 flat angles C4'-P-C4' energy: -148.374 flat angles P-C4'-P energy: -97.331 tors. eta vs tors. theta energy: -114.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1484.125586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.125586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.125586 (E_RNA) where: Base-Base interactions energy: -839.976 where: short stacking energy: -528.839 Base-Backbone interact. energy: -0.993 local terms energy: -643.156918 where: bonds (distance) C4'-P energy: -155.744 bonds (distance) P-C4' energy: -157.890 flat angles C4'-P-C4' energy: -130.481 flat angles P-C4'-P energy: -85.703 tors. eta vs tors. theta energy: -113.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1262.314444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.314444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.314444 (E_RNA) where: Base-Base interactions energy: -666.572 where: short stacking energy: -447.937 Base-Backbone interact. energy: -0.056 local terms energy: -595.686984 where: bonds (distance) C4'-P energy: -150.111 bonds (distance) P-C4' energy: -127.290 flat angles C4'-P-C4' energy: -148.705 flat angles P-C4'-P energy: -80.310 tors. eta vs tors. theta energy: -89.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1360.287610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.287610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.287610 (E_RNA) where: Base-Base interactions energy: -861.596 where: short stacking energy: -407.644 Base-Backbone interact. energy: 3.492 local terms energy: -502.183733 where: bonds (distance) C4'-P energy: -121.612 bonds (distance) P-C4' energy: -137.909 flat angles C4'-P-C4' energy: -133.532 flat angles P-C4'-P energy: -70.296 tors. eta vs tors. theta energy: -38.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -972.560374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.560374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.560374 (E_RNA) where: Base-Base interactions energy: -490.586 where: short stacking energy: -344.050 Base-Backbone interact. energy: 2.859 local terms energy: -484.833197 where: bonds (distance) C4'-P energy: -112.281 bonds (distance) P-C4' energy: -124.431 flat angles C4'-P-C4' energy: -140.819 flat angles P-C4'-P energy: -70.430 tors. eta vs tors. theta energy: -36.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1125.292521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.292521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.292521 (E_RNA) where: Base-Base interactions energy: -635.644 where: short stacking energy: -311.641 Base-Backbone interact. energy: -0.407 local terms energy: -489.241481 where: bonds (distance) C4'-P energy: -132.632 bonds (distance) P-C4' energy: -119.590 flat angles C4'-P-C4' energy: -137.823 flat angles P-C4'-P energy: -63.649 tors. eta vs tors. theta energy: -35.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -994.741645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.741645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.741645 (E_RNA) where: Base-Base interactions energy: -544.048 where: short stacking energy: -306.597 Base-Backbone interact. energy: 11.580 local terms energy: -462.273168 where: bonds (distance) C4'-P energy: -117.908 bonds (distance) P-C4' energy: -135.733 flat angles C4'-P-C4' energy: -105.856 flat angles P-C4'-P energy: -81.984 tors. eta vs tors. theta energy: -20.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -764.225062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.225062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.225062 (E_RNA) where: Base-Base interactions energy: -348.736 where: short stacking energy: -219.946 Base-Backbone interact. energy: 7.340 local terms energy: -422.829457 where: bonds (distance) C4'-P energy: -133.144 bonds (distance) P-C4' energy: -137.282 flat angles C4'-P-C4' energy: -110.054 flat angles P-C4'-P energy: -61.211 tors. eta vs tors. theta energy: 18.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -2043.203801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2043.203801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2043.203801 (E_RNA) where: Base-Base interactions energy: -1254.868 where: short stacking energy: -708.732 Base-Backbone interact. energy: -4.198 local terms energy: -784.137931 where: bonds (distance) C4'-P energy: -156.834 bonds (distance) P-C4' energy: -171.068 flat angles C4'-P-C4' energy: -172.313 flat angles P-C4'-P energy: -106.192 tors. eta vs tors. theta energy: -177.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1886.985473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.985473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.985473 (E_RNA) where: Base-Base interactions energy: -1180.541 where: short stacking energy: -628.983 Base-Backbone interact. energy: -3.189 local terms energy: -703.255699 where: bonds (distance) C4'-P energy: -147.550 bonds (distance) P-C4' energy: -162.059 flat angles C4'-P-C4' energy: -162.318 flat angles P-C4'-P energy: -92.221 tors. eta vs tors. theta energy: -139.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1685.305551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.305551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.305551 (E_RNA) where: Base-Base interactions energy: -1000.066 where: short stacking energy: -637.892 Base-Backbone interact. energy: 0.525 local terms energy: -685.764589 where: bonds (distance) C4'-P energy: -136.262 bonds (distance) P-C4' energy: -139.014 flat angles C4'-P-C4' energy: -153.896 flat angles P-C4'-P energy: -97.927 tors. eta vs tors. theta energy: -158.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1416.317603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.317603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.317603 (E_RNA) where: Base-Base interactions energy: -775.150 where: short stacking energy: -490.742 Base-Backbone interact. energy: -1.408 local terms energy: -639.760409 where: bonds (distance) C4'-P energy: -137.778 bonds (distance) P-C4' energy: -153.133 flat angles C4'-P-C4' energy: -142.711 flat angles P-C4'-P energy: -105.365 tors. eta vs tors. theta energy: -100.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1511.916364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.916364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.916364 (E_RNA) where: Base-Base interactions energy: -943.858 where: short stacking energy: -467.030 Base-Backbone interact. energy: -2.999 local terms energy: -565.058851 where: bonds (distance) C4'-P energy: -128.648 bonds (distance) P-C4' energy: -131.712 flat angles C4'-P-C4' energy: -152.087 flat angles P-C4'-P energy: -78.969 tors. eta vs tors. theta energy: -73.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1160.048254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.048254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.048254 (E_RNA) where: Base-Base interactions energy: -627.420 where: short stacking energy: -387.633 Base-Backbone interact. energy: -3.334 local terms energy: -529.293971 where: bonds (distance) C4'-P energy: -128.258 bonds (distance) P-C4' energy: -147.671 flat angles C4'-P-C4' energy: -123.821 flat angles P-C4'-P energy: -80.551 tors. eta vs tors. theta energy: -48.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1230.031552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.031552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.031552 (E_RNA) where: Base-Base interactions energy: -711.784 where: short stacking energy: -391.890 Base-Backbone interact. energy: -3.127 local terms energy: -515.120103 where: bonds (distance) C4'-P energy: -134.062 bonds (distance) P-C4' energy: -122.569 flat angles C4'-P-C4' energy: -127.709 flat angles P-C4'-P energy: -78.075 tors. eta vs tors. theta energy: -52.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -925.936686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.936686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.936686 (E_RNA) where: Base-Base interactions energy: -486.928 where: short stacking energy: -286.736 Base-Backbone interact. energy: -3.727 local terms energy: -435.281552 where: bonds (distance) C4'-P energy: -95.578 bonds (distance) P-C4' energy: -143.459 flat angles C4'-P-C4' energy: -109.424 flat angles P-C4'-P energy: -74.529 tors. eta vs tors. theta energy: -12.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1020.373873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.373873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.373873 (E_RNA) where: Base-Base interactions energy: -549.559 where: short stacking energy: -329.065 Base-Backbone interact. energy: 6.139 local terms energy: -476.953940 where: bonds (distance) C4'-P energy: -121.683 bonds (distance) P-C4' energy: -134.972 flat angles C4'-P-C4' energy: -125.214 flat angles P-C4'-P energy: -58.351 tors. eta vs tors. theta energy: -36.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -745.616952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.616952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.616952 (E_RNA) where: Base-Base interactions energy: -357.893 where: short stacking energy: -236.123 Base-Backbone interact. energy: 1.425 local terms energy: -389.148357 where: bonds (distance) C4'-P energy: -109.899 bonds (distance) P-C4' energy: -119.378 flat angles C4'-P-C4' energy: -89.013 flat angles P-C4'-P energy: -70.896 tors. eta vs tors. theta energy: 0.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2029.608596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.608596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.608596 (E_RNA) where: Base-Base interactions energy: -1253.446 where: short stacking energy: -711.035 Base-Backbone interact. energy: -3.154 local terms energy: -773.009240 where: bonds (distance) C4'-P energy: -150.145 bonds (distance) P-C4' energy: -162.777 flat angles C4'-P-C4' energy: -165.299 flat angles P-C4'-P energy: -108.073 tors. eta vs tors. theta energy: -186.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1942.028008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.028008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.028008 (E_RNA) where: Base-Base interactions energy: -1240.202 where: short stacking energy: -642.506 Base-Backbone interact. energy: -4.110 local terms energy: -697.716199 where: bonds (distance) C4'-P energy: -126.270 bonds (distance) P-C4' energy: -156.882 flat angles C4'-P-C4' energy: -156.319 flat angles P-C4'-P energy: -98.409 tors. eta vs tors. theta energy: -159.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1682.837882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.837882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.837882 (E_RNA) where: Base-Base interactions energy: -988.774 where: short stacking energy: -621.988 Base-Backbone interact. energy: -1.815 local terms energy: -692.249034 where: bonds (distance) C4'-P energy: -128.951 bonds (distance) P-C4' energy: -159.552 flat angles C4'-P-C4' energy: -150.356 flat angles P-C4'-P energy: -100.890 tors. eta vs tors. theta energy: -152.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1727.731330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.731330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.731330 (E_RNA) where: Base-Base interactions energy: -1073.813 where: short stacking energy: -543.424 Base-Backbone interact. energy: -2.377 local terms energy: -651.541822 where: bonds (distance) C4'-P energy: -149.961 bonds (distance) P-C4' energy: -156.143 flat angles C4'-P-C4' energy: -142.816 flat angles P-C4'-P energy: -106.484 tors. eta vs tors. theta energy: -96.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1348.582867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.582867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.582867 (E_RNA) where: Base-Base interactions energy: -774.665 where: short stacking energy: -459.080 Base-Backbone interact. energy: -1.230 local terms energy: -572.687443 where: bonds (distance) C4'-P energy: -127.316 bonds (distance) P-C4' energy: -131.720 flat angles C4'-P-C4' energy: -141.280 flat angles P-C4'-P energy: -86.067 tors. eta vs tors. theta energy: -86.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1367.554857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.554857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.554857 (E_RNA) where: Base-Base interactions energy: -790.905 where: short stacking energy: -477.453 Base-Backbone interact. energy: 1.061 local terms energy: -577.711520 where: bonds (distance) C4'-P energy: -138.139 bonds (distance) P-C4' energy: -152.902 flat angles C4'-P-C4' energy: -113.287 flat angles P-C4'-P energy: -85.418 tors. eta vs tors. theta energy: -87.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1063.097871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.097871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.097871 (E_RNA) where: Base-Base interactions energy: -546.524 where: short stacking energy: -345.617 Base-Backbone interact. energy: 0.486 local terms energy: -517.059844 where: bonds (distance) C4'-P energy: -133.315 bonds (distance) P-C4' energy: -126.851 flat angles C4'-P-C4' energy: -114.096 flat angles P-C4'-P energy: -83.916 tors. eta vs tors. theta energy: -58.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1059.722584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.722584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.722584 (E_RNA) where: Base-Base interactions energy: -589.648 where: short stacking energy: -316.903 Base-Backbone interact. energy: 0.744 local terms energy: -470.818100 where: bonds (distance) C4'-P energy: -127.265 bonds (distance) P-C4' energy: -128.776 flat angles C4'-P-C4' energy: -116.850 flat angles P-C4'-P energy: -69.383 tors. eta vs tors. theta energy: -28.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -923.282953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.282953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.282953 (E_RNA) where: Base-Base interactions energy: -469.533 where: short stacking energy: -262.803 Base-Backbone interact. energy: -4.618 local terms energy: -449.131927 where: bonds (distance) C4'-P energy: -130.744 bonds (distance) P-C4' energy: -127.813 flat angles C4'-P-C4' energy: -105.843 flat angles P-C4'-P energy: -72.646 tors. eta vs tors. theta energy: -12.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -821.588284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.588284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.588284 (E_RNA) where: Base-Base interactions energy: -400.031 where: short stacking energy: -254.782 Base-Backbone interact. energy: 6.575 local terms energy: -428.131830 where: bonds (distance) C4'-P energy: -113.317 bonds (distance) P-C4' energy: -128.346 flat angles C4'-P-C4' energy: -104.931 flat angles P-C4'-P energy: -68.852 tors. eta vs tors. theta energy: -12.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2074.507686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2074.507686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.507686 (E_RNA) where: Base-Base interactions energy: -1310.866 where: short stacking energy: -734.135 Base-Backbone interact. energy: -5.982 local terms energy: -757.659786 where: bonds (distance) C4'-P energy: -154.062 bonds (distance) P-C4' energy: -155.288 flat angles C4'-P-C4' energy: -163.934 flat angles P-C4'-P energy: -100.478 tors. eta vs tors. theta energy: -183.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1945.806262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1945.806262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.806262 (E_RNA) where: Base-Base interactions energy: -1260.657 where: short stacking energy: -629.895 Base-Backbone interact. energy: 0.014 local terms energy: -685.162422 where: bonds (distance) C4'-P energy: -133.065 bonds (distance) P-C4' energy: -142.725 flat angles C4'-P-C4' energy: -157.324 flat angles P-C4'-P energy: -99.994 tors. eta vs tors. theta energy: -152.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1797.894705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.894705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.894705 (E_RNA) where: Base-Base interactions energy: -1153.999 where: short stacking energy: -570.016 Base-Backbone interact. energy: -0.924 local terms energy: -642.972158 where: bonds (distance) C4'-P energy: -136.513 bonds (distance) P-C4' energy: -146.906 flat angles C4'-P-C4' energy: -144.546 flat angles P-C4'-P energy: -113.671 tors. eta vs tors. theta energy: -101.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1628.681740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.681740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.681740 (E_RNA) where: Base-Base interactions energy: -981.728 where: short stacking energy: -587.180 Base-Backbone interact. energy: -1.932 local terms energy: -645.021747 where: bonds (distance) C4'-P energy: -131.838 bonds (distance) P-C4' energy: -130.496 flat angles C4'-P-C4' energy: -158.580 flat angles P-C4'-P energy: -79.204 tors. eta vs tors. theta energy: -144.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1488.394085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.394085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.394085 (E_RNA) where: Base-Base interactions energy: -896.777 where: short stacking energy: -503.084 Base-Backbone interact. energy: 0.623 local terms energy: -592.239396 where: bonds (distance) C4'-P energy: -135.066 bonds (distance) P-C4' energy: -141.371 flat angles C4'-P-C4' energy: -135.528 flat angles P-C4'-P energy: -76.578 tors. eta vs tors. theta energy: -103.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1213.436033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.436033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.436033 (E_RNA) where: Base-Base interactions energy: -660.914 where: short stacking energy: -372.480 Base-Backbone interact. energy: 1.737 local terms energy: -554.259563 where: bonds (distance) C4'-P energy: -156.325 bonds (distance) P-C4' energy: -140.127 flat angles C4'-P-C4' energy: -139.633 flat angles P-C4'-P energy: -61.793 tors. eta vs tors. theta energy: -56.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1292.639819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.639819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.639819 (E_RNA) where: Base-Base interactions energy: -744.441 where: short stacking energy: -428.247 Base-Backbone interact. energy: -4.929 local terms energy: -543.269605 where: bonds (distance) C4'-P energy: -135.212 bonds (distance) P-C4' energy: -133.431 flat angles C4'-P-C4' energy: -135.247 flat angles P-C4'-P energy: -66.298 tors. eta vs tors. theta energy: -73.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -907.849297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.849297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.849297 (E_RNA) where: Base-Base interactions energy: -465.977 where: short stacking energy: -320.620 Base-Backbone interact. energy: 9.350 local terms energy: -451.221647 where: bonds (distance) C4'-P energy: -120.713 bonds (distance) P-C4' energy: -115.766 flat angles C4'-P-C4' energy: -102.730 flat angles P-C4'-P energy: -79.650 tors. eta vs tors. theta energy: -32.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -985.997854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.997854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.997854 (E_RNA) where: Base-Base interactions energy: -524.931 where: short stacking energy: -307.913 Base-Backbone interact. energy: -4.370 local terms energy: -456.696963 where: bonds (distance) C4'-P energy: -131.509 bonds (distance) P-C4' energy: -122.249 flat angles C4'-P-C4' energy: -116.385 flat angles P-C4'-P energy: -66.053 tors. eta vs tors. theta energy: -20.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -781.559461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.559461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.559461 (E_RNA) where: Base-Base interactions energy: -379.483 where: short stacking energy: -229.142 Base-Backbone interact. energy: 1.926 local terms energy: -404.002327 where: bonds (distance) C4'-P energy: -124.013 bonds (distance) P-C4' energy: -149.585 flat angles C4'-P-C4' energy: -111.251 flat angles P-C4'-P energy: -37.185 tors. eta vs tors. theta energy: 18.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2128.757831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.757831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.757831 (E_RNA) where: Base-Base interactions energy: -1379.487 where: short stacking energy: -731.231 Base-Backbone interact. energy: -3.034 local terms energy: -746.236293 where: bonds (distance) C4'-P energy: -150.550 bonds (distance) P-C4' energy: -154.388 flat angles C4'-P-C4' energy: -161.694 flat angles P-C4'-P energy: -90.619 tors. eta vs tors. theta energy: -188.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1917.508053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1917.508053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.508053 (E_RNA) where: Base-Base interactions energy: -1231.709 where: short stacking energy: -613.853 Base-Backbone interact. energy: -3.558 local terms energy: -682.241386 where: bonds (distance) C4'-P energy: -138.341 bonds (distance) P-C4' energy: -151.229 flat angles C4'-P-C4' energy: -158.930 flat angles P-C4'-P energy: -106.754 tors. eta vs tors. theta energy: -126.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1822.699015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1822.699015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1822.699015 (E_RNA) where: Base-Base interactions energy: -1194.173 where: short stacking energy: -585.122 Base-Backbone interact. energy: -4.064 local terms energy: -624.462410 where: bonds (distance) C4'-P energy: -113.604 bonds (distance) P-C4' energy: -139.908 flat angles C4'-P-C4' energy: -163.431 flat angles P-C4'-P energy: -96.641 tors. eta vs tors. theta energy: -110.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1706.246990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.246990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.246990 (E_RNA) where: Base-Base interactions energy: -1045.256 where: short stacking energy: -583.658 Base-Backbone interact. energy: -0.833 local terms energy: -660.158418 where: bonds (distance) C4'-P energy: -164.631 bonds (distance) P-C4' energy: -144.734 flat angles C4'-P-C4' energy: -145.691 flat angles P-C4'-P energy: -84.136 tors. eta vs tors. theta energy: -120.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1602.751659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.751659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.751659 (E_RNA) where: Base-Base interactions energy: -979.854 where: short stacking energy: -515.433 Base-Backbone interact. energy: 0.407 local terms energy: -623.304322 where: bonds (distance) C4'-P energy: -155.214 bonds (distance) P-C4' energy: -126.030 flat angles C4'-P-C4' energy: -136.195 flat angles P-C4'-P energy: -99.427 tors. eta vs tors. theta energy: -106.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1450.355955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.355955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.355955 (E_RNA) where: Base-Base interactions energy: -874.970 where: short stacking energy: -432.007 Base-Backbone interact. energy: -2.713 local terms energy: -572.672670 where: bonds (distance) C4'-P energy: -122.660 bonds (distance) P-C4' energy: -153.847 flat angles C4'-P-C4' energy: -129.718 flat angles P-C4'-P energy: -89.728 tors. eta vs tors. theta energy: -76.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1115.394015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.394015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.394015 (E_RNA) where: Base-Base interactions energy: -604.080 where: short stacking energy: -363.197 Base-Backbone interact. energy: -3.073 local terms energy: -508.240922 where: bonds (distance) C4'-P energy: -134.241 bonds (distance) P-C4' energy: -131.611 flat angles C4'-P-C4' energy: -119.195 flat angles P-C4'-P energy: -61.856 tors. eta vs tors. theta energy: -61.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1267.995840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.995840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.995840 (E_RNA) where: Base-Base interactions energy: -760.836 where: short stacking energy: -401.146 Base-Backbone interact. energy: 1.183 local terms energy: -508.342790 where: bonds (distance) C4'-P energy: -114.511 bonds (distance) P-C4' energy: -144.913 flat angles C4'-P-C4' energy: -121.451 flat angles P-C4'-P energy: -73.316 tors. eta vs tors. theta energy: -54.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -927.738166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.738166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.738166 (E_RNA) where: Base-Base interactions energy: -489.469 where: short stacking energy: -247.515 Base-Backbone interact. energy: -1.019 local terms energy: -437.250307 where: bonds (distance) C4'-P energy: -120.237 bonds (distance) P-C4' energy: -129.682 flat angles C4'-P-C4' energy: -101.841 flat angles P-C4'-P energy: -88.104 tors. eta vs tors. theta energy: 2.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -751.292981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.292981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.292981 (E_RNA) where: Base-Base interactions energy: -349.973 where: short stacking energy: -255.411 Base-Backbone interact. energy: 4.701 local terms energy: -406.020118 where: bonds (distance) C4'-P energy: -93.711 bonds (distance) P-C4' energy: -138.871 flat angles C4'-P-C4' energy: -114.179 flat angles P-C4'-P energy: -74.747 tors. eta vs tors. theta energy: 15.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2134.626619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2134.626619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2134.626619 (E_RNA) where: Base-Base interactions energy: -1355.757 where: short stacking energy: -751.423 Base-Backbone interact. energy: -3.902 local terms energy: -774.967692 where: bonds (distance) C4'-P energy: -148.160 bonds (distance) P-C4' energy: -154.475 flat angles C4'-P-C4' energy: -163.708 flat angles P-C4'-P energy: -107.799 tors. eta vs tors. theta energy: -200.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1970.976494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.976494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1970.976494 (E_RNA) where: Base-Base interactions energy: -1275.768 where: short stacking energy: -648.065 Base-Backbone interact. energy: -4.570 local terms energy: -690.638683 where: bonds (distance) C4'-P energy: -139.083 bonds (distance) P-C4' energy: -152.255 flat angles C4'-P-C4' energy: -147.757 flat angles P-C4'-P energy: -102.733 tors. eta vs tors. theta energy: -148.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1916.745563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1916.745563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1916.745563 (E_RNA) where: Base-Base interactions energy: -1254.663 where: short stacking energy: -586.834 Base-Backbone interact. energy: -4.900 local terms energy: -657.183387 where: bonds (distance) C4'-P energy: -143.557 bonds (distance) P-C4' energy: -157.230 flat angles C4'-P-C4' energy: -137.027 flat angles P-C4'-P energy: -103.146 tors. eta vs tors. theta energy: -116.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1688.171876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.171876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.171876 (E_RNA) where: Base-Base interactions energy: -1021.303 where: short stacking energy: -556.864 Base-Backbone interact. energy: -2.464 local terms energy: -664.404641 where: bonds (distance) C4'-P energy: -129.893 bonds (distance) P-C4' energy: -158.213 flat angles C4'-P-C4' energy: -159.161 flat angles P-C4'-P energy: -99.683 tors. eta vs tors. theta energy: -117.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1612.457161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.457161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.457161 (E_RNA) where: Base-Base interactions energy: -987.392 where: short stacking energy: -525.612 Base-Backbone interact. energy: -0.774 local terms energy: -624.291801 where: bonds (distance) C4'-P energy: -138.754 bonds (distance) P-C4' energy: -141.098 flat angles C4'-P-C4' energy: -140.363 flat angles P-C4'-P energy: -88.099 tors. eta vs tors. theta energy: -115.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1498.321231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1498.321231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.321231 (E_RNA) where: Base-Base interactions energy: -934.894 where: short stacking energy: -492.020 Base-Backbone interact. energy: 3.066 local terms energy: -566.492520 where: bonds (distance) C4'-P energy: -133.106 bonds (distance) P-C4' energy: -115.656 flat angles C4'-P-C4' energy: -131.165 flat angles P-C4'-P energy: -85.653 tors. eta vs tors. theta energy: -100.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1396.220268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1396.220268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.220268 (E_RNA) where: Base-Base interactions energy: -849.628 where: short stacking energy: -470.939 Base-Backbone interact. energy: -4.062 local terms energy: -542.530862 where: bonds (distance) C4'-P energy: -118.369 bonds (distance) P-C4' energy: -144.270 flat angles C4'-P-C4' energy: -124.935 flat angles P-C4'-P energy: -72.721 tors. eta vs tors. theta energy: -82.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1034.069821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.069821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.069821 (E_RNA) where: Base-Base interactions energy: -542.880 where: short stacking energy: -353.431 Base-Backbone interact. energy: -0.096 local terms energy: -491.093184 where: bonds (distance) C4'-P energy: -103.790 bonds (distance) P-C4' energy: -140.603 flat angles C4'-P-C4' energy: -127.302 flat angles P-C4'-P energy: -71.553 tors. eta vs tors. theta energy: -47.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -978.649791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.649791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.649791 (E_RNA) where: Base-Base interactions energy: -515.741 where: short stacking energy: -300.434 Base-Backbone interact. energy: 8.779 local terms energy: -471.687712 where: bonds (distance) C4'-P energy: -108.214 bonds (distance) P-C4' energy: -139.499 flat angles C4'-P-C4' energy: -100.117 flat angles P-C4'-P energy: -94.246 tors. eta vs tors. theta energy: -29.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -832.510835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.510835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.510835 (E_RNA) where: Base-Base interactions energy: -390.928 where: short stacking energy: -253.268 Base-Backbone interact. energy: 1.366 local terms energy: -442.948341 where: bonds (distance) C4'-P energy: -123.603 bonds (distance) P-C4' energy: -135.783 flat angles C4'-P-C4' energy: -103.364 flat angles P-C4'-P energy: -73.221 tors. eta vs tors. theta energy: -6.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2143.867317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2143.867317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2143.867317 (E_RNA) where: Base-Base interactions energy: -1378.812 where: short stacking energy: -734.782 Base-Backbone interact. energy: -3.256 local terms energy: -761.799614 where: bonds (distance) C4'-P energy: -162.848 bonds (distance) P-C4' energy: -137.541 flat angles C4'-P-C4' energy: -171.215 flat angles P-C4'-P energy: -107.883 tors. eta vs tors. theta energy: -182.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2095.957701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2095.957701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2095.957701 (E_RNA) where: Base-Base interactions energy: -1369.428 where: short stacking energy: -629.064 Base-Backbone interact. energy: -4.798 local terms energy: -721.732349 where: bonds (distance) C4'-P energy: -157.213 bonds (distance) P-C4' energy: -170.417 flat angles C4'-P-C4' energy: -154.683 flat angles P-C4'-P energy: -103.651 tors. eta vs tors. theta energy: -135.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1911.243060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1911.243060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1911.243060 (E_RNA) where: Base-Base interactions energy: -1248.253 where: short stacking energy: -599.116 Base-Backbone interact. energy: -3.247 local terms energy: -659.742797 where: bonds (distance) C4'-P energy: -138.840 bonds (distance) P-C4' energy: -151.686 flat angles C4'-P-C4' energy: -144.017 flat angles P-C4'-P energy: -84.550 tors. eta vs tors. theta energy: -140.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1766.219093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1766.219093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.219093 (E_RNA) where: Base-Base interactions energy: -1091.539 where: short stacking energy: -598.636 Base-Backbone interact. energy: 1.666 local terms energy: -676.345930 where: bonds (distance) C4'-P energy: -154.656 bonds (distance) P-C4' energy: -135.976 flat angles C4'-P-C4' energy: -158.210 flat angles P-C4'-P energy: -88.968 tors. eta vs tors. theta energy: -138.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1653.293719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.293719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.293719 (E_RNA) where: Base-Base interactions energy: -1054.191 where: short stacking energy: -505.434 Base-Backbone interact. energy: -0.596 local terms energy: -598.506321 where: bonds (distance) C4'-P energy: -128.263 bonds (distance) P-C4' energy: -154.427 flat angles C4'-P-C4' energy: -135.105 flat angles P-C4'-P energy: -88.584 tors. eta vs tors. theta energy: -92.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1541.291070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.291070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.291070 (E_RNA) where: Base-Base interactions energy: -947.963 where: short stacking energy: -517.502 Base-Backbone interact. energy: 2.457 local terms energy: -595.784776 where: bonds (distance) C4'-P energy: -113.916 bonds (distance) P-C4' energy: -144.055 flat angles C4'-P-C4' energy: -139.301 flat angles P-C4'-P energy: -91.543 tors. eta vs tors. theta energy: -106.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1371.676447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.676447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.676447 (E_RNA) where: Base-Base interactions energy: -818.411 where: short stacking energy: -400.984 Base-Backbone interact. energy: 0.467 local terms energy: -553.731827 where: bonds (distance) C4'-P energy: -135.184 bonds (distance) P-C4' energy: -135.174 flat angles C4'-P-C4' energy: -130.106 flat angles P-C4'-P energy: -91.780 tors. eta vs tors. theta energy: -61.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -965.224237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.224237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.224237 (E_RNA) where: Base-Base interactions energy: -507.774 where: short stacking energy: -310.850 Base-Backbone interact. energy: 7.540 local terms energy: -464.989595 where: bonds (distance) C4'-P energy: -116.129 bonds (distance) P-C4' energy: -130.078 flat angles C4'-P-C4' energy: -124.772 flat angles P-C4'-P energy: -53.820 tors. eta vs tors. theta energy: -40.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1004.900735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.900735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.900735 (E_RNA) where: Base-Base interactions energy: -547.544 where: short stacking energy: -332.632 Base-Backbone interact. energy: -1.421 local terms energy: -455.936121 where: bonds (distance) C4'-P energy: -120.610 bonds (distance) P-C4' energy: -121.482 flat angles C4'-P-C4' energy: -115.442 flat angles P-C4'-P energy: -68.545 tors. eta vs tors. theta energy: -29.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -842.834208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.834208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.834208 (E_RNA) where: Base-Base interactions energy: -432.426 where: short stacking energy: -230.670 Base-Backbone interact. energy: -2.813 local terms energy: -407.595448 where: bonds (distance) C4'-P energy: -116.211 bonds (distance) P-C4' energy: -118.508 flat angles C4'-P-C4' energy: -118.871 flat angles P-C4'-P energy: -47.467 tors. eta vs tors. theta energy: -6.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2133.816184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.816184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.816184 (E_RNA) where: Base-Base interactions energy: -1371.964 where: short stacking energy: -714.447 Base-Backbone interact. energy: -1.828 local terms energy: -760.024131 where: bonds (distance) C4'-P energy: -137.907 bonds (distance) P-C4' energy: -153.911 flat angles C4'-P-C4' energy: -173.049 flat angles P-C4'-P energy: -99.995 tors. eta vs tors. theta energy: -195.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -2090.357017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2090.357017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2090.357017 (E_RNA) where: Base-Base interactions energy: -1374.907 where: short stacking energy: -641.797 Base-Backbone interact. energy: -3.613 local terms energy: -711.836911 where: bonds (distance) C4'-P energy: -140.321 bonds (distance) P-C4' energy: -150.060 flat angles C4'-P-C4' energy: -168.125 flat angles P-C4'-P energy: -112.175 tors. eta vs tors. theta energy: -141.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1878.040877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1878.040877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1878.040877 (E_RNA) where: Base-Base interactions energy: -1207.572 where: short stacking energy: -630.568 Base-Backbone interact. energy: -2.114 local terms energy: -668.354514 where: bonds (distance) C4'-P energy: -130.822 bonds (distance) P-C4' energy: -142.536 flat angles C4'-P-C4' energy: -152.411 flat angles P-C4'-P energy: -100.651 tors. eta vs tors. theta energy: -141.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1785.552570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1785.552570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1785.552570 (E_RNA) where: Base-Base interactions energy: -1103.691 where: short stacking energy: -585.573 Base-Backbone interact. energy: -2.919 local terms energy: -678.942706 where: bonds (distance) C4'-P energy: -142.324 bonds (distance) P-C4' energy: -161.115 flat angles C4'-P-C4' energy: -142.879 flat angles P-C4'-P energy: -93.006 tors. eta vs tors. theta energy: -139.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1639.279893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.279893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.279893 (E_RNA) where: Base-Base interactions energy: -1065.230 where: short stacking energy: -553.061 Base-Backbone interact. energy: -0.255 local terms energy: -573.795162 where: bonds (distance) C4'-P energy: -118.185 bonds (distance) P-C4' energy: -118.215 flat angles C4'-P-C4' energy: -140.223 flat angles P-C4'-P energy: -84.987 tors. eta vs tors. theta energy: -112.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1505.382287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.382287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.382287 (E_RNA) where: Base-Base interactions energy: -933.466 where: short stacking energy: -472.749 Base-Backbone interact. energy: 2.556 local terms energy: -574.472338 where: bonds (distance) C4'-P energy: -123.110 bonds (distance) P-C4' energy: -158.608 flat angles C4'-P-C4' energy: -122.011 flat angles P-C4'-P energy: -78.517 tors. eta vs tors. theta energy: -92.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1449.137051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.137051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.137051 (E_RNA) where: Base-Base interactions energy: -892.842 where: short stacking energy: -433.217 Base-Backbone interact. energy: -2.986 local terms energy: -553.309535 where: bonds (distance) C4'-P energy: -130.370 bonds (distance) P-C4' energy: -139.380 flat angles C4'-P-C4' energy: -120.081 flat angles P-C4'-P energy: -88.022 tors. eta vs tors. theta energy: -75.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -911.392383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.392383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.392383 (E_RNA) where: Base-Base interactions energy: -467.038 where: short stacking energy: -286.883 Base-Backbone interact. energy: -0.342 local terms energy: -444.011492 where: bonds (distance) C4'-P energy: -107.993 bonds (distance) P-C4' energy: -131.572 flat angles C4'-P-C4' energy: -126.196 flat angles P-C4'-P energy: -74.280 tors. eta vs tors. theta energy: -3.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1055.117618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.117618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.117618 (E_RNA) where: Base-Base interactions energy: -584.858 where: short stacking energy: -302.347 Base-Backbone interact. energy: -0.535 local terms energy: -469.723996 where: bonds (distance) C4'-P energy: -129.666 bonds (distance) P-C4' energy: -127.618 flat angles C4'-P-C4' energy: -139.418 flat angles P-C4'-P energy: -46.376 tors. eta vs tors. theta energy: -26.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -910.222538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.222538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.222538 (E_RNA) where: Base-Base interactions energy: -509.659 where: short stacking energy: -260.682 Base-Backbone interact. energy: 2.810 local terms energy: -403.373200 where: bonds (distance) C4'-P energy: -123.302 bonds (distance) P-C4' energy: -107.897 flat angles C4'-P-C4' energy: -120.127 flat angles P-C4'-P energy: -45.837 tors. eta vs tors. theta energy: -6.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2124.226310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.226310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.226310 (E_RNA) where: Base-Base interactions energy: -1369.566 where: short stacking energy: -744.257 Base-Backbone interact. energy: -0.539 local terms energy: -754.121584 where: bonds (distance) C4'-P energy: -141.037 bonds (distance) P-C4' energy: -142.344 flat angles C4'-P-C4' energy: -164.706 flat angles P-C4'-P energy: -101.535 tors. eta vs tors. theta energy: -204.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -2057.546910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2057.546910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2057.546910 (E_RNA) where: Base-Base interactions energy: -1366.281 where: short stacking energy: -614.819 Base-Backbone interact. energy: -2.261 local terms energy: -689.004770 where: bonds (distance) C4'-P energy: -145.256 bonds (distance) P-C4' energy: -156.557 flat angles C4'-P-C4' energy: -161.095 flat angles P-C4'-P energy: -103.875 tors. eta vs tors. theta energy: -122.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1868.013265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.013265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1868.013265 (E_RNA) where: Base-Base interactions energy: -1186.133 where: short stacking energy: -612.059 Base-Backbone interact. energy: -4.222 local terms energy: -677.658280 where: bonds (distance) C4'-P energy: -143.202 bonds (distance) P-C4' energy: -140.870 flat angles C4'-P-C4' energy: -158.362 flat angles P-C4'-P energy: -105.986 tors. eta vs tors. theta energy: -129.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1774.382465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1774.382465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.382465 (E_RNA) where: Base-Base interactions energy: -1086.685 where: short stacking energy: -576.286 Base-Backbone interact. energy: 0.894 local terms energy: -688.591763 where: bonds (distance) C4'-P energy: -153.170 bonds (distance) P-C4' energy: -147.507 flat angles C4'-P-C4' energy: -168.440 flat angles P-C4'-P energy: -95.848 tors. eta vs tors. theta energy: -123.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1689.987163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.987163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.987163 (E_RNA) where: Base-Base interactions energy: -1071.145 where: short stacking energy: -527.093 Base-Backbone interact. energy: -3.990 local terms energy: -614.852825 where: bonds (distance) C4'-P energy: -137.637 bonds (distance) P-C4' energy: -116.777 flat angles C4'-P-C4' energy: -159.196 flat angles P-C4'-P energy: -98.684 tors. eta vs tors. theta energy: -102.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1548.999729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.999729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.999729 (E_RNA) where: Base-Base interactions energy: -948.301 where: short stacking energy: -489.632 Base-Backbone interact. energy: -1.059 local terms energy: -599.639698 where: bonds (distance) C4'-P energy: -143.617 bonds (distance) P-C4' energy: -138.663 flat angles C4'-P-C4' energy: -127.800 flat angles P-C4'-P energy: -81.028 tors. eta vs tors. theta energy: -108.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1435.621531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.621531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.621531 (E_RNA) where: Base-Base interactions energy: -897.020 where: short stacking energy: -446.870 Base-Backbone interact. energy: -1.870 local terms energy: -536.731437 where: bonds (distance) C4'-P energy: -139.339 bonds (distance) P-C4' energy: -117.016 flat angles C4'-P-C4' energy: -127.884 flat angles P-C4'-P energy: -77.681 tors. eta vs tors. theta energy: -74.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1114.005529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.005529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1114.005529 (E_RNA) where: Base-Base interactions energy: -632.139 where: short stacking energy: -356.078 Base-Backbone interact. energy: -0.891 local terms energy: -480.976006 where: bonds (distance) C4'-P energy: -120.185 bonds (distance) P-C4' energy: -122.764 flat angles C4'-P-C4' energy: -115.206 flat angles P-C4'-P energy: -82.467 tors. eta vs tors. theta energy: -40.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -855.812338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.812338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.812338 (E_RNA) where: Base-Base interactions energy: -393.999 where: short stacking energy: -226.790 Base-Backbone interact. energy: 0.865 local terms energy: -462.678095 where: bonds (distance) C4'-P energy: -123.008 bonds (distance) P-C4' energy: -144.801 flat angles C4'-P-C4' energy: -119.104 flat angles P-C4'-P energy: -72.366 tors. eta vs tors. theta energy: -3.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -964.798562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.798562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.798562 (E_RNA) where: Base-Base interactions energy: -521.739 where: short stacking energy: -291.612 Base-Backbone interact. energy: -2.088 local terms energy: -440.972116 where: bonds (distance) C4'-P energy: -122.213 bonds (distance) P-C4' energy: -124.419 flat angles C4'-P-C4' energy: -108.165 flat angles P-C4'-P energy: -54.767 tors. eta vs tors. theta energy: -31.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2175.091809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2175.091809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.091809 (E_RNA) where: Base-Base interactions energy: -1426.540 where: short stacking energy: -730.304 Base-Backbone interact. energy: 0.180 local terms energy: -748.731554 where: bonds (distance) C4'-P energy: -150.178 bonds (distance) P-C4' energy: -149.660 flat angles C4'-P-C4' energy: -174.753 flat angles P-C4'-P energy: -91.607 tors. eta vs tors. theta energy: -182.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -2068.564658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2068.564658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2068.564658 (E_RNA) where: Base-Base interactions energy: -1379.026 where: short stacking energy: -656.489 Base-Backbone interact. energy: 7.397 local terms energy: -696.935305 where: bonds (distance) C4'-P energy: -135.474 bonds (distance) P-C4' energy: -168.142 flat angles C4'-P-C4' energy: -160.113 flat angles P-C4'-P energy: -91.739 tors. eta vs tors. theta energy: -141.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1934.972717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.972717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.972717 (E_RNA) where: Base-Base interactions energy: -1287.028 where: short stacking energy: -630.681 Base-Backbone interact. energy: -0.520 local terms energy: -647.424979 where: bonds (distance) C4'-P energy: -140.307 bonds (distance) P-C4' energy: -158.653 flat angles C4'-P-C4' energy: -138.623 flat angles P-C4'-P energy: -88.358 tors. eta vs tors. theta energy: -121.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1813.745079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1813.745079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.745079 (E_RNA) where: Base-Base interactions energy: -1159.197 where: short stacking energy: -581.595 Base-Backbone interact. energy: 0.054 local terms energy: -654.602075 where: bonds (distance) C4'-P energy: -123.754 bonds (distance) P-C4' energy: -144.180 flat angles C4'-P-C4' energy: -154.730 flat angles P-C4'-P energy: -99.636 tors. eta vs tors. theta energy: -132.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1716.350810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.350810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.350810 (E_RNA) where: Base-Base interactions energy: -1120.573 where: short stacking energy: -543.496 Base-Backbone interact. energy: -4.328 local terms energy: -591.449490 where: bonds (distance) C4'-P energy: -121.759 bonds (distance) P-C4' energy: -136.555 flat angles C4'-P-C4' energy: -132.582 flat angles P-C4'-P energy: -94.165 tors. eta vs tors. theta energy: -106.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1473.577834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.577834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.577834 (E_RNA) where: Base-Base interactions energy: -915.001 where: short stacking energy: -518.208 Base-Backbone interact. energy: -3.453 local terms energy: -555.123232 where: bonds (distance) C4'-P energy: -111.302 bonds (distance) P-C4' energy: -140.292 flat angles C4'-P-C4' energy: -138.235 flat angles P-C4'-P energy: -67.504 tors. eta vs tors. theta energy: -97.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1454.162688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.162688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.162688 (E_RNA) where: Base-Base interactions energy: -870.066 where: short stacking energy: -444.419 Base-Backbone interact. energy: -1.594 local terms energy: -582.502603 where: bonds (distance) C4'-P energy: -149.196 bonds (distance) P-C4' energy: -137.253 flat angles C4'-P-C4' energy: -118.442 flat angles P-C4'-P energy: -83.281 tors. eta vs tors. theta energy: -94.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1093.474103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.474103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.474103 (E_RNA) where: Base-Base interactions energy: -636.231 where: short stacking energy: -366.381 Base-Backbone interact. energy: 3.946 local terms energy: -461.189154 where: bonds (distance) C4'-P energy: -126.380 bonds (distance) P-C4' energy: -115.214 flat angles C4'-P-C4' energy: -117.332 flat angles P-C4'-P energy: -67.696 tors. eta vs tors. theta energy: -34.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1063.555949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.555949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.555949 (E_RNA) where: Base-Base interactions energy: -608.673 where: short stacking energy: -341.790 Base-Backbone interact. energy: 4.276 local terms energy: -459.158335 where: bonds (distance) C4'-P energy: -136.266 bonds (distance) P-C4' energy: -115.316 flat angles C4'-P-C4' energy: -126.315 flat angles P-C4'-P energy: -39.596 tors. eta vs tors. theta energy: -41.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -704.115275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.115275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.115275 (E_RNA) where: Base-Base interactions energy: -287.255 where: short stacking energy: -205.019 Base-Backbone interact. energy: 7.006 local terms energy: -423.867022 where: bonds (distance) C4'-P energy: -125.512 bonds (distance) P-C4' energy: -120.393 flat angles C4'-P-C4' energy: -118.210 flat angles P-C4'-P energy: -77.604 tors. eta vs tors. theta energy: 17.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2194.567104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.567104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.567104 (E_RNA) where: Base-Base interactions energy: -1427.904 where: short stacking energy: -749.744 Base-Backbone interact. energy: -5.047 local terms energy: -761.616019 where: bonds (distance) C4'-P energy: -132.122 bonds (distance) P-C4' energy: -153.036 flat angles C4'-P-C4' energy: -166.675 flat angles P-C4'-P energy: -110.487 tors. eta vs tors. theta energy: -199.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2075.988214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2075.988214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2075.988214 (E_RNA) where: Base-Base interactions energy: -1411.885 where: short stacking energy: -641.493 Base-Backbone interact. energy: -6.347 local terms energy: -657.756195 where: bonds (distance) C4'-P energy: -118.394 bonds (distance) P-C4' energy: -160.689 flat angles C4'-P-C4' energy: -153.741 flat angles P-C4'-P energy: -97.034 tors. eta vs tors. theta energy: -127.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1866.556113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1866.556113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1866.556113 (E_RNA) where: Base-Base interactions energy: -1199.158 where: short stacking energy: -583.556 Base-Backbone interact. energy: 0.872 local terms energy: -668.270372 where: bonds (distance) C4'-P energy: -152.518 bonds (distance) P-C4' energy: -146.832 flat angles C4'-P-C4' energy: -148.829 flat angles P-C4'-P energy: -97.307 tors. eta vs tors. theta energy: -122.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1824.872943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.872943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.872943 (E_RNA) where: Base-Base interactions energy: -1177.050 where: short stacking energy: -581.838 Base-Backbone interact. energy: -2.332 local terms energy: -645.491510 where: bonds (distance) C4'-P energy: -132.623 bonds (distance) P-C4' energy: -137.402 flat angles C4'-P-C4' energy: -145.922 flat angles P-C4'-P energy: -98.222 tors. eta vs tors. theta energy: -131.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1787.313007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.313007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.313007 (E_RNA) where: Base-Base interactions energy: -1170.581 where: short stacking energy: -574.781 Base-Backbone interact. energy: -3.677 local terms energy: -613.054529 where: bonds (distance) C4'-P energy: -130.204 bonds (distance) P-C4' energy: -137.437 flat angles C4'-P-C4' energy: -139.346 flat angles P-C4'-P energy: -86.914 tors. eta vs tors. theta energy: -119.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1516.226786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.226786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.226786 (E_RNA) where: Base-Base interactions energy: -925.185 where: short stacking energy: -481.814 Base-Backbone interact. energy: -2.071 local terms energy: -588.970620 where: bonds (distance) C4'-P energy: -140.545 bonds (distance) P-C4' energy: -143.027 flat angles C4'-P-C4' energy: -117.811 flat angles P-C4'-P energy: -90.611 tors. eta vs tors. theta energy: -96.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1410.812902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.812902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.812902 (E_RNA) where: Base-Base interactions energy: -835.703 where: short stacking energy: -453.459 Base-Backbone interact. energy: -3.281 local terms energy: -571.828680 where: bonds (distance) C4'-P energy: -122.986 bonds (distance) P-C4' energy: -136.707 flat angles C4'-P-C4' energy: -132.812 flat angles P-C4'-P energy: -86.682 tors. eta vs tors. theta energy: -92.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1299.319314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.319314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.319314 (E_RNA) where: Base-Base interactions energy: -773.694 where: short stacking energy: -392.225 Base-Backbone interact. energy: 3.095 local terms energy: -528.720430 where: bonds (distance) C4'-P energy: -135.739 bonds (distance) P-C4' energy: -118.982 flat angles C4'-P-C4' energy: -115.441 flat angles P-C4'-P energy: -86.207 tors. eta vs tors. theta energy: -72.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1124.162985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.162985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.162985 (E_RNA) where: Base-Base interactions energy: -692.317 where: short stacking energy: -349.393 Base-Backbone interact. energy: -0.700 local terms energy: -431.145644 where: bonds (distance) C4'-P energy: -115.577 bonds (distance) P-C4' energy: -110.825 flat angles C4'-P-C4' energy: -119.831 flat angles P-C4'-P energy: -46.927 tors. eta vs tors. theta energy: -37.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -737.425256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.425256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.425256 (E_RNA) where: Base-Base interactions energy: -310.521 where: short stacking energy: -196.025 Base-Backbone interact. energy: 8.904 local terms energy: -435.808390 where: bonds (distance) C4'-P energy: -120.290 bonds (distance) P-C4' energy: -132.200 flat angles C4'-P-C4' energy: -113.288 flat angles P-C4'-P energy: -78.815 tors. eta vs tors. theta energy: 8.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2261.731689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2261.731689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.731689 (E_RNA) where: Base-Base interactions energy: -1453.374 where: short stacking energy: -784.158 Base-Backbone interact. energy: -2.108 local terms energy: -806.249097 where: bonds (distance) C4'-P energy: -153.853 bonds (distance) P-C4' energy: -165.269 flat angles C4'-P-C4' energy: -162.720 flat angles P-C4'-P energy: -103.892 tors. eta vs tors. theta energy: -220.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2098.400316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2098.400316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2098.400316 (E_RNA) where: Base-Base interactions energy: -1388.378 where: short stacking energy: -630.498 Base-Backbone interact. energy: -3.812 local terms energy: -706.211291 where: bonds (distance) C4'-P energy: -155.493 bonds (distance) P-C4' energy: -147.362 flat angles C4'-P-C4' energy: -170.984 flat angles P-C4'-P energy: -96.987 tors. eta vs tors. theta energy: -135.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1926.371364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1926.371364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1926.371364 (E_RNA) where: Base-Base interactions energy: -1219.293 where: short stacking energy: -664.601 Base-Backbone interact. energy: -3.406 local terms energy: -703.671817 where: bonds (distance) C4'-P energy: -141.450 bonds (distance) P-C4' energy: -134.722 flat angles C4'-P-C4' energy: -159.306 flat angles P-C4'-P energy: -105.814 tors. eta vs tors. theta energy: -162.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1804.124833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1804.124833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1804.124833 (E_RNA) where: Base-Base interactions energy: -1160.205 where: short stacking energy: -575.791 Base-Backbone interact. energy: -3.206 local terms energy: -640.713691 where: bonds (distance) C4'-P energy: -130.115 bonds (distance) P-C4' energy: -145.908 flat angles C4'-P-C4' energy: -151.395 flat angles P-C4'-P energy: -92.466 tors. eta vs tors. theta energy: -120.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1759.304124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1759.304124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.304124 (E_RNA) where: Base-Base interactions energy: -1137.613 where: short stacking energy: -549.917 Base-Backbone interact. energy: -3.459 local terms energy: -618.232983 where: bonds (distance) C4'-P energy: -120.625 bonds (distance) P-C4' energy: -144.818 flat angles C4'-P-C4' energy: -156.598 flat angles P-C4'-P energy: -80.759 tors. eta vs tors. theta energy: -115.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1597.952000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.952000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.952000 (E_RNA) where: Base-Base interactions energy: -1037.951 where: short stacking energy: -489.197 Base-Backbone interact. energy: -2.564 local terms energy: -557.437509 where: bonds (distance) C4'-P energy: -110.214 bonds (distance) P-C4' energy: -145.386 flat angles C4'-P-C4' energy: -133.622 flat angles P-C4'-P energy: -75.404 tors. eta vs tors. theta energy: -92.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1481.120147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.120147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.120147 (E_RNA) where: Base-Base interactions energy: -898.046 where: short stacking energy: -428.107 Base-Backbone interact. energy: -0.359 local terms energy: -582.715444 where: bonds (distance) C4'-P energy: -142.478 bonds (distance) P-C4' energy: -138.588 flat angles C4'-P-C4' energy: -137.516 flat angles P-C4'-P energy: -93.867 tors. eta vs tors. theta energy: -70.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1239.166460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.166460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.166460 (E_RNA) where: Base-Base interactions energy: -756.547 where: short stacking energy: -370.401 Base-Backbone interact. energy: -4.428 local terms energy: -478.190843 where: bonds (distance) C4'-P energy: -124.669 bonds (distance) P-C4' energy: -116.820 flat angles C4'-P-C4' energy: -118.851 flat angles P-C4'-P energy: -71.936 tors. eta vs tors. theta energy: -45.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1124.823587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.823587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.823587 (E_RNA) where: Base-Base interactions energy: -671.306 where: short stacking energy: -331.322 Base-Backbone interact. energy: -1.608 local terms energy: -451.909543 where: bonds (distance) C4'-P energy: -117.146 bonds (distance) P-C4' energy: -123.315 flat angles C4'-P-C4' energy: -115.479 flat angles P-C4'-P energy: -64.223 tors. eta vs tors. theta energy: -31.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -726.156522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.156522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.156522 (E_RNA) where: Base-Base interactions energy: -348.875 where: short stacking energy: -238.275 Base-Backbone interact. energy: -1.562 local terms energy: -375.719769 where: bonds (distance) C4'-P energy: -104.157 bonds (distance) P-C4' energy: -140.719 flat angles C4'-P-C4' energy: -76.947 flat angles P-C4'-P energy: -56.245 tors. eta vs tors. theta energy: 2.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2193.706372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.706372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.706372 (E_RNA) where: Base-Base interactions energy: -1396.813 where: short stacking energy: -765.900 Base-Backbone interact. energy: -3.079 local terms energy: -793.814615 where: bonds (distance) C4'-P energy: -148.507 bonds (distance) P-C4' energy: -156.568 flat angles C4'-P-C4' energy: -168.913 flat angles P-C4'-P energy: -105.674 tors. eta vs tors. theta energy: -214.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2093.903389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2093.903389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2093.903389 (E_RNA) where: Base-Base interactions energy: -1399.447 where: short stacking energy: -618.010 Base-Backbone interact. energy: -3.268 local terms energy: -691.187837 where: bonds (distance) C4'-P energy: -154.904 bonds (distance) P-C4' energy: -137.967 flat angles C4'-P-C4' energy: -158.609 flat angles P-C4'-P energy: -105.347 tors. eta vs tors. theta energy: -134.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1943.826098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.826098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.826098 (E_RNA) where: Base-Base interactions energy: -1217.412 where: short stacking energy: -649.966 Base-Backbone interact. energy: -2.912 local terms energy: -723.501955 where: bonds (distance) C4'-P energy: -149.692 bonds (distance) P-C4' energy: -151.391 flat angles C4'-P-C4' energy: -150.400 flat angles P-C4'-P energy: -105.467 tors. eta vs tors. theta energy: -166.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1886.703018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.703018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.703018 (E_RNA) where: Base-Base interactions energy: -1249.284 where: short stacking energy: -613.898 Base-Backbone interact. energy: -4.563 local terms energy: -632.856191 where: bonds (distance) C4'-P energy: -137.116 bonds (distance) P-C4' energy: -144.811 flat angles C4'-P-C4' energy: -146.863 flat angles P-C4'-P energy: -77.432 tors. eta vs tors. theta energy: -126.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1642.087705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.087705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1642.087705 (E_RNA) where: Base-Base interactions energy: -1059.602 where: short stacking energy: -511.270 Base-Backbone interact. energy: 1.081 local terms energy: -583.566348 where: bonds (distance) C4'-P energy: -134.492 bonds (distance) P-C4' energy: -133.034 flat angles C4'-P-C4' energy: -156.010 flat angles P-C4'-P energy: -66.217 tors. eta vs tors. theta energy: -93.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1640.489321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.489321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.489321 (E_RNA) where: Base-Base interactions energy: -1079.979 where: short stacking energy: -478.874 Base-Backbone interact. energy: -3.685 local terms energy: -556.824761 where: bonds (distance) C4'-P energy: -114.973 bonds (distance) P-C4' energy: -135.323 flat angles C4'-P-C4' energy: -137.250 flat angles P-C4'-P energy: -83.263 tors. eta vs tors. theta energy: -86.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1447.248687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.248687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.248687 (E_RNA) where: Base-Base interactions energy: -898.355 where: short stacking energy: -453.497 Base-Backbone interact. energy: -0.067 local terms energy: -548.826333 where: bonds (distance) C4'-P energy: -134.853 bonds (distance) P-C4' energy: -132.608 flat angles C4'-P-C4' energy: -136.607 flat angles P-C4'-P energy: -63.378 tors. eta vs tors. theta energy: -81.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1281.083192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.083192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.083192 (E_RNA) where: Base-Base interactions energy: -769.079 where: short stacking energy: -385.626 Base-Backbone interact. energy: -4.619 local terms energy: -507.384809 where: bonds (distance) C4'-P energy: -123.145 bonds (distance) P-C4' energy: -140.680 flat angles C4'-P-C4' energy: -116.641 flat angles P-C4'-P energy: -68.981 tors. eta vs tors. theta energy: -57.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1122.519930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.519930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.519930 (E_RNA) where: Base-Base interactions energy: -664.287 where: short stacking energy: -339.595 Base-Backbone interact. energy: 0.727 local terms energy: -458.960712 where: bonds (distance) C4'-P energy: -118.552 bonds (distance) P-C4' energy: -137.598 flat angles C4'-P-C4' energy: -110.595 flat angles P-C4'-P energy: -58.584 tors. eta vs tors. theta energy: -33.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -741.022812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.022812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.022812 (E_RNA) where: Base-Base interactions energy: -330.479 where: short stacking energy: -221.476 Base-Backbone interact. energy: 4.663 local terms energy: -415.206873 where: bonds (distance) C4'-P energy: -118.435 bonds (distance) P-C4' energy: -128.712 flat angles C4'-P-C4' energy: -119.224 flat angles P-C4'-P energy: -68.000 tors. eta vs tors. theta energy: 19.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2215.868383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2215.868383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.868383 (E_RNA) where: Base-Base interactions energy: -1446.327 where: short stacking energy: -742.008 Base-Backbone interact. energy: -4.089 local terms energy: -765.452089 where: bonds (distance) C4'-P energy: -146.387 bonds (distance) P-C4' energy: -158.862 flat angles C4'-P-C4' energy: -168.232 flat angles P-C4'-P energy: -106.115 tors. eta vs tors. theta energy: -185.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2073.657658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2073.657658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2073.657658 (E_RNA) where: Base-Base interactions energy: -1400.872 where: short stacking energy: -648.963 Base-Backbone interact. energy: -3.293 local terms energy: -669.492889 where: bonds (distance) C4'-P energy: -128.829 bonds (distance) P-C4' energy: -154.482 flat angles C4'-P-C4' energy: -158.141 flat angles P-C4'-P energy: -96.748 tors. eta vs tors. theta energy: -131.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1997.306928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1997.306928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1997.306928 (E_RNA) where: Base-Base interactions energy: -1316.058 where: short stacking energy: -668.501 Base-Backbone interact. energy: -2.066 local terms energy: -679.182697 where: bonds (distance) C4'-P energy: -143.758 bonds (distance) P-C4' energy: -150.265 flat angles C4'-P-C4' energy: -146.174 flat angles P-C4'-P energy: -87.125 tors. eta vs tors. theta energy: -151.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1982.159153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1982.159153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1982.159153 (E_RNA) where: Base-Base interactions energy: -1326.389 where: short stacking energy: -626.157 Base-Backbone interact. energy: -3.910 local terms energy: -651.860156 where: bonds (distance) C4'-P energy: -108.585 bonds (distance) P-C4' energy: -135.154 flat angles C4'-P-C4' energy: -157.315 flat angles P-C4'-P energy: -106.128 tors. eta vs tors. theta energy: -144.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1741.479251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.479251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.479251 (E_RNA) where: Base-Base interactions energy: -1153.409 where: short stacking energy: -543.810 Base-Backbone interact. energy: -2.288 local terms energy: -585.781643 where: bonds (distance) C4'-P energy: -118.195 bonds (distance) P-C4' energy: -135.576 flat angles C4'-P-C4' energy: -144.700 flat angles P-C4'-P energy: -72.636 tors. eta vs tors. theta energy: -114.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1600.425799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.425799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.425799 (E_RNA) where: Base-Base interactions energy: -1027.913 where: short stacking energy: -471.521 Base-Backbone interact. energy: -3.070 local terms energy: -569.443284 where: bonds (distance) C4'-P energy: -136.776 bonds (distance) P-C4' energy: -138.680 flat angles C4'-P-C4' energy: -128.005 flat angles P-C4'-P energy: -78.201 tors. eta vs tors. theta energy: -87.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1389.950887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.950887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.950887 (E_RNA) where: Base-Base interactions energy: -815.010 where: short stacking energy: -458.419 Base-Backbone interact. energy: -0.649 local terms energy: -574.292484 where: bonds (distance) C4'-P energy: -129.833 bonds (distance) P-C4' energy: -148.084 flat angles C4'-P-C4' energy: -124.301 flat angles P-C4'-P energy: -81.220 tors. eta vs tors. theta energy: -90.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1261.338289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.338289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1261.338289 (E_RNA) where: Base-Base interactions energy: -759.152 where: short stacking energy: -376.602 Base-Backbone interact. energy: -0.700 local terms energy: -501.486442 where: bonds (distance) C4'-P energy: -115.019 bonds (distance) P-C4' energy: -114.177 flat angles C4'-P-C4' energy: -133.383 flat angles P-C4'-P energy: -77.335 tors. eta vs tors. theta energy: -61.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1117.125548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.125548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.125548 (E_RNA) where: Base-Base interactions energy: -636.846 where: short stacking energy: -333.952 Base-Backbone interact. energy: 2.155 local terms energy: -482.435313 where: bonds (distance) C4'-P energy: -137.521 bonds (distance) P-C4' energy: -123.058 flat angles C4'-P-C4' energy: -112.899 flat angles P-C4'-P energy: -73.875 tors. eta vs tors. theta energy: -35.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -706.967319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.967319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.967319 (E_RNA) where: Base-Base interactions energy: -319.058 where: short stacking energy: -234.285 Base-Backbone interact. energy: 2.223 local terms energy: -390.132737 where: bonds (distance) C4'-P energy: -111.631 bonds (distance) P-C4' energy: -116.517 flat angles C4'-P-C4' energy: -113.978 flat angles P-C4'-P energy: -45.837 tors. eta vs tors. theta energy: -2.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2163.205177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2163.205177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2163.205177 (E_RNA) where: Base-Base interactions energy: -1420.147 where: short stacking energy: -751.208 Base-Backbone interact. energy: -5.784 local terms energy: -737.274191 where: bonds (distance) C4'-P energy: -155.315 bonds (distance) P-C4' energy: -143.213 flat angles C4'-P-C4' energy: -149.536 flat angles P-C4'-P energy: -93.570 tors. eta vs tors. theta energy: -195.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2146.359019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2146.359019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2146.359019 (E_RNA) where: Base-Base interactions energy: -1407.584 where: short stacking energy: -671.183 Base-Backbone interact. energy: -1.181 local terms energy: -737.593672 where: bonds (distance) C4'-P energy: -151.858 bonds (distance) P-C4' energy: -153.170 flat angles C4'-P-C4' energy: -161.771 flat angles P-C4'-P energy: -119.478 tors. eta vs tors. theta energy: -151.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -2054.214006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2054.214006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2054.214006 (E_RNA) where: Base-Base interactions energy: -1334.817 where: short stacking energy: -687.757 Base-Backbone interact. energy: -1.695 local terms energy: -717.701819 where: bonds (distance) C4'-P energy: -146.208 bonds (distance) P-C4' energy: -149.458 flat angles C4'-P-C4' energy: -155.869 flat angles P-C4'-P energy: -95.656 tors. eta vs tors. theta energy: -170.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1894.049811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1894.049811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1894.049811 (E_RNA) where: Base-Base interactions energy: -1254.033 where: short stacking energy: -611.022 Base-Backbone interact. energy: -2.681 local terms energy: -637.335350 where: bonds (distance) C4'-P energy: -127.814 bonds (distance) P-C4' energy: -135.612 flat angles C4'-P-C4' energy: -132.734 flat angles P-C4'-P energy: -100.650 tors. eta vs tors. theta energy: -140.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1787.717210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.717210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.717210 (E_RNA) where: Base-Base interactions energy: -1183.286 where: short stacking energy: -566.353 Base-Backbone interact. energy: -3.812 local terms energy: -600.619894 where: bonds (distance) C4'-P energy: -116.127 bonds (distance) P-C4' energy: -127.440 flat angles C4'-P-C4' energy: -128.440 flat angles P-C4'-P energy: -101.469 tors. eta vs tors. theta energy: -127.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1616.549403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.549403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.549403 (E_RNA) where: Base-Base interactions energy: -1028.767 where: short stacking energy: -499.415 Base-Backbone interact. energy: -0.329 local terms energy: -587.453576 where: bonds (distance) C4'-P energy: -148.322 bonds (distance) P-C4' energy: -121.915 flat angles C4'-P-C4' energy: -126.317 flat angles P-C4'-P energy: -90.180 tors. eta vs tors. theta energy: -100.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1348.740821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.740821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.740821 (E_RNA) where: Base-Base interactions energy: -848.044 where: short stacking energy: -435.983 Base-Backbone interact. energy: -2.724 local terms energy: -497.972521 where: bonds (distance) C4'-P energy: -105.257 bonds (distance) P-C4' energy: -134.143 flat angles C4'-P-C4' energy: -136.234 flat angles P-C4'-P energy: -62.140 tors. eta vs tors. theta energy: -60.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1189.549724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.549724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1189.549724 (E_RNA) where: Base-Base interactions energy: -698.398 where: short stacking energy: -370.683 Base-Backbone interact. energy: 1.192 local terms energy: -492.343456 where: bonds (distance) C4'-P energy: -131.168 bonds (distance) P-C4' energy: -117.394 flat angles C4'-P-C4' energy: -120.353 flat angles P-C4'-P energy: -78.555 tors. eta vs tors. theta energy: -44.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1115.811066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.811066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.811066 (E_RNA) where: Base-Base interactions energy: -673.371 where: short stacking energy: -311.229 Base-Backbone interact. energy: -4.119 local terms energy: -438.320846 where: bonds (distance) C4'-P energy: -86.762 bonds (distance) P-C4' energy: -136.435 flat angles C4'-P-C4' energy: -119.787 flat angles P-C4'-P energy: -60.222 tors. eta vs tors. theta energy: -35.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -796.937584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.937584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.937584 (E_RNA) where: Base-Base interactions energy: -347.820 where: short stacking energy: -236.770 Base-Backbone interact. energy: 0.396 local terms energy: -449.512897 where: bonds (distance) C4'-P energy: -119.686 bonds (distance) P-C4' energy: -148.268 flat angles C4'-P-C4' energy: -121.211 flat angles P-C4'-P energy: -55.894 tors. eta vs tors. theta energy: -4.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2260.056046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.056046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.056046 (E_RNA) where: Base-Base interactions energy: -1541.424 where: short stacking energy: -680.061 Base-Backbone interact. energy: -7.421 local terms energy: -711.211486 where: bonds (distance) C4'-P energy: -141.635 bonds (distance) P-C4' energy: -140.410 flat angles C4'-P-C4' energy: -165.520 flat angles P-C4'-P energy: -111.131 tors. eta vs tors. theta energy: -152.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2082.440998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.440998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.440998 (E_RNA) where: Base-Base interactions energy: -1358.398 where: short stacking energy: -693.493 Base-Backbone interact. energy: 0.603 local terms energy: -724.646774 where: bonds (distance) C4'-P energy: -140.718 bonds (distance) P-C4' energy: -149.391 flat angles C4'-P-C4' energy: -155.829 flat angles P-C4'-P energy: -94.857 tors. eta vs tors. theta energy: -183.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2058.953660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2058.953660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.953660 (E_RNA) where: Base-Base interactions energy: -1354.255 where: short stacking energy: -678.379 Base-Backbone interact. energy: -0.672 local terms energy: -704.026268 where: bonds (distance) C4'-P energy: -142.421 bonds (distance) P-C4' energy: -136.170 flat angles C4'-P-C4' energy: -159.029 flat angles P-C4'-P energy: -99.422 tors. eta vs tors. theta energy: -166.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1925.527141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1925.527141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1925.527141 (E_RNA) where: Base-Base interactions energy: -1290.551 where: short stacking energy: -604.565 Base-Backbone interact. energy: 0.880 local terms energy: -635.855796 where: bonds (distance) C4'-P energy: -139.420 bonds (distance) P-C4' energy: -137.452 flat angles C4'-P-C4' energy: -128.491 flat angles P-C4'-P energy: -100.547 tors. eta vs tors. theta energy: -129.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1785.808224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1785.808224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1785.808224 (E_RNA) where: Base-Base interactions energy: -1187.063 where: short stacking energy: -573.119 Base-Backbone interact. energy: -4.203 local terms energy: -594.542398 where: bonds (distance) C4'-P energy: -127.316 bonds (distance) P-C4' energy: -131.481 flat angles C4'-P-C4' energy: -144.074 flat angles P-C4'-P energy: -70.043 tors. eta vs tors. theta energy: -121.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1612.511662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.511662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.511662 (E_RNA) where: Base-Base interactions energy: -1026.881 where: short stacking energy: -495.441 Base-Backbone interact. energy: -1.896 local terms energy: -583.735544 where: bonds (distance) C4'-P energy: -133.557 bonds (distance) P-C4' energy: -132.150 flat angles C4'-P-C4' energy: -144.828 flat angles P-C4'-P energy: -76.777 tors. eta vs tors. theta energy: -96.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1397.730219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.730219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.730219 (E_RNA) where: Base-Base interactions energy: -900.302 where: short stacking energy: -467.675 Base-Backbone interact. energy: -0.556 local terms energy: -496.872768 where: bonds (distance) C4'-P energy: -101.054 bonds (distance) P-C4' energy: -115.154 flat angles C4'-P-C4' energy: -136.233 flat angles P-C4'-P energy: -70.241 tors. eta vs tors. theta energy: -74.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1185.941679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.941679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.941679 (E_RNA) where: Base-Base interactions energy: -714.585 where: short stacking energy: -356.313 Base-Backbone interact. energy: 0.856 local terms energy: -472.212523 where: bonds (distance) C4'-P energy: -122.731 bonds (distance) P-C4' energy: -135.004 flat angles C4'-P-C4' energy: -102.354 flat angles P-C4'-P energy: -72.441 tors. eta vs tors. theta energy: -39.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1210.103210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.103210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.103210 (E_RNA) where: Base-Base interactions energy: -735.440 where: short stacking energy: -338.405 Base-Backbone interact. energy: 3.160 local terms energy: -477.823520 where: bonds (distance) C4'-P energy: -126.091 bonds (distance) P-C4' energy: -136.702 flat angles C4'-P-C4' energy: -125.513 flat angles P-C4'-P energy: -62.885 tors. eta vs tors. theta energy: -26.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -770.332773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.332773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.332773 (E_RNA) where: Base-Base interactions energy: -386.646 where: short stacking energy: -230.020 Base-Backbone interact. energy: -1.087 local terms energy: -382.600283 where: bonds (distance) C4'-P energy: -88.181 bonds (distance) P-C4' energy: -132.952 flat angles C4'-P-C4' energy: -97.653 flat angles P-C4'-P energy: -70.018 tors. eta vs tors. theta energy: 6.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2252.977020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2252.977020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2252.977020 (E_RNA) where: Base-Base interactions energy: -1525.903 where: short stacking energy: -679.680 Base-Backbone interact. energy: -3.583 local terms energy: -723.490908 where: bonds (distance) C4'-P energy: -148.606 bonds (distance) P-C4' energy: -171.264 flat angles C4'-P-C4' energy: -162.841 flat angles P-C4'-P energy: -98.060 tors. eta vs tors. theta energy: -142.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2071.419333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2071.419333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2071.419333 (E_RNA) where: Base-Base interactions energy: -1305.593 where: short stacking energy: -686.552 Base-Backbone interact. energy: -2.029 local terms energy: -763.797298 where: bonds (distance) C4'-P energy: -144.283 bonds (distance) P-C4' energy: -157.344 flat angles C4'-P-C4' energy: -176.993 flat angles P-C4'-P energy: -105.522 tors. eta vs tors. theta energy: -179.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -2049.828316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2049.828316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2049.828316 (E_RNA) where: Base-Base interactions energy: -1350.430 where: short stacking energy: -686.922 Base-Backbone interact. energy: -2.536 local terms energy: -696.861871 where: bonds (distance) C4'-P energy: -139.141 bonds (distance) P-C4' energy: -145.872 flat angles C4'-P-C4' energy: -144.086 flat angles P-C4'-P energy: -98.967 tors. eta vs tors. theta energy: -168.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1984.585494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1984.585494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1984.585494 (E_RNA) where: Base-Base interactions energy: -1291.170 where: short stacking energy: -620.026 Base-Backbone interact. energy: 0.779 local terms energy: -694.194757 where: bonds (distance) C4'-P energy: -137.537 bonds (distance) P-C4' energy: -159.139 flat angles C4'-P-C4' energy: -139.331 flat angles P-C4'-P energy: -113.494 tors. eta vs tors. theta energy: -144.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1886.497569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.497569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.497569 (E_RNA) where: Base-Base interactions energy: -1238.854 where: short stacking energy: -582.425 Base-Backbone interact. energy: 0.236 local terms energy: -647.879487 where: bonds (distance) C4'-P energy: -144.826 bonds (distance) P-C4' energy: -135.137 flat angles C4'-P-C4' energy: -144.538 flat angles P-C4'-P energy: -96.515 tors. eta vs tors. theta energy: -126.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1531.445721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.445721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.445721 (E_RNA) where: Base-Base interactions energy: -967.358 where: short stacking energy: -448.910 Base-Backbone interact. energy: 5.042 local terms energy: -569.129824 where: bonds (distance) C4'-P energy: -148.329 bonds (distance) P-C4' energy: -133.293 flat angles C4'-P-C4' energy: -129.241 flat angles P-C4'-P energy: -91.671 tors. eta vs tors. theta energy: -66.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1373.807308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.807308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.807308 (E_RNA) where: Base-Base interactions energy: -822.102 where: short stacking energy: -381.007 Base-Backbone interact. energy: -1.643 local terms energy: -550.061631 where: bonds (distance) C4'-P energy: -105.954 bonds (distance) P-C4' energy: -154.374 flat angles C4'-P-C4' energy: -149.400 flat angles P-C4'-P energy: -64.780 tors. eta vs tors. theta energy: -75.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1229.440832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.440832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.440832 (E_RNA) where: Base-Base interactions energy: -721.282 where: short stacking energy: -377.463 Base-Backbone interact. energy: -1.757 local terms energy: -506.401910 where: bonds (distance) C4'-P energy: -132.246 bonds (distance) P-C4' energy: -127.658 flat angles C4'-P-C4' energy: -139.834 flat angles P-C4'-P energy: -68.930 tors. eta vs tors. theta energy: -37.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1271.853481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.853481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.853481 (E_RNA) where: Base-Base interactions energy: -778.176 where: short stacking energy: -399.136 Base-Backbone interact. energy: 1.137 local terms energy: -494.814370 where: bonds (distance) C4'-P energy: -107.063 bonds (distance) P-C4' energy: -117.221 flat angles C4'-P-C4' energy: -144.903 flat angles P-C4'-P energy: -84.085 tors. eta vs tors. theta energy: -41.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -815.990971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.990971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.990971 (E_RNA) where: Base-Base interactions energy: -418.236 where: short stacking energy: -231.592 Base-Backbone interact. energy: -3.069 local terms energy: -394.685783 where: bonds (distance) C4'-P energy: -119.198 bonds (distance) P-C4' energy: -127.959 flat angles C4'-P-C4' energy: -88.280 flat angles P-C4'-P energy: -52.639 tors. eta vs tors. theta energy: -6.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2275.880645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.880645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.880645 (E_RNA) where: Base-Base interactions energy: -1525.058 where: short stacking energy: -682.338 Base-Backbone interact. energy: -8.118 local terms energy: -742.704108 where: bonds (distance) C4'-P energy: -152.118 bonds (distance) P-C4' energy: -159.025 flat angles C4'-P-C4' energy: -166.010 flat angles P-C4'-P energy: -103.124 tors. eta vs tors. theta energy: -162.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2105.934364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2105.934364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2105.934364 (E_RNA) where: Base-Base interactions energy: -1373.597 where: short stacking energy: -672.071 Base-Backbone interact. energy: -3.394 local terms energy: -728.943518 where: bonds (distance) C4'-P energy: -130.227 bonds (distance) P-C4' energy: -161.612 flat angles C4'-P-C4' energy: -154.454 flat angles P-C4'-P energy: -106.168 tors. eta vs tors. theta energy: -176.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2099.064974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2099.064974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2099.064974 (E_RNA) where: Base-Base interactions energy: -1404.096 where: short stacking energy: -692.454 Base-Backbone interact. energy: -4.959 local terms energy: -690.009760 where: bonds (distance) C4'-P energy: -126.534 bonds (distance) P-C4' energy: -132.589 flat angles C4'-P-C4' energy: -158.024 flat angles P-C4'-P energy: -99.887 tors. eta vs tors. theta energy: -172.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1962.945421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.945421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.945421 (E_RNA) where: Base-Base interactions energy: -1288.360 where: short stacking energy: -614.925 Base-Backbone interact. energy: -2.173 local terms energy: -672.412743 where: bonds (distance) C4'-P energy: -133.961 bonds (distance) P-C4' energy: -134.804 flat angles C4'-P-C4' energy: -150.865 flat angles P-C4'-P energy: -91.667 tors. eta vs tors. theta energy: -161.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1850.719540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1850.719540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1850.719540 (E_RNA) where: Base-Base interactions energy: -1215.729 where: short stacking energy: -541.310 Base-Backbone interact. energy: -0.997 local terms energy: -633.993888 where: bonds (distance) C4'-P energy: -123.363 bonds (distance) P-C4' energy: -138.938 flat angles C4'-P-C4' energy: -150.760 flat angles P-C4'-P energy: -98.701 tors. eta vs tors. theta energy: -122.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1545.179035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.179035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1545.179035 (E_RNA) where: Base-Base interactions energy: -983.647 where: short stacking energy: -459.281 Base-Backbone interact. energy: 5.610 local terms energy: -567.142777 where: bonds (distance) C4'-P energy: -139.983 bonds (distance) P-C4' energy: -115.441 flat angles C4'-P-C4' energy: -136.107 flat angles P-C4'-P energy: -87.770 tors. eta vs tors. theta energy: -87.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1385.596636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.596636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.596636 (E_RNA) where: Base-Base interactions energy: -853.018 where: short stacking energy: -431.069 Base-Backbone interact. energy: -1.503 local terms energy: -531.075724 where: bonds (distance) C4'-P energy: -137.190 bonds (distance) P-C4' energy: -116.105 flat angles C4'-P-C4' energy: -138.614 flat angles P-C4'-P energy: -87.822 tors. eta vs tors. theta energy: -51.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1172.543155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.543155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1172.543155 (E_RNA) where: Base-Base interactions energy: -684.286 where: short stacking energy: -382.505 Base-Backbone interact. energy: -4.091 local terms energy: -484.165889 where: bonds (distance) C4'-P energy: -110.784 bonds (distance) P-C4' energy: -137.580 flat angles C4'-P-C4' energy: -120.616 flat angles P-C4'-P energy: -67.697 tors. eta vs tors. theta energy: -47.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1252.441395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.441395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.441395 (E_RNA) where: Base-Base interactions energy: -782.863 where: short stacking energy: -391.752 Base-Backbone interact. energy: -2.282 local terms energy: -467.295837 where: bonds (distance) C4'-P energy: -120.027 bonds (distance) P-C4' energy: -117.650 flat angles C4'-P-C4' energy: -116.789 flat angles P-C4'-P energy: -55.979 tors. eta vs tors. theta energy: -56.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -819.557784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.557784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.557784 (E_RNA) where: Base-Base interactions energy: -413.527 where: short stacking energy: -231.314 Base-Backbone interact. energy: 2.146 local terms energy: -408.176806 where: bonds (distance) C4'-P energy: -121.552 bonds (distance) P-C4' energy: -138.761 flat angles C4'-P-C4' energy: -103.276 flat angles P-C4'-P energy: -45.502 tors. eta vs tors. theta energy: 0.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2299.221824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2299.221824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2299.221824 (E_RNA) where: Base-Base interactions energy: -1557.181 where: short stacking energy: -683.074 Base-Backbone interact. energy: 0.162 local terms energy: -742.203132 where: bonds (distance) C4'-P energy: -155.227 bonds (distance) P-C4' energy: -156.328 flat angles C4'-P-C4' energy: -164.711 flat angles P-C4'-P energy: -113.862 tors. eta vs tors. theta energy: -152.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2112.611489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.611489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.611489 (E_RNA) where: Base-Base interactions energy: -1367.143 where: short stacking energy: -699.242 Base-Backbone interact. energy: -5.728 local terms energy: -739.740855 where: bonds (distance) C4'-P energy: -149.793 bonds (distance) P-C4' energy: -143.030 flat angles C4'-P-C4' energy: -159.544 flat angles P-C4'-P energy: -99.606 tors. eta vs tors. theta energy: -187.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -2062.236678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2062.236678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2062.236678 (E_RNA) where: Base-Base interactions energy: -1347.124 where: short stacking energy: -667.777 Base-Backbone interact. energy: -0.493 local terms energy: -714.620208 where: bonds (distance) C4'-P energy: -133.671 bonds (distance) P-C4' energy: -148.365 flat angles C4'-P-C4' energy: -150.833 flat angles P-C4'-P energy: -109.422 tors. eta vs tors. theta energy: -172.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1971.645667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.645667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.645667 (E_RNA) where: Base-Base interactions energy: -1304.056 where: short stacking energy: -618.461 Base-Backbone interact. energy: 2.913 local terms energy: -670.502769 where: bonds (distance) C4'-P energy: -134.091 bonds (distance) P-C4' energy: -132.952 flat angles C4'-P-C4' energy: -160.818 flat angles P-C4'-P energy: -103.800 tors. eta vs tors. theta energy: -138.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1891.244134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.244134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.244134 (E_RNA) where: Base-Base interactions energy: -1260.685 where: short stacking energy: -594.344 Base-Backbone interact. energy: -3.791 local terms energy: -626.767368 where: bonds (distance) C4'-P energy: -128.422 bonds (distance) P-C4' energy: -136.971 flat angles C4'-P-C4' energy: -146.737 flat angles P-C4'-P energy: -99.855 tors. eta vs tors. theta energy: -114.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1587.391550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.391550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.391550 (E_RNA) where: Base-Base interactions energy: -1012.658 where: short stacking energy: -477.306 Base-Backbone interact. energy: 3.842 local terms energy: -578.575775 where: bonds (distance) C4'-P energy: -129.339 bonds (distance) P-C4' energy: -152.381 flat angles C4'-P-C4' energy: -133.962 flat angles P-C4'-P energy: -83.762 tors. eta vs tors. theta energy: -79.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1365.047004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.047004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.047004 (E_RNA) where: Base-Base interactions energy: -834.567 where: short stacking energy: -434.851 Base-Backbone interact. energy: 5.374 local terms energy: -535.854094 where: bonds (distance) C4'-P energy: -124.047 bonds (distance) P-C4' energy: -120.149 flat angles C4'-P-C4' energy: -126.115 flat angles P-C4'-P energy: -93.178 tors. eta vs tors. theta energy: -72.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1290.183336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.183336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.183336 (E_RNA) where: Base-Base interactions energy: -792.787 where: short stacking energy: -404.496 Base-Backbone interact. energy: 0.678 local terms energy: -498.074634 where: bonds (distance) C4'-P energy: -115.719 bonds (distance) P-C4' energy: -117.570 flat angles C4'-P-C4' energy: -117.663 flat angles P-C4'-P energy: -89.191 tors. eta vs tors. theta energy: -57.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1138.993969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.993969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.993969 (E_RNA) where: Base-Base interactions energy: -694.120 where: short stacking energy: -353.276 Base-Backbone interact. energy: -2.017 local terms energy: -442.856767 where: bonds (distance) C4'-P energy: -110.174 bonds (distance) P-C4' energy: -133.738 flat angles C4'-P-C4' energy: -92.056 flat angles P-C4'-P energy: -60.846 tors. eta vs tors. theta energy: -46.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -888.464070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.464070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.464070 (E_RNA) where: Base-Base interactions energy: -448.654 where: short stacking energy: -268.350 Base-Backbone interact. energy: 1.413 local terms energy: -441.222701 where: bonds (distance) C4'-P energy: -148.735 bonds (distance) P-C4' energy: -129.368 flat angles C4'-P-C4' energy: -101.762 flat angles P-C4'-P energy: -58.588 tors. eta vs tors. theta energy: -2.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2350.751822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2350.751822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2350.751822 (E_RNA) where: Base-Base interactions energy: -1614.487 where: short stacking energy: -688.992 Base-Backbone interact. energy: -2.343 local terms energy: -733.921723 where: bonds (distance) C4'-P energy: -156.488 bonds (distance) P-C4' energy: -159.635 flat angles C4'-P-C4' energy: -167.044 flat angles P-C4'-P energy: -99.501 tors. eta vs tors. theta energy: -151.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2134.302176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2134.302176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2134.302176 (E_RNA) where: Base-Base interactions energy: -1405.945 where: short stacking energy: -684.849 Base-Backbone interact. energy: -2.475 local terms energy: -725.881895 where: bonds (distance) C4'-P energy: -140.266 bonds (distance) P-C4' energy: -136.895 flat angles C4'-P-C4' energy: -162.928 flat angles P-C4'-P energy: -106.748 tors. eta vs tors. theta energy: -179.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2062.239397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2062.239397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2062.239397 (E_RNA) where: Base-Base interactions energy: -1373.928 where: short stacking energy: -701.171 Base-Backbone interact. energy: -2.181 local terms energy: -686.130567 where: bonds (distance) C4'-P energy: -124.715 bonds (distance) P-C4' energy: -136.315 flat angles C4'-P-C4' energy: -152.874 flat angles P-C4'-P energy: -94.210 tors. eta vs tors. theta energy: -178.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -2015.390681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.390681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.390681 (E_RNA) where: Base-Base interactions energy: -1344.914 where: short stacking energy: -663.689 Base-Backbone interact. energy: -4.890 local terms energy: -665.587005 where: bonds (distance) C4'-P energy: -139.493 bonds (distance) P-C4' energy: -109.943 flat angles C4'-P-C4' energy: -162.616 flat angles P-C4'-P energy: -98.144 tors. eta vs tors. theta energy: -155.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1856.485777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1856.485777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1856.485777 (E_RNA) where: Base-Base interactions energy: -1229.464 where: short stacking energy: -555.668 Base-Backbone interact. energy: 0.901 local terms energy: -627.922910 where: bonds (distance) C4'-P energy: -126.878 bonds (distance) P-C4' energy: -145.854 flat angles C4'-P-C4' energy: -158.823 flat angles P-C4'-P energy: -99.366 tors. eta vs tors. theta energy: -97.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1620.408728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.408728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.408728 (E_RNA) where: Base-Base interactions energy: -1047.379 where: short stacking energy: -497.033 Base-Backbone interact. energy: -3.610 local terms energy: -569.419546 where: bonds (distance) C4'-P energy: -131.794 bonds (distance) P-C4' energy: -143.055 flat angles C4'-P-C4' energy: -126.853 flat angles P-C4'-P energy: -71.419 tors. eta vs tors. theta energy: -96.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1348.433071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.433071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.433071 (E_RNA) where: Base-Base interactions energy: -834.049 where: short stacking energy: -415.167 Base-Backbone interact. energy: 3.340 local terms energy: -517.724501 where: bonds (distance) C4'-P energy: -115.168 bonds (distance) P-C4' energy: -125.779 flat angles C4'-P-C4' energy: -133.953 flat angles P-C4'-P energy: -86.454 tors. eta vs tors. theta energy: -56.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1257.787681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.787681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.787681 (E_RNA) where: Base-Base interactions energy: -752.075 where: short stacking energy: -362.062 Base-Backbone interact. energy: -0.963 local terms energy: -504.749661 where: bonds (distance) C4'-P energy: -121.532 bonds (distance) P-C4' energy: -136.429 flat angles C4'-P-C4' energy: -120.183 flat angles P-C4'-P energy: -90.173 tors. eta vs tors. theta energy: -36.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1074.174068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.174068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.174068 (E_RNA) where: Base-Base interactions energy: -617.480 where: short stacking energy: -322.912 Base-Backbone interact. energy: -3.193 local terms energy: -453.500777 where: bonds (distance) C4'-P energy: -113.123 bonds (distance) P-C4' energy: -134.685 flat angles C4'-P-C4' energy: -118.559 flat angles P-C4'-P energy: -70.867 tors. eta vs tors. theta energy: -16.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -848.875937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.875937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.875937 (E_RNA) where: Base-Base interactions energy: -411.398 where: short stacking energy: -239.759 Base-Backbone interact. energy: 9.084 local terms energy: -446.562301 where: bonds (distance) C4'-P energy: -110.921 bonds (distance) P-C4' energy: -134.185 flat angles C4'-P-C4' energy: -116.314 flat angles P-C4'-P energy: -76.739 tors. eta vs tors. theta energy: -8.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2371.425511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.425511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.425511 (E_RNA) where: Base-Base interactions energy: -1644.655 where: short stacking energy: -712.041 Base-Backbone interact. energy: -2.978 local terms energy: -723.792821 where: bonds (distance) C4'-P energy: -147.694 bonds (distance) P-C4' energy: -165.439 flat angles C4'-P-C4' energy: -155.789 flat angles P-C4'-P energy: -101.063 tors. eta vs tors. theta energy: -153.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2112.781348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.781348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.781348 (E_RNA) where: Base-Base interactions energy: -1400.902 where: short stacking energy: -675.417 Base-Backbone interact. energy: -0.436 local terms energy: -711.443344 where: bonds (distance) C4'-P energy: -131.146 bonds (distance) P-C4' energy: -159.635 flat angles C4'-P-C4' energy: -154.222 flat angles P-C4'-P energy: -101.804 tors. eta vs tors. theta energy: -164.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2102.192655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.192655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2102.192655 (E_RNA) where: Base-Base interactions energy: -1385.781 where: short stacking energy: -712.656 Base-Backbone interact. energy: -0.859 local terms energy: -715.552740 where: bonds (distance) C4'-P energy: -142.281 bonds (distance) P-C4' energy: -154.141 flat angles C4'-P-C4' energy: -153.109 flat angles P-C4'-P energy: -103.839 tors. eta vs tors. theta energy: -162.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -2040.241133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2040.241133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2040.241133 (E_RNA) where: Base-Base interactions energy: -1359.330 where: short stacking energy: -651.122 Base-Backbone interact. energy: -0.657 local terms energy: -680.253934 where: bonds (distance) C4'-P energy: -123.240 bonds (distance) P-C4' energy: -136.311 flat angles C4'-P-C4' energy: -151.501 flat angles P-C4'-P energy: -109.583 tors. eta vs tors. theta energy: -159.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1883.079537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.079537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.079537 (E_RNA) where: Base-Base interactions energy: -1237.775 where: short stacking energy: -581.289 Base-Backbone interact. energy: -1.416 local terms energy: -643.887613 where: bonds (distance) C4'-P energy: -135.292 bonds (distance) P-C4' energy: -136.751 flat angles C4'-P-C4' energy: -157.368 flat angles P-C4'-P energy: -87.704 tors. eta vs tors. theta energy: -126.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1649.200808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.200808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.200808 (E_RNA) where: Base-Base interactions energy: -1056.760 where: short stacking energy: -509.967 Base-Backbone interact. energy: -0.916 local terms energy: -591.525142 where: bonds (distance) C4'-P energy: -148.757 bonds (distance) P-C4' energy: -115.610 flat angles C4'-P-C4' energy: -143.348 flat angles P-C4'-P energy: -93.285 tors. eta vs tors. theta energy: -90.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1414.416328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.416328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.416328 (E_RNA) where: Base-Base interactions energy: -853.299 where: short stacking energy: -428.569 Base-Backbone interact. energy: -1.124 local terms energy: -559.993116 where: bonds (distance) C4'-P energy: -127.825 bonds (distance) P-C4' energy: -141.939 flat angles C4'-P-C4' energy: -134.422 flat angles P-C4'-P energy: -85.105 tors. eta vs tors. theta energy: -70.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1226.182896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.182896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.182896 (E_RNA) where: Base-Base interactions energy: -711.802 where: short stacking energy: -376.104 Base-Backbone interact. energy: 0.823 local terms energy: -515.203994 where: bonds (distance) C4'-P energy: -132.145 bonds (distance) P-C4' energy: -148.462 flat angles C4'-P-C4' energy: -126.895 flat angles P-C4'-P energy: -62.220 tors. eta vs tors. theta energy: -45.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1113.236782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1113.236782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1113.236782 (E_RNA) where: Base-Base interactions energy: -668.311 where: short stacking energy: -337.519 Base-Backbone interact. energy: 1.814 local terms energy: -446.739933 where: bonds (distance) C4'-P energy: -129.082 bonds (distance) P-C4' energy: -115.699 flat angles C4'-P-C4' energy: -109.608 flat angles P-C4'-P energy: -60.129 tors. eta vs tors. theta energy: -32.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -846.023146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.023146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.023146 (E_RNA) where: Base-Base interactions energy: -437.130 where: short stacking energy: -268.575 Base-Backbone interact. energy: 7.138 local terms energy: -416.031556 where: bonds (distance) C4'-P energy: -117.041 bonds (distance) P-C4' energy: -142.647 flat angles C4'-P-C4' energy: -94.440 flat angles P-C4'-P energy: -50.103 tors. eta vs tors. theta energy: -11.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2382.128283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2382.128283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2382.128283 (E_RNA) where: Base-Base interactions energy: -1632.250 where: short stacking energy: -706.608 Base-Backbone interact. energy: -4.588 local terms energy: -745.290631 where: bonds (distance) C4'-P energy: -155.164 bonds (distance) P-C4' energy: -148.894 flat angles C4'-P-C4' energy: -159.194 flat angles P-C4'-P energy: -120.696 tors. eta vs tors. theta energy: -161.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2108.589396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2108.589396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2108.589396 (E_RNA) where: Base-Base interactions energy: -1351.475 where: short stacking energy: -701.806 Base-Backbone interact. energy: -1.731 local terms energy: -755.382738 where: bonds (distance) C4'-P energy: -145.968 bonds (distance) P-C4' energy: -153.010 flat angles C4'-P-C4' energy: -169.330 flat angles P-C4'-P energy: -120.209 tors. eta vs tors. theta energy: -166.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2077.584995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2077.584995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2077.584995 (E_RNA) where: Base-Base interactions energy: -1379.517 where: short stacking energy: -683.979 Base-Backbone interact. energy: 1.553 local terms energy: -699.621767 where: bonds (distance) C4'-P energy: -136.682 bonds (distance) P-C4' energy: -152.783 flat angles C4'-P-C4' energy: -156.578 flat angles P-C4'-P energy: -94.530 tors. eta vs tors. theta energy: -159.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -2063.557461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2063.557461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2063.557461 (E_RNA) where: Base-Base interactions energy: -1350.560 where: short stacking energy: -658.187 Base-Backbone interact. energy: -3.962 local terms energy: -709.035092 where: bonds (distance) C4'-P energy: -153.461 bonds (distance) P-C4' energy: -145.065 flat angles C4'-P-C4' energy: -159.867 flat angles P-C4'-P energy: -93.029 tors. eta vs tors. theta energy: -157.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1870.297523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1870.297523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1870.297523 (E_RNA) where: Base-Base interactions energy: -1219.620 where: short stacking energy: -567.317 Base-Backbone interact. energy: -0.724 local terms energy: -649.954100 where: bonds (distance) C4'-P energy: -129.209 bonds (distance) P-C4' energy: -131.984 flat angles C4'-P-C4' energy: -169.733 flat angles P-C4'-P energy: -101.603 tors. eta vs tors. theta energy: -117.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1617.982288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.982288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.982288 (E_RNA) where: Base-Base interactions energy: -1042.785 where: short stacking energy: -511.787 Base-Backbone interact. energy: 3.440 local terms energy: -578.637407 where: bonds (distance) C4'-P energy: -113.353 bonds (distance) P-C4' energy: -141.084 flat angles C4'-P-C4' energy: -146.317 flat angles P-C4'-P energy: -80.362 tors. eta vs tors. theta energy: -97.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1356.289529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.289529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.289529 (E_RNA) where: Base-Base interactions energy: -842.218 where: short stacking energy: -411.488 Base-Backbone interact. energy: -3.087 local terms energy: -510.985325 where: bonds (distance) C4'-P energy: -130.153 bonds (distance) P-C4' energy: -123.978 flat angles C4'-P-C4' energy: -107.984 flat angles P-C4'-P energy: -75.932 tors. eta vs tors. theta energy: -72.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1332.005690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.005690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.005690 (E_RNA) where: Base-Base interactions energy: -791.183 where: short stacking energy: -393.467 Base-Backbone interact. energy: -3.240 local terms energy: -537.582870 where: bonds (distance) C4'-P energy: -130.250 bonds (distance) P-C4' energy: -136.147 flat angles C4'-P-C4' energy: -129.832 flat angles P-C4'-P energy: -87.908 tors. eta vs tors. theta energy: -53.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1083.692073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.692073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.692073 (E_RNA) where: Base-Base interactions energy: -614.264 where: short stacking energy: -342.150 Base-Backbone interact. energy: 7.772 local terms energy: -477.200056 where: bonds (distance) C4'-P energy: -111.840 bonds (distance) P-C4' energy: -134.214 flat angles C4'-P-C4' energy: -122.274 flat angles P-C4'-P energy: -70.777 tors. eta vs tors. theta energy: -38.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -830.355530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.355530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.355530 (E_RNA) where: Base-Base interactions energy: -394.708 where: short stacking energy: -240.283 Base-Backbone interact. energy: -2.176 local terms energy: -433.471165 where: bonds (distance) C4'-P energy: -111.458 bonds (distance) P-C4' energy: -128.935 flat angles C4'-P-C4' energy: -119.016 flat angles P-C4'-P energy: -71.484 tors. eta vs tors. theta energy: -2.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2402.040651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2402.040651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2402.040651 (E_RNA) where: Base-Base interactions energy: -1627.968 where: short stacking energy: -702.556 Base-Backbone interact. energy: -3.263 local terms energy: -770.809937 where: bonds (distance) C4'-P energy: -162.989 bonds (distance) P-C4' energy: -166.054 flat angles C4'-P-C4' energy: -150.221 flat angles P-C4'-P energy: -123.046 tors. eta vs tors. theta energy: -168.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2139.226485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2139.226485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2139.226485 (E_RNA) where: Base-Base interactions energy: -1396.161 where: short stacking energy: -709.454 Base-Backbone interact. energy: -4.844 local terms energy: -738.221479 where: bonds (distance) C4'-P energy: -142.441 bonds (distance) P-C4' energy: -140.357 flat angles C4'-P-C4' energy: -172.802 flat angles P-C4'-P energy: -102.505 tors. eta vs tors. theta energy: -180.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2022.056660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2022.056660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2022.056660 (E_RNA) where: Base-Base interactions energy: -1331.865 where: short stacking energy: -669.732 Base-Backbone interact. energy: -5.346 local terms energy: -684.846469 where: bonds (distance) C4'-P energy: -137.205 bonds (distance) P-C4' energy: -147.849 flat angles C4'-P-C4' energy: -146.455 flat angles P-C4'-P energy: -102.002 tors. eta vs tors. theta energy: -151.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -2089.151679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.151679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.151679 (E_RNA) where: Base-Base interactions energy: -1404.583 where: short stacking energy: -659.399 Base-Backbone interact. energy: -5.240 local terms energy: -679.328561 where: bonds (distance) C4'-P energy: -136.237 bonds (distance) P-C4' energy: -136.565 flat angles C4'-P-C4' energy: -151.015 flat angles P-C4'-P energy: -105.938 tors. eta vs tors. theta energy: -149.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1891.255632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.255632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.255632 (E_RNA) where: Base-Base interactions energy: -1261.886 where: short stacking energy: -584.821 Base-Backbone interact. energy: -0.738 local terms energy: -628.631152 where: bonds (distance) C4'-P energy: -132.989 bonds (distance) P-C4' energy: -143.865 flat angles C4'-P-C4' energy: -148.708 flat angles P-C4'-P energy: -88.563 tors. eta vs tors. theta energy: -114.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1735.839969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.839969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.839969 (E_RNA) where: Base-Base interactions energy: -1150.602 where: short stacking energy: -545.024 Base-Backbone interact. energy: 4.936 local terms energy: -590.174719 where: bonds (distance) C4'-P energy: -136.323 bonds (distance) P-C4' energy: -131.511 flat angles C4'-P-C4' energy: -129.433 flat angles P-C4'-P energy: -104.014 tors. eta vs tors. theta energy: -88.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1309.362458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.362458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.362458 (E_RNA) where: Base-Base interactions energy: -741.128 where: short stacking energy: -398.747 Base-Backbone interact. energy: 0.582 local terms energy: -568.816039 where: bonds (distance) C4'-P energy: -135.567 bonds (distance) P-C4' energy: -149.987 flat angles C4'-P-C4' energy: -136.085 flat angles P-C4'-P energy: -92.303 tors. eta vs tors. theta energy: -54.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1284.600546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.600546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.600546 (E_RNA) where: Base-Base interactions energy: -825.331 where: short stacking energy: -429.143 Base-Backbone interact. energy: -1.240 local terms energy: -458.029927 where: bonds (distance) C4'-P energy: -99.730 bonds (distance) P-C4' energy: -112.607 flat angles C4'-P-C4' energy: -115.910 flat angles P-C4'-P energy: -76.634 tors. eta vs tors. theta energy: -53.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1137.748074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.748074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.748074 (E_RNA) where: Base-Base interactions energy: -667.199 where: short stacking energy: -356.368 Base-Backbone interact. energy: 0.532 local terms energy: -471.081143 where: bonds (distance) C4'-P energy: -124.320 bonds (distance) P-C4' energy: -124.504 flat angles C4'-P-C4' energy: -109.832 flat angles P-C4'-P energy: -79.100 tors. eta vs tors. theta energy: -33.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -762.077076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.077076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.077076 (E_RNA) where: Base-Base interactions energy: -366.649 where: short stacking energy: -239.583 Base-Backbone interact. energy: 9.552 local terms energy: -404.980146 where: bonds (distance) C4'-P energy: -138.338 bonds (distance) P-C4' energy: -118.683 flat angles C4'-P-C4' energy: -88.203 flat angles P-C4'-P energy: -59.817 tors. eta vs tors. theta energy: 0.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2374.758374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2374.758374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2374.758374 (E_RNA) where: Base-Base interactions energy: -1631.331 where: short stacking energy: -686.886 Base-Backbone interact. energy: -0.791 local terms energy: -742.636423 where: bonds (distance) C4'-P energy: -150.605 bonds (distance) P-C4' energy: -153.260 flat angles C4'-P-C4' energy: -163.215 flat angles P-C4'-P energy: -108.359 tors. eta vs tors. theta energy: -167.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2207.400626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.400626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.400626 (E_RNA) where: Base-Base interactions energy: -1453.083 where: short stacking energy: -721.990 Base-Backbone interact. energy: -5.110 local terms energy: -749.207694 where: bonds (distance) C4'-P energy: -136.201 bonds (distance) P-C4' energy: -153.766 flat angles C4'-P-C4' energy: -155.750 flat angles P-C4'-P energy: -116.193 tors. eta vs tors. theta energy: -187.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2169.580175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2169.580175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2169.580175 (E_RNA) where: Base-Base interactions energy: -1452.339 where: short stacking energy: -693.273 Base-Backbone interact. energy: -0.926 local terms energy: -716.315480 where: bonds (distance) C4'-P energy: -140.391 bonds (distance) P-C4' energy: -145.110 flat angles C4'-P-C4' energy: -139.577 flat angles P-C4'-P energy: -109.096 tors. eta vs tors. theta energy: -182.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1997.266581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1997.266581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1997.266581 (E_RNA) where: Base-Base interactions energy: -1297.623 where: short stacking energy: -653.205 Base-Backbone interact. energy: -0.800 local terms energy: -698.843597 where: bonds (distance) C4'-P energy: -140.099 bonds (distance) P-C4' energy: -138.579 flat angles C4'-P-C4' energy: -169.108 flat angles P-C4'-P energy: -94.361 tors. eta vs tors. theta energy: -156.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1849.800738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1849.800738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1849.800738 (E_RNA) where: Base-Base interactions energy: -1221.540 where: short stacking energy: -578.433 Base-Backbone interact. energy: -2.984 local terms energy: -625.277461 where: bonds (distance) C4'-P energy: -148.621 bonds (distance) P-C4' energy: -126.349 flat angles C4'-P-C4' energy: -146.962 flat angles P-C4'-P energy: -90.575 tors. eta vs tors. theta energy: -112.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1850.408631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1850.408631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1850.408631 (E_RNA) where: Base-Base interactions energy: -1238.413 where: short stacking energy: -557.322 Base-Backbone interact. energy: 1.133 local terms energy: -613.128728 where: bonds (distance) C4'-P energy: -128.242 bonds (distance) P-C4' energy: -132.711 flat angles C4'-P-C4' energy: -147.315 flat angles P-C4'-P energy: -97.843 tors. eta vs tors. theta energy: -107.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1334.561716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.561716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.561716 (E_RNA) where: Base-Base interactions energy: -817.935 where: short stacking energy: -427.438 Base-Backbone interact. energy: -5.420 local terms energy: -511.206706 where: bonds (distance) C4'-P energy: -115.275 bonds (distance) P-C4' energy: -115.764 flat angles C4'-P-C4' energy: -134.768 flat angles P-C4'-P energy: -79.018 tors. eta vs tors. theta energy: -66.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1343.807282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.807282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.807282 (E_RNA) where: Base-Base interactions energy: -847.862 where: short stacking energy: -403.080 Base-Backbone interact. energy: -2.565 local terms energy: -493.379590 where: bonds (distance) C4'-P energy: -108.988 bonds (distance) P-C4' energy: -121.341 flat angles C4'-P-C4' energy: -126.237 flat angles P-C4'-P energy: -77.928 tors. eta vs tors. theta energy: -58.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1127.661112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.661112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.661112 (E_RNA) where: Base-Base interactions energy: -654.354 where: short stacking energy: -367.106 Base-Backbone interact. energy: -1.807 local terms energy: -471.500569 where: bonds (distance) C4'-P energy: -117.435 bonds (distance) P-C4' energy: -111.962 flat angles C4'-P-C4' energy: -133.668 flat angles P-C4'-P energy: -69.604 tors. eta vs tors. theta energy: -38.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -839.725400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.725400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.725400 (E_RNA) where: Base-Base interactions energy: -431.250 where: short stacking energy: -260.392 Base-Backbone interact. energy: 0.583 local terms energy: -409.058505 where: bonds (distance) C4'-P energy: -113.526 bonds (distance) P-C4' energy: -128.057 flat angles C4'-P-C4' energy: -110.981 flat angles P-C4'-P energy: -58.538 tors. eta vs tors. theta energy: 2.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2437.509082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2437.509082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2437.509082 (E_RNA) where: Base-Base interactions energy: -1663.321 where: short stacking energy: -745.282 Base-Backbone interact. energy: -11.530 local terms energy: -762.657659 where: bonds (distance) C4'-P energy: -154.082 bonds (distance) P-C4' energy: -163.243 flat angles C4'-P-C4' energy: -172.495 flat angles P-C4'-P energy: -95.072 tors. eta vs tors. theta energy: -177.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2264.632717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2264.632717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2264.632717 (E_RNA) where: Base-Base interactions energy: -1501.790 where: short stacking energy: -754.844 Base-Backbone interact. energy: -2.883 local terms energy: -759.959860 where: bonds (distance) C4'-P energy: -138.042 bonds (distance) P-C4' energy: -150.396 flat angles C4'-P-C4' energy: -167.723 flat angles P-C4'-P energy: -94.157 tors. eta vs tors. theta energy: -209.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2138.777320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2138.777320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2138.777320 (E_RNA) where: Base-Base interactions energy: -1446.354 where: short stacking energy: -728.753 Base-Backbone interact. energy: 1.717 local terms energy: -694.140255 where: bonds (distance) C4'-P energy: -141.298 bonds (distance) P-C4' energy: -130.158 flat angles C4'-P-C4' energy: -160.774 flat angles P-C4'-P energy: -83.879 tors. eta vs tors. theta energy: -178.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1994.865642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1994.865642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1994.865642 (E_RNA) where: Base-Base interactions energy: -1331.042 where: short stacking energy: -635.740 Base-Backbone interact. energy: 2.724 local terms energy: -666.547795 where: bonds (distance) C4'-P energy: -129.204 bonds (distance) P-C4' energy: -137.431 flat angles C4'-P-C4' energy: -155.208 flat angles P-C4'-P energy: -91.539 tors. eta vs tors. theta energy: -153.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1860.245479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.245479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.245479 (E_RNA) where: Base-Base interactions energy: -1233.837 where: short stacking energy: -599.353 Base-Backbone interact. energy: -0.477 local terms energy: -625.931888 where: bonds (distance) C4'-P energy: -120.915 bonds (distance) P-C4' energy: -140.528 flat angles C4'-P-C4' energy: -149.159 flat angles P-C4'-P energy: -83.801 tors. eta vs tors. theta energy: -131.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1800.085942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.085942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.085942 (E_RNA) where: Base-Base interactions energy: -1191.886 where: short stacking energy: -545.763 Base-Backbone interact. energy: -0.257 local terms energy: -607.942208 where: bonds (distance) C4'-P energy: -123.940 bonds (distance) P-C4' energy: -122.126 flat angles C4'-P-C4' energy: -142.681 flat angles P-C4'-P energy: -96.767 tors. eta vs tors. theta energy: -122.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1385.632871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.632871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.632871 (E_RNA) where: Base-Base interactions energy: -809.579 where: short stacking energy: -441.780 Base-Backbone interact. energy: -2.439 local terms energy: -573.614867 where: bonds (distance) C4'-P energy: -108.267 bonds (distance) P-C4' energy: -137.964 flat angles C4'-P-C4' energy: -144.604 flat angles P-C4'-P energy: -82.299 tors. eta vs tors. theta energy: -100.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1369.566008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.566008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.566008 (E_RNA) where: Base-Base interactions energy: -835.261 where: short stacking energy: -397.049 Base-Backbone interact. energy: -0.544 local terms energy: -533.760607 where: bonds (distance) C4'-P energy: -131.187 bonds (distance) P-C4' energy: -119.700 flat angles C4'-P-C4' energy: -128.532 flat angles P-C4'-P energy: -80.417 tors. eta vs tors. theta energy: -73.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1128.073316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.073316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.073316 (E_RNA) where: Base-Base interactions energy: -640.932 where: short stacking energy: -319.155 Base-Backbone interact. energy: 4.678 local terms energy: -491.819847 where: bonds (distance) C4'-P energy: -136.444 bonds (distance) P-C4' energy: -118.197 flat angles C4'-P-C4' energy: -133.197 flat angles P-C4'-P energy: -77.828 tors. eta vs tors. theta energy: -26.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -802.250057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.250057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.250057 (E_RNA) where: Base-Base interactions energy: -386.132 where: short stacking energy: -278.061 Base-Backbone interact. energy: 9.196 local terms energy: -425.314055 where: bonds (distance) C4'-P energy: -99.049 bonds (distance) P-C4' energy: -114.753 flat angles C4'-P-C4' energy: -124.831 flat angles P-C4'-P energy: -63.482 tors. eta vs tors. theta energy: -23.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2410.666647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2410.666647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2410.666647 (E_RNA) where: Base-Base interactions energy: -1691.831 where: short stacking energy: -682.028 Base-Backbone interact. energy: -6.723 local terms energy: -712.112763 where: bonds (distance) C4'-P energy: -140.517 bonds (distance) P-C4' energy: -158.213 flat angles C4'-P-C4' energy: -164.040 flat angles P-C4'-P energy: -94.925 tors. eta vs tors. theta energy: -154.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2305.364173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2305.364173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2305.364173 (E_RNA) where: Base-Base interactions energy: -1525.220 where: short stacking energy: -713.321 Base-Backbone interact. energy: -6.464 local terms energy: -773.680583 where: bonds (distance) C4'-P energy: -146.006 bonds (distance) P-C4' energy: -160.476 flat angles C4'-P-C4' energy: -164.721 flat angles P-C4'-P energy: -110.967 tors. eta vs tors. theta energy: -191.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2156.070718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.070718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.070718 (E_RNA) where: Base-Base interactions energy: -1434.006 where: short stacking energy: -710.682 Base-Backbone interact. energy: -4.407 local terms energy: -717.658443 where: bonds (distance) C4'-P energy: -132.614 bonds (distance) P-C4' energy: -136.883 flat angles C4'-P-C4' energy: -159.922 flat angles P-C4'-P energy: -109.618 tors. eta vs tors. theta energy: -178.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -2017.959035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2017.959035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2017.959035 (E_RNA) where: Base-Base interactions energy: -1352.638 where: short stacking energy: -635.518 Base-Backbone interact. energy: -4.771 local terms energy: -660.550175 where: bonds (distance) C4'-P energy: -139.609 bonds (distance) P-C4' energy: -138.259 flat angles C4'-P-C4' energy: -164.223 flat angles P-C4'-P energy: -64.103 tors. eta vs tors. theta energy: -154.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1908.501971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1908.501971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1908.501971 (E_RNA) where: Base-Base interactions energy: -1273.466 where: short stacking energy: -593.621 Base-Backbone interact. energy: -4.115 local terms energy: -630.920763 where: bonds (distance) C4'-P energy: -131.106 bonds (distance) P-C4' energy: -127.913 flat angles C4'-P-C4' energy: -146.586 flat angles P-C4'-P energy: -79.603 tors. eta vs tors. theta energy: -145.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1732.346008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.346008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.346008 (E_RNA) where: Base-Base interactions energy: -1155.057 where: short stacking energy: -508.069 Base-Backbone interact. energy: -3.657 local terms energy: -573.632054 where: bonds (distance) C4'-P energy: -131.161 bonds (distance) P-C4' energy: -123.845 flat angles C4'-P-C4' energy: -128.886 flat angles P-C4'-P energy: -94.596 tors. eta vs tors. theta energy: -95.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1370.850134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.850134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.850134 (E_RNA) where: Base-Base interactions energy: -800.607 where: short stacking energy: -426.055 Base-Backbone interact. energy: 8.875 local terms energy: -579.118151 where: bonds (distance) C4'-P energy: -131.410 bonds (distance) P-C4' energy: -133.276 flat angles C4'-P-C4' energy: -143.478 flat angles P-C4'-P energy: -75.277 tors. eta vs tors. theta energy: -95.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1285.487854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.487854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.487854 (E_RNA) where: Base-Base interactions energy: -807.949 where: short stacking energy: -425.686 Base-Backbone interact. energy: -3.246 local terms energy: -474.292764 where: bonds (distance) C4'-P energy: -119.266 bonds (distance) P-C4' energy: -102.614 flat angles C4'-P-C4' energy: -115.869 flat angles P-C4'-P energy: -69.475 tors. eta vs tors. theta energy: -67.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1178.173225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.173225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1178.173225 (E_RNA) where: Base-Base interactions energy: -711.779 where: short stacking energy: -351.896 Base-Backbone interact. energy: 3.567 local terms energy: -469.961398 where: bonds (distance) C4'-P energy: -123.129 bonds (distance) P-C4' energy: -127.561 flat angles C4'-P-C4' energy: -119.134 flat angles P-C4'-P energy: -75.051 tors. eta vs tors. theta energy: -25.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -810.795107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.795107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.795107 (E_RNA) where: Base-Base interactions energy: -385.812 where: short stacking energy: -255.783 Base-Backbone interact. energy: -2.446 local terms energy: -422.536757 where: bonds (distance) C4'-P energy: -109.607 bonds (distance) P-C4' energy: -117.480 flat angles C4'-P-C4' energy: -110.392 flat angles P-C4'-P energy: -74.971 tors. eta vs tors. theta energy: -10.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2404.256391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2404.256391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2404.256391 (E_RNA) where: Base-Base interactions energy: -1658.650 where: short stacking energy: -675.039 Base-Backbone interact. energy: -6.639 local terms energy: -738.967843 where: bonds (distance) C4'-P energy: -144.777 bonds (distance) P-C4' energy: -155.679 flat angles C4'-P-C4' energy: -164.034 flat angles P-C4'-P energy: -116.506 tors. eta vs tors. theta energy: -157.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2312.873082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2312.873082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2312.873082 (E_RNA) where: Base-Base interactions energy: -1547.138 where: short stacking energy: -733.161 Base-Backbone interact. energy: -3.237 local terms energy: -762.497899 where: bonds (distance) C4'-P energy: -145.314 bonds (distance) P-C4' energy: -144.460 flat angles C4'-P-C4' energy: -149.271 flat angles P-C4'-P energy: -116.108 tors. eta vs tors. theta energy: -207.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2175.265301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2175.265301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.265301 (E_RNA) where: Base-Base interactions energy: -1462.790 where: short stacking energy: -698.165 Base-Backbone interact. energy: -4.629 local terms energy: -707.845693 where: bonds (distance) C4'-P energy: -142.038 bonds (distance) P-C4' energy: -148.733 flat angles C4'-P-C4' energy: -154.634 flat angles P-C4'-P energy: -99.571 tors. eta vs tors. theta energy: -162.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1957.460775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1957.460775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.460775 (E_RNA) where: Base-Base interactions energy: -1284.818 where: short stacking energy: -594.693 Base-Backbone interact. energy: -1.557 local terms energy: -671.085383 where: bonds (distance) C4'-P energy: -152.086 bonds (distance) P-C4' energy: -137.097 flat angles C4'-P-C4' energy: -147.170 flat angles P-C4'-P energy: -101.074 tors. eta vs tors. theta energy: -133.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1903.982094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1903.982094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1903.982094 (E_RNA) where: Base-Base interactions energy: -1250.699 where: short stacking energy: -564.533 Base-Backbone interact. energy: -0.471 local terms energy: -652.812387 where: bonds (distance) C4'-P energy: -121.408 bonds (distance) P-C4' energy: -153.261 flat angles C4'-P-C4' energy: -160.821 flat angles P-C4'-P energy: -95.217 tors. eta vs tors. theta energy: -122.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1766.179531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1766.179531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.179531 (E_RNA) where: Base-Base interactions energy: -1171.270 where: short stacking energy: -535.689 Base-Backbone interact. energy: -2.247 local terms energy: -592.663091 where: bonds (distance) C4'-P energy: -119.927 bonds (distance) P-C4' energy: -129.802 flat angles C4'-P-C4' energy: -141.449 flat angles P-C4'-P energy: -85.744 tors. eta vs tors. theta energy: -115.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1379.202800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.202800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.202800 (E_RNA) where: Base-Base interactions energy: -841.840 where: short stacking energy: -453.934 Base-Backbone interact. energy: 4.250 local terms energy: -541.612714 where: bonds (distance) C4'-P energy: -111.501 bonds (distance) P-C4' energy: -145.685 flat angles C4'-P-C4' energy: -132.200 flat angles P-C4'-P energy: -74.042 tors. eta vs tors. theta energy: -78.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1330.639134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.639134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.639134 (E_RNA) where: Base-Base interactions energy: -827.844 where: short stacking energy: -403.739 Base-Backbone interact. energy: 4.731 local terms energy: -507.526716 where: bonds (distance) C4'-P energy: -122.979 bonds (distance) P-C4' energy: -141.127 flat angles C4'-P-C4' energy: -116.426 flat angles P-C4'-P energy: -69.767 tors. eta vs tors. theta energy: -57.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1177.643791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.643791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.643791 (E_RNA) where: Base-Base interactions energy: -721.823 where: short stacking energy: -371.869 Base-Backbone interact. energy: -0.300 local terms energy: -455.521186 where: bonds (distance) C4'-P energy: -118.053 bonds (distance) P-C4' energy: -96.666 flat angles C4'-P-C4' energy: -111.515 flat angles P-C4'-P energy: -81.889 tors. eta vs tors. theta energy: -47.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -763.451586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.451586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.451586 (E_RNA) where: Base-Base interactions energy: -392.554 where: short stacking energy: -217.943 Base-Backbone interact. energy: 3.268 local terms energy: -374.166027 where: bonds (distance) C4'-P energy: -127.417 bonds (distance) P-C4' energy: -113.317 flat angles C4'-P-C4' energy: -98.163 flat angles P-C4'-P energy: -55.991 tors. eta vs tors. theta energy: 20.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2361.786827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2361.786827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2361.786827 (E_RNA) where: Base-Base interactions energy: -1634.340 where: short stacking energy: -706.632 Base-Backbone interact. energy: -2.716 local terms energy: -724.730615 where: bonds (distance) C4'-P energy: -139.146 bonds (distance) P-C4' energy: -145.943 flat angles C4'-P-C4' energy: -165.257 flat angles P-C4'-P energy: -110.047 tors. eta vs tors. theta energy: -164.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2325.138144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2325.138144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2325.138144 (E_RNA) where: Base-Base interactions energy: -1562.276 where: short stacking energy: -733.627 Base-Backbone interact. energy: -0.800 local terms energy: -762.061773 where: bonds (distance) C4'-P energy: -148.255 bonds (distance) P-C4' energy: -153.647 flat angles C4'-P-C4' energy: -164.079 flat angles P-C4'-P energy: -101.688 tors. eta vs tors. theta energy: -194.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2138.834651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2138.834651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2138.834651 (E_RNA) where: Base-Base interactions energy: -1420.388 where: short stacking energy: -684.402 Base-Backbone interact. energy: -3.669 local terms energy: -714.778120 where: bonds (distance) C4'-P energy: -146.917 bonds (distance) P-C4' energy: -144.501 flat angles C4'-P-C4' energy: -167.484 flat angles P-C4'-P energy: -97.518 tors. eta vs tors. theta energy: -158.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1951.095598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1951.095598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1951.095598 (E_RNA) where: Base-Base interactions energy: -1278.739 where: short stacking energy: -584.355 Base-Backbone interact. energy: -4.138 local terms energy: -668.219266 where: bonds (distance) C4'-P energy: -136.568 bonds (distance) P-C4' energy: -148.927 flat angles C4'-P-C4' energy: -162.489 flat angles P-C4'-P energy: -95.218 tors. eta vs tors. theta energy: -125.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1899.419138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.419138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.419138 (E_RNA) where: Base-Base interactions energy: -1264.925 where: short stacking energy: -587.180 Base-Backbone interact. energy: -2.158 local terms energy: -632.336027 where: bonds (distance) C4'-P energy: -122.803 bonds (distance) P-C4' energy: -142.757 flat angles C4'-P-C4' energy: -145.268 flat angles P-C4'-P energy: -84.752 tors. eta vs tors. theta energy: -136.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1804.584909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1804.584909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1804.584909 (E_RNA) where: Base-Base interactions energy: -1179.524 where: short stacking energy: -527.578 Base-Backbone interact. energy: -1.966 local terms energy: -623.094732 where: bonds (distance) C4'-P energy: -151.119 bonds (distance) P-C4' energy: -132.725 flat angles C4'-P-C4' energy: -135.154 flat angles P-C4'-P energy: -83.516 tors. eta vs tors. theta energy: -120.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1461.244639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.244639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.244639 (E_RNA) where: Base-Base interactions energy: -922.401 where: short stacking energy: -454.333 Base-Backbone interact. energy: 5.793 local terms energy: -544.636952 where: bonds (distance) C4'-P energy: -123.772 bonds (distance) P-C4' energy: -121.741 flat angles C4'-P-C4' energy: -139.100 flat angles P-C4'-P energy: -93.254 tors. eta vs tors. theta energy: -66.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1250.364600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.364600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.364600 (E_RNA) where: Base-Base interactions energy: -743.113 where: short stacking energy: -375.245 Base-Backbone interact. energy: 6.446 local terms energy: -513.697422 where: bonds (distance) C4'-P energy: -112.266 bonds (distance) P-C4' energy: -132.177 flat angles C4'-P-C4' energy: -128.653 flat angles P-C4'-P energy: -78.812 tors. eta vs tors. theta energy: -61.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1229.454684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.454684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.454684 (E_RNA) where: Base-Base interactions energy: -747.970 where: short stacking energy: -363.353 Base-Backbone interact. energy: 1.070 local terms energy: -482.555212 where: bonds (distance) C4'-P energy: -114.286 bonds (distance) P-C4' energy: -125.288 flat angles C4'-P-C4' energy: -121.278 flat angles P-C4'-P energy: -65.876 tors. eta vs tors. theta energy: -55.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -800.896304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.896304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.896304 (E_RNA) where: Base-Base interactions energy: -432.682 where: short stacking energy: -276.640 Base-Backbone interact. energy: -2.264 local terms energy: -365.950105 where: bonds (distance) C4'-P energy: -94.259 bonds (distance) P-C4' energy: -114.175 flat angles C4'-P-C4' energy: -105.664 flat angles P-C4'-P energy: -44.342 tors. eta vs tors. theta energy: -7.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2379.401124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.401124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.401124 (E_RNA) where: Base-Base interactions energy: -1617.493 where: short stacking energy: -706.625 Base-Backbone interact. energy: -3.353 local terms energy: -758.554700 where: bonds (distance) C4'-P energy: -148.453 bonds (distance) P-C4' energy: -154.313 flat angles C4'-P-C4' energy: -161.474 flat angles P-C4'-P energy: -113.038 tors. eta vs tors. theta energy: -181.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2296.886362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2296.886362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2296.886362 (E_RNA) where: Base-Base interactions energy: -1536.722 where: short stacking energy: -732.512 Base-Backbone interact. energy: 0.836 local terms energy: -761.000973 where: bonds (distance) C4'-P energy: -155.200 bonds (distance) P-C4' energy: -147.051 flat angles C4'-P-C4' energy: -170.722 flat angles P-C4'-P energy: -104.499 tors. eta vs tors. theta energy: -183.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2087.962590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2087.962590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2087.962590 (E_RNA) where: Base-Base interactions energy: -1350.319 where: short stacking energy: -680.277 Base-Backbone interact. energy: -4.377 local terms energy: -733.266625 where: bonds (distance) C4'-P energy: -156.218 bonds (distance) P-C4' energy: -129.028 flat angles C4'-P-C4' energy: -169.315 flat angles P-C4'-P energy: -86.303 tors. eta vs tors. theta energy: -192.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2018.935184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2018.935184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2018.935184 (E_RNA) where: Base-Base interactions energy: -1347.464 where: short stacking energy: -634.011 Base-Backbone interact. energy: -0.378 local terms energy: -671.093266 where: bonds (distance) C4'-P energy: -128.391 bonds (distance) P-C4' energy: -134.370 flat angles C4'-P-C4' energy: -155.299 flat angles P-C4'-P energy: -101.897 tors. eta vs tors. theta energy: -151.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1881.069795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1881.069795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1881.069795 (E_RNA) where: Base-Base interactions energy: -1230.586 where: short stacking energy: -557.215 Base-Backbone interact. energy: -1.039 local terms energy: -649.445201 where: bonds (distance) C4'-P energy: -119.169 bonds (distance) P-C4' energy: -146.560 flat angles C4'-P-C4' energy: -156.950 flat angles P-C4'-P energy: -94.700 tors. eta vs tors. theta energy: -132.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1884.679814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1884.679814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1884.679814 (E_RNA) where: Base-Base interactions energy: -1228.183 where: short stacking energy: -600.761 Base-Backbone interact. energy: 5.145 local terms energy: -661.642063 where: bonds (distance) C4'-P energy: -139.802 bonds (distance) P-C4' energy: -135.995 flat angles C4'-P-C4' energy: -152.550 flat angles P-C4'-P energy: -97.141 tors. eta vs tors. theta energy: -136.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1510.685383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.685383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.685383 (E_RNA) where: Base-Base interactions energy: -959.301 where: short stacking energy: -474.973 Base-Backbone interact. energy: 3.165 local terms energy: -554.549369 where: bonds (distance) C4'-P energy: -127.699 bonds (distance) P-C4' energy: -126.996 flat angles C4'-P-C4' energy: -142.098 flat angles P-C4'-P energy: -82.966 tors. eta vs tors. theta energy: -74.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1323.619051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.619051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.619051 (E_RNA) where: Base-Base interactions energy: -821.792 where: short stacking energy: -382.705 Base-Backbone interact. energy: 1.916 local terms energy: -503.742072 where: bonds (distance) C4'-P energy: -117.599 bonds (distance) P-C4' energy: -123.610 flat angles C4'-P-C4' energy: -126.098 flat angles P-C4'-P energy: -84.920 tors. eta vs tors. theta energy: -51.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1127.169787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.169787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.169787 (E_RNA) where: Base-Base interactions energy: -650.354 where: short stacking energy: -322.363 Base-Backbone interact. energy: -3.306 local terms energy: -473.509603 where: bonds (distance) C4'-P energy: -127.143 bonds (distance) P-C4' energy: -125.962 flat angles C4'-P-C4' energy: -113.111 flat angles P-C4'-P energy: -74.441 tors. eta vs tors. theta energy: -32.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -826.341516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.341516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.341516 (E_RNA) where: Base-Base interactions energy: -443.663 where: short stacking energy: -272.751 Base-Backbone interact. energy: 0.764 local terms energy: -383.442005 where: bonds (distance) C4'-P energy: -112.744 bonds (distance) P-C4' energy: -127.006 flat angles C4'-P-C4' energy: -85.817 flat angles P-C4'-P energy: -69.132 tors. eta vs tors. theta energy: 11.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2400.749524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2400.749524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2400.749524 (E_RNA) where: Base-Base interactions energy: -1644.525 where: short stacking energy: -716.508 Base-Backbone interact. energy: -9.083 local terms energy: -747.141014 where: bonds (distance) C4'-P energy: -150.679 bonds (distance) P-C4' energy: -153.790 flat angles C4'-P-C4' energy: -167.074 flat angles P-C4'-P energy: -106.760 tors. eta vs tors. theta energy: -168.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2337.688866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2337.688866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.688866 (E_RNA) where: Base-Base interactions energy: -1583.132 where: short stacking energy: -750.957 Base-Backbone interact. energy: -4.393 local terms energy: -750.163721 where: bonds (distance) C4'-P energy: -143.965 bonds (distance) P-C4' energy: -146.731 flat angles C4'-P-C4' energy: -162.524 flat angles P-C4'-P energy: -104.894 tors. eta vs tors. theta energy: -192.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2141.345139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2141.345139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2141.345139 (E_RNA) where: Base-Base interactions energy: -1385.102 where: short stacking energy: -714.649 Base-Backbone interact. energy: -2.968 local terms energy: -753.274901 where: bonds (distance) C4'-P energy: -144.814 bonds (distance) P-C4' energy: -152.021 flat angles C4'-P-C4' energy: -165.532 flat angles P-C4'-P energy: -101.011 tors. eta vs tors. theta energy: -189.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2007.737052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2007.737052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2007.737052 (E_RNA) where: Base-Base interactions energy: -1356.297 where: short stacking energy: -603.364 Base-Backbone interact. energy: 0.362 local terms energy: -651.801861 where: bonds (distance) C4'-P energy: -132.685 bonds (distance) P-C4' energy: -153.617 flat angles C4'-P-C4' energy: -133.243 flat angles P-C4'-P energy: -97.183 tors. eta vs tors. theta energy: -135.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1939.893010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1939.893010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1939.893010 (E_RNA) where: Base-Base interactions energy: -1330.168 where: short stacking energy: -585.242 Base-Backbone interact. energy: 0.531 local terms energy: -610.256183 where: bonds (distance) C4'-P energy: -103.499 bonds (distance) P-C4' energy: -135.421 flat angles C4'-P-C4' energy: -156.341 flat angles P-C4'-P energy: -84.035 tors. eta vs tors. theta energy: -130.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1895.311123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.311123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.311123 (E_RNA) where: Base-Base interactions energy: -1293.906 where: short stacking energy: -604.706 Base-Backbone interact. energy: -2.555 local terms energy: -598.850095 where: bonds (distance) C4'-P energy: -114.937 bonds (distance) P-C4' energy: -114.769 flat angles C4'-P-C4' energy: -147.657 flat angles P-C4'-P energy: -81.576 tors. eta vs tors. theta energy: -139.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1544.522336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.522336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.522336 (E_RNA) where: Base-Base interactions energy: -968.364 where: short stacking energy: -485.073 Base-Backbone interact. energy: 1.806 local terms energy: -577.964458 where: bonds (distance) C4'-P energy: -119.870 bonds (distance) P-C4' energy: -139.338 flat angles C4'-P-C4' energy: -143.565 flat angles P-C4'-P energy: -81.652 tors. eta vs tors. theta energy: -93.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1351.270411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.270411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.270411 (E_RNA) where: Base-Base interactions energy: -820.925 where: short stacking energy: -392.160 Base-Backbone interact. energy: -1.249 local terms energy: -529.096580 where: bonds (distance) C4'-P energy: -119.401 bonds (distance) P-C4' energy: -148.530 flat angles C4'-P-C4' energy: -137.049 flat angles P-C4'-P energy: -67.882 tors. eta vs tors. theta energy: -56.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1120.115301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.115301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.115301 (E_RNA) where: Base-Base interactions energy: -652.901 where: short stacking energy: -332.511 Base-Backbone interact. energy: 2.492 local terms energy: -469.705925 where: bonds (distance) C4'-P energy: -119.948 bonds (distance) P-C4' energy: -136.551 flat angles C4'-P-C4' energy: -128.109 flat angles P-C4'-P energy: -57.006 tors. eta vs tors. theta energy: -28.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -818.879828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.879828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.879828 (E_RNA) where: Base-Base interactions energy: -419.064 where: short stacking energy: -254.022 Base-Backbone interact. energy: -2.928 local terms energy: -396.887667 where: bonds (distance) C4'-P energy: -102.255 bonds (distance) P-C4' energy: -120.651 flat angles C4'-P-C4' energy: -110.081 flat angles P-C4'-P energy: -73.571 tors. eta vs tors. theta energy: 9.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2414.012506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2414.012506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2414.012506 (E_RNA) where: Base-Base interactions energy: -1689.322 where: short stacking energy: -716.314 Base-Backbone interact. energy: -0.970 local terms energy: -723.720647 where: bonds (distance) C4'-P energy: -155.245 bonds (distance) P-C4' energy: -137.684 flat angles C4'-P-C4' energy: -165.825 flat angles P-C4'-P energy: -100.218 tors. eta vs tors. theta energy: -164.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2326.400614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.400614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.400614 (E_RNA) where: Base-Base interactions energy: -1524.940 where: short stacking energy: -719.839 Base-Backbone interact. energy: -2.003 local terms energy: -799.457258 where: bonds (distance) C4'-P energy: -154.736 bonds (distance) P-C4' energy: -165.522 flat angles C4'-P-C4' energy: -157.467 flat angles P-C4'-P energy: -124.213 tors. eta vs tors. theta energy: -197.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2155.449081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2155.449081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2155.449081 (E_RNA) where: Base-Base interactions energy: -1410.114 where: short stacking energy: -693.269 Base-Backbone interact. energy: -3.406 local terms energy: -741.928518 where: bonds (distance) C4'-P energy: -137.157 bonds (distance) P-C4' energy: -146.752 flat angles C4'-P-C4' energy: -164.572 flat angles P-C4'-P energy: -111.898 tors. eta vs tors. theta energy: -181.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2039.236160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2039.236160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2039.236160 (E_RNA) where: Base-Base interactions energy: -1403.075 where: short stacking energy: -617.457 Base-Backbone interact. energy: -0.471 local terms energy: -635.690494 where: bonds (distance) C4'-P energy: -123.460 bonds (distance) P-C4' energy: -122.672 flat angles C4'-P-C4' energy: -149.531 flat angles P-C4'-P energy: -93.408 tors. eta vs tors. theta energy: -146.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1942.625109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.625109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.625109 (E_RNA) where: Base-Base interactions energy: -1282.483 where: short stacking energy: -631.328 Base-Backbone interact. energy: -4.618 local terms energy: -655.524479 where: bonds (distance) C4'-P energy: -126.451 bonds (distance) P-C4' energy: -138.540 flat angles C4'-P-C4' energy: -140.279 flat angles P-C4'-P energy: -100.676 tors. eta vs tors. theta energy: -149.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1911.066655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1911.066655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1911.066655 (E_RNA) where: Base-Base interactions energy: -1319.899 where: short stacking energy: -564.158 Base-Backbone interact. energy: 1.023 local terms energy: -592.190315 where: bonds (distance) C4'-P energy: -118.382 bonds (distance) P-C4' energy: -129.425 flat angles C4'-P-C4' energy: -139.021 flat angles P-C4'-P energy: -92.967 tors. eta vs tors. theta energy: -112.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1660.003197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.003197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.003197 (E_RNA) where: Base-Base interactions energy: -1083.719 where: short stacking energy: -498.044 Base-Backbone interact. energy: -2.846 local terms energy: -573.437949 where: bonds (distance) C4'-P energy: -115.263 bonds (distance) P-C4' energy: -112.844 flat angles C4'-P-C4' energy: -156.868 flat angles P-C4'-P energy: -87.342 tors. eta vs tors. theta energy: -101.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1336.290230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.290230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.290230 (E_RNA) where: Base-Base interactions energy: -806.163 where: short stacking energy: -369.238 Base-Backbone interact. energy: -1.202 local terms energy: -528.925160 where: bonds (distance) C4'-P energy: -133.041 bonds (distance) P-C4' energy: -132.688 flat angles C4'-P-C4' energy: -124.269 flat angles P-C4'-P energy: -88.316 tors. eta vs tors. theta energy: -50.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1155.924651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.924651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.924651 (E_RNA) where: Base-Base interactions energy: -679.729 where: short stacking energy: -316.213 Base-Backbone interact. energy: 1.578 local terms energy: -477.773808 where: bonds (distance) C4'-P energy: -125.824 bonds (distance) P-C4' energy: -121.468 flat angles C4'-P-C4' energy: -123.286 flat angles P-C4'-P energy: -75.392 tors. eta vs tors. theta energy: -31.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -758.020798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.020798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.020798 (E_RNA) where: Base-Base interactions energy: -385.960 where: short stacking energy: -249.874 Base-Backbone interact. energy: 11.307 local terms energy: -383.367346 where: bonds (distance) C4'-P energy: -118.449 bonds (distance) P-C4' energy: -118.120 flat angles C4'-P-C4' energy: -104.152 flat angles P-C4'-P energy: -42.820 tors. eta vs tors. theta energy: 0.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2436.789492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2436.789492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2436.789492 (E_RNA) where: Base-Base interactions energy: -1661.377 where: short stacking energy: -724.848 Base-Backbone interact. energy: -2.601 local terms energy: -772.811865 where: bonds (distance) C4'-P energy: -153.406 bonds (distance) P-C4' energy: -162.176 flat angles C4'-P-C4' energy: -176.816 flat angles P-C4'-P energy: -109.804 tors. eta vs tors. theta energy: -170.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2312.696537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2312.696537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2312.696537 (E_RNA) where: Base-Base interactions energy: -1549.077 where: short stacking energy: -737.130 Base-Backbone interact. energy: -4.534 local terms energy: -759.085945 where: bonds (distance) C4'-P energy: -150.804 bonds (distance) P-C4' energy: -136.104 flat angles C4'-P-C4' energy: -160.312 flat angles P-C4'-P energy: -112.110 tors. eta vs tors. theta energy: -199.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2147.867933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2147.867933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2147.867933 (E_RNA) where: Base-Base interactions energy: -1438.598 where: short stacking energy: -671.641 Base-Backbone interact. energy: -4.411 local terms energy: -704.858877 where: bonds (distance) C4'-P energy: -150.085 bonds (distance) P-C4' energy: -148.963 flat angles C4'-P-C4' energy: -150.779 flat angles P-C4'-P energy: -93.338 tors. eta vs tors. theta energy: -161.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2063.095927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2063.095927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2063.095927 (E_RNA) where: Base-Base interactions energy: -1369.964 where: short stacking energy: -664.314 Base-Backbone interact. energy: -1.827 local terms energy: -691.304320 where: bonds (distance) C4'-P energy: -128.983 bonds (distance) P-C4' energy: -112.997 flat angles C4'-P-C4' energy: -166.948 flat angles P-C4'-P energy: -92.538 tors. eta vs tors. theta energy: -189.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1918.320286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.320286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.320286 (E_RNA) where: Base-Base interactions energy: -1279.626 where: short stacking energy: -588.110 Base-Backbone interact. energy: 3.382 local terms energy: -642.075899 where: bonds (distance) C4'-P energy: -139.518 bonds (distance) P-C4' energy: -133.167 flat angles C4'-P-C4' energy: -147.835 flat angles P-C4'-P energy: -77.816 tors. eta vs tors. theta energy: -143.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1886.087080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.087080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.087080 (E_RNA) where: Base-Base interactions energy: -1273.290 where: short stacking energy: -572.697 Base-Backbone interact. energy: 1.880 local terms energy: -614.676633 where: bonds (distance) C4'-P energy: -117.037 bonds (distance) P-C4' energy: -140.349 flat angles C4'-P-C4' energy: -132.192 flat angles P-C4'-P energy: -95.716 tors. eta vs tors. theta energy: -129.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1693.335646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.335646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.335646 (E_RNA) where: Base-Base interactions energy: -1106.877 where: short stacking energy: -491.722 Base-Backbone interact. energy: -2.707 local terms energy: -583.751728 where: bonds (distance) C4'-P energy: -121.853 bonds (distance) P-C4' energy: -139.307 flat angles C4'-P-C4' energy: -141.515 flat angles P-C4'-P energy: -91.071 tors. eta vs tors. theta energy: -90.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1346.709769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.709769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.709769 (E_RNA) where: Base-Base interactions energy: -859.143 where: short stacking energy: -368.634 Base-Backbone interact. energy: 4.193 local terms energy: -491.759584 where: bonds (distance) C4'-P energy: -105.629 bonds (distance) P-C4' energy: -145.171 flat angles C4'-P-C4' energy: -128.533 flat angles P-C4'-P energy: -69.660 tors. eta vs tors. theta energy: -42.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1138.560406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.560406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.560406 (E_RNA) where: Base-Base interactions energy: -669.294 where: short stacking energy: -326.401 Base-Backbone interact. energy: -3.111 local terms energy: -466.155612 where: bonds (distance) C4'-P energy: -127.131 bonds (distance) P-C4' energy: -112.542 flat angles C4'-P-C4' energy: -110.306 flat angles P-C4'-P energy: -72.423 tors. eta vs tors. theta energy: -43.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -793.683976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.683976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.683976 (E_RNA) where: Base-Base interactions energy: -373.776 where: short stacking energy: -243.448 Base-Backbone interact. energy: 6.364 local terms energy: -426.271690 where: bonds (distance) C4'-P energy: -101.907 bonds (distance) P-C4' energy: -145.239 flat angles C4'-P-C4' energy: -125.185 flat angles P-C4'-P energy: -64.978 tors. eta vs tors. theta energy: 11.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2409.491065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2409.491065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2409.491065 (E_RNA) where: Base-Base interactions energy: -1672.298 where: short stacking energy: -722.535 Base-Backbone interact. energy: -7.482 local terms energy: -729.711865 where: bonds (distance) C4'-P energy: -151.498 bonds (distance) P-C4' energy: -146.876 flat angles C4'-P-C4' energy: -160.812 flat angles P-C4'-P energy: -114.167 tors. eta vs tors. theta energy: -156.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2352.238368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2352.238368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2352.238368 (E_RNA) where: Base-Base interactions energy: -1591.066 where: short stacking energy: -762.190 Base-Backbone interact. energy: -7.756 local terms energy: -753.416222 where: bonds (distance) C4'-P energy: -138.577 bonds (distance) P-C4' energy: -141.703 flat angles C4'-P-C4' energy: -163.974 flat angles P-C4'-P energy: -103.773 tors. eta vs tors. theta energy: -205.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2124.070137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.070137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.070137 (E_RNA) where: Base-Base interactions energy: -1374.216 where: short stacking energy: -624.647 Base-Backbone interact. energy: -1.767 local terms energy: -748.087092 where: bonds (distance) C4'-P energy: -148.175 bonds (distance) P-C4' energy: -165.871 flat angles C4'-P-C4' energy: -160.159 flat angles P-C4'-P energy: -125.292 tors. eta vs tors. theta energy: -148.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2079.887788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2079.887788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2079.887788 (E_RNA) where: Base-Base interactions energy: -1363.258 where: short stacking energy: -658.770 Base-Backbone interact. energy: -6.692 local terms energy: -709.937355 where: bonds (distance) C4'-P energy: -132.808 bonds (distance) P-C4' energy: -152.757 flat angles C4'-P-C4' energy: -154.462 flat angles P-C4'-P energy: -90.038 tors. eta vs tors. theta energy: -179.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1939.612009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1939.612009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1939.612009 (E_RNA) where: Base-Base interactions energy: -1271.472 where: short stacking energy: -589.338 Base-Backbone interact. energy: -4.460 local terms energy: -663.680017 where: bonds (distance) C4'-P energy: -130.625 bonds (distance) P-C4' energy: -132.929 flat angles C4'-P-C4' energy: -165.724 flat angles P-C4'-P energy: -97.987 tors. eta vs tors. theta energy: -136.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1885.673292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.673292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.673292 (E_RNA) where: Base-Base interactions energy: -1267.551 where: short stacking energy: -560.570 Base-Backbone interact. energy: -2.896 local terms energy: -615.226735 where: bonds (distance) C4'-P energy: -125.279 bonds (distance) P-C4' energy: -128.455 flat angles C4'-P-C4' energy: -149.549 flat angles P-C4'-P energy: -87.259 tors. eta vs tors. theta energy: -124.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1691.526857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.526857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.526857 (E_RNA) where: Base-Base interactions energy: -1106.294 where: short stacking energy: -520.193 Base-Backbone interact. energy: -3.187 local terms energy: -582.046754 where: bonds (distance) C4'-P energy: -130.853 bonds (distance) P-C4' energy: -123.875 flat angles C4'-P-C4' energy: -127.471 flat angles P-C4'-P energy: -90.212 tors. eta vs tors. theta energy: -109.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1412.892543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.892543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.892543 (E_RNA) where: Base-Base interactions energy: -929.430 where: short stacking energy: -422.873 Base-Backbone interact. energy: 2.079 local terms energy: -485.541329 where: bonds (distance) C4'-P energy: -108.364 bonds (distance) P-C4' energy: -129.091 flat angles C4'-P-C4' energy: -116.833 flat angles P-C4'-P energy: -69.654 tors. eta vs tors. theta energy: -61.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1233.808780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.808780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.808780 (E_RNA) where: Base-Base interactions energy: -771.123 where: short stacking energy: -403.335 Base-Backbone interact. energy: 2.467 local terms energy: -465.153461 where: bonds (distance) C4'-P energy: -105.424 bonds (distance) P-C4' energy: -124.665 flat angles C4'-P-C4' energy: -130.911 flat angles P-C4'-P energy: -44.926 tors. eta vs tors. theta energy: -59.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -806.638833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.638833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.638833 (E_RNA) where: Base-Base interactions energy: -404.689 where: short stacking energy: -245.211 Base-Backbone interact. energy: 7.507 local terms energy: -409.457350 where: bonds (distance) C4'-P energy: -115.108 bonds (distance) P-C4' energy: -131.219 flat angles C4'-P-C4' energy: -97.070 flat angles P-C4'-P energy: -71.863 tors. eta vs tors. theta energy: 5.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2463.176050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2463.176050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2463.176050 (E_RNA) where: Base-Base interactions energy: -1745.389 where: short stacking energy: -722.822 Base-Backbone interact. energy: -6.220 local terms energy: -711.567637 where: bonds (distance) C4'-P energy: -147.727 bonds (distance) P-C4' energy: -151.671 flat angles C4'-P-C4' energy: -157.204 flat angles P-C4'-P energy: -95.141 tors. eta vs tors. theta energy: -159.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2324.413039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2324.413039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.413039 (E_RNA) where: Base-Base interactions energy: -1561.480 where: short stacking energy: -746.710 Base-Backbone interact. energy: -5.338 local terms energy: -757.595436 where: bonds (distance) C4'-P energy: -132.971 bonds (distance) P-C4' energy: -145.756 flat angles C4'-P-C4' energy: -172.449 flat angles P-C4'-P energy: -112.904 tors. eta vs tors. theta energy: -193.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2143.846798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2143.846798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2143.846798 (E_RNA) where: Base-Base interactions energy: -1426.129 where: short stacking energy: -648.068 Base-Backbone interact. energy: -4.649 local terms energy: -713.069350 where: bonds (distance) C4'-P energy: -138.628 bonds (distance) P-C4' energy: -140.297 flat angles C4'-P-C4' energy: -166.565 flat angles P-C4'-P energy: -110.958 tors. eta vs tors. theta energy: -156.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -2088.943215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.943215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.943215 (E_RNA) where: Base-Base interactions energy: -1376.344 where: short stacking energy: -650.617 Base-Backbone interact. energy: -2.661 local terms energy: -709.938363 where: bonds (distance) C4'-P energy: -131.155 bonds (distance) P-C4' energy: -152.288 flat angles C4'-P-C4' energy: -161.334 flat angles P-C4'-P energy: -100.130 tors. eta vs tors. theta energy: -165.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1969.770544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1969.770544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1969.770544 (E_RNA) where: Base-Base interactions energy: -1333.249 where: short stacking energy: -595.229 Base-Backbone interact. energy: 1.010 local terms energy: -637.530777 where: bonds (distance) C4'-P energy: -141.628 bonds (distance) P-C4' energy: -129.515 flat angles C4'-P-C4' energy: -147.428 flat angles P-C4'-P energy: -90.196 tors. eta vs tors. theta energy: -128.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1905.445902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1905.445902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1905.445902 (E_RNA) where: Base-Base interactions energy: -1268.805 where: short stacking energy: -564.165 Base-Backbone interact. energy: -0.718 local terms energy: -635.922742 where: bonds (distance) C4'-P energy: -120.009 bonds (distance) P-C4' energy: -133.462 flat angles C4'-P-C4' energy: -141.649 flat angles P-C4'-P energy: -104.533 tors. eta vs tors. theta energy: -136.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1649.402019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.402019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.402019 (E_RNA) where: Base-Base interactions energy: -1070.152 where: short stacking energy: -493.159 Base-Backbone interact. energy: -0.434 local terms energy: -578.815490 where: bonds (distance) C4'-P energy: -123.472 bonds (distance) P-C4' energy: -140.296 flat angles C4'-P-C4' energy: -128.840 flat angles P-C4'-P energy: -92.504 tors. eta vs tors. theta energy: -93.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1443.039871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.039871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.039871 (E_RNA) where: Base-Base interactions energy: -919.056 where: short stacking energy: -421.828 Base-Backbone interact. energy: -1.159 local terms energy: -522.824613 where: bonds (distance) C4'-P energy: -124.069 bonds (distance) P-C4' energy: -129.878 flat angles C4'-P-C4' energy: -138.272 flat angles P-C4'-P energy: -77.049 tors. eta vs tors. theta energy: -53.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1151.540493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.540493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.540493 (E_RNA) where: Base-Base interactions energy: -688.152 where: short stacking energy: -339.241 Base-Backbone interact. energy: -1.399 local terms energy: -461.988807 where: bonds (distance) C4'-P energy: -102.066 bonds (distance) P-C4' energy: -146.766 flat angles C4'-P-C4' energy: -118.262 flat angles P-C4'-P energy: -66.811 tors. eta vs tors. theta energy: -28.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -881.300153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.300153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.300153 (E_RNA) where: Base-Base interactions energy: -432.704 where: short stacking energy: -251.759 Base-Backbone interact. energy: 0.016 local terms energy: -448.612202 where: bonds (distance) C4'-P energy: -128.575 bonds (distance) P-C4' energy: -129.343 flat angles C4'-P-C4' energy: -118.926 flat angles P-C4'-P energy: -64.467 tors. eta vs tors. theta energy: -7.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2460.046136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2460.046136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2460.046136 (E_RNA) where: Base-Base interactions energy: -1729.383 where: short stacking energy: -700.696 Base-Backbone interact. energy: -3.269 local terms energy: -727.393818 where: bonds (distance) C4'-P energy: -154.568 bonds (distance) P-C4' energy: -158.946 flat angles C4'-P-C4' energy: -168.010 flat angles P-C4'-P energy: -90.860 tors. eta vs tors. theta energy: -155.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2334.990116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2334.990116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2334.990116 (E_RNA) where: Base-Base interactions energy: -1568.308 where: short stacking energy: -722.683 Base-Backbone interact. energy: -4.130 local terms energy: -762.551995 where: bonds (distance) C4'-P energy: -152.548 bonds (distance) P-C4' energy: -144.167 flat angles C4'-P-C4' energy: -170.595 flat angles P-C4'-P energy: -105.645 tors. eta vs tors. theta energy: -189.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2129.942318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2129.942318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2129.942318 (E_RNA) where: Base-Base interactions energy: -1458.989 where: short stacking energy: -679.547 Base-Backbone interact. energy: -3.136 local terms energy: -667.817600 where: bonds (distance) C4'-P energy: -121.967 bonds (distance) P-C4' energy: -153.270 flat angles C4'-P-C4' energy: -147.524 flat angles P-C4'-P energy: -94.864 tors. eta vs tors. theta energy: -150.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2117.664711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2117.664711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2117.664711 (E_RNA) where: Base-Base interactions energy: -1424.116 where: short stacking energy: -679.617 Base-Backbone interact. energy: 2.816 local terms energy: -696.364264 where: bonds (distance) C4'-P energy: -132.022 bonds (distance) P-C4' energy: -130.755 flat angles C4'-P-C4' energy: -151.422 flat angles P-C4'-P energy: -103.920 tors. eta vs tors. theta energy: -178.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1951.616126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1951.616126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1951.616126 (E_RNA) where: Base-Base interactions energy: -1287.178 where: short stacking energy: -604.750 Base-Backbone interact. energy: -2.199 local terms energy: -662.239450 where: bonds (distance) C4'-P energy: -147.319 bonds (distance) P-C4' energy: -136.832 flat angles C4'-P-C4' energy: -155.460 flat angles P-C4'-P energy: -102.426 tors. eta vs tors. theta energy: -120.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1921.374388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1921.374388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1921.374388 (E_RNA) where: Base-Base interactions energy: -1292.055 where: short stacking energy: -590.740 Base-Backbone interact. energy: -0.445 local terms energy: -628.874787 where: bonds (distance) C4'-P energy: -128.284 bonds (distance) P-C4' energy: -144.705 flat angles C4'-P-C4' energy: -135.624 flat angles P-C4'-P energy: -94.345 tors. eta vs tors. theta energy: -125.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1648.651372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.651372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.651372 (E_RNA) where: Base-Base interactions energy: -1113.910 where: short stacking energy: -521.364 Base-Backbone interact. energy: 1.986 local terms energy: -536.727518 where: bonds (distance) C4'-P energy: -119.980 bonds (distance) P-C4' energy: -125.866 flat angles C4'-P-C4' energy: -115.301 flat angles P-C4'-P energy: -73.707 tors. eta vs tors. theta energy: -101.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1472.802747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.802747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.802747 (E_RNA) where: Base-Base interactions energy: -947.576 where: short stacking energy: -428.533 Base-Backbone interact. energy: -1.035 local terms energy: -524.192024 where: bonds (distance) C4'-P energy: -132.572 bonds (distance) P-C4' energy: -111.281 flat angles C4'-P-C4' energy: -113.383 flat angles P-C4'-P energy: -80.464 tors. eta vs tors. theta energy: -86.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1172.913888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.913888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1172.913888 (E_RNA) where: Base-Base interactions energy: -710.731 where: short stacking energy: -360.056 Base-Backbone interact. energy: 6.835 local terms energy: -469.018277 where: bonds (distance) C4'-P energy: -104.120 bonds (distance) P-C4' energy: -137.183 flat angles C4'-P-C4' energy: -106.346 flat angles P-C4'-P energy: -69.896 tors. eta vs tors. theta energy: -51.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -935.839031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.839031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.839031 (E_RNA) where: Base-Base interactions energy: -515.308 where: short stacking energy: -304.401 Base-Backbone interact. energy: -0.349 local terms energy: -420.181737 where: bonds (distance) C4'-P energy: -107.360 bonds (distance) P-C4' energy: -112.741 flat angles C4'-P-C4' energy: -105.056 flat angles P-C4'-P energy: -71.173 tors. eta vs tors. theta energy: -23.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2505.695079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.695079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.695079 (E_RNA) where: Base-Base interactions energy: -1769.145 where: short stacking energy: -735.001 Base-Backbone interact. energy: -0.301 local terms energy: -736.248770 where: bonds (distance) C4'-P energy: -137.051 bonds (distance) P-C4' energy: -151.472 flat angles C4'-P-C4' energy: -174.492 flat angles P-C4'-P energy: -105.311 tors. eta vs tors. theta energy: -167.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2330.772677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2330.772677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2330.772677 (E_RNA) where: Base-Base interactions energy: -1562.631 where: short stacking energy: -732.059 Base-Backbone interact. energy: -2.368 local terms energy: -765.774463 where: bonds (distance) C4'-P energy: -145.051 bonds (distance) P-C4' energy: -129.819 flat angles C4'-P-C4' energy: -173.412 flat angles P-C4'-P energy: -118.149 tors. eta vs tors. theta energy: -199.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2141.761373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2141.761373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2141.761373 (E_RNA) where: Base-Base interactions energy: -1447.223 where: short stacking energy: -679.266 Base-Backbone interact. energy: -1.583 local terms energy: -692.955612 where: bonds (distance) C4'-P energy: -133.167 bonds (distance) P-C4' energy: -149.440 flat angles C4'-P-C4' energy: -145.401 flat angles P-C4'-P energy: -100.681 tors. eta vs tors. theta energy: -164.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2097.053167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2097.053167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2097.053167 (E_RNA) where: Base-Base interactions energy: -1404.888 where: short stacking energy: -635.243 Base-Backbone interact. energy: -3.655 local terms energy: -688.510136 where: bonds (distance) C4'-P energy: -147.805 bonds (distance) P-C4' energy: -155.990 flat angles C4'-P-C4' energy: -126.518 flat angles P-C4'-P energy: -89.830 tors. eta vs tors. theta energy: -168.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1910.963065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1910.963065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1910.963065 (E_RNA) where: Base-Base interactions energy: -1257.352 where: short stacking energy: -551.461 Base-Backbone interact. energy: -0.158 local terms energy: -653.453269 where: bonds (distance) C4'-P energy: -137.945 bonds (distance) P-C4' energy: -150.304 flat angles C4'-P-C4' energy: -138.947 flat angles P-C4'-P energy: -92.333 tors. eta vs tors. theta energy: -133.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1910.694499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1910.694499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1910.694499 (E_RNA) where: Base-Base interactions energy: -1270.061 where: short stacking energy: -580.775 Base-Backbone interact. energy: -2.499 local terms energy: -638.133976 where: bonds (distance) C4'-P energy: -134.104 bonds (distance) P-C4' energy: -123.584 flat angles C4'-P-C4' energy: -153.124 flat angles P-C4'-P energy: -76.126 tors. eta vs tors. theta energy: -151.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1643.611067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.611067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.611067 (E_RNA) where: Base-Base interactions energy: -1077.793 where: short stacking energy: -479.452 Base-Backbone interact. energy: -2.034 local terms energy: -563.784697 where: bonds (distance) C4'-P energy: -128.640 bonds (distance) P-C4' energy: -130.391 flat angles C4'-P-C4' energy: -135.905 flat angles P-C4'-P energy: -72.144 tors. eta vs tors. theta energy: -96.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1535.801946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.801946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.801946 (E_RNA) where: Base-Base interactions energy: -1005.167 where: short stacking energy: -470.282 Base-Backbone interact. energy: -3.258 local terms energy: -527.377168 where: bonds (distance) C4'-P energy: -135.069 bonds (distance) P-C4' energy: -122.857 flat angles C4'-P-C4' energy: -118.408 flat angles P-C4'-P energy: -68.514 tors. eta vs tors. theta energy: -82.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1104.188140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.188140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.188140 (E_RNA) where: Base-Base interactions energy: -632.545 where: short stacking energy: -334.400 Base-Backbone interact. energy: 6.659 local terms energy: -478.302333 where: bonds (distance) C4'-P energy: -128.606 bonds (distance) P-C4' energy: -120.167 flat angles C4'-P-C4' energy: -119.720 flat angles P-C4'-P energy: -55.432 tors. eta vs tors. theta energy: -54.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -875.494162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.494162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.494162 (E_RNA) where: Base-Base interactions energy: -463.153 where: short stacking energy: -273.960 Base-Backbone interact. energy: -2.433 local terms energy: -409.907944 where: bonds (distance) C4'-P energy: -134.345 bonds (distance) P-C4' energy: -132.584 flat angles C4'-P-C4' energy: -100.009 flat angles P-C4'-P energy: -42.422 tors. eta vs tors. theta energy: -0.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2489.926803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2489.926803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2489.926803 (E_RNA) where: Base-Base interactions energy: -1748.776 where: short stacking energy: -722.375 Base-Backbone interact. energy: -4.088 local terms energy: -737.062265 where: bonds (distance) C4'-P energy: -145.272 bonds (distance) P-C4' energy: -160.871 flat angles C4'-P-C4' energy: -157.260 flat angles P-C4'-P energy: -103.864 tors. eta vs tors. theta energy: -169.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2352.035326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2352.035326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2352.035326 (E_RNA) where: Base-Base interactions energy: -1587.751 where: short stacking energy: -754.655 Base-Backbone interact. energy: -1.583 local terms energy: -762.701471 where: bonds (distance) C4'-P energy: -126.470 bonds (distance) P-C4' energy: -147.430 flat angles C4'-P-C4' energy: -170.205 flat angles P-C4'-P energy: -115.879 tors. eta vs tors. theta energy: -202.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2164.486864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2164.486864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2164.486864 (E_RNA) where: Base-Base interactions energy: -1490.150 where: short stacking energy: -649.212 Base-Backbone interact. energy: -3.221 local terms energy: -671.115815 where: bonds (distance) C4'-P energy: -140.661 bonds (distance) P-C4' energy: -144.528 flat angles C4'-P-C4' energy: -139.354 flat angles P-C4'-P energy: -94.991 tors. eta vs tors. theta energy: -151.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2120.841822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2120.841822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2120.841822 (E_RNA) where: Base-Base interactions energy: -1427.185 where: short stacking energy: -696.459 Base-Backbone interact. energy: -1.957 local terms energy: -691.699605 where: bonds (distance) C4'-P energy: -136.329 bonds (distance) P-C4' energy: -137.059 flat angles C4'-P-C4' energy: -147.357 flat angles P-C4'-P energy: -84.776 tors. eta vs tors. theta energy: -186.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1953.517641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1953.517641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1953.517641 (E_RNA) where: Base-Base interactions energy: -1293.965 where: short stacking energy: -598.387 Base-Backbone interact. energy: 0.101 local terms energy: -659.653656 where: bonds (distance) C4'-P energy: -128.662 bonds (distance) P-C4' energy: -136.837 flat angles C4'-P-C4' energy: -155.661 flat angles P-C4'-P energy: -93.511 tors. eta vs tors. theta energy: -144.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1844.565875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1844.565875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1844.565875 (E_RNA) where: Base-Base interactions energy: -1217.213 where: short stacking energy: -556.938 Base-Backbone interact. energy: -2.506 local terms energy: -624.846485 where: bonds (distance) C4'-P energy: -130.353 bonds (distance) P-C4' energy: -139.011 flat angles C4'-P-C4' energy: -140.653 flat angles P-C4'-P energy: -87.294 tors. eta vs tors. theta energy: -127.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1679.405699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.405699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.405699 (E_RNA) where: Base-Base interactions energy: -1082.581 where: short stacking energy: -520.039 Base-Backbone interact. energy: -1.619 local terms energy: -595.206079 where: bonds (distance) C4'-P energy: -130.136 bonds (distance) P-C4' energy: -126.472 flat angles C4'-P-C4' energy: -145.107 flat angles P-C4'-P energy: -72.169 tors. eta vs tors. theta energy: -121.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1599.404382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.404382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.404382 (E_RNA) where: Base-Base interactions energy: -1029.061 where: short stacking energy: -468.109 Base-Backbone interact. energy: 0.510 local terms energy: -570.853658 where: bonds (distance) C4'-P energy: -133.956 bonds (distance) P-C4' energy: -140.830 flat angles C4'-P-C4' energy: -123.579 flat angles P-C4'-P energy: -73.799 tors. eta vs tors. theta energy: -98.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1083.894493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.894493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.894493 (E_RNA) where: Base-Base interactions energy: -656.782 where: short stacking energy: -357.907 Base-Backbone interact. energy: -0.487 local terms energy: -426.624717 where: bonds (distance) C4'-P energy: -103.536 bonds (distance) P-C4' energy: -139.112 flat angles C4'-P-C4' energy: -106.701 flat angles P-C4'-P energy: -57.306 tors. eta vs tors. theta energy: -19.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -832.002294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.002294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.002294 (E_RNA) where: Base-Base interactions energy: -453.268 where: short stacking energy: -241.520 Base-Backbone interact. energy: -1.554 local terms energy: -377.179788 where: bonds (distance) C4'-P energy: -98.631 bonds (distance) P-C4' energy: -135.674 flat angles C4'-P-C4' energy: -101.468 flat angles P-C4'-P energy: -57.842 tors. eta vs tors. theta energy: 16.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2526.868219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.868219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.868219 (E_RNA) where: Base-Base interactions energy: -1781.731 where: short stacking energy: -733.645 Base-Backbone interact. energy: -5.426 local terms energy: -739.711009 where: bonds (distance) C4'-P energy: -136.799 bonds (distance) P-C4' energy: -150.547 flat angles C4'-P-C4' energy: -176.562 flat angles P-C4'-P energy: -110.481 tors. eta vs tors. theta energy: -165.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2348.711460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.711460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.711460 (E_RNA) where: Base-Base interactions energy: -1568.301 where: short stacking energy: -732.225 Base-Backbone interact. energy: -3.966 local terms energy: -776.444488 where: bonds (distance) C4'-P energy: -137.831 bonds (distance) P-C4' energy: -154.179 flat angles C4'-P-C4' energy: -166.686 flat angles P-C4'-P energy: -121.566 tors. eta vs tors. theta energy: -196.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2176.115756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.115756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.115756 (E_RNA) where: Base-Base interactions energy: -1467.285 where: short stacking energy: -680.137 Base-Backbone interact. energy: -4.717 local terms energy: -704.113677 where: bonds (distance) C4'-P energy: -124.567 bonds (distance) P-C4' energy: -149.397 flat angles C4'-P-C4' energy: -161.260 flat angles P-C4'-P energy: -92.130 tors. eta vs tors. theta energy: -176.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2081.324497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2081.324497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2081.324497 (E_RNA) where: Base-Base interactions energy: -1359.614 where: short stacking energy: -648.160 Base-Backbone interact. energy: -6.929 local terms energy: -714.781450 where: bonds (distance) C4'-P energy: -144.637 bonds (distance) P-C4' energy: -159.598 flat angles C4'-P-C4' energy: -153.320 flat angles P-C4'-P energy: -84.339 tors. eta vs tors. theta energy: -172.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -2023.692808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2023.692808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2023.692808 (E_RNA) where: Base-Base interactions energy: -1351.876 where: short stacking energy: -637.674 Base-Backbone interact. energy: -5.835 local terms energy: -665.981594 where: bonds (distance) C4'-P energy: -153.288 bonds (distance) P-C4' energy: -127.567 flat angles C4'-P-C4' energy: -140.663 flat angles P-C4'-P energy: -89.299 tors. eta vs tors. theta energy: -155.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1781.483542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1781.483542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1781.483542 (E_RNA) where: Base-Base interactions energy: -1205.947 where: short stacking energy: -541.719 Base-Backbone interact. energy: -0.633 local terms energy: -574.903760 where: bonds (distance) C4'-P energy: -125.113 bonds (distance) P-C4' energy: -128.840 flat angles C4'-P-C4' energy: -139.396 flat angles P-C4'-P energy: -77.316 tors. eta vs tors. theta energy: -104.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1651.985089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.985089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.985089 (E_RNA) where: Base-Base interactions energy: -1079.281 where: short stacking energy: -513.109 Base-Backbone interact. energy: -2.348 local terms energy: -570.356268 where: bonds (distance) C4'-P energy: -116.469 bonds (distance) P-C4' energy: -127.821 flat angles C4'-P-C4' energy: -144.073 flat angles P-C4'-P energy: -91.633 tors. eta vs tors. theta energy: -90.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1579.478150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.478150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.478150 (E_RNA) where: Base-Base interactions energy: -1034.253 where: short stacking energy: -466.997 Base-Backbone interact. energy: 3.051 local terms energy: -548.275888 where: bonds (distance) C4'-P energy: -114.407 bonds (distance) P-C4' energy: -124.675 flat angles C4'-P-C4' energy: -133.832 flat angles P-C4'-P energy: -84.820 tors. eta vs tors. theta energy: -90.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1105.409861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.409861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.409861 (E_RNA) where: Base-Base interactions energy: -616.683 where: short stacking energy: -339.088 Base-Backbone interact. energy: -0.318 local terms energy: -488.408703 where: bonds (distance) C4'-P energy: -125.980 bonds (distance) P-C4' energy: -142.704 flat angles C4'-P-C4' energy: -120.697 flat angles P-C4'-P energy: -70.616 tors. eta vs tors. theta energy: -28.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -833.556469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.556469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.556469 (E_RNA) where: Base-Base interactions energy: -441.937 where: short stacking energy: -286.765 Base-Backbone interact. energy: 0.266 local terms energy: -391.885110 where: bonds (distance) C4'-P energy: -115.814 bonds (distance) P-C4' energy: -105.189 flat angles C4'-P-C4' energy: -107.777 flat angles P-C4'-P energy: -48.166 tors. eta vs tors. theta energy: -14.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2553.455828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2553.455828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2553.455828 (E_RNA) where: Base-Base interactions energy: -1778.078 where: short stacking energy: -766.915 Base-Backbone interact. energy: -2.422 local terms energy: -772.955593 where: bonds (distance) C4'-P energy: -160.715 bonds (distance) P-C4' energy: -145.797 flat angles C4'-P-C4' energy: -169.068 flat angles P-C4'-P energy: -116.167 tors. eta vs tors. theta energy: -181.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2365.919145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2365.919145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2365.919145 (E_RNA) where: Base-Base interactions energy: -1584.565 where: short stacking energy: -767.737 Base-Backbone interact. energy: -3.301 local terms energy: -778.053479 where: bonds (distance) C4'-P energy: -153.568 bonds (distance) P-C4' energy: -138.831 flat angles C4'-P-C4' energy: -169.231 flat angles P-C4'-P energy: -122.809 tors. eta vs tors. theta energy: -193.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2170.611419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2170.611419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2170.611419 (E_RNA) where: Base-Base interactions energy: -1448.326 where: short stacking energy: -630.637 Base-Backbone interact. energy: 0.339 local terms energy: -722.623740 where: bonds (distance) C4'-P energy: -140.240 bonds (distance) P-C4' energy: -145.551 flat angles C4'-P-C4' energy: -165.230 flat angles P-C4'-P energy: -112.654 tors. eta vs tors. theta energy: -158.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2099.956393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2099.956393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2099.956393 (E_RNA) where: Base-Base interactions energy: -1418.279 where: short stacking energy: -673.740 Base-Backbone interact. energy: -3.196 local terms energy: -678.481556 where: bonds (distance) C4'-P energy: -126.950 bonds (distance) P-C4' energy: -137.682 flat angles C4'-P-C4' energy: -156.656 flat angles P-C4'-P energy: -94.500 tors. eta vs tors. theta energy: -162.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -2011.778609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2011.778609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.778609 (E_RNA) where: Base-Base interactions energy: -1344.417 where: short stacking energy: -612.515 Base-Backbone interact. energy: -3.816 local terms energy: -663.545377 where: bonds (distance) C4'-P energy: -125.721 bonds (distance) P-C4' energy: -146.079 flat angles C4'-P-C4' energy: -157.136 flat angles P-C4'-P energy: -102.153 tors. eta vs tors. theta energy: -132.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1803.261383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1803.261383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1803.261383 (E_RNA) where: Base-Base interactions energy: -1175.206 where: short stacking energy: -538.876 Base-Backbone interact. energy: -2.998 local terms energy: -625.057549 where: bonds (distance) C4'-P energy: -129.702 bonds (distance) P-C4' energy: -132.695 flat angles C4'-P-C4' energy: -133.501 flat angles P-C4'-P energy: -104.767 tors. eta vs tors. theta energy: -124.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1795.393323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1795.393323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.393323 (E_RNA) where: Base-Base interactions energy: -1200.822 where: short stacking energy: -549.722 Base-Backbone interact. energy: 1.445 local terms energy: -596.017198 where: bonds (distance) C4'-P energy: -121.391 bonds (distance) P-C4' energy: -141.376 flat angles C4'-P-C4' energy: -134.192 flat angles P-C4'-P energy: -78.792 tors. eta vs tors. theta energy: -120.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1666.024881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.024881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.024881 (E_RNA) where: Base-Base interactions energy: -1084.144 where: short stacking energy: -485.951 Base-Backbone interact. energy: -0.128 local terms energy: -581.753491 where: bonds (distance) C4'-P energy: -132.185 bonds (distance) P-C4' energy: -143.049 flat angles C4'-P-C4' energy: -136.078 flat angles P-C4'-P energy: -80.935 tors. eta vs tors. theta energy: -89.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1098.365183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.365183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.365183 (E_RNA) where: Base-Base interactions energy: -639.208 where: short stacking energy: -335.133 Base-Backbone interact. energy: 4.212 local terms energy: -463.368699 where: bonds (distance) C4'-P energy: -142.246 bonds (distance) P-C4' energy: -122.754 flat angles C4'-P-C4' energy: -126.711 flat angles P-C4'-P energy: -60.607 tors. eta vs tors. theta energy: -11.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -835.245932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.245932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.245932 (E_RNA) where: Base-Base interactions energy: -404.996 where: short stacking energy: -253.910 Base-Backbone interact. energy: 3.314 local terms energy: -433.563866 where: bonds (distance) C4'-P energy: -108.761 bonds (distance) P-C4' energy: -130.750 flat angles C4'-P-C4' energy: -117.174 flat angles P-C4'-P energy: -71.528 tors. eta vs tors. theta energy: -5.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2540.576964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2540.576964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2540.576964 (E_RNA) where: Base-Base interactions energy: -1795.309 where: short stacking energy: -737.760 Base-Backbone interact. energy: -9.171 local terms energy: -736.096721 where: bonds (distance) C4'-P energy: -143.055 bonds (distance) P-C4' energy: -145.484 flat angles C4'-P-C4' energy: -163.650 flat angles P-C4'-P energy: -108.106 tors. eta vs tors. theta energy: -175.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2362.748008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2362.748008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2362.748008 (E_RNA) where: Base-Base interactions energy: -1565.863 where: short stacking energy: -766.886 Base-Backbone interact. energy: -3.025 local terms energy: -793.859985 where: bonds (distance) C4'-P energy: -154.131 bonds (distance) P-C4' energy: -142.390 flat angles C4'-P-C4' energy: -175.219 flat angles P-C4'-P energy: -112.486 tors. eta vs tors. theta energy: -209.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2169.545836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2169.545836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2169.545836 (E_RNA) where: Base-Base interactions energy: -1451.162 where: short stacking energy: -670.579 Base-Backbone interact. energy: 0.798 local terms energy: -719.181988 where: bonds (distance) C4'-P energy: -142.443 bonds (distance) P-C4' energy: -165.254 flat angles C4'-P-C4' energy: -154.367 flat angles P-C4'-P energy: -85.805 tors. eta vs tors. theta energy: -171.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2121.291394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2121.291394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2121.291394 (E_RNA) where: Base-Base interactions energy: -1419.719 where: short stacking energy: -684.468 Base-Backbone interact. energy: -4.228 local terms energy: -697.344358 where: bonds (distance) C4'-P energy: -116.629 bonds (distance) P-C4' energy: -137.814 flat angles C4'-P-C4' energy: -171.720 flat angles P-C4'-P energy: -96.351 tors. eta vs tors. theta energy: -174.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -2012.457218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.457218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.457218 (E_RNA) where: Base-Base interactions energy: -1351.444 where: short stacking energy: -603.016 Base-Backbone interact. energy: 0.900 local terms energy: -661.913313 where: bonds (distance) C4'-P energy: -127.744 bonds (distance) P-C4' energy: -139.720 flat angles C4'-P-C4' energy: -151.859 flat angles P-C4'-P energy: -87.995 tors. eta vs tors. theta energy: -154.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1885.617352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.617352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.617352 (E_RNA) where: Base-Base interactions energy: -1257.044 where: short stacking energy: -578.827 Base-Backbone interact. energy: 1.388 local terms energy: -629.961115 where: bonds (distance) C4'-P energy: -124.601 bonds (distance) P-C4' energy: -147.771 flat angles C4'-P-C4' energy: -147.543 flat angles P-C4'-P energy: -70.119 tors. eta vs tors. theta energy: -139.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1758.708833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1758.708833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.708833 (E_RNA) where: Base-Base interactions energy: -1153.669 where: short stacking energy: -521.312 Base-Backbone interact. energy: -3.114 local terms energy: -601.925686 where: bonds (distance) C4'-P energy: -135.299 bonds (distance) P-C4' energy: -134.827 flat angles C4'-P-C4' energy: -139.258 flat angles P-C4'-P energy: -88.558 tors. eta vs tors. theta energy: -103.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1656.342424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.342424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.342424 (E_RNA) where: Base-Base interactions energy: -1094.481 where: short stacking energy: -508.886 Base-Backbone interact. energy: 0.946 local terms energy: -562.807570 where: bonds (distance) C4'-P energy: -123.487 bonds (distance) P-C4' energy: -116.218 flat angles C4'-P-C4' energy: -137.998 flat angles P-C4'-P energy: -75.646 tors. eta vs tors. theta energy: -109.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1104.225848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.225848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.225848 (E_RNA) where: Base-Base interactions energy: -662.770 where: short stacking energy: -354.507 Base-Backbone interact. energy: -0.112 local terms energy: -441.343492 where: bonds (distance) C4'-P energy: -88.356 bonds (distance) P-C4' energy: -111.720 flat angles C4'-P-C4' energy: -121.157 flat angles P-C4'-P energy: -69.895 tors. eta vs tors. theta energy: -50.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -802.230311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.230311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.230311 (E_RNA) where: Base-Base interactions energy: -370.921 where: short stacking energy: -233.420 Base-Backbone interact. energy: 7.045 local terms energy: -438.354456 where: bonds (distance) C4'-P energy: -117.868 bonds (distance) P-C4' energy: -145.407 flat angles C4'-P-C4' energy: -105.472 flat angles P-C4'-P energy: -72.049 tors. eta vs tors. theta energy: 2.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2523.988590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2523.988590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2523.988590 (E_RNA) where: Base-Base interactions energy: -1757.862 where: short stacking energy: -738.860 Base-Backbone interact. energy: -1.509 local terms energy: -764.617634 where: bonds (distance) C4'-P energy: -158.046 bonds (distance) P-C4' energy: -142.940 flat angles C4'-P-C4' energy: -165.990 flat angles P-C4'-P energy: -116.275 tors. eta vs tors. theta energy: -181.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2328.255712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2328.255712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2328.255712 (E_RNA) where: Base-Base interactions energy: -1527.449 where: short stacking energy: -760.960 Base-Backbone interact. energy: 0.028 local terms energy: -800.835317 where: bonds (distance) C4'-P energy: -150.439 bonds (distance) P-C4' energy: -167.176 flat angles C4'-P-C4' energy: -169.908 flat angles P-C4'-P energy: -113.910 tors. eta vs tors. theta energy: -199.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2158.991956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2158.991956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2158.991956 (E_RNA) where: Base-Base interactions energy: -1471.278 where: short stacking energy: -663.625 Base-Backbone interact. energy: -2.171 local terms energy: -685.543478 where: bonds (distance) C4'-P energy: -135.548 bonds (distance) P-C4' energy: -133.876 flat angles C4'-P-C4' energy: -167.134 flat angles P-C4'-P energy: -88.229 tors. eta vs tors. theta energy: -160.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2108.520993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2108.520993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2108.520993 (E_RNA) where: Base-Base interactions energy: -1394.584 where: short stacking energy: -652.073 Base-Backbone interact. energy: -0.022 local terms energy: -713.915058 where: bonds (distance) C4'-P energy: -138.338 bonds (distance) P-C4' energy: -159.346 flat angles C4'-P-C4' energy: -153.908 flat angles P-C4'-P energy: -94.498 tors. eta vs tors. theta energy: -167.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2080.789688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2080.789688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2080.789688 (E_RNA) where: Base-Base interactions energy: -1421.534 where: short stacking energy: -612.878 Base-Backbone interact. energy: -2.230 local terms energy: -657.025449 where: bonds (distance) C4'-P energy: -115.867 bonds (distance) P-C4' energy: -153.682 flat angles C4'-P-C4' energy: -140.191 flat angles P-C4'-P energy: -99.659 tors. eta vs tors. theta energy: -147.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1884.890775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1884.890775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1884.890775 (E_RNA) where: Base-Base interactions energy: -1275.208 where: short stacking energy: -578.203 Base-Backbone interact. energy: 0.546 local terms energy: -610.228585 where: bonds (distance) C4'-P energy: -136.551 bonds (distance) P-C4' energy: -132.368 flat angles C4'-P-C4' energy: -126.935 flat angles P-C4'-P energy: -102.073 tors. eta vs tors. theta energy: -112.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1713.572863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.572863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.572863 (E_RNA) where: Base-Base interactions energy: -1103.415 where: short stacking energy: -525.780 Base-Backbone interact. energy: 2.306 local terms energy: -612.463832 where: bonds (distance) C4'-P energy: -132.245 bonds (distance) P-C4' energy: -120.457 flat angles C4'-P-C4' energy: -144.492 flat angles P-C4'-P energy: -94.665 tors. eta vs tors. theta energy: -120.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1682.242956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.242956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.242956 (E_RNA) where: Base-Base interactions energy: -1090.517 where: short stacking energy: -507.577 Base-Backbone interact. energy: -2.039 local terms energy: -589.686704 where: bonds (distance) C4'-P energy: -116.217 bonds (distance) P-C4' energy: -141.339 flat angles C4'-P-C4' energy: -127.981 flat angles P-C4'-P energy: -89.757 tors. eta vs tors. theta energy: -114.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1133.712155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.712155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1133.712155 (E_RNA) where: Base-Base interactions energy: -682.909 where: short stacking energy: -340.155 Base-Backbone interact. energy: 3.295 local terms energy: -454.098546 where: bonds (distance) C4'-P energy: -124.881 bonds (distance) P-C4' energy: -123.367 flat angles C4'-P-C4' energy: -114.587 flat angles P-C4'-P energy: -67.406 tors. eta vs tors. theta energy: -23.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -767.358235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.358235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.358235 (E_RNA) where: Base-Base interactions energy: -365.114 where: short stacking energy: -233.043 Base-Backbone interact. energy: -3.475 local terms energy: -398.769242 where: bonds (distance) C4'-P energy: -112.580 bonds (distance) P-C4' energy: -123.308 flat angles C4'-P-C4' energy: -104.960 flat angles P-C4'-P energy: -72.694 tors. eta vs tors. theta energy: 14.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2498.229528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2498.229528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2498.229528 (E_RNA) where: Base-Base interactions energy: -1729.848 where: short stacking energy: -747.909 Base-Backbone interact. energy: -4.911 local terms energy: -763.470501 where: bonds (distance) C4'-P energy: -142.026 bonds (distance) P-C4' energy: -157.302 flat angles C4'-P-C4' energy: -170.310 flat angles P-C4'-P energy: -115.539 tors. eta vs tors. theta energy: -178.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2330.787427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2330.787427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2330.787427 (E_RNA) where: Base-Base interactions energy: -1564.068 where: short stacking energy: -720.521 Base-Backbone interact. energy: -2.753 local terms energy: -763.966846 where: bonds (distance) C4'-P energy: -145.430 bonds (distance) P-C4' energy: -153.980 flat angles C4'-P-C4' energy: -171.605 flat angles P-C4'-P energy: -111.228 tors. eta vs tors. theta energy: -181.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2182.351077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2182.351077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.351077 (E_RNA) where: Base-Base interactions energy: -1467.156 where: short stacking energy: -676.621 Base-Backbone interact. energy: 2.759 local terms energy: -717.954069 where: bonds (distance) C4'-P energy: -154.694 bonds (distance) P-C4' energy: -138.459 flat angles C4'-P-C4' energy: -159.903 flat angles P-C4'-P energy: -94.707 tors. eta vs tors. theta energy: -170.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2113.696834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2113.696834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2113.696834 (E_RNA) where: Base-Base interactions energy: -1408.404 where: short stacking energy: -667.052 Base-Backbone interact. energy: -6.652 local terms energy: -698.640532 where: bonds (distance) C4'-P energy: -133.215 bonds (distance) P-C4' energy: -127.675 flat angles C4'-P-C4' energy: -150.592 flat angles P-C4'-P energy: -110.806 tors. eta vs tors. theta energy: -176.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2070.879573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2070.879573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2070.879573 (E_RNA) where: Base-Base interactions energy: -1408.767 where: short stacking energy: -602.463 Base-Backbone interact. energy: -2.600 local terms energy: -659.512901 where: bonds (distance) C4'-P energy: -126.102 bonds (distance) P-C4' energy: -137.282 flat angles C4'-P-C4' energy: -153.798 flat angles P-C4'-P energy: -91.653 tors. eta vs tors. theta energy: -150.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1857.140790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1857.140790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1857.140790 (E_RNA) where: Base-Base interactions energy: -1241.676 where: short stacking energy: -557.378 Base-Backbone interact. energy: -0.730 local terms energy: -614.735459 where: bonds (distance) C4'-P energy: -117.119 bonds (distance) P-C4' energy: -142.506 flat angles C4'-P-C4' energy: -142.610 flat angles P-C4'-P energy: -89.496 tors. eta vs tors. theta energy: -123.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1691.674816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.674816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.674816 (E_RNA) where: Base-Base interactions energy: -1096.180 where: short stacking energy: -515.645 Base-Backbone interact. energy: -2.955 local terms energy: -592.539913 where: bonds (distance) C4'-P energy: -124.643 bonds (distance) P-C4' energy: -131.854 flat angles C4'-P-C4' energy: -141.752 flat angles P-C4'-P energy: -71.616 tors. eta vs tors. theta energy: -122.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1583.892544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.892544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.892544 (E_RNA) where: Base-Base interactions energy: -1041.119 where: short stacking energy: -466.465 Base-Backbone interact. energy: -0.435 local terms energy: -542.338413 where: bonds (distance) C4'-P energy: -118.634 bonds (distance) P-C4' energy: -132.624 flat angles C4'-P-C4' energy: -119.708 flat angles P-C4'-P energy: -70.419 tors. eta vs tors. theta energy: -100.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1069.616952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.616952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.616952 (E_RNA) where: Base-Base interactions energy: -623.974 where: short stacking energy: -342.870 Base-Backbone interact. energy: 6.164 local terms energy: -451.807346 where: bonds (distance) C4'-P energy: -109.507 bonds (distance) P-C4' energy: -132.539 flat angles C4'-P-C4' energy: -107.581 flat angles P-C4'-P energy: -69.245 tors. eta vs tors. theta energy: -32.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -841.293274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.293274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.293274 (E_RNA) where: Base-Base interactions energy: -403.610 where: short stacking energy: -264.921 Base-Backbone interact. energy: 5.241 local terms energy: -442.925037 where: bonds (distance) C4'-P energy: -121.360 bonds (distance) P-C4' energy: -127.319 flat angles C4'-P-C4' energy: -112.140 flat angles P-C4'-P energy: -65.772 tors. eta vs tors. theta energy: -16.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2491.116374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2491.116374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2491.116374 (E_RNA) where: Base-Base interactions energy: -1748.351 where: short stacking energy: -734.597 Base-Backbone interact. energy: -3.746 local terms energy: -739.020075 where: bonds (distance) C4'-P energy: -140.396 bonds (distance) P-C4' energy: -165.040 flat angles C4'-P-C4' energy: -146.588 flat angles P-C4'-P energy: -106.780 tors. eta vs tors. theta energy: -180.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2384.851668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2384.851668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2384.851668 (E_RNA) where: Base-Base interactions energy: -1603.340 where: short stacking energy: -748.282 Base-Backbone interact. energy: -1.673 local terms energy: -779.837879 where: bonds (distance) C4'-P energy: -139.194 bonds (distance) P-C4' energy: -155.663 flat angles C4'-P-C4' energy: -166.810 flat angles P-C4'-P energy: -118.729 tors. eta vs tors. theta energy: -199.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2211.630688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2211.630688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.630688 (E_RNA) where: Base-Base interactions energy: -1512.709 where: short stacking energy: -671.748 Base-Backbone interact. energy: -4.906 local terms energy: -694.015623 where: bonds (distance) C4'-P energy: -137.722 bonds (distance) P-C4' energy: -140.570 flat angles C4'-P-C4' energy: -149.766 flat angles P-C4'-P energy: -95.432 tors. eta vs tors. theta energy: -170.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2178.460778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2178.460778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2178.460778 (E_RNA) where: Base-Base interactions energy: -1491.568 where: short stacking energy: -722.036 Base-Backbone interact. energy: -4.087 local terms energy: -682.805658 where: bonds (distance) C4'-P energy: -134.653 bonds (distance) P-C4' energy: -125.838 flat angles C4'-P-C4' energy: -153.812 flat angles P-C4'-P energy: -86.233 tors. eta vs tors. theta energy: -182.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2124.277123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.277123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.277123 (E_RNA) where: Base-Base interactions energy: -1450.807 where: short stacking energy: -639.893 Base-Backbone interact. energy: -1.196 local terms energy: -672.273403 where: bonds (distance) C4'-P energy: -135.829 bonds (distance) P-C4' energy: -130.244 flat angles C4'-P-C4' energy: -148.742 flat angles P-C4'-P energy: -100.298 tors. eta vs tors. theta energy: -157.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1864.330114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1864.330114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1864.330114 (E_RNA) where: Base-Base interactions energy: -1285.114 where: short stacking energy: -555.015 Base-Backbone interact. energy: -0.796 local terms energy: -578.419687 where: bonds (distance) C4'-P energy: -117.193 bonds (distance) P-C4' energy: -105.719 flat angles C4'-P-C4' energy: -157.874 flat angles P-C4'-P energy: -69.549 tors. eta vs tors. theta energy: -128.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1695.527170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.527170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.527170 (E_RNA) where: Base-Base interactions energy: -1109.331 where: short stacking energy: -496.043 Base-Backbone interact. energy: -0.824 local terms energy: -585.371797 where: bonds (distance) C4'-P energy: -114.833 bonds (distance) P-C4' energy: -124.471 flat angles C4'-P-C4' energy: -152.965 flat angles P-C4'-P energy: -91.909 tors. eta vs tors. theta energy: -101.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1588.600184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.600184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.600184 (E_RNA) where: Base-Base interactions energy: -1068.522 where: short stacking energy: -515.389 Base-Backbone interact. energy: 7.481 local terms energy: -527.558865 where: bonds (distance) C4'-P energy: -103.607 bonds (distance) P-C4' energy: -125.443 flat angles C4'-P-C4' energy: -122.897 flat angles P-C4'-P energy: -76.211 tors. eta vs tors. theta energy: -99.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1134.139576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.139576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.139576 (E_RNA) where: Base-Base interactions energy: -637.116 where: short stacking energy: -307.366 Base-Backbone interact. energy: 2.056 local terms energy: -499.079215 where: bonds (distance) C4'-P energy: -134.509 bonds (distance) P-C4' energy: -125.702 flat angles C4'-P-C4' energy: -134.714 flat angles P-C4'-P energy: -63.971 tors. eta vs tors. theta energy: -40.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -924.744502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.744502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.744502 (E_RNA) where: Base-Base interactions energy: -505.810 where: short stacking energy: -267.985 Base-Backbone interact. energy: -2.491 local terms energy: -416.443431 where: bonds (distance) C4'-P energy: -108.263 bonds (distance) P-C4' energy: -126.594 flat angles C4'-P-C4' energy: -115.858 flat angles P-C4'-P energy: -61.803 tors. eta vs tors. theta energy: -3.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2477.143679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2477.143679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2477.143679 (E_RNA) where: Base-Base interactions energy: -1741.485 where: short stacking energy: -741.808 Base-Backbone interact. energy: -9.390 local terms energy: -726.268334 where: bonds (distance) C4'-P energy: -139.616 bonds (distance) P-C4' energy: -154.269 flat angles C4'-P-C4' energy: -154.496 flat angles P-C4'-P energy: -94.337 tors. eta vs tors. theta energy: -183.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2377.228510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2377.228510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2377.228510 (E_RNA) where: Base-Base interactions energy: -1625.795 where: short stacking energy: -793.731 Base-Backbone interact. energy: -3.279 local terms energy: -748.154798 where: bonds (distance) C4'-P energy: -127.762 bonds (distance) P-C4' energy: -146.857 flat angles C4'-P-C4' energy: -160.748 flat angles P-C4'-P energy: -109.350 tors. eta vs tors. theta energy: -203.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2220.135622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.135622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2220.135622 (E_RNA) where: Base-Base interactions energy: -1516.144 where: short stacking energy: -702.281 Base-Backbone interact. energy: -0.138 local terms energy: -703.853276 where: bonds (distance) C4'-P energy: -136.613 bonds (distance) P-C4' energy: -133.662 flat angles C4'-P-C4' energy: -170.562 flat angles P-C4'-P energy: -88.658 tors. eta vs tors. theta energy: -174.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2217.396545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2217.396545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2217.396545 (E_RNA) where: Base-Base interactions energy: -1512.819 where: short stacking energy: -699.003 Base-Backbone interact. energy: -2.844 local terms energy: -701.733701 where: bonds (distance) C4'-P energy: -123.845 bonds (distance) P-C4' energy: -143.562 flat angles C4'-P-C4' energy: -159.925 flat angles P-C4'-P energy: -94.230 tors. eta vs tors. theta energy: -180.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2111.333024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2111.333024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2111.333024 (E_RNA) where: Base-Base interactions energy: -1448.671 where: short stacking energy: -640.859 Base-Backbone interact. energy: -2.592 local terms energy: -660.070166 where: bonds (distance) C4'-P energy: -129.625 bonds (distance) P-C4' energy: -115.832 flat angles C4'-P-C4' energy: -145.442 flat angles P-C4'-P energy: -110.548 tors. eta vs tors. theta energy: -158.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1932.669582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.669582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1932.669582 (E_RNA) where: Base-Base interactions energy: -1309.458 where: short stacking energy: -563.037 Base-Backbone interact. energy: 2.946 local terms energy: -626.157504 where: bonds (distance) C4'-P energy: -143.697 bonds (distance) P-C4' energy: -146.516 flat angles C4'-P-C4' energy: -141.777 flat angles P-C4'-P energy: -83.038 tors. eta vs tors. theta energy: -111.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1708.461595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.461595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.461595 (E_RNA) where: Base-Base interactions energy: -1111.303 where: short stacking energy: -538.274 Base-Backbone interact. energy: -5.061 local terms energy: -592.097229 where: bonds (distance) C4'-P energy: -110.686 bonds (distance) P-C4' energy: -135.915 flat angles C4'-P-C4' energy: -150.170 flat angles P-C4'-P energy: -97.696 tors. eta vs tors. theta energy: -97.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1616.444360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.444360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.444360 (E_RNA) where: Base-Base interactions energy: -1057.746 where: short stacking energy: -490.997 Base-Backbone interact. energy: -1.423 local terms energy: -557.275128 where: bonds (distance) C4'-P energy: -131.847 bonds (distance) P-C4' energy: -113.952 flat angles C4'-P-C4' energy: -133.229 flat angles P-C4'-P energy: -95.181 tors. eta vs tors. theta energy: -83.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1205.253768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.253768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1205.253768 (E_RNA) where: Base-Base interactions energy: -686.963 where: short stacking energy: -373.112 Base-Backbone interact. energy: -1.440 local terms energy: -516.850242 where: bonds (distance) C4'-P energy: -115.366 bonds (distance) P-C4' energy: -137.190 flat angles C4'-P-C4' energy: -125.407 flat angles P-C4'-P energy: -89.983 tors. eta vs tors. theta energy: -48.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -946.862605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.862605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.862605 (E_RNA) where: Base-Base interactions energy: -556.502 where: short stacking energy: -297.292 Base-Backbone interact. energy: -0.135 local terms energy: -390.226209 where: bonds (distance) C4'-P energy: -114.378 bonds (distance) P-C4' energy: -111.039 flat angles C4'-P-C4' energy: -108.496 flat angles P-C4'-P energy: -55.393 tors. eta vs tors. theta energy: -0.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2513.277842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2513.277842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2513.277842 (E_RNA) where: Base-Base interactions energy: -1750.354 where: short stacking energy: -727.375 Base-Backbone interact. energy: -6.517 local terms energy: -756.407124 where: bonds (distance) C4'-P energy: -150.158 bonds (distance) P-C4' energy: -151.792 flat angles C4'-P-C4' energy: -162.585 flat angles P-C4'-P energy: -120.631 tors. eta vs tors. theta energy: -171.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2379.597470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.597470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.597470 (E_RNA) where: Base-Base interactions energy: -1610.323 where: short stacking energy: -739.822 Base-Backbone interact. energy: -5.184 local terms energy: -764.090735 where: bonds (distance) C4'-P energy: -133.598 bonds (distance) P-C4' energy: -148.940 flat angles C4'-P-C4' energy: -168.971 flat angles P-C4'-P energy: -118.390 tors. eta vs tors. theta energy: -194.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2188.849196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2188.849196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2188.849196 (E_RNA) where: Base-Base interactions energy: -1488.197 where: short stacking energy: -681.458 Base-Backbone interact. energy: -4.652 local terms energy: -696.000290 where: bonds (distance) C4'-P energy: -147.047 bonds (distance) P-C4' energy: -136.109 flat angles C4'-P-C4' energy: -169.634 flat angles P-C4'-P energy: -88.844 tors. eta vs tors. theta energy: -154.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -2184.507177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2184.507177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2184.507177 (E_RNA) where: Base-Base interactions energy: -1453.669 where: short stacking energy: -669.930 Base-Backbone interact. energy: -2.659 local terms energy: -728.179335 where: bonds (distance) C4'-P energy: -126.172 bonds (distance) P-C4' energy: -161.906 flat angles C4'-P-C4' energy: -167.509 flat angles P-C4'-P energy: -105.702 tors. eta vs tors. theta energy: -166.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -2147.458985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2147.458985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2147.458985 (E_RNA) where: Base-Base interactions energy: -1461.373 where: short stacking energy: -631.196 Base-Backbone interact. energy: 0.908 local terms energy: -686.993769 where: bonds (distance) C4'-P energy: -146.955 bonds (distance) P-C4' energy: -127.251 flat angles C4'-P-C4' energy: -163.045 flat angles P-C4'-P energy: -90.976 tors. eta vs tors. theta energy: -158.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1883.905488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.905488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.905488 (E_RNA) where: Base-Base interactions energy: -1300.819 where: short stacking energy: -570.170 Base-Backbone interact. energy: 3.742 local terms energy: -586.828586 where: bonds (distance) C4'-P energy: -117.593 bonds (distance) P-C4' energy: -130.644 flat angles C4'-P-C4' energy: -145.390 flat angles P-C4'-P energy: -79.784 tors. eta vs tors. theta energy: -113.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1726.285823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.285823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.285823 (E_RNA) where: Base-Base interactions energy: -1092.407 where: short stacking energy: -487.736 Base-Backbone interact. energy: -0.723 local terms energy: -633.155862 where: bonds (distance) C4'-P energy: -136.774 bonds (distance) P-C4' energy: -146.797 flat angles C4'-P-C4' energy: -149.568 flat angles P-C4'-P energy: -88.375 tors. eta vs tors. theta energy: -111.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1526.042131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.042131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.042131 (E_RNA) where: Base-Base interactions energy: -996.124 where: short stacking energy: -466.915 Base-Backbone interact. energy: 1.684 local terms energy: -531.602164 where: bonds (distance) C4'-P energy: -153.741 bonds (distance) P-C4' energy: -103.547 flat angles C4'-P-C4' energy: -135.208 flat angles P-C4'-P energy: -71.577 tors. eta vs tors. theta energy: -67.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1214.150436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.150436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.150436 (E_RNA) where: Base-Base interactions energy: -695.096 where: short stacking energy: -342.589 Base-Backbone interact. energy: 0.119 local terms energy: -519.173533 where: bonds (distance) C4'-P energy: -129.059 bonds (distance) P-C4' energy: -136.274 flat angles C4'-P-C4' energy: -130.700 flat angles P-C4'-P energy: -72.036 tors. eta vs tors. theta energy: -51.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -997.216255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.216255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.216255 (E_RNA) where: Base-Base interactions energy: -565.336 where: short stacking energy: -307.472 Base-Backbone interact. energy: -2.084 local terms energy: -429.796089 where: bonds (distance) C4'-P energy: -114.260 bonds (distance) P-C4' energy: -107.498 flat angles C4'-P-C4' energy: -124.012 flat angles P-C4'-P energy: -69.181 tors. eta vs tors. theta energy: -14.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2482.917390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2482.917390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2482.917390 (E_RNA) where: Base-Base interactions energy: -1750.043 where: short stacking energy: -736.599 Base-Backbone interact. energy: -0.269 local terms energy: -732.604563 where: bonds (distance) C4'-P energy: -141.251 bonds (distance) P-C4' energy: -145.054 flat angles C4'-P-C4' energy: -165.311 flat angles P-C4'-P energy: -114.317 tors. eta vs tors. theta energy: -166.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2358.385942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2358.385942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2358.385942 (E_RNA) where: Base-Base interactions energy: -1592.409 where: short stacking energy: -765.789 Base-Backbone interact. energy: -4.056 local terms energy: -761.920013 where: bonds (distance) C4'-P energy: -145.797 bonds (distance) P-C4' energy: -150.952 flat angles C4'-P-C4' energy: -151.504 flat angles P-C4'-P energy: -113.555 tors. eta vs tors. theta energy: -200.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2261.569688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2261.569688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.569688 (E_RNA) where: Base-Base interactions energy: -1511.825 where: short stacking energy: -692.811 Base-Backbone interact. energy: -1.665 local terms energy: -748.079072 where: bonds (distance) C4'-P energy: -151.739 bonds (distance) P-C4' energy: -140.567 flat angles C4'-P-C4' energy: -171.976 flat angles P-C4'-P energy: -104.717 tors. eta vs tors. theta energy: -179.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -2106.700337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.700337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.700337 (E_RNA) where: Base-Base interactions energy: -1407.831 where: short stacking energy: -596.963 Base-Backbone interact. energy: -5.075 local terms energy: -693.794558 where: bonds (distance) C4'-P energy: -148.110 bonds (distance) P-C4' energy: -141.564 flat angles C4'-P-C4' energy: -165.245 flat angles P-C4'-P energy: -88.864 tors. eta vs tors. theta energy: -150.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -2162.863823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.863823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2162.863823 (E_RNA) where: Base-Base interactions energy: -1489.437 where: short stacking energy: -666.747 Base-Backbone interact. energy: -5.790 local terms energy: -667.637572 where: bonds (distance) C4'-P energy: -138.508 bonds (distance) P-C4' energy: -122.545 flat angles C4'-P-C4' energy: -143.441 flat angles P-C4'-P energy: -91.404 tors. eta vs tors. theta energy: -171.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1942.206405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.206405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.206405 (E_RNA) where: Base-Base interactions energy: -1334.827 where: short stacking energy: -608.525 Base-Backbone interact. energy: 1.282 local terms energy: -608.661532 where: bonds (distance) C4'-P energy: -126.567 bonds (distance) P-C4' energy: -126.382 flat angles C4'-P-C4' energy: -133.874 flat angles P-C4'-P energy: -92.224 tors. eta vs tors. theta energy: -129.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1665.786948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.786948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.786948 (E_RNA) where: Base-Base interactions energy: -1074.529 where: short stacking energy: -500.656 Base-Backbone interact. energy: 0.661 local terms energy: -591.919413 where: bonds (distance) C4'-P energy: -136.642 bonds (distance) P-C4' energy: -130.043 flat angles C4'-P-C4' energy: -148.814 flat angles P-C4'-P energy: -87.961 tors. eta vs tors. theta energy: -88.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1550.712203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.712203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.712203 (E_RNA) where: Base-Base interactions energy: -1020.943 where: short stacking energy: -496.831 Base-Backbone interact. energy: 1.216 local terms energy: -530.985314 where: bonds (distance) C4'-P energy: -129.698 bonds (distance) P-C4' energy: -118.480 flat angles C4'-P-C4' energy: -102.790 flat angles P-C4'-P energy: -85.225 tors. eta vs tors. theta energy: -94.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1208.096460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.096460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.096460 (E_RNA) where: Base-Base interactions energy: -766.663 where: short stacking energy: -392.291 Base-Backbone interact. energy: -5.456 local terms energy: -435.977058 where: bonds (distance) C4'-P energy: -113.677 bonds (distance) P-C4' energy: -108.008 flat angles C4'-P-C4' energy: -92.403 flat angles P-C4'-P energy: -68.469 tors. eta vs tors. theta energy: -53.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1047.185128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.185128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.185128 (E_RNA) where: Base-Base interactions energy: -589.644 where: short stacking energy: -315.945 Base-Backbone interact. energy: -1.586 local terms energy: -455.955566 where: bonds (distance) C4'-P energy: -120.446 bonds (distance) P-C4' energy: -123.657 flat angles C4'-P-C4' energy: -97.339 flat angles P-C4'-P energy: -81.734 tors. eta vs tors. theta energy: -32.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2531.783044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2531.783044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2531.783044 (E_RNA) where: Base-Base interactions energy: -1794.561 where: short stacking energy: -755.526 Base-Backbone interact. energy: -3.218 local terms energy: -734.004380 where: bonds (distance) C4'-P energy: -132.348 bonds (distance) P-C4' energy: -146.147 flat angles C4'-P-C4' energy: -166.304 flat angles P-C4'-P energy: -112.556 tors. eta vs tors. theta energy: -176.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2334.869466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2334.869466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2334.869466 (E_RNA) where: Base-Base interactions energy: -1576.832 where: short stacking energy: -726.382 Base-Backbone interact. energy: -1.828 local terms energy: -756.209637 where: bonds (distance) C4'-P energy: -144.720 bonds (distance) P-C4' energy: -153.233 flat angles C4'-P-C4' energy: -156.675 flat angles P-C4'-P energy: -102.782 tors. eta vs tors. theta energy: -198.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2271.221454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2271.221454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2271.221454 (E_RNA) where: Base-Base interactions energy: -1531.976 where: short stacking energy: -705.680 Base-Backbone interact. energy: -0.538 local terms energy: -738.708072 where: bonds (distance) C4'-P energy: -138.306 bonds (distance) P-C4' energy: -158.087 flat angles C4'-P-C4' energy: -162.874 flat angles P-C4'-P energy: -93.959 tors. eta vs tors. theta energy: -185.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -2200.307090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2200.307090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.307090 (E_RNA) where: Base-Base interactions energy: -1539.743 where: short stacking energy: -670.981 Base-Backbone interact. energy: -3.266 local terms energy: -657.297646 where: bonds (distance) C4'-P energy: -135.945 bonds (distance) P-C4' energy: -124.130 flat angles C4'-P-C4' energy: -161.837 flat angles P-C4'-P energy: -87.797 tors. eta vs tors. theta energy: -147.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -2034.064107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.064107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2034.064107 (E_RNA) where: Base-Base interactions energy: -1342.746 where: short stacking energy: -573.384 Base-Backbone interact. energy: 2.161 local terms energy: -693.478628 where: bonds (distance) C4'-P energy: -150.178 bonds (distance) P-C4' energy: -156.455 flat angles C4'-P-C4' energy: -144.391 flat angles P-C4'-P energy: -90.566 tors. eta vs tors. theta energy: -151.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1935.210133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.210133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.210133 (E_RNA) where: Base-Base interactions energy: -1309.292 where: short stacking energy: -596.073 Base-Backbone interact. energy: -1.446 local terms energy: -624.472142 where: bonds (distance) C4'-P energy: -124.367 bonds (distance) P-C4' energy: -128.405 flat angles C4'-P-C4' energy: -139.498 flat angles P-C4'-P energy: -99.883 tors. eta vs tors. theta energy: -132.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1644.375319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.375319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.375319 (E_RNA) where: Base-Base interactions energy: -1094.581 where: short stacking energy: -516.951 Base-Backbone interact. energy: 8.459 local terms energy: -558.253068 where: bonds (distance) C4'-P energy: -112.841 bonds (distance) P-C4' energy: -132.637 flat angles C4'-P-C4' energy: -126.976 flat angles P-C4'-P energy: -85.770 tors. eta vs tors. theta energy: -100.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1615.784865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.784865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.784865 (E_RNA) where: Base-Base interactions energy: -1049.735 where: short stacking energy: -494.616 Base-Backbone interact. energy: 1.204 local terms energy: -567.253824 where: bonds (distance) C4'-P energy: -134.932 bonds (distance) P-C4' energy: -138.304 flat angles C4'-P-C4' energy: -119.546 flat angles P-C4'-P energy: -86.300 tors. eta vs tors. theta energy: -88.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1184.477557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.477557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.477557 (E_RNA) where: Base-Base interactions energy: -770.779 where: short stacking energy: -360.272 Base-Backbone interact. energy: 1.348 local terms energy: -415.046119 where: bonds (distance) C4'-P energy: -101.955 bonds (distance) P-C4' energy: -123.996 flat angles C4'-P-C4' energy: -111.060 flat angles P-C4'-P energy: -53.210 tors. eta vs tors. theta energy: -24.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1036.138692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.138692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.138692 (E_RNA) where: Base-Base interactions energy: -621.638 where: short stacking energy: -318.446 Base-Backbone interact. energy: -1.023 local terms energy: -413.477554 where: bonds (distance) C4'-P energy: -101.099 bonds (distance) P-C4' energy: -107.781 flat angles C4'-P-C4' energy: -117.095 flat angles P-C4'-P energy: -61.106 tors. eta vs tors. theta energy: -26.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -2542.394191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.394191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2542.394191 (E_RNA) where: Base-Base interactions energy: -1764.532 where: short stacking energy: -745.471 Base-Backbone interact. energy: -3.186 local terms energy: -774.675566 where: bonds (distance) C4'-P energy: -139.558 bonds (distance) P-C4' energy: -155.129 flat angles C4'-P-C4' energy: -161.701 flat angles P-C4'-P energy: -128.337 tors. eta vs tors. theta energy: -189.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2384.960729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2384.960729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2384.960729 (E_RNA) where: Base-Base interactions energy: -1621.038 where: short stacking energy: -742.247 Base-Backbone interact. energy: -3.703 local terms energy: -760.219197 where: bonds (distance) C4'-P energy: -129.988 bonds (distance) P-C4' energy: -163.742 flat angles C4'-P-C4' energy: -166.319 flat angles P-C4'-P energy: -108.226 tors. eta vs tors. theta energy: -191.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2244.702636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2244.702636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2244.702636 (E_RNA) where: Base-Base interactions energy: -1515.023 where: short stacking energy: -703.626 Base-Backbone interact. energy: -0.846 local terms energy: -728.833858 where: bonds (distance) C4'-P energy: -142.520 bonds (distance) P-C4' energy: -137.978 flat angles C4'-P-C4' energy: -158.194 flat angles P-C4'-P energy: -106.620 tors. eta vs tors. theta energy: -183.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -2258.092156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2258.092156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2258.092156 (E_RNA) where: Base-Base interactions energy: -1550.994 where: short stacking energy: -676.779 Base-Backbone interact. energy: -1.350 local terms energy: -705.748079 where: bonds (distance) C4'-P energy: -118.513 bonds (distance) P-C4' energy: -151.450 flat angles C4'-P-C4' energy: -163.265 flat angles P-C4'-P energy: -97.580 tors. eta vs tors. theta energy: -174.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1995.950643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1995.950643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1995.950643 (E_RNA) where: Base-Base interactions energy: -1375.248 where: short stacking energy: -632.209 Base-Backbone interact. energy: -2.936 local terms energy: -617.766772 where: bonds (distance) C4'-P energy: -130.588 bonds (distance) P-C4' energy: -126.821 flat angles C4'-P-C4' energy: -142.681 flat angles P-C4'-P energy: -82.504 tors. eta vs tors. theta energy: -135.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1916.926152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1916.926152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1916.926152 (E_RNA) where: Base-Base interactions energy: -1279.962 where: short stacking energy: -606.338 Base-Backbone interact. energy: -2.964 local terms energy: -634.000324 where: bonds (distance) C4'-P energy: -131.901 bonds (distance) P-C4' energy: -118.166 flat angles C4'-P-C4' energy: -156.410 flat angles P-C4'-P energy: -91.558 tors. eta vs tors. theta energy: -135.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1686.550488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.550488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.550488 (E_RNA) where: Base-Base interactions energy: -1103.478 where: short stacking energy: -467.553 Base-Backbone interact. energy: -2.569 local terms energy: -580.503738 where: bonds (distance) C4'-P energy: -111.398 bonds (distance) P-C4' energy: -142.582 flat angles C4'-P-C4' energy: -135.888 flat angles P-C4'-P energy: -89.981 tors. eta vs tors. theta energy: -100.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1558.109334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.109334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.109334 (E_RNA) where: Base-Base interactions energy: -1032.455 where: short stacking energy: -467.297 Base-Backbone interact. energy: 0.157 local terms energy: -525.812045 where: bonds (distance) C4'-P energy: -112.122 bonds (distance) P-C4' energy: -150.070 flat angles C4'-P-C4' energy: -113.919 flat angles P-C4'-P energy: -85.277 tors. eta vs tors. theta energy: -64.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1138.501701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.501701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.501701 (E_RNA) where: Base-Base interactions energy: -667.699 where: short stacking energy: -349.946 Base-Backbone interact. energy: -1.446 local terms energy: -469.356781 where: bonds (distance) C4'-P energy: -110.717 bonds (distance) P-C4' energy: -123.924 flat angles C4'-P-C4' energy: -106.104 flat angles P-C4'-P energy: -79.394 tors. eta vs tors. theta energy: -49.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -978.295304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.295304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.295304 (E_RNA) where: Base-Base interactions energy: -536.094 where: short stacking energy: -290.788 Base-Backbone interact. energy: -0.083 local terms energy: -442.118266 where: bonds (distance) C4'-P energy: -106.298 bonds (distance) P-C4' energy: -128.799 flat angles C4'-P-C4' energy: -119.986 flat angles P-C4'-P energy: -60.946 tors. eta vs tors. theta energy: -26.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -2539.800910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2539.800910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2539.800910 (E_RNA) where: Base-Base interactions energy: -1784.437 where: short stacking energy: -746.809 Base-Backbone interact. energy: -4.408 local terms energy: -750.955607 where: bonds (distance) C4'-P energy: -137.313 bonds (distance) P-C4' energy: -152.801 flat angles C4'-P-C4' energy: -171.127 flat angles P-C4'-P energy: -111.764 tors. eta vs tors. theta energy: -177.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2363.142362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2363.142362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2363.142362 (E_RNA) where: Base-Base interactions energy: -1611.087 where: short stacking energy: -749.187 Base-Backbone interact. energy: -3.417 local terms energy: -748.638373 where: bonds (distance) C4'-P energy: -145.122 bonds (distance) P-C4' energy: -149.681 flat angles C4'-P-C4' energy: -169.942 flat angles P-C4'-P energy: -88.725 tors. eta vs tors. theta energy: -195.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2328.519759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2328.519759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2328.519759 (E_RNA) where: Base-Base interactions energy: -1552.266 where: short stacking energy: -722.900 Base-Backbone interact. energy: -2.593 local terms energy: -773.660548 where: bonds (distance) C4'-P energy: -141.507 bonds (distance) P-C4' energy: -145.407 flat angles C4'-P-C4' energy: -163.256 flat angles P-C4'-P energy: -111.927 tors. eta vs tors. theta energy: -211.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -2185.957579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2185.957579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2185.957579 (E_RNA) where: Base-Base interactions energy: -1526.291 where: short stacking energy: -689.211 Base-Backbone interact. energy: -1.624 local terms energy: -658.042518 where: bonds (distance) C4'-P energy: -126.405 bonds (distance) P-C4' energy: -140.383 flat angles C4'-P-C4' energy: -140.569 flat angles P-C4'-P energy: -89.613 tors. eta vs tors. theta energy: -161.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -2012.123795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.123795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.123795 (E_RNA) where: Base-Base interactions energy: -1382.126 where: short stacking energy: -612.488 Base-Backbone interact. energy: 1.894 local terms energy: -631.891495 where: bonds (distance) C4'-P energy: -124.599 bonds (distance) P-C4' energy: -142.117 flat angles C4'-P-C4' energy: -149.826 flat angles P-C4'-P energy: -88.158 tors. eta vs tors. theta energy: -127.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1901.321182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1901.321182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1901.321182 (E_RNA) where: Base-Base interactions energy: -1260.637 where: short stacking energy: -596.205 Base-Backbone interact. energy: -0.107 local terms energy: -640.576694 where: bonds (distance) C4'-P energy: -122.988 bonds (distance) P-C4' energy: -135.196 flat angles C4'-P-C4' energy: -138.023 flat angles P-C4'-P energy: -90.804 tors. eta vs tors. theta energy: -153.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1774.056218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1774.056218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.056218 (E_RNA) where: Base-Base interactions energy: -1200.337 where: short stacking energy: -526.250 Base-Backbone interact. energy: 4.627 local terms energy: -578.346239 where: bonds (distance) C4'-P energy: -107.233 bonds (distance) P-C4' energy: -130.790 flat angles C4'-P-C4' energy: -134.500 flat angles P-C4'-P energy: -92.979 tors. eta vs tors. theta energy: -112.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1599.382614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.382614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.382614 (E_RNA) where: Base-Base interactions energy: -1064.458 where: short stacking energy: -493.948 Base-Backbone interact. energy: 2.166 local terms energy: -537.090373 where: bonds (distance) C4'-P energy: -108.993 bonds (distance) P-C4' energy: -126.876 flat angles C4'-P-C4' energy: -122.259 flat angles P-C4'-P energy: -87.564 tors. eta vs tors. theta energy: -91.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1166.240852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.240852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.240852 (E_RNA) where: Base-Base interactions energy: -688.957 where: short stacking energy: -349.457 Base-Backbone interact. energy: 0.279 local terms energy: -477.563013 where: bonds (distance) C4'-P energy: -134.605 bonds (distance) P-C4' energy: -114.084 flat angles C4'-P-C4' energy: -125.870 flat angles P-C4'-P energy: -69.023 tors. eta vs tors. theta energy: -33.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1023.666459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.666459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.666459 (E_RNA) where: Base-Base interactions energy: -551.651 where: short stacking energy: -296.015 Base-Backbone interact. energy: 0.834 local terms energy: -472.848901 where: bonds (distance) C4'-P energy: -132.900 bonds (distance) P-C4' energy: -137.248 flat angles C4'-P-C4' energy: -114.694 flat angles P-C4'-P energy: -64.542 tors. eta vs tors. theta energy: -23.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -2525.554226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2525.554226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2525.554226 (E_RNA) where: Base-Base interactions energy: -1757.535 where: short stacking energy: -768.718 Base-Backbone interact. energy: -4.996 local terms energy: -763.023395 where: bonds (distance) C4'-P energy: -149.954 bonds (distance) P-C4' energy: -153.950 flat angles C4'-P-C4' energy: -174.344 flat angles P-C4'-P energy: -103.728 tors. eta vs tors. theta energy: -181.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2340.343595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.343595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.343595 (E_RNA) where: Base-Base interactions energy: -1579.777 where: short stacking energy: -736.634 Base-Backbone interact. energy: -3.763 local terms energy: -756.803269 where: bonds (distance) C4'-P energy: -138.289 bonds (distance) P-C4' energy: -171.221 flat angles C4'-P-C4' energy: -161.980 flat angles P-C4'-P energy: -92.767 tors. eta vs tors. theta energy: -192.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2316.348571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.348571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2316.348571 (E_RNA) where: Base-Base interactions energy: -1564.251 where: short stacking energy: -746.391 Base-Backbone interact. energy: -1.037 local terms energy: -751.061108 where: bonds (distance) C4'-P energy: -134.019 bonds (distance) P-C4' energy: -144.287 flat angles C4'-P-C4' energy: -160.690 flat angles P-C4'-P energy: -110.187 tors. eta vs tors. theta energy: -201.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2219.598828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2219.598828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2219.598828 (E_RNA) where: Base-Base interactions energy: -1523.786 where: short stacking energy: -662.678 Base-Backbone interact. energy: -1.942 local terms energy: -693.870196 where: bonds (distance) C4'-P energy: -122.199 bonds (distance) P-C4' energy: -145.605 flat angles C4'-P-C4' energy: -151.305 flat angles P-C4'-P energy: -102.049 tors. eta vs tors. theta energy: -172.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -2045.712377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2045.712377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2045.712377 (E_RNA) where: Base-Base interactions energy: -1384.241 where: short stacking energy: -620.900 Base-Backbone interact. energy: -4.694 local terms energy: -656.777749 where: bonds (distance) C4'-P energy: -140.265 bonds (distance) P-C4' energy: -122.671 flat angles C4'-P-C4' energy: -155.568 flat angles P-C4'-P energy: -101.135 tors. eta vs tors. theta energy: -137.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1901.782694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1901.782694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1901.782694 (E_RNA) where: Base-Base interactions energy: -1254.410 where: short stacking energy: -551.733 Base-Backbone interact. energy: 1.332 local terms energy: -648.704669 where: bonds (distance) C4'-P energy: -134.991 bonds (distance) P-C4' energy: -147.836 flat angles C4'-P-C4' energy: -142.703 flat angles P-C4'-P energy: -90.196 tors. eta vs tors. theta energy: -132.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1809.795060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.795060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.795060 (E_RNA) where: Base-Base interactions energy: -1231.069 where: short stacking energy: -515.245 Base-Backbone interact. energy: -0.058 local terms energy: -578.667932 where: bonds (distance) C4'-P energy: -132.714 bonds (distance) P-C4' energy: -129.387 flat angles C4'-P-C4' energy: -126.711 flat angles P-C4'-P energy: -91.442 tors. eta vs tors. theta energy: -98.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1596.566755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.566755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.566755 (E_RNA) where: Base-Base interactions energy: -1057.904 where: short stacking energy: -473.671 Base-Backbone interact. energy: -3.273 local terms energy: -535.390423 where: bonds (distance) C4'-P energy: -110.387 bonds (distance) P-C4' energy: -123.406 flat angles C4'-P-C4' energy: -133.510 flat angles P-C4'-P energy: -93.612 tors. eta vs tors. theta energy: -74.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1186.872659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.872659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.872659 (E_RNA) where: Base-Base interactions energy: -744.956 where: short stacking energy: -387.056 Base-Backbone interact. energy: -0.976 local terms energy: -440.940338 where: bonds (distance) C4'-P energy: -114.442 bonds (distance) P-C4' energy: -118.865 flat angles C4'-P-C4' energy: -99.463 flat angles P-C4'-P energy: -61.208 tors. eta vs tors. theta energy: -46.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1001.981625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.981625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.981625 (E_RNA) where: Base-Base interactions energy: -587.048 where: short stacking energy: -265.846 Base-Backbone interact. energy: -1.023 local terms energy: -413.910842 where: bonds (distance) C4'-P energy: -105.074 bonds (distance) P-C4' energy: -146.133 flat angles C4'-P-C4' energy: -111.758 flat angles P-C4'-P energy: -58.342 tors. eta vs tors. theta energy: 7.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2524.531363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2524.531363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2524.531363 (E_RNA) where: Base-Base interactions energy: -1777.360 where: short stacking energy: -728.760 Base-Backbone interact. energy: 1.010 local terms energy: -748.181339 where: bonds (distance) C4'-P energy: -155.347 bonds (distance) P-C4' energy: -153.008 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -95.028 tors. eta vs tors. theta energy: -163.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2360.798405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2360.798405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2360.798405 (E_RNA) where: Base-Base interactions energy: -1598.388 where: short stacking energy: -746.192 Base-Backbone interact. energy: -3.875 local terms energy: -758.535364 where: bonds (distance) C4'-P energy: -136.979 bonds (distance) P-C4' energy: -147.089 flat angles C4'-P-C4' energy: -163.039 flat angles P-C4'-P energy: -113.177 tors. eta vs tors. theta energy: -198.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2236.767204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.767204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.767204 (E_RNA) where: Base-Base interactions energy: -1486.198 where: short stacking energy: -679.948 Base-Backbone interact. energy: -5.210 local terms energy: -745.359166 where: bonds (distance) C4'-P energy: -144.110 bonds (distance) P-C4' energy: -143.652 flat angles C4'-P-C4' energy: -159.519 flat angles P-C4'-P energy: -115.428 tors. eta vs tors. theta energy: -182.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2239.189089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2239.189089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2239.189089 (E_RNA) where: Base-Base interactions energy: -1519.629 where: short stacking energy: -657.192 Base-Backbone interact. energy: -3.338 local terms energy: -716.222596 where: bonds (distance) C4'-P energy: -149.433 bonds (distance) P-C4' energy: -153.424 flat angles C4'-P-C4' energy: -149.935 flat angles P-C4'-P energy: -101.077 tors. eta vs tors. theta energy: -162.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -2012.685349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.685349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.685349 (E_RNA) where: Base-Base interactions energy: -1380.690 where: short stacking energy: -608.074 Base-Backbone interact. energy: 0.711 local terms energy: -632.705727 where: bonds (distance) C4'-P energy: -135.228 bonds (distance) P-C4' energy: -140.705 flat angles C4'-P-C4' energy: -134.640 flat angles P-C4'-P energy: -92.725 tors. eta vs tors. theta energy: -129.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1927.723919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1927.723919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1927.723919 (E_RNA) where: Base-Base interactions energy: -1308.547 where: short stacking energy: -581.001 Base-Backbone interact. energy: -4.148 local terms energy: -615.028190 where: bonds (distance) C4'-P energy: -143.067 bonds (distance) P-C4' energy: -118.793 flat angles C4'-P-C4' energy: -132.915 flat angles P-C4'-P energy: -89.466 tors. eta vs tors. theta energy: -130.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1696.669074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.669074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.669074 (E_RNA) where: Base-Base interactions energy: -1135.446 where: short stacking energy: -513.556 Base-Backbone interact. energy: 6.305 local terms energy: -567.528424 where: bonds (distance) C4'-P energy: -116.995 bonds (distance) P-C4' energy: -120.401 flat angles C4'-P-C4' energy: -140.793 flat angles P-C4'-P energy: -82.334 tors. eta vs tors. theta energy: -107.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1610.286849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.286849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.286849 (E_RNA) where: Base-Base interactions energy: -1090.915 where: short stacking energy: -471.786 Base-Backbone interact. energy: -0.174 local terms energy: -519.197385 where: bonds (distance) C4'-P energy: -85.622 bonds (distance) P-C4' energy: -129.288 flat angles C4'-P-C4' energy: -120.309 flat angles P-C4'-P energy: -95.676 tors. eta vs tors. theta energy: -88.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1221.964229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.964229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.964229 (E_RNA) where: Base-Base interactions energy: -761.466 where: short stacking energy: -374.844 Base-Backbone interact. energy: 1.007 local terms energy: -461.505539 where: bonds (distance) C4'-P energy: -117.660 bonds (distance) P-C4' energy: -128.840 flat angles C4'-P-C4' energy: -105.154 flat angles P-C4'-P energy: -61.597 tors. eta vs tors. theta energy: -48.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -974.604460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.604460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.604460 (E_RNA) where: Base-Base interactions energy: -575.376 where: short stacking energy: -300.275 Base-Backbone interact. energy: 0.735 local terms energy: -399.963008 where: bonds (distance) C4'-P energy: -105.193 bonds (distance) P-C4' energy: -109.702 flat angles C4'-P-C4' energy: -109.606 flat angles P-C4'-P energy: -67.664 tors. eta vs tors. theta energy: -7.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2524.498161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2524.498161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2524.498161 (E_RNA) where: Base-Base interactions energy: -1762.745 where: short stacking energy: -732.695 Base-Backbone interact. energy: -7.298 local terms energy: -754.454789 where: bonds (distance) C4'-P energy: -153.206 bonds (distance) P-C4' energy: -151.437 flat angles C4'-P-C4' energy: -157.422 flat angles P-C4'-P energy: -113.430 tors. eta vs tors. theta energy: -178.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2391.957855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2391.957855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2391.957855 (E_RNA) where: Base-Base interactions energy: -1608.569 where: short stacking energy: -758.660 Base-Backbone interact. energy: -4.125 local terms energy: -779.263520 where: bonds (distance) C4'-P energy: -142.586 bonds (distance) P-C4' energy: -162.873 flat angles C4'-P-C4' energy: -163.907 flat angles P-C4'-P energy: -110.230 tors. eta vs tors. theta energy: -199.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2275.658559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.658559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.658559 (E_RNA) where: Base-Base interactions energy: -1540.130 where: short stacking energy: -732.819 Base-Backbone interact. energy: -2.470 local terms energy: -733.058739 where: bonds (distance) C4'-P energy: -136.461 bonds (distance) P-C4' energy: -143.715 flat angles C4'-P-C4' energy: -161.025 flat angles P-C4'-P energy: -109.880 tors. eta vs tors. theta energy: -181.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -2215.660621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2215.660621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.660621 (E_RNA) where: Base-Base interactions energy: -1533.944 where: short stacking energy: -624.898 Base-Backbone interact. energy: -3.611 local terms energy: -678.105766 where: bonds (distance) C4'-P energy: -149.971 bonds (distance) P-C4' energy: -145.219 flat angles C4'-P-C4' energy: -137.059 flat angles P-C4'-P energy: -81.155 tors. eta vs tors. theta energy: -164.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1970.974070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.974070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1970.974070 (E_RNA) where: Base-Base interactions energy: -1347.235 where: short stacking energy: -588.347 Base-Backbone interact. energy: -2.458 local terms energy: -621.281256 where: bonds (distance) C4'-P energy: -126.903 bonds (distance) P-C4' energy: -133.441 flat angles C4'-P-C4' energy: -138.723 flat angles P-C4'-P energy: -98.668 tors. eta vs tors. theta energy: -123.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1891.589532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.589532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.589532 (E_RNA) where: Base-Base interactions energy: -1258.343 where: short stacking energy: -564.025 Base-Backbone interact. energy: -1.026 local terms energy: -632.220517 where: bonds (distance) C4'-P energy: -143.736 bonds (distance) P-C4' energy: -119.227 flat angles C4'-P-C4' energy: -150.110 flat angles P-C4'-P energy: -79.813 tors. eta vs tors. theta energy: -139.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1666.057325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.057325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.057325 (E_RNA) where: Base-Base interactions energy: -1066.648 where: short stacking energy: -509.210 Base-Backbone interact. energy: -2.137 local terms energy: -597.271628 where: bonds (distance) C4'-P energy: -128.530 bonds (distance) P-C4' energy: -124.611 flat angles C4'-P-C4' energy: -139.832 flat angles P-C4'-P energy: -94.825 tors. eta vs tors. theta energy: -109.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1666.908577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.908577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.908577 (E_RNA) where: Base-Base interactions energy: -1110.968 where: short stacking energy: -497.048 Base-Backbone interact. energy: 1.820 local terms energy: -557.760431 where: bonds (distance) C4'-P energy: -117.785 bonds (distance) P-C4' energy: -125.946 flat angles C4'-P-C4' energy: -128.554 flat angles P-C4'-P energy: -86.178 tors. eta vs tors. theta energy: -99.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1204.489309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.489309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.489309 (E_RNA) where: Base-Base interactions energy: -731.709 where: short stacking energy: -348.262 Base-Backbone interact. energy: 0.852 local terms energy: -473.632418 where: bonds (distance) C4'-P energy: -113.274 bonds (distance) P-C4' energy: -120.667 flat angles C4'-P-C4' energy: -113.320 flat angles P-C4'-P energy: -85.984 tors. eta vs tors. theta energy: -40.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -986.180265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.180265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.180265 (E_RNA) where: Base-Base interactions energy: -547.220 where: short stacking energy: -269.262 Base-Backbone interact. energy: 0.901 local terms energy: -439.861221 where: bonds (distance) C4'-P energy: -115.900 bonds (distance) P-C4' energy: -135.438 flat angles C4'-P-C4' energy: -107.940 flat angles P-C4'-P energy: -53.344 tors. eta vs tors. theta energy: -27.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -2541.037267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2541.037267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2541.037267 (E_RNA) where: Base-Base interactions energy: -1775.365 where: short stacking energy: -751.694 Base-Backbone interact. energy: -7.525 local terms energy: -758.146748 where: bonds (distance) C4'-P energy: -140.883 bonds (distance) P-C4' energy: -156.370 flat angles C4'-P-C4' energy: -174.499 flat angles P-C4'-P energy: -105.606 tors. eta vs tors. theta energy: -180.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2403.103041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2403.103041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2403.103041 (E_RNA) where: Base-Base interactions energy: -1613.089 where: short stacking energy: -768.589 Base-Backbone interact. energy: -3.799 local terms energy: -786.214860 where: bonds (distance) C4'-P energy: -153.054 bonds (distance) P-C4' energy: -165.621 flat angles C4'-P-C4' energy: -160.221 flat angles P-C4'-P energy: -103.431 tors. eta vs tors. theta energy: -203.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2264.552363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2264.552363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2264.552363 (E_RNA) where: Base-Base interactions energy: -1556.297 where: short stacking energy: -720.597 Base-Backbone interact. energy: -4.400 local terms energy: -703.855029 where: bonds (distance) C4'-P energy: -129.555 bonds (distance) P-C4' energy: -127.474 flat angles C4'-P-C4' energy: -161.907 flat angles P-C4'-P energy: -100.678 tors. eta vs tors. theta energy: -184.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -2263.458448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2263.458448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2263.458448 (E_RNA) where: Base-Base interactions energy: -1542.794 where: short stacking energy: -675.682 Base-Backbone interact. energy: -4.689 local terms energy: -715.975314 where: bonds (distance) C4'-P energy: -152.537 bonds (distance) P-C4' energy: -129.670 flat angles C4'-P-C4' energy: -151.521 flat angles P-C4'-P energy: -107.770 tors. eta vs tors. theta energy: -174.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -2019.003248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2019.003248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2019.003248 (E_RNA) where: Base-Base interactions energy: -1382.961 where: short stacking energy: -608.298 Base-Backbone interact. energy: -2.372 local terms energy: -633.670509 where: bonds (distance) C4'-P energy: -130.843 bonds (distance) P-C4' energy: -117.197 flat angles C4'-P-C4' energy: -161.458 flat angles P-C4'-P energy: -93.562 tors. eta vs tors. theta energy: -130.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1939.693298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1939.693298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1939.693298 (E_RNA) where: Base-Base interactions energy: -1321.742 where: short stacking energy: -573.281 Base-Backbone interact. energy: -2.174 local terms energy: -615.776951 where: bonds (distance) C4'-P energy: -140.369 bonds (distance) P-C4' energy: -120.564 flat angles C4'-P-C4' energy: -134.887 flat angles P-C4'-P energy: -78.346 tors. eta vs tors. theta energy: -141.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1604.685850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.685850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.685850 (E_RNA) where: Base-Base interactions energy: -1025.835 where: short stacking energy: -461.508 Base-Backbone interact. energy: -2.650 local terms energy: -576.200903 where: bonds (distance) C4'-P energy: -113.665 bonds (distance) P-C4' energy: -139.606 flat angles C4'-P-C4' energy: -136.068 flat angles P-C4'-P energy: -96.250 tors. eta vs tors. theta energy: -90.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1613.430389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.430389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.430389 (E_RNA) where: Base-Base interactions energy: -1068.968 where: short stacking energy: -498.064 Base-Backbone interact. energy: 0.726 local terms energy: -545.188818 where: bonds (distance) C4'-P energy: -117.960 bonds (distance) P-C4' energy: -127.828 flat angles C4'-P-C4' energy: -130.290 flat angles P-C4'-P energy: -78.195 tors. eta vs tors. theta energy: -90.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1272.985321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.985321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.985321 (E_RNA) where: Base-Base interactions energy: -804.667 where: short stacking energy: -400.105 Base-Backbone interact. energy: -0.090 local terms energy: -468.227909 where: bonds (distance) C4'-P energy: -112.920 bonds (distance) P-C4' energy: -128.637 flat angles C4'-P-C4' energy: -123.583 flat angles P-C4'-P energy: -60.203 tors. eta vs tors. theta energy: -42.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -919.826968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.826968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.826968 (E_RNA) where: Base-Base interactions energy: -507.741 where: short stacking energy: -256.868 Base-Backbone interact. energy: -0.060 local terms energy: -412.026240 where: bonds (distance) C4'-P energy: -118.407 bonds (distance) P-C4' energy: -125.122 flat angles C4'-P-C4' energy: -113.749 flat angles P-C4'-P energy: -55.543 tors. eta vs tors. theta energy: 0.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -2545.501693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2545.501693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2545.501693 (E_RNA) where: Base-Base interactions energy: -1788.882 where: short stacking energy: -754.604 Base-Backbone interact. energy: -5.346 local terms energy: -751.273637 where: bonds (distance) C4'-P energy: -144.766 bonds (distance) P-C4' energy: -154.886 flat angles C4'-P-C4' energy: -170.597 flat angles P-C4'-P energy: -109.423 tors. eta vs tors. theta energy: -171.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2400.540852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2400.540852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2400.540852 (E_RNA) where: Base-Base interactions energy: -1624.977 where: short stacking energy: -746.945 Base-Backbone interact. energy: -4.980 local terms energy: -770.584055 where: bonds (distance) C4'-P energy: -150.513 bonds (distance) P-C4' energy: -147.901 flat angles C4'-P-C4' energy: -171.891 flat angles P-C4'-P energy: -101.632 tors. eta vs tors. theta energy: -198.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2259.850544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2259.850544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.850544 (E_RNA) where: Base-Base interactions energy: -1512.174 where: short stacking energy: -691.576 Base-Backbone interact. energy: -4.293 local terms energy: -743.382866 where: bonds (distance) C4'-P energy: -127.141 bonds (distance) P-C4' energy: -165.904 flat angles C4'-P-C4' energy: -168.627 flat angles P-C4'-P energy: -108.210 tors. eta vs tors. theta energy: -173.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -2196.223766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.223766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.223766 (E_RNA) where: Base-Base interactions energy: -1470.505 where: short stacking energy: -630.135 Base-Backbone interact. energy: 7.931 local terms energy: -733.649778 where: bonds (distance) C4'-P energy: -154.184 bonds (distance) P-C4' energy: -160.353 flat angles C4'-P-C4' energy: -143.626 flat angles P-C4'-P energy: -115.368 tors. eta vs tors. theta energy: -160.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -2012.158383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.158383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.158383 (E_RNA) where: Base-Base interactions energy: -1402.212 where: short stacking energy: -603.437 Base-Backbone interact. energy: -3.957 local terms energy: -605.989574 where: bonds (distance) C4'-P energy: -118.805 bonds (distance) P-C4' energy: -133.074 flat angles C4'-P-C4' energy: -141.414 flat angles P-C4'-P energy: -84.421 tors. eta vs tors. theta energy: -128.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1871.952787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.952787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.952787 (E_RNA) where: Base-Base interactions energy: -1255.963 where: short stacking energy: -541.717 Base-Backbone interact. energy: -0.676 local terms energy: -615.314545 where: bonds (distance) C4'-P energy: -127.042 bonds (distance) P-C4' energy: -130.752 flat angles C4'-P-C4' energy: -145.565 flat angles P-C4'-P energy: -100.722 tors. eta vs tors. theta energy: -111.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1621.881633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.881633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1621.881633 (E_RNA) where: Base-Base interactions energy: -1054.962 where: short stacking energy: -513.159 Base-Backbone interact. energy: 1.375 local terms energy: -568.294713 where: bonds (distance) C4'-P energy: -129.430 bonds (distance) P-C4' energy: -142.181 flat angles C4'-P-C4' energy: -115.513 flat angles P-C4'-P energy: -82.303 tors. eta vs tors. theta energy: -98.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1559.567223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.567223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.567223 (E_RNA) where: Base-Base interactions energy: -1006.438 where: short stacking energy: -451.877 Base-Backbone interact. energy: -2.763 local terms energy: -550.367084 where: bonds (distance) C4'-P energy: -131.286 bonds (distance) P-C4' energy: -123.189 flat angles C4'-P-C4' energy: -121.392 flat angles P-C4'-P energy: -93.441 tors. eta vs tors. theta energy: -81.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1355.975312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.975312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.975312 (E_RNA) where: Base-Base interactions energy: -890.512 where: short stacking energy: -413.516 Base-Backbone interact. energy: 6.204 local terms energy: -471.666546 where: bonds (distance) C4'-P energy: -131.678 bonds (distance) P-C4' energy: -121.307 flat angles C4'-P-C4' energy: -114.331 flat angles P-C4'-P energy: -51.988 tors. eta vs tors. theta energy: -52.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -896.117936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.117936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.117936 (E_RNA) where: Base-Base interactions energy: -491.313 where: short stacking energy: -284.555 Base-Backbone interact. energy: 2.393 local terms energy: -407.198125 where: bonds (distance) C4'-P energy: -106.646 bonds (distance) P-C4' energy: -102.753 flat angles C4'-P-C4' energy: -130.229 flat angles P-C4'-P energy: -57.975 tors. eta vs tors. theta energy: -9.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -2554.587197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2554.587197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2554.587197 (E_RNA) where: Base-Base interactions energy: -1768.862 where: short stacking energy: -750.199 Base-Backbone interact. energy: -4.285 local terms energy: -781.440896 where: bonds (distance) C4'-P energy: -159.396 bonds (distance) P-C4' energy: -145.666 flat angles C4'-P-C4' energy: -174.337 flat angles P-C4'-P energy: -117.960 tors. eta vs tors. theta energy: -184.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2393.022352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2393.022352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2393.022352 (E_RNA) where: Base-Base interactions energy: -1621.754 where: short stacking energy: -758.816 Base-Backbone interact. energy: -5.553 local terms energy: -765.714851 where: bonds (distance) C4'-P energy: -138.565 bonds (distance) P-C4' energy: -160.327 flat angles C4'-P-C4' energy: -164.977 flat angles P-C4'-P energy: -91.349 tors. eta vs tors. theta energy: -210.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2263.530795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2263.530795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2263.530795 (E_RNA) where: Base-Base interactions energy: -1526.614 where: short stacking energy: -716.904 Base-Backbone interact. energy: -3.616 local terms energy: -733.300763 where: bonds (distance) C4'-P energy: -138.758 bonds (distance) P-C4' energy: -133.653 flat angles C4'-P-C4' energy: -163.111 flat angles P-C4'-P energy: -112.606 tors. eta vs tors. theta energy: -185.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -2218.544089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.544089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.544089 (E_RNA) where: Base-Base interactions energy: -1489.509 where: short stacking energy: -668.991 Base-Backbone interact. energy: -8.335 local terms energy: -720.699969 where: bonds (distance) C4'-P energy: -135.708 bonds (distance) P-C4' energy: -134.787 flat angles C4'-P-C4' energy: -166.665 flat angles P-C4'-P energy: -101.736 tors. eta vs tors. theta energy: -181.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -2004.171811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2004.171811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2004.171811 (E_RNA) where: Base-Base interactions energy: -1369.891 where: short stacking energy: -586.756 Base-Backbone interact. energy: 2.294 local terms energy: -636.575207 where: bonds (distance) C4'-P energy: -143.210 bonds (distance) P-C4' energy: -141.427 flat angles C4'-P-C4' energy: -148.992 flat angles P-C4'-P energy: -90.874 tors. eta vs tors. theta energy: -112.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1929.116415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.116415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.116415 (E_RNA) where: Base-Base interactions energy: -1337.111 where: short stacking energy: -608.074 Base-Backbone interact. energy: -3.772 local terms energy: -588.233561 where: bonds (distance) C4'-P energy: -116.547 bonds (distance) P-C4' energy: -131.943 flat angles C4'-P-C4' energy: -139.068 flat angles P-C4'-P energy: -72.796 tors. eta vs tors. theta energy: -127.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1671.637344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1671.637344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.637344 (E_RNA) where: Base-Base interactions energy: -1083.589 where: short stacking energy: -472.662 Base-Backbone interact. energy: -5.865 local terms energy: -582.184075 where: bonds (distance) C4'-P energy: -116.828 bonds (distance) P-C4' energy: -142.727 flat angles C4'-P-C4' energy: -137.054 flat angles P-C4'-P energy: -91.715 tors. eta vs tors. theta energy: -93.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1558.141753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.141753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.141753 (E_RNA) where: Base-Base interactions energy: -1016.087 where: short stacking energy: -459.558 Base-Backbone interact. energy: 12.275 local terms energy: -554.329392 where: bonds (distance) C4'-P energy: -134.568 bonds (distance) P-C4' energy: -123.947 flat angles C4'-P-C4' energy: -139.040 flat angles P-C4'-P energy: -88.115 tors. eta vs tors. theta energy: -68.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1405.530480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.530480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.530480 (E_RNA) where: Base-Base interactions energy: -906.528 where: short stacking energy: -417.571 Base-Backbone interact. energy: -4.412 local terms energy: -494.590940 where: bonds (distance) C4'-P energy: -129.120 bonds (distance) P-C4' energy: -124.615 flat angles C4'-P-C4' energy: -131.363 flat angles P-C4'-P energy: -40.737 tors. eta vs tors. theta energy: -68.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -920.210209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.210209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.210209 (E_RNA) where: Base-Base interactions energy: -482.676 where: short stacking energy: -290.604 Base-Backbone interact. energy: 2.269 local terms energy: -439.803198 where: bonds (distance) C4'-P energy: -112.512 bonds (distance) P-C4' energy: -136.435 flat angles C4'-P-C4' energy: -105.533 flat angles P-C4'-P energy: -58.171 tors. eta vs tors. theta energy: -27.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -2535.255365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.255365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.255365 (E_RNA) where: Base-Base interactions energy: -1778.759 where: short stacking energy: -778.364 Base-Backbone interact. energy: -6.051 local terms energy: -750.445561 where: bonds (distance) C4'-P energy: -145.346 bonds (distance) P-C4' energy: -163.193 flat angles C4'-P-C4' energy: -173.467 flat angles P-C4'-P energy: -86.207 tors. eta vs tors. theta energy: -182.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2456.706643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2456.706643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2456.706643 (E_RNA) where: Base-Base interactions energy: -1657.269 where: short stacking energy: -810.902 Base-Backbone interact. energy: -1.522 local terms energy: -797.915803 where: bonds (distance) C4'-P energy: -140.760 bonds (distance) P-C4' energy: -163.318 flat angles C4'-P-C4' energy: -171.952 flat angles P-C4'-P energy: -107.394 tors. eta vs tors. theta energy: -214.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2214.092229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2214.092229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2214.092229 (E_RNA) where: Base-Base interactions energy: -1523.377 where: short stacking energy: -686.304 Base-Backbone interact. energy: 2.298 local terms energy: -693.012423 where: bonds (distance) C4'-P energy: -127.673 bonds (distance) P-C4' energy: -134.847 flat angles C4'-P-C4' energy: -151.692 flat angles P-C4'-P energy: -114.378 tors. eta vs tors. theta energy: -164.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -2206.305549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2206.305549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2206.305549 (E_RNA) where: Base-Base interactions energy: -1483.461 where: short stacking energy: -628.328 Base-Backbone interact. energy: -4.794 local terms energy: -718.051235 where: bonds (distance) C4'-P energy: -154.936 bonds (distance) P-C4' energy: -136.890 flat angles C4'-P-C4' energy: -161.041 flat angles P-C4'-P energy: -105.936 tors. eta vs tors. theta energy: -159.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -2020.644771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2020.644771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2020.644771 (E_RNA) where: Base-Base interactions energy: -1353.608 where: short stacking energy: -602.178 Base-Backbone interact. energy: 1.542 local terms energy: -668.578149 where: bonds (distance) C4'-P energy: -141.942 bonds (distance) P-C4' energy: -150.603 flat angles C4'-P-C4' energy: -140.977 flat angles P-C4'-P energy: -91.890 tors. eta vs tors. theta energy: -143.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1917.567178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1917.567178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.567178 (E_RNA) where: Base-Base interactions energy: -1278.942 where: short stacking energy: -549.465 Base-Backbone interact. energy: -1.682 local terms energy: -636.943023 where: bonds (distance) C4'-P energy: -148.055 bonds (distance) P-C4' energy: -139.694 flat angles C4'-P-C4' energy: -143.485 flat angles P-C4'-P energy: -90.965 tors. eta vs tors. theta energy: -114.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1670.083125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.083125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1670.083125 (E_RNA) where: Base-Base interactions energy: -1090.965 where: short stacking energy: -516.620 Base-Backbone interact. energy: -2.478 local terms energy: -576.640420 where: bonds (distance) C4'-P energy: -131.195 bonds (distance) P-C4' energy: -128.009 flat angles C4'-P-C4' energy: -142.123 flat angles P-C4'-P energy: -74.492 tors. eta vs tors. theta energy: -100.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1559.667840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.667840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.667840 (E_RNA) where: Base-Base interactions energy: -1014.995 where: short stacking energy: -454.909 Base-Backbone interact. energy: -1.581 local terms energy: -543.092159 where: bonds (distance) C4'-P energy: -119.554 bonds (distance) P-C4' energy: -146.705 flat angles C4'-P-C4' energy: -113.953 flat angles P-C4'-P energy: -80.224 tors. eta vs tors. theta energy: -82.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1435.019972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.019972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.019972 (E_RNA) where: Base-Base interactions energy: -936.777 where: short stacking energy: -414.230 Base-Backbone interact. energy: 2.938 local terms energy: -501.180561 where: bonds (distance) C4'-P energy: -116.229 bonds (distance) P-C4' energy: -113.663 flat angles C4'-P-C4' energy: -129.581 flat angles P-C4'-P energy: -78.646 tors. eta vs tors. theta energy: -63.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -892.954806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.954806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.954806 (E_RNA) where: Base-Base interactions energy: -448.048 where: short stacking energy: -257.084 Base-Backbone interact. energy: 4.356 local terms energy: -449.263278 where: bonds (distance) C4'-P energy: -125.923 bonds (distance) P-C4' energy: -127.374 flat angles C4'-P-C4' energy: -118.861 flat angles P-C4'-P energy: -69.784 tors. eta vs tors. theta energy: -7.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -2568.984264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2568.984264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2568.984264 (E_RNA) where: Base-Base interactions energy: -1823.466 where: short stacking energy: -793.884 Base-Backbone interact. energy: -5.290 local terms energy: -740.228501 where: bonds (distance) C4'-P energy: -147.817 bonds (distance) P-C4' energy: -145.572 flat angles C4'-P-C4' energy: -144.557 flat angles P-C4'-P energy: -110.409 tors. eta vs tors. theta energy: -191.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2416.643802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2416.643802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2416.643802 (E_RNA) where: Base-Base interactions energy: -1629.339 where: short stacking energy: -791.421 Base-Backbone interact. energy: -1.735 local terms energy: -785.569983 where: bonds (distance) C4'-P energy: -155.115 bonds (distance) P-C4' energy: -144.823 flat angles C4'-P-C4' energy: -168.510 flat angles P-C4'-P energy: -116.760 tors. eta vs tors. theta energy: -200.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2274.919295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2274.919295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2274.919295 (E_RNA) where: Base-Base interactions energy: -1547.938 where: short stacking energy: -737.003 Base-Backbone interact. energy: -3.437 local terms energy: -723.544801 where: bonds (distance) C4'-P energy: -125.548 bonds (distance) P-C4' energy: -151.754 flat angles C4'-P-C4' energy: -164.181 flat angles P-C4'-P energy: -105.286 tors. eta vs tors. theta energy: -176.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -2210.573826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2210.573826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2210.573826 (E_RNA) where: Base-Base interactions energy: -1482.553 where: short stacking energy: -652.419 Base-Backbone interact. energy: -5.519 local terms energy: -722.502075 where: bonds (distance) C4'-P energy: -155.328 bonds (distance) P-C4' energy: -142.715 flat angles C4'-P-C4' energy: -160.441 flat angles P-C4'-P energy: -105.688 tors. eta vs tors. theta energy: -158.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -2041.190634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.190634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2041.190634 (E_RNA) where: Base-Base interactions energy: -1386.807 where: short stacking energy: -619.689 Base-Backbone interact. energy: -0.238 local terms energy: -654.145857 where: bonds (distance) C4'-P energy: -130.381 bonds (distance) P-C4' energy: -128.836 flat angles C4'-P-C4' energy: -148.582 flat angles P-C4'-P energy: -92.685 tors. eta vs tors. theta energy: -153.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1879.976440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1879.976440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1879.976440 (E_RNA) where: Base-Base interactions energy: -1259.507 where: short stacking energy: -592.806 Base-Backbone interact. energy: -3.348 local terms energy: -617.121433 where: bonds (distance) C4'-P energy: -131.525 bonds (distance) P-C4' energy: -121.823 flat angles C4'-P-C4' energy: -134.950 flat angles P-C4'-P energy: -92.478 tors. eta vs tors. theta energy: -136.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1764.530939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1764.530939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.530939 (E_RNA) where: Base-Base interactions energy: -1176.862 where: short stacking energy: -522.375 Base-Backbone interact. energy: 6.093 local terms energy: -593.761514 where: bonds (distance) C4'-P energy: -127.094 bonds (distance) P-C4' energy: -129.230 flat angles C4'-P-C4' energy: -148.460 flat angles P-C4'-P energy: -83.312 tors. eta vs tors. theta energy: -105.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1510.273699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.273699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.273699 (E_RNA) where: Base-Base interactions energy: -979.666 where: short stacking energy: -452.920 Base-Backbone interact. energy: -3.065 local terms energy: -527.542077 where: bonds (distance) C4'-P energy: -134.892 bonds (distance) P-C4' energy: -117.581 flat angles C4'-P-C4' energy: -110.348 flat angles P-C4'-P energy: -80.443 tors. eta vs tors. theta energy: -84.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1391.429825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.429825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.429825 (E_RNA) where: Base-Base interactions energy: -900.972 where: short stacking energy: -403.757 Base-Backbone interact. energy: -2.720 local terms energy: -487.737632 where: bonds (distance) C4'-P energy: -98.033 bonds (distance) P-C4' energy: -134.417 flat angles C4'-P-C4' energy: -113.324 flat angles P-C4'-P energy: -82.464 tors. eta vs tors. theta energy: -59.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -960.171551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.171551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.171551 (E_RNA) where: Base-Base interactions energy: -517.034 where: short stacking energy: -289.423 Base-Backbone interact. energy: -2.210 local terms energy: -440.927966 where: bonds (distance) C4'-P energy: -130.045 bonds (distance) P-C4' energy: -118.280 flat angles C4'-P-C4' energy: -117.777 flat angles P-C4'-P energy: -58.017 tors. eta vs tors. theta energy: -16.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -2572.033511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2572.033511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2572.033511 (E_RNA) where: Base-Base interactions energy: -1779.460 where: short stacking energy: -751.056 Base-Backbone interact. energy: -4.878 local terms energy: -787.695484 where: bonds (distance) C4'-P energy: -161.200 bonds (distance) P-C4' energy: -155.377 flat angles C4'-P-C4' energy: -162.975 flat angles P-C4'-P energy: -120.051 tors. eta vs tors. theta energy: -188.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2430.545224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2430.545224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2430.545224 (E_RNA) where: Base-Base interactions energy: -1641.432 where: short stacking energy: -809.984 Base-Backbone interact. energy: -0.878 local terms energy: -788.235457 where: bonds (distance) C4'-P energy: -138.009 bonds (distance) P-C4' energy: -138.855 flat angles C4'-P-C4' energy: -173.439 flat angles P-C4'-P energy: -116.020 tors. eta vs tors. theta energy: -221.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2283.084105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.084105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2283.084105 (E_RNA) where: Base-Base interactions energy: -1538.605 where: short stacking energy: -692.397 Base-Backbone interact. energy: -4.306 local terms energy: -740.172300 where: bonds (distance) C4'-P energy: -154.040 bonds (distance) P-C4' energy: -133.030 flat angles C4'-P-C4' energy: -171.781 flat angles P-C4'-P energy: -109.210 tors. eta vs tors. theta energy: -172.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2132.149067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2132.149067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2132.149067 (E_RNA) where: Base-Base interactions energy: -1427.801 where: short stacking energy: -689.712 Base-Backbone interact. energy: -6.188 local terms energy: -698.160157 where: bonds (distance) C4'-P energy: -134.612 bonds (distance) P-C4' energy: -146.517 flat angles C4'-P-C4' energy: -155.516 flat angles P-C4'-P energy: -91.599 tors. eta vs tors. theta energy: -169.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -2024.187453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.187453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.187453 (E_RNA) where: Base-Base interactions energy: -1363.767 where: short stacking energy: -593.544 Base-Backbone interact. energy: -2.946 local terms energy: -657.474584 where: bonds (distance) C4'-P energy: -147.972 bonds (distance) P-C4' energy: -135.711 flat angles C4'-P-C4' energy: -144.859 flat angles P-C4'-P energy: -86.568 tors. eta vs tors. theta energy: -142.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1928.358586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.358586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.358586 (E_RNA) where: Base-Base interactions energy: -1319.228 where: short stacking energy: -572.056 Base-Backbone interact. energy: -2.945 local terms energy: -606.185960 where: bonds (distance) C4'-P energy: -127.436 bonds (distance) P-C4' energy: -129.454 flat angles C4'-P-C4' energy: -139.838 flat angles P-C4'-P energy: -79.967 tors. eta vs tors. theta energy: -129.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1784.280701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1784.280701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.280701 (E_RNA) where: Base-Base interactions energy: -1204.121 where: short stacking energy: -538.056 Base-Backbone interact. energy: -2.604 local terms energy: -577.555634 where: bonds (distance) C4'-P energy: -96.281 bonds (distance) P-C4' energy: -146.450 flat angles C4'-P-C4' energy: -129.138 flat angles P-C4'-P energy: -74.868 tors. eta vs tors. theta energy: -130.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1506.077755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.077755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.077755 (E_RNA) where: Base-Base interactions energy: -983.373 where: short stacking energy: -469.720 Base-Backbone interact. energy: -0.316 local terms energy: -522.388765 where: bonds (distance) C4'-P energy: -122.156 bonds (distance) P-C4' energy: -117.045 flat angles C4'-P-C4' energy: -115.118 flat angles P-C4'-P energy: -84.597 tors. eta vs tors. theta energy: -83.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1368.965689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.965689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.965689 (E_RNA) where: Base-Base interactions energy: -863.720 where: short stacking energy: -423.562 Base-Backbone interact. energy: -0.358 local terms energy: -504.887640 where: bonds (distance) C4'-P energy: -124.214 bonds (distance) P-C4' energy: -126.819 flat angles C4'-P-C4' energy: -131.382 flat angles P-C4'-P energy: -69.640 tors. eta vs tors. theta energy: -52.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -952.323543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.323543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.323543 (E_RNA) where: Base-Base interactions energy: -529.305 where: short stacking energy: -279.693 Base-Backbone interact. energy: 0.760 local terms energy: -423.778721 where: bonds (distance) C4'-P energy: -120.674 bonds (distance) P-C4' energy: -105.373 flat angles C4'-P-C4' energy: -111.920 flat angles P-C4'-P energy: -68.544 tors. eta vs tors. theta energy: -17.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -2560.542041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2560.542041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2560.542041 (E_RNA) where: Base-Base interactions energy: -1785.521 where: short stacking energy: -757.006 Base-Backbone interact. energy: -0.573 local terms energy: -774.448063 where: bonds (distance) C4'-P energy: -153.998 bonds (distance) P-C4' energy: -148.372 flat angles C4'-P-C4' energy: -171.884 flat angles P-C4'-P energy: -104.867 tors. eta vs tors. theta energy: -195.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -2383.786583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.786583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2383.786583 (E_RNA) where: Base-Base interactions energy: -1616.786 where: short stacking energy: -761.072 Base-Backbone interact. energy: -4.661 local terms energy: -762.340271 where: bonds (distance) C4'-P energy: -149.511 bonds (distance) P-C4' energy: -136.260 flat angles C4'-P-C4' energy: -168.674 flat angles P-C4'-P energy: -106.638 tors. eta vs tors. theta energy: -201.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -2273.105635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2273.105635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2273.105635 (E_RNA) where: Base-Base interactions energy: -1540.702 where: short stacking energy: -695.101 Base-Backbone interact. energy: -4.316 local terms energy: -728.087537 where: bonds (distance) C4'-P energy: -131.783 bonds (distance) P-C4' energy: -162.532 flat angles C4'-P-C4' energy: -147.650 flat angles P-C4'-P energy: -97.137 tors. eta vs tors. theta energy: -188.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -2168.350112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2168.350112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2168.350112 (E_RNA) where: Base-Base interactions energy: -1469.008 where: short stacking energy: -693.286 Base-Backbone interact. energy: -5.396 local terms energy: -693.945925 where: bonds (distance) C4'-P energy: -138.217 bonds (distance) P-C4' energy: -138.117 flat angles C4'-P-C4' energy: -150.145 flat angles P-C4'-P energy: -90.680 tors. eta vs tors. theta energy: -176.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -2112.390489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.390489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.390489 (E_RNA) where: Base-Base interactions energy: -1449.556 where: short stacking energy: -638.019 Base-Backbone interact. energy: -1.779 local terms energy: -661.054725 where: bonds (distance) C4'-P energy: -125.456 bonds (distance) P-C4' energy: -138.905 flat angles C4'-P-C4' energy: -163.470 flat angles P-C4'-P energy: -84.539 tors. eta vs tors. theta energy: -148.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1979.579365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.579365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.579365 (E_RNA) where: Base-Base interactions energy: -1362.402 where: short stacking energy: -621.705 Base-Backbone interact. energy: -0.401 local terms energy: -616.776114 where: bonds (distance) C4'-P energy: -116.993 bonds (distance) P-C4' energy: -116.734 flat angles C4'-P-C4' energy: -140.852 flat angles P-C4'-P energy: -92.907 tors. eta vs tors. theta energy: -149.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1819.757260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1819.757260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1819.757260 (E_RNA) where: Base-Base interactions energy: -1214.090 where: short stacking energy: -546.407 Base-Backbone interact. energy: -4.539 local terms energy: -601.128280 where: bonds (distance) C4'-P energy: -124.938 bonds (distance) P-C4' energy: -129.805 flat angles C4'-P-C4' energy: -132.230 flat angles P-C4'-P energy: -89.274 tors. eta vs tors. theta energy: -124.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1554.315176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.315176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.315176 (E_RNA) where: Base-Base interactions energy: -1024.964 where: short stacking energy: -464.790 Base-Backbone interact. energy: -3.047 local terms energy: -526.304087 where: bonds (distance) C4'-P energy: -125.711 bonds (distance) P-C4' energy: -132.775 flat angles C4'-P-C4' energy: -107.778 flat angles P-C4'-P energy: -82.574 tors. eta vs tors. theta energy: -77.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1379.775407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.775407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.775407 (E_RNA) where: Base-Base interactions energy: -835.058 where: short stacking energy: -408.619 Base-Backbone interact. energy: 0.133 local terms energy: -544.850360 where: bonds (distance) C4'-P energy: -131.184 bonds (distance) P-C4' energy: -124.821 flat angles C4'-P-C4' energy: -137.515 flat angles P-C4'-P energy: -82.498 tors. eta vs tors. theta energy: -68.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -919.135456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.135456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.135456 (E_RNA) where: Base-Base interactions energy: -519.508 where: short stacking energy: -284.559 Base-Backbone interact. energy: 5.835 local terms energy: -405.462437 where: bonds (distance) C4'-P energy: -123.922 bonds (distance) P-C4' energy: -121.274 flat angles C4'-P-C4' energy: -106.110 flat angles P-C4'-P energy: -49.951 tors. eta vs tors. theta energy: -4.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -2563.713001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2563.713001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2563.713001 (E_RNA) where: Base-Base interactions energy: -1805.105 where: short stacking energy: -765.859 Base-Backbone interact. energy: -1.951 local terms energy: -756.657267 where: bonds (distance) C4'-P energy: -145.814 bonds (distance) P-C4' energy: -140.234 flat angles C4'-P-C4' energy: -166.801 flat angles P-C4'-P energy: -120.792 tors. eta vs tors. theta energy: -183.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -2450.018979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2450.018979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2450.018979 (E_RNA) where: Base-Base interactions energy: -1647.018 where: short stacking energy: -790.016 Base-Backbone interact. energy: -1.233 local terms energy: -801.767541 where: bonds (distance) C4'-P energy: -151.624 bonds (distance) P-C4' energy: -163.041 flat angles C4'-P-C4' energy: -153.925 flat angles P-C4'-P energy: -107.411 tors. eta vs tors. theta energy: -225.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -2326.550592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.550592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.550592 (E_RNA) where: Base-Base interactions energy: -1590.978 where: short stacking energy: -717.127 Base-Backbone interact. energy: 0.274 local terms energy: -735.846491 where: bonds (distance) C4'-P energy: -139.772 bonds (distance) P-C4' energy: -137.991 flat angles C4'-P-C4' energy: -165.542 flat angles P-C4'-P energy: -111.026 tors. eta vs tors. theta energy: -181.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -2138.425417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2138.425417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2138.425417 (E_RNA) where: Base-Base interactions energy: -1451.260 where: short stacking energy: -700.576 Base-Backbone interact. energy: -1.686 local terms energy: -685.479176 where: bonds (distance) C4'-P energy: -124.341 bonds (distance) P-C4' energy: -138.715 flat angles C4'-P-C4' energy: -145.937 flat angles P-C4'-P energy: -87.308 tors. eta vs tors. theta energy: -189.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -2124.475952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2124.475952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.475952 (E_RNA) where: Base-Base interactions energy: -1461.134 where: short stacking energy: -666.274 Base-Backbone interact. energy: 5.544 local terms energy: -668.886276 where: bonds (distance) C4'-P energy: -133.523 bonds (distance) P-C4' energy: -137.168 flat angles C4'-P-C4' energy: -154.821 flat angles P-C4'-P energy: -78.129 tors. eta vs tors. theta energy: -165.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1963.120125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1963.120125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1963.120125 (E_RNA) where: Base-Base interactions energy: -1351.187 where: short stacking energy: -591.507 Base-Backbone interact. energy: -3.300 local terms energy: -608.633254 where: bonds (distance) C4'-P energy: -124.792 bonds (distance) P-C4' energy: -119.995 flat angles C4'-P-C4' energy: -146.627 flat angles P-C4'-P energy: -81.761 tors. eta vs tors. theta energy: -135.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1778.398187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1778.398187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1778.398187 (E_RNA) where: Base-Base interactions energy: -1166.834 where: short stacking energy: -520.646 Base-Backbone interact. energy: 3.374 local terms energy: -614.938106 where: bonds (distance) C4'-P energy: -142.059 bonds (distance) P-C4' energy: -137.244 flat angles C4'-P-C4' energy: -133.357 flat angles P-C4'-P energy: -95.608 tors. eta vs tors. theta energy: -106.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1639.861772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.861772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.861772 (E_RNA) where: Base-Base interactions energy: -1068.076 where: short stacking energy: -450.042 Base-Backbone interact. energy: 3.857 local terms energy: -575.642896 where: bonds (distance) C4'-P energy: -114.510 bonds (distance) P-C4' energy: -135.746 flat angles C4'-P-C4' energy: -132.338 flat angles P-C4'-P energy: -97.555 tors. eta vs tors. theta energy: -95.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1405.964749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.964749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.964749 (E_RNA) where: Base-Base interactions energy: -929.577 where: short stacking energy: -416.570 Base-Backbone interact. energy: 2.451 local terms energy: -478.838720 where: bonds (distance) C4'-P energy: -116.514 bonds (distance) P-C4' energy: -105.615 flat angles C4'-P-C4' energy: -126.292 flat angles P-C4'-P energy: -79.739 tors. eta vs tors. theta energy: -50.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -970.384566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.384566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.384566 (E_RNA) where: Base-Base interactions energy: -530.447 where: short stacking energy: -317.628 Base-Backbone interact. energy: 3.050 local terms energy: -442.988149 where: bonds (distance) C4'-P energy: -117.050 bonds (distance) P-C4' energy: -127.120 flat angles C4'-P-C4' energy: -114.473 flat angles P-C4'-P energy: -64.564 tors. eta vs tors. theta energy: -19.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -2557.993651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2557.993651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2557.993651 (E_RNA) where: Base-Base interactions energy: -1792.685 where: short stacking energy: -752.375 Base-Backbone interact. energy: -6.792 local terms energy: -758.516550 where: bonds (distance) C4'-P energy: -153.662 bonds (distance) P-C4' energy: -155.066 flat angles C4'-P-C4' energy: -173.155 flat angles P-C4'-P energy: -103.564 tors. eta vs tors. theta energy: -173.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -2416.610862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2416.610862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2416.610862 (E_RNA) where: Base-Base interactions energy: -1642.527 where: short stacking energy: -769.477 Base-Backbone interact. energy: -6.878 local terms energy: -767.205933 where: bonds (distance) C4'-P energy: -150.202 bonds (distance) P-C4' energy: -140.590 flat angles C4'-P-C4' energy: -158.809 flat angles P-C4'-P energy: -97.237 tors. eta vs tors. theta energy: -220.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -2322.821684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2322.821684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2322.821684 (E_RNA) where: Base-Base interactions energy: -1596.125 where: short stacking energy: -703.473 Base-Backbone interact. energy: -3.867 local terms energy: -722.829106 where: bonds (distance) C4'-P energy: -158.673 bonds (distance) P-C4' energy: -144.420 flat angles C4'-P-C4' energy: -142.337 flat angles P-C4'-P energy: -104.808 tors. eta vs tors. theta energy: -172.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -2186.571060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.571060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.571060 (E_RNA) where: Base-Base interactions energy: -1496.063 where: short stacking energy: -655.881 Base-Backbone interact. energy: -4.476 local terms energy: -686.032486 where: bonds (distance) C4'-P energy: -134.970 bonds (distance) P-C4' energy: -145.105 flat angles C4'-P-C4' energy: -149.170 flat angles P-C4'-P energy: -90.335 tors. eta vs tors. theta energy: -166.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -2044.447625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2044.447625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2044.447625 (E_RNA) where: Base-Base interactions energy: -1368.292 where: short stacking energy: -638.116 Base-Backbone interact. energy: 0.253 local terms energy: -676.409266 where: bonds (distance) C4'-P energy: -126.217 bonds (distance) P-C4' energy: -141.305 flat angles C4'-P-C4' energy: -154.339 flat angles P-C4'-P energy: -97.784 tors. eta vs tors. theta energy: -156.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1987.110202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1987.110202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1987.110202 (E_RNA) where: Base-Base interactions energy: -1341.715 where: short stacking energy: -578.619 Base-Backbone interact. energy: 2.227 local terms energy: -647.621641 where: bonds (distance) C4'-P energy: -138.165 bonds (distance) P-C4' energy: -129.920 flat angles C4'-P-C4' energy: -139.409 flat angles P-C4'-P energy: -107.967 tors. eta vs tors. theta energy: -132.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1812.005041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.005041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.005041 (E_RNA) where: Base-Base interactions energy: -1224.573 where: short stacking energy: -563.534 Base-Backbone interact. energy: -2.701 local terms energy: -584.730901 where: bonds (distance) C4'-P energy: -132.522 bonds (distance) P-C4' energy: -129.925 flat angles C4'-P-C4' energy: -133.096 flat angles P-C4'-P energy: -64.790 tors. eta vs tors. theta energy: -124.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1605.555515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.555515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.555515 (E_RNA) where: Base-Base interactions energy: -1067.001 where: short stacking energy: -450.904 Base-Backbone interact. energy: -1.842 local terms energy: -536.712595 where: bonds (distance) C4'-P energy: -114.514 bonds (distance) P-C4' energy: -113.307 flat angles C4'-P-C4' energy: -130.030 flat angles P-C4'-P energy: -86.908 tors. eta vs tors. theta energy: -91.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1504.961970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.961970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.961970 (E_RNA) where: Base-Base interactions energy: -982.386 where: short stacking energy: -463.483 Base-Backbone interact. energy: 0.130 local terms energy: -522.705372 where: bonds (distance) C4'-P energy: -107.966 bonds (distance) P-C4' energy: -125.013 flat angles C4'-P-C4' energy: -124.654 flat angles P-C4'-P energy: -79.737 tors. eta vs tors. theta energy: -85.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -800.259596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.259596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.259596 (E_RNA) where: Base-Base interactions energy: -411.951 where: short stacking energy: -235.523 Base-Backbone interact. energy: -4.108 local terms energy: -384.199974 where: bonds (distance) C4'-P energy: -130.699 bonds (distance) P-C4' energy: -114.859 flat angles C4'-P-C4' energy: -76.274 flat angles P-C4'-P energy: -63.057 tors. eta vs tors. theta energy: 0.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -2538.290714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2538.290714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2538.290714 (E_RNA) where: Base-Base interactions energy: -1786.552 where: short stacking energy: -748.070 Base-Backbone interact. energy: -6.139 local terms energy: -745.599752 where: bonds (distance) C4'-P energy: -148.667 bonds (distance) P-C4' energy: -151.452 flat angles C4'-P-C4' energy: -166.871 flat angles P-C4'-P energy: -97.486 tors. eta vs tors. theta energy: -181.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -2416.819349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2416.819349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2416.819349 (E_RNA) where: Base-Base interactions energy: -1634.976 where: short stacking energy: -786.453 Base-Backbone interact. energy: -2.840 local terms energy: -779.003350 where: bonds (distance) C4'-P energy: -143.260 bonds (distance) P-C4' energy: -147.381 flat angles C4'-P-C4' energy: -168.861 flat angles P-C4'-P energy: -102.409 tors. eta vs tors. theta energy: -217.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -2305.791437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2305.791437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2305.791437 (E_RNA) where: Base-Base interactions energy: -1554.088 where: short stacking energy: -672.540 Base-Backbone interact. energy: -1.941 local terms energy: -749.763108 where: bonds (distance) C4'-P energy: -141.724 bonds (distance) P-C4' energy: -159.676 flat angles C4'-P-C4' energy: -169.947 flat angles P-C4'-P energy: -110.779 tors. eta vs tors. theta energy: -167.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -2158.307205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2158.307205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2158.307205 (E_RNA) where: Base-Base interactions energy: -1468.414 where: short stacking energy: -636.054 Base-Backbone interact. energy: 0.378 local terms energy: -690.271039 where: bonds (distance) C4'-P energy: -134.658 bonds (distance) P-C4' energy: -145.632 flat angles C4'-P-C4' energy: -156.114 flat angles P-C4'-P energy: -104.797 tors. eta vs tors. theta energy: -149.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -2081.834405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2081.834405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2081.834405 (E_RNA) where: Base-Base interactions energy: -1420.011 where: short stacking energy: -667.629 Base-Backbone interact. energy: -5.279 local terms energy: -656.544535 where: bonds (distance) C4'-P energy: -126.962 bonds (distance) P-C4' energy: -122.585 flat angles C4'-P-C4' energy: -142.392 flat angles P-C4'-P energy: -91.465 tors. eta vs tors. theta energy: -173.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1958.916754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1958.916754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.916754 (E_RNA) where: Base-Base interactions energy: -1351.541 where: short stacking energy: -604.874 Base-Backbone interact. energy: -0.985 local terms energy: -606.391003 where: bonds (distance) C4'-P energy: -131.748 bonds (distance) P-C4' energy: -127.132 flat angles C4'-P-C4' energy: -136.326 flat angles P-C4'-P energy: -81.364 tors. eta vs tors. theta energy: -129.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1784.165067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1784.165067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.165067 (E_RNA) where: Base-Base interactions energy: -1225.882 where: short stacking energy: -527.415 Base-Backbone interact. energy: -2.758 local terms energy: -555.525343 where: bonds (distance) C4'-P energy: -119.124 bonds (distance) P-C4' energy: -126.477 flat angles C4'-P-C4' energy: -116.897 flat angles P-C4'-P energy: -88.863 tors. eta vs tors. theta energy: -104.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1646.256699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.256699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.256699 (E_RNA) where: Base-Base interactions energy: -1077.180 where: short stacking energy: -496.323 Base-Backbone interact. energy: -0.856 local terms energy: -568.221265 where: bonds (distance) C4'-P energy: -118.497 bonds (distance) P-C4' energy: -143.529 flat angles C4'-P-C4' energy: -138.317 flat angles P-C4'-P energy: -58.894 tors. eta vs tors. theta energy: -108.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1459.137087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.137087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.137087 (E_RNA) where: Base-Base interactions energy: -951.074 where: short stacking energy: -436.532 Base-Backbone interact. energy: 0.479 local terms energy: -508.541943 where: bonds (distance) C4'-P energy: -121.792 bonds (distance) P-C4' energy: -128.128 flat angles C4'-P-C4' energy: -122.685 flat angles P-C4'-P energy: -57.638 tors. eta vs tors. theta energy: -78.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -909.088373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.088373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.088373 (E_RNA) where: Base-Base interactions energy: -479.162 where: short stacking energy: -281.053 Base-Backbone interact. energy: -1.531 local terms energy: -428.394819 where: bonds (distance) C4'-P energy: -109.403 bonds (distance) P-C4' energy: -126.751 flat angles C4'-P-C4' energy: -109.028 flat angles P-C4'-P energy: -68.605 tors. eta vs tors. theta energy: -14.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -2561.594294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2561.594294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2561.594294 (E_RNA) where: Base-Base interactions energy: -1817.893 where: short stacking energy: -783.355 Base-Backbone interact. energy: -8.489 local terms energy: -735.211989 where: bonds (distance) C4'-P energy: -134.444 bonds (distance) P-C4' energy: -138.606 flat angles C4'-P-C4' energy: -158.745 flat angles P-C4'-P energy: -112.463 tors. eta vs tors. theta energy: -190.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -2373.912930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.912930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.912930 (E_RNA) where: Base-Base interactions energy: -1614.379 where: short stacking energy: -756.520 Base-Backbone interact. energy: -2.755 local terms energy: -756.778478 where: bonds (distance) C4'-P energy: -141.198 bonds (distance) P-C4' energy: -153.337 flat angles C4'-P-C4' energy: -158.076 flat angles P-C4'-P energy: -98.819 tors. eta vs tors. theta energy: -205.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -2313.373571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2313.373571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2313.373571 (E_RNA) where: Base-Base interactions energy: -1563.290 where: short stacking energy: -704.227 Base-Backbone interact. energy: -5.898 local terms energy: -744.185815 where: bonds (distance) C4'-P energy: -158.753 bonds (distance) P-C4' energy: -138.383 flat angles C4'-P-C4' energy: -170.178 flat angles P-C4'-P energy: -93.837 tors. eta vs tors. theta energy: -183.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -2186.431992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.431992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.431992 (E_RNA) where: Base-Base interactions energy: -1518.950 where: short stacking energy: -684.154 Base-Backbone interact. energy: 3.807 local terms energy: -671.288923 where: bonds (distance) C4'-P energy: -125.502 bonds (distance) P-C4' energy: -149.900 flat angles C4'-P-C4' energy: -144.190 flat angles P-C4'-P energy: -91.431 tors. eta vs tors. theta energy: -160.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1966.513955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1966.513955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1966.513955 (E_RNA) where: Base-Base interactions energy: -1306.675 where: short stacking energy: -607.546 Base-Backbone interact. energy: -3.279 local terms energy: -656.560066 where: bonds (distance) C4'-P energy: -121.984 bonds (distance) P-C4' energy: -139.422 flat angles C4'-P-C4' energy: -154.303 flat angles P-C4'-P energy: -100.976 tors. eta vs tors. theta energy: -139.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1935.739528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.739528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.739528 (E_RNA) where: Base-Base interactions energy: -1333.630 where: short stacking energy: -577.262 Base-Backbone interact. energy: -5.158 local terms energy: -596.951540 where: bonds (distance) C4'-P energy: -130.059 bonds (distance) P-C4' energy: -137.457 flat angles C4'-P-C4' energy: -143.714 flat angles P-C4'-P energy: -68.565 tors. eta vs tors. theta energy: -117.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1793.655043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1793.655043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1793.655043 (E_RNA) where: Base-Base interactions energy: -1190.889 where: short stacking energy: -537.687 Base-Backbone interact. energy: -5.222 local terms energy: -597.544628 where: bonds (distance) C4'-P energy: -137.769 bonds (distance) P-C4' energy: -136.742 flat angles C4'-P-C4' energy: -140.604 flat angles P-C4'-P energy: -81.952 tors. eta vs tors. theta energy: -100.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1639.402635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.402635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.402635 (E_RNA) where: Base-Base interactions energy: -1097.694 where: short stacking energy: -478.882 Base-Backbone interact. energy: -3.037 local terms energy: -538.671609 where: bonds (distance) C4'-P energy: -112.206 bonds (distance) P-C4' energy: -131.057 flat angles C4'-P-C4' energy: -133.051 flat angles P-C4'-P energy: -78.518 tors. eta vs tors. theta energy: -83.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1413.702654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1413.702654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.702654 (E_RNA) where: Base-Base interactions energy: -929.997 where: short stacking energy: -438.177 Base-Backbone interact. energy: -2.124 local terms energy: -481.582274 where: bonds (distance) C4'-P energy: -112.136 bonds (distance) P-C4' energy: -111.294 flat angles C4'-P-C4' energy: -109.729 flat angles P-C4'-P energy: -74.943 tors. eta vs tors. theta energy: -73.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -924.505113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.505113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.505113 (E_RNA) where: Base-Base interactions energy: -474.167 where: short stacking energy: -270.266 Base-Backbone interact. energy: 1.630 local terms energy: -451.968351 where: bonds (distance) C4'-P energy: -131.902 bonds (distance) P-C4' energy: -115.763 flat angles C4'-P-C4' energy: -123.941 flat angles P-C4'-P energy: -60.154 tors. eta vs tors. theta energy: -20.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -2509.486491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2509.486491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2509.486491 (E_RNA) where: Base-Base interactions energy: -1760.690 where: short stacking energy: -724.573 Base-Backbone interact. energy: -7.124 local terms energy: -741.672189 where: bonds (distance) C4'-P energy: -152.929 bonds (distance) P-C4' energy: -143.737 flat angles C4'-P-C4' energy: -164.984 flat angles P-C4'-P energy: -111.302 tors. eta vs tors. theta energy: -168.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -2389.457187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2389.457187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2389.457187 (E_RNA) where: Base-Base interactions energy: -1594.162 where: short stacking energy: -767.208 Base-Backbone interact. energy: -0.175 local terms energy: -795.120210 where: bonds (distance) C4'-P energy: -146.961 bonds (distance) P-C4' energy: -167.536 flat angles C4'-P-C4' energy: -170.235 flat angles P-C4'-P energy: -99.972 tors. eta vs tors. theta energy: -210.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -2308.883853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2308.883853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2308.883853 (E_RNA) where: Base-Base interactions energy: -1564.029 where: short stacking energy: -691.997 Base-Backbone interact. energy: -2.498 local terms energy: -742.356933 where: bonds (distance) C4'-P energy: -155.405 bonds (distance) P-C4' energy: -145.519 flat angles C4'-P-C4' energy: -155.630 flat angles P-C4'-P energy: -103.900 tors. eta vs tors. theta energy: -181.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -2191.072321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2191.072321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2191.072321 (E_RNA) where: Base-Base interactions energy: -1493.692 where: short stacking energy: -637.927 Base-Backbone interact. energy: 0.915 local terms energy: -698.295301 where: bonds (distance) C4'-P energy: -123.691 bonds (distance) P-C4' energy: -149.758 flat angles C4'-P-C4' energy: -170.509 flat angles P-C4'-P energy: -98.421 tors. eta vs tors. theta energy: -155.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -2035.479504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2035.479504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2035.479504 (E_RNA) where: Base-Base interactions energy: -1381.314 where: short stacking energy: -614.946 Base-Backbone interact. energy: -2.433 local terms energy: -651.732676 where: bonds (distance) C4'-P energy: -131.298 bonds (distance) P-C4' energy: -138.796 flat angles C4'-P-C4' energy: -145.937 flat angles P-C4'-P energy: -96.899 tors. eta vs tors. theta energy: -138.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1879.103333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1879.103333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1879.103333 (E_RNA) where: Base-Base interactions energy: -1273.003 where: short stacking energy: -588.571 Base-Backbone interact. energy: 0.024 local terms energy: -606.124080 where: bonds (distance) C4'-P energy: -133.577 bonds (distance) P-C4' energy: -114.558 flat angles C4'-P-C4' energy: -134.599 flat angles P-C4'-P energy: -80.175 tors. eta vs tors. theta energy: -143.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1786.058369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1786.058369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.058369 (E_RNA) where: Base-Base interactions energy: -1218.315 where: short stacking energy: -543.874 Base-Backbone interact. energy: 2.138 local terms energy: -569.881520 where: bonds (distance) C4'-P energy: -132.823 bonds (distance) P-C4' energy: -127.775 flat angles C4'-P-C4' energy: -128.502 flat angles P-C4'-P energy: -58.025 tors. eta vs tors. theta energy: -122.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1718.299161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.299161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.299161 (E_RNA) where: Base-Base interactions energy: -1153.478 where: short stacking energy: -521.501 Base-Backbone interact. energy: 1.952 local terms energy: -566.774029 where: bonds (distance) C4'-P energy: -111.052 bonds (distance) P-C4' energy: -132.185 flat angles C4'-P-C4' energy: -145.338 flat angles P-C4'-P energy: -75.726 tors. eta vs tors. theta energy: -102.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1488.715648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.715648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.715648 (E_RNA) where: Base-Base interactions energy: -948.528 where: short stacking energy: -439.799 Base-Backbone interact. energy: -0.940 local terms energy: -539.247127 where: bonds (distance) C4'-P energy: -134.432 bonds (distance) P-C4' energy: -128.305 flat angles C4'-P-C4' energy: -137.963 flat angles P-C4'-P energy: -57.496 tors. eta vs tors. theta energy: -81.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -857.381260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.381260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.381260 (E_RNA) where: Base-Base interactions energy: -469.077 where: short stacking energy: -262.892 Base-Backbone interact. energy: -3.732 local terms energy: -384.572057 where: bonds (distance) C4'-P energy: -107.171 bonds (distance) P-C4' energy: -116.489 flat angles C4'-P-C4' energy: -99.091 flat angles P-C4'-P energy: -59.594 tors. eta vs tors. theta energy: -2.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -2511.851563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2511.851563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2511.851563 (E_RNA) where: Base-Base interactions energy: -1805.639 where: short stacking energy: -725.739 Base-Backbone interact. energy: 1.719 local terms energy: -707.931153 where: bonds (distance) C4'-P energy: -125.216 bonds (distance) P-C4' energy: -152.054 flat angles C4'-P-C4' energy: -170.034 flat angles P-C4'-P energy: -103.944 tors. eta vs tors. theta energy: -156.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -2451.170325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2451.170325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2451.170325 (E_RNA) where: Base-Base interactions energy: -1660.125 where: short stacking energy: -774.425 Base-Backbone interact. energy: -0.024 local terms energy: -791.021081 where: bonds (distance) C4'-P energy: -159.485 bonds (distance) P-C4' energy: -165.616 flat angles C4'-P-C4' energy: -163.011 flat angles P-C4'-P energy: -96.515 tors. eta vs tors. theta energy: -206.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -2295.806986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2295.806986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.806986 (E_RNA) where: Base-Base interactions energy: -1598.491 where: short stacking energy: -722.323 Base-Backbone interact. energy: -1.072 local terms energy: -696.243553 where: bonds (distance) C4'-P energy: -120.783 bonds (distance) P-C4' energy: -138.039 flat angles C4'-P-C4' energy: -146.706 flat angles P-C4'-P energy: -103.749 tors. eta vs tors. theta energy: -186.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -2221.774857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2221.774857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2221.774857 (E_RNA) where: Base-Base interactions energy: -1563.402 where: short stacking energy: -672.446 Base-Backbone interact. energy: -1.588 local terms energy: -656.784537 where: bonds (distance) C4'-P energy: -134.041 bonds (distance) P-C4' energy: -148.351 flat angles C4'-P-C4' energy: -140.163 flat angles P-C4'-P energy: -82.436 tors. eta vs tors. theta energy: -151.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -2001.980197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.980197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.980197 (E_RNA) where: Base-Base interactions energy: -1348.069 where: short stacking energy: -597.141 Base-Backbone interact. energy: 0.272 local terms energy: -654.183061 where: bonds (distance) C4'-P energy: -139.895 bonds (distance) P-C4' energy: -137.565 flat angles C4'-P-C4' energy: -150.440 flat angles P-C4'-P energy: -81.290 tors. eta vs tors. theta energy: -144.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1861.379022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1861.379022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1861.379022 (E_RNA) where: Base-Base interactions energy: -1216.433 where: short stacking energy: -587.792 Base-Backbone interact. energy: -3.222 local terms energy: -641.723667 where: bonds (distance) C4'-P energy: -132.000 bonds (distance) P-C4' energy: -138.221 flat angles C4'-P-C4' energy: -161.106 flat angles P-C4'-P energy: -80.680 tors. eta vs tors. theta energy: -129.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1808.937050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1808.937050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1808.937050 (E_RNA) where: Base-Base interactions energy: -1213.465 where: short stacking energy: -525.442 Base-Backbone interact. energy: -3.785 local terms energy: -591.687900 where: bonds (distance) C4'-P energy: -125.232 bonds (distance) P-C4' energy: -116.752 flat angles C4'-P-C4' energy: -148.163 flat angles P-C4'-P energy: -83.721 tors. eta vs tors. theta energy: -117.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1684.377840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1684.377840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.377840 (E_RNA) where: Base-Base interactions energy: -1116.937 where: short stacking energy: -506.378 Base-Backbone interact. energy: -0.359 local terms energy: -567.082684 where: bonds (distance) C4'-P energy: -122.125 bonds (distance) P-C4' energy: -131.411 flat angles C4'-P-C4' energy: -142.480 flat angles P-C4'-P energy: -86.015 tors. eta vs tors. theta energy: -85.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1295.657778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.657778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.657778 (E_RNA) where: Base-Base interactions energy: -816.498 where: short stacking energy: -386.792 Base-Backbone interact. energy: -2.538 local terms energy: -476.621577 where: bonds (distance) C4'-P energy: -96.992 bonds (distance) P-C4' energy: -130.069 flat angles C4'-P-C4' energy: -124.194 flat angles P-C4'-P energy: -69.413 tors. eta vs tors. theta energy: -55.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -797.464345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.464345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.464345 (E_RNA) where: Base-Base interactions energy: -410.493 where: short stacking energy: -243.528 Base-Backbone interact. energy: 7.207 local terms energy: -394.178833 where: bonds (distance) C4'-P energy: -94.712 bonds (distance) P-C4' energy: -112.640 flat angles C4'-P-C4' energy: -107.509 flat angles P-C4'-P energy: -81.417 tors. eta vs tors. theta energy: 2.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -2536.638467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2536.638467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2536.638467 (E_RNA) where: Base-Base interactions energy: -1762.215 where: short stacking energy: -717.917 Base-Backbone interact. energy: -5.876 local terms energy: -768.547170 where: bonds (distance) C4'-P energy: -157.870 bonds (distance) P-C4' energy: -150.295 flat angles C4'-P-C4' energy: -169.302 flat angles P-C4'-P energy: -107.628 tors. eta vs tors. theta energy: -183.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -2401.078553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2401.078553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2401.078553 (E_RNA) where: Base-Base interactions energy: -1636.231 where: short stacking energy: -772.453 Base-Backbone interact. energy: 3.877 local terms energy: -768.724367 where: bonds (distance) C4'-P energy: -137.466 bonds (distance) P-C4' energy: -153.458 flat angles C4'-P-C4' energy: -164.835 flat angles P-C4'-P energy: -102.200 tors. eta vs tors. theta energy: -210.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -2304.989155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2304.989155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2304.989155 (E_RNA) where: Base-Base interactions energy: -1565.175 where: short stacking energy: -713.001 Base-Backbone interact. energy: -2.828 local terms energy: -736.986632 where: bonds (distance) C4'-P energy: -136.978 bonds (distance) P-C4' energy: -150.980 flat angles C4'-P-C4' energy: -155.033 flat angles P-C4'-P energy: -101.531 tors. eta vs tors. theta energy: -192.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -2197.000637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2197.000637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2197.000637 (E_RNA) where: Base-Base interactions energy: -1506.520 where: short stacking energy: -665.515 Base-Backbone interact. energy: -0.060 local terms energy: -690.420373 where: bonds (distance) C4'-P energy: -144.400 bonds (distance) P-C4' energy: -142.101 flat angles C4'-P-C4' energy: -146.879 flat angles P-C4'-P energy: -103.623 tors. eta vs tors. theta energy: -153.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -2082.035442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.035442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.035442 (E_RNA) where: Base-Base interactions energy: -1425.088 where: short stacking energy: -640.634 Base-Backbone interact. energy: 4.025 local terms energy: -660.972656 where: bonds (distance) C4'-P energy: -125.501 bonds (distance) P-C4' energy: -143.334 flat angles C4'-P-C4' energy: -158.112 flat angles P-C4'-P energy: -95.141 tors. eta vs tors. theta energy: -138.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1906.586796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1906.586796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1906.586796 (E_RNA) where: Base-Base interactions energy: -1250.557 where: short stacking energy: -574.357 Base-Backbone interact. energy: -4.709 local terms energy: -651.320858 where: bonds (distance) C4'-P energy: -139.969 bonds (distance) P-C4' energy: -148.563 flat angles C4'-P-C4' energy: -146.515 flat angles P-C4'-P energy: -83.548 tors. eta vs tors. theta energy: -132.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1799.141975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.141975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.141975 (E_RNA) where: Base-Base interactions energy: -1227.967 where: short stacking energy: -555.755 Base-Backbone interact. energy: -1.386 local terms energy: -569.788564 where: bonds (distance) C4'-P energy: -130.104 bonds (distance) P-C4' energy: -116.948 flat angles C4'-P-C4' energy: -142.651 flat angles P-C4'-P energy: -72.148 tors. eta vs tors. theta energy: -107.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1682.400336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.400336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.400336 (E_RNA) where: Base-Base interactions energy: -1109.313 where: short stacking energy: -474.942 Base-Backbone interact. energy: 0.451 local terms energy: -573.538287 where: bonds (distance) C4'-P energy: -118.595 bonds (distance) P-C4' energy: -128.611 flat angles C4'-P-C4' energy: -137.453 flat angles P-C4'-P energy: -102.623 tors. eta vs tors. theta energy: -86.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1307.389424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.389424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.389424 (E_RNA) where: Base-Base interactions energy: -777.077 where: short stacking energy: -390.416 Base-Backbone interact. energy: -1.845 local terms energy: -528.467117 where: bonds (distance) C4'-P energy: -128.229 bonds (distance) P-C4' energy: -144.383 flat angles C4'-P-C4' energy: -118.912 flat angles P-C4'-P energy: -82.197 tors. eta vs tors. theta energy: -54.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -795.629420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.629420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.629420 (E_RNA) where: Base-Base interactions energy: -380.520 where: short stacking energy: -249.225 Base-Backbone interact. energy: 0.775 local terms energy: -415.884112 where: bonds (distance) C4'-P energy: -117.004 bonds (distance) P-C4' energy: -132.074 flat angles C4'-P-C4' energy: -96.645 flat angles P-C4'-P energy: -67.960 tors. eta vs tors. theta energy: -2.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -2543.070145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2543.070145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2543.070145 (E_RNA) where: Base-Base interactions energy: -1782.902 where: short stacking energy: -741.849 Base-Backbone interact. energy: -6.922 local terms energy: -753.246355 where: bonds (distance) C4'-P energy: -148.405 bonds (distance) P-C4' energy: -161.535 flat angles C4'-P-C4' energy: -164.898 flat angles P-C4'-P energy: -105.620 tors. eta vs tors. theta energy: -172.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -2355.807393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.807393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.807393 (E_RNA) where: Base-Base interactions energy: -1607.537 where: short stacking energy: -721.670 Base-Backbone interact. energy: 0.128 local terms energy: -748.398162 where: bonds (distance) C4'-P energy: -145.218 bonds (distance) P-C4' energy: -157.965 flat angles C4'-P-C4' energy: -155.829 flat angles P-C4'-P energy: -89.708 tors. eta vs tors. theta energy: -199.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -2335.401993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.401993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2335.401993 (E_RNA) where: Base-Base interactions energy: -1576.287 where: short stacking energy: -766.496 Base-Backbone interact. energy: -1.798 local terms energy: -757.316983 where: bonds (distance) C4'-P energy: -131.727 bonds (distance) P-C4' energy: -139.765 flat angles C4'-P-C4' energy: -168.763 flat angles P-C4'-P energy: -106.531 tors. eta vs tors. theta energy: -210.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -2224.187638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2224.187638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2224.187638 (E_RNA) where: Base-Base interactions energy: -1533.059 where: short stacking energy: -654.939 Base-Backbone interact. energy: -1.731 local terms energy: -689.396982 where: bonds (distance) C4'-P energy: -139.237 bonds (distance) P-C4' energy: -145.377 flat angles C4'-P-C4' energy: -148.707 flat angles P-C4'-P energy: -91.925 tors. eta vs tors. theta energy: -164.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -2078.736561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2078.736561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2078.736561 (E_RNA) where: Base-Base interactions energy: -1422.585 where: short stacking energy: -608.654 Base-Backbone interact. energy: 6.937 local terms energy: -663.089408 where: bonds (distance) C4'-P energy: -145.353 bonds (distance) P-C4' energy: -143.489 flat angles C4'-P-C4' energy: -145.565 flat angles P-C4'-P energy: -93.634 tors. eta vs tors. theta energy: -135.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1849.124959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1849.124959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1849.124959 (E_RNA) where: Base-Base interactions energy: -1246.358 where: short stacking energy: -569.358 Base-Backbone interact. energy: -1.942 local terms energy: -600.824671 where: bonds (distance) C4'-P energy: -120.927 bonds (distance) P-C4' energy: -135.098 flat angles C4'-P-C4' energy: -145.655 flat angles P-C4'-P energy: -75.874 tors. eta vs tors. theta energy: -123.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1741.817307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.817307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.817307 (E_RNA) where: Base-Base interactions energy: -1140.793 where: short stacking energy: -530.649 Base-Backbone interact. energy: -2.974 local terms energy: -598.050242 where: bonds (distance) C4'-P energy: -114.948 bonds (distance) P-C4' energy: -138.954 flat angles C4'-P-C4' energy: -148.774 flat angles P-C4'-P energy: -78.391 tors. eta vs tors. theta energy: -116.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1598.432647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.432647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.432647 (E_RNA) where: Base-Base interactions energy: -1050.526 where: short stacking energy: -472.445 Base-Backbone interact. energy: -1.063 local terms energy: -546.843078 where: bonds (distance) C4'-P energy: -149.544 bonds (distance) P-C4' energy: -115.445 flat angles C4'-P-C4' energy: -124.152 flat angles P-C4'-P energy: -80.004 tors. eta vs tors. theta energy: -77.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1249.784079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.784079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.784079 (E_RNA) where: Base-Base interactions energy: -775.668 where: short stacking energy: -388.194 Base-Backbone interact. energy: 2.416 local terms energy: -476.531231 where: bonds (distance) C4'-P energy: -118.473 bonds (distance) P-C4' energy: -140.000 flat angles C4'-P-C4' energy: -112.107 flat angles P-C4'-P energy: -70.283 tors. eta vs tors. theta energy: -35.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -844.468363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.468363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.468363 (E_RNA) where: Base-Base interactions energy: -441.553 where: short stacking energy: -260.100 Base-Backbone interact. energy: 3.393 local terms energy: -406.309129 where: bonds (distance) C4'-P energy: -123.019 bonds (distance) P-C4' energy: -121.136 flat angles C4'-P-C4' energy: -96.471 flat angles P-C4'-P energy: -72.229 tors. eta vs tors. theta energy: 6.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -2520.683986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2520.683986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2520.683986 (E_RNA) where: Base-Base interactions energy: -1769.403 where: short stacking energy: -740.813 Base-Backbone interact. energy: -3.500 local terms energy: -747.781395 where: bonds (distance) C4'-P energy: -137.559 bonds (distance) P-C4' energy: -145.074 flat angles C4'-P-C4' energy: -169.610 flat angles P-C4'-P energy: -117.968 tors. eta vs tors. theta energy: -177.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -2410.491570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2410.491570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2410.491570 (E_RNA) where: Base-Base interactions energy: -1652.746 where: short stacking energy: -754.950 Base-Backbone interact. energy: -5.526 local terms energy: -752.219699 where: bonds (distance) C4'-P energy: -135.411 bonds (distance) P-C4' energy: -156.505 flat angles C4'-P-C4' energy: -164.816 flat angles P-C4'-P energy: -94.100 tors. eta vs tors. theta energy: -201.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -2301.287686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.287686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.287686 (E_RNA) where: Base-Base interactions energy: -1560.777 where: short stacking energy: -731.504 Base-Backbone interact. energy: -3.117 local terms energy: -737.394008 where: bonds (distance) C4'-P energy: -145.627 bonds (distance) P-C4' energy: -140.998 flat angles C4'-P-C4' energy: -155.136 flat angles P-C4'-P energy: -93.317 tors. eta vs tors. theta energy: -202.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -2254.079070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2254.079070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2254.079070 (E_RNA) where: Base-Base interactions energy: -1551.363 where: short stacking energy: -676.812 Base-Backbone interact. energy: -0.164 local terms energy: -702.552518 where: bonds (distance) C4'-P energy: -132.515 bonds (distance) P-C4' energy: -140.718 flat angles C4'-P-C4' energy: -168.328 flat angles P-C4'-P energy: -90.846 tors. eta vs tors. theta energy: -170.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -2042.429945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2042.429945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2042.429945 (E_RNA) where: Base-Base interactions energy: -1413.351 where: short stacking energy: -629.718 Base-Backbone interact. energy: 0.790 local terms energy: -629.868986 where: bonds (distance) C4'-P energy: -119.432 bonds (distance) P-C4' energy: -141.747 flat angles C4'-P-C4' energy: -151.334 flat angles P-C4'-P energy: -85.577 tors. eta vs tors. theta energy: -131.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1972.547955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1972.547955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1972.547955 (E_RNA) where: Base-Base interactions energy: -1320.801 where: short stacking energy: -568.226 Base-Backbone interact. energy: 3.798 local terms energy: -655.545004 where: bonds (distance) C4'-P energy: -149.299 bonds (distance) P-C4' energy: -147.961 flat angles C4'-P-C4' energy: -151.377 flat angles P-C4'-P energy: -89.187 tors. eta vs tors. theta energy: -117.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1701.222767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.222767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.222767 (E_RNA) where: Base-Base interactions energy: -1124.847 where: short stacking energy: -486.760 Base-Backbone interact. energy: -1.783 local terms energy: -574.593490 where: bonds (distance) C4'-P energy: -98.567 bonds (distance) P-C4' energy: -129.845 flat angles C4'-P-C4' energy: -144.840 flat angles P-C4'-P energy: -82.678 tors. eta vs tors. theta energy: -118.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1643.752192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.752192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.752192 (E_RNA) where: Base-Base interactions energy: -1111.120 where: short stacking energy: -514.524 Base-Backbone interact. energy: 0.585 local terms energy: -533.216628 where: bonds (distance) C4'-P energy: -104.725 bonds (distance) P-C4' energy: -126.364 flat angles C4'-P-C4' energy: -138.150 flat angles P-C4'-P energy: -65.155 tors. eta vs tors. theta energy: -98.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1270.116286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.116286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.116286 (E_RNA) where: Base-Base interactions energy: -762.879 where: short stacking energy: -381.537 Base-Backbone interact. energy: 2.527 local terms energy: -509.764002 where: bonds (distance) C4'-P energy: -125.958 bonds (distance) P-C4' energy: -123.636 flat angles C4'-P-C4' energy: -114.138 flat angles P-C4'-P energy: -89.748 tors. eta vs tors. theta energy: -56.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -833.051849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.051849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.051849 (E_RNA) where: Base-Base interactions energy: -422.804 where: short stacking energy: -255.023 Base-Backbone interact. energy: -0.698 local terms energy: -409.549644 where: bonds (distance) C4'-P energy: -132.086 bonds (distance) P-C4' energy: -112.519 flat angles C4'-P-C4' energy: -96.217 flat angles P-C4'-P energy: -61.422 tors. eta vs tors. theta energy: -7.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -2503.870068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2503.870068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2503.870068 (E_RNA) where: Base-Base interactions energy: -1726.040 where: short stacking energy: -733.850 Base-Backbone interact. energy: -10.583 local terms energy: -767.247087 where: bonds (distance) C4'-P energy: -156.521 bonds (distance) P-C4' energy: -156.762 flat angles C4'-P-C4' energy: -160.743 flat angles P-C4'-P energy: -107.294 tors. eta vs tors. theta energy: -185.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -2371.605495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.605495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.605495 (E_RNA) where: Base-Base interactions energy: -1615.658 where: short stacking energy: -724.921 Base-Backbone interact. energy: -2.855 local terms energy: -753.092700 where: bonds (distance) C4'-P energy: -150.801 bonds (distance) P-C4' energy: -150.585 flat angles C4'-P-C4' energy: -157.759 flat angles P-C4'-P energy: -102.331 tors. eta vs tors. theta energy: -191.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -2281.040903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2281.040903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2281.040903 (E_RNA) where: Base-Base interactions energy: -1556.002 where: short stacking energy: -743.689 Base-Backbone interact. energy: -2.389 local terms energy: -722.649382 where: bonds (distance) C4'-P energy: -135.698 bonds (distance) P-C4' energy: -143.948 flat angles C4'-P-C4' energy: -154.954 flat angles P-C4'-P energy: -100.959 tors. eta vs tors. theta energy: -187.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -2220.983450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.983450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2220.983450 (E_RNA) where: Base-Base interactions energy: -1536.411 where: short stacking energy: -665.442 Base-Backbone interact. energy: -2.525 local terms energy: -682.046875 where: bonds (distance) C4'-P energy: -146.841 bonds (distance) P-C4' energy: -143.494 flat angles C4'-P-C4' energy: -140.799 flat angles P-C4'-P energy: -95.494 tors. eta vs tors. theta energy: -155.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -2072.150802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2072.150802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2072.150802 (E_RNA) where: Base-Base interactions energy: -1420.278 where: short stacking energy: -648.602 Base-Backbone interact. energy: 2.052 local terms energy: -653.924578 where: bonds (distance) C4'-P energy: -129.506 bonds (distance) P-C4' energy: -131.649 flat angles C4'-P-C4' energy: -143.979 flat angles P-C4'-P energy: -89.894 tors. eta vs tors. theta energy: -158.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1962.485645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.485645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.485645 (E_RNA) where: Base-Base interactions energy: -1321.478 where: short stacking energy: -609.640 Base-Backbone interact. energy: -2.729 local terms energy: -638.278386 where: bonds (distance) C4'-P energy: -126.521 bonds (distance) P-C4' energy: -124.109 flat angles C4'-P-C4' energy: -153.323 flat angles P-C4'-P energy: -84.278 tors. eta vs tors. theta energy: -150.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1737.385967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.385967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.385967 (E_RNA) where: Base-Base interactions energy: -1176.669 where: short stacking energy: -518.964 Base-Backbone interact. energy: -5.207 local terms energy: -555.510580 where: bonds (distance) C4'-P energy: -125.476 bonds (distance) P-C4' energy: -135.841 flat angles C4'-P-C4' energy: -136.352 flat angles P-C4'-P energy: -62.791 tors. eta vs tors. theta energy: -95.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1657.192739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.192739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.192739 (E_RNA) where: Base-Base interactions energy: -1087.913 where: short stacking energy: -501.394 Base-Backbone interact. energy: -1.060 local terms energy: -568.219166 where: bonds (distance) C4'-P energy: -131.753 bonds (distance) P-C4' energy: -123.320 flat angles C4'-P-C4' energy: -150.334 flat angles P-C4'-P energy: -71.518 tors. eta vs tors. theta energy: -91.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1264.188505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.188505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.188505 (E_RNA) where: Base-Base interactions energy: -765.641 where: short stacking energy: -367.405 Base-Backbone interact. energy: -2.010 local terms energy: -496.536810 where: bonds (distance) C4'-P energy: -109.925 bonds (distance) P-C4' energy: -124.720 flat angles C4'-P-C4' energy: -119.427 flat angles P-C4'-P energy: -87.681 tors. eta vs tors. theta energy: -54.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -773.538551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.538551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.538551 (E_RNA) where: Base-Base interactions energy: -358.940 where: short stacking energy: -259.284 Base-Backbone interact. energy: 0.577 local terms energy: -415.175676 where: bonds (distance) C4'-P energy: -105.934 bonds (distance) P-C4' energy: -139.169 flat angles C4'-P-C4' energy: -104.571 flat angles P-C4'-P energy: -72.731 tors. eta vs tors. theta energy: 7.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -2526.612152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.612152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.612152 (E_RNA) where: Base-Base interactions energy: -1766.994 where: short stacking energy: -702.431 Base-Backbone interact. energy: 0.332 local terms energy: -759.950606 where: bonds (distance) C4'-P energy: -146.960 bonds (distance) P-C4' energy: -161.980 flat angles C4'-P-C4' energy: -155.144 flat angles P-C4'-P energy: -119.412 tors. eta vs tors. theta energy: -176.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -2373.217252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.217252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.217252 (E_RNA) where: Base-Base interactions energy: -1612.281 where: short stacking energy: -741.641 Base-Backbone interact. energy: -2.601 local terms energy: -758.335364 where: bonds (distance) C4'-P energy: -159.579 bonds (distance) P-C4' energy: -150.727 flat angles C4'-P-C4' energy: -161.064 flat angles P-C4'-P energy: -107.421 tors. eta vs tors. theta energy: -179.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -2282.127351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2282.127351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.127351 (E_RNA) where: Base-Base interactions energy: -1553.372 where: short stacking energy: -720.238 Base-Backbone interact. energy: -4.891 local terms energy: -723.864374 where: bonds (distance) C4'-P energy: -135.867 bonds (distance) P-C4' energy: -138.949 flat angles C4'-P-C4' energy: -164.762 flat angles P-C4'-P energy: -88.647 tors. eta vs tors. theta energy: -195.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -2260.541055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.541055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.541055 (E_RNA) where: Base-Base interactions energy: -1584.934 where: short stacking energy: -711.525 Base-Backbone interact. energy: 0.861 local terms energy: -676.468736 where: bonds (distance) C4'-P energy: -125.456 bonds (distance) P-C4' energy: -148.889 flat angles C4'-P-C4' energy: -143.734 flat angles P-C4'-P energy: -88.662 tors. eta vs tors. theta energy: -169.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -2055.446925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.446925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.446925 (E_RNA) where: Base-Base interactions energy: -1404.957 where: short stacking energy: -590.741 Base-Backbone interact. energy: -2.285 local terms energy: -648.204350 where: bonds (distance) C4'-P energy: -127.209 bonds (distance) P-C4' energy: -132.436 flat angles C4'-P-C4' energy: -148.572 flat angles P-C4'-P energy: -108.509 tors. eta vs tors. theta energy: -131.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1949.246497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1949.246497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1949.246497 (E_RNA) where: Base-Base interactions energy: -1330.265 where: short stacking energy: -608.904 Base-Backbone interact. energy: -0.186 local terms energy: -618.795040 where: bonds (distance) C4'-P energy: -135.032 bonds (distance) P-C4' energy: -126.276 flat angles C4'-P-C4' energy: -139.038 flat angles P-C4'-P energy: -89.248 tors. eta vs tors. theta energy: -129.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1753.470964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1753.470964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.470964 (E_RNA) where: Base-Base interactions energy: -1148.776 where: short stacking energy: -511.228 Base-Backbone interact. energy: -3.358 local terms energy: -601.337305 where: bonds (distance) C4'-P energy: -148.024 bonds (distance) P-C4' energy: -123.796 flat angles C4'-P-C4' energy: -147.969 flat angles P-C4'-P energy: -80.373 tors. eta vs tors. theta energy: -101.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1553.684421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.684421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.684421 (E_RNA) where: Base-Base interactions energy: -1045.951 where: short stacking energy: -462.049 Base-Backbone interact. energy: -0.073 local terms energy: -507.660043 where: bonds (distance) C4'-P energy: -112.798 bonds (distance) P-C4' energy: -123.022 flat angles C4'-P-C4' energy: -119.994 flat angles P-C4'-P energy: -80.285 tors. eta vs tors. theta energy: -71.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1295.596933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.596933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.596933 (E_RNA) where: Base-Base interactions energy: -805.232 where: short stacking energy: -397.834 Base-Backbone interact. energy: -4.492 local terms energy: -485.873207 where: bonds (distance) C4'-P energy: -124.012 bonds (distance) P-C4' energy: -122.732 flat angles C4'-P-C4' energy: -108.830 flat angles P-C4'-P energy: -81.365 tors. eta vs tors. theta energy: -48.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -807.935558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.935558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.935558 (E_RNA) where: Base-Base interactions energy: -403.050 where: short stacking energy: -244.590 Base-Backbone interact. energy: 2.913 local terms energy: -407.798689 where: bonds (distance) C4'-P energy: -127.810 bonds (distance) P-C4' energy: -117.287 flat angles C4'-P-C4' energy: -94.315 flat angles P-C4'-P energy: -71.387 tors. eta vs tors. theta energy: 3.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -2541.408981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2541.408981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2541.408981 (E_RNA) where: Base-Base interactions energy: -1751.663 where: short stacking energy: -717.830 Base-Backbone interact. energy: -4.934 local terms energy: -784.811557 where: bonds (distance) C4'-P energy: -159.464 bonds (distance) P-C4' energy: -163.079 flat angles C4'-P-C4' energy: -167.250 flat angles P-C4'-P energy: -116.692 tors. eta vs tors. theta energy: -178.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -2372.683361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2372.683361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2372.683361 (E_RNA) where: Base-Base interactions energy: -1626.901 where: short stacking energy: -763.926 Base-Backbone interact. energy: -5.753 local terms energy: -740.028711 where: bonds (distance) C4'-P energy: -143.306 bonds (distance) P-C4' energy: -151.876 flat angles C4'-P-C4' energy: -158.142 flat angles P-C4'-P energy: -96.931 tors. eta vs tors. theta energy: -189.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -2298.177973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2298.177973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2298.177973 (E_RNA) where: Base-Base interactions energy: -1553.125 where: short stacking energy: -732.679 Base-Backbone interact. energy: -2.857 local terms energy: -742.196011 where: bonds (distance) C4'-P energy: -131.469 bonds (distance) P-C4' energy: -142.992 flat angles C4'-P-C4' energy: -171.791 flat angles P-C4'-P energy: -99.877 tors. eta vs tors. theta energy: -196.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -2302.827876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2302.827876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2302.827876 (E_RNA) where: Base-Base interactions energy: -1574.276 where: short stacking energy: -712.939 Base-Backbone interact. energy: -3.039 local terms energy: -725.513347 where: bonds (distance) C4'-P energy: -155.208 bonds (distance) P-C4' energy: -139.669 flat angles C4'-P-C4' energy: -152.118 flat angles P-C4'-P energy: -96.520 tors. eta vs tors. theta energy: -181.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -2130.880436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2130.880436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2130.880436 (E_RNA) where: Base-Base interactions energy: -1454.162 where: short stacking energy: -639.897 Base-Backbone interact. energy: 3.379 local terms energy: -680.097744 where: bonds (distance) C4'-P energy: -134.918 bonds (distance) P-C4' energy: -136.304 flat angles C4'-P-C4' energy: -141.154 flat angles P-C4'-P energy: -107.922 tors. eta vs tors. theta energy: -159.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1943.152557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.152557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.152557 (E_RNA) where: Base-Base interactions energy: -1308.983 where: short stacking energy: -621.009 Base-Backbone interact. energy: -2.742 local terms energy: -631.427355 where: bonds (distance) C4'-P energy: -132.014 bonds (distance) P-C4' energy: -124.970 flat angles C4'-P-C4' energy: -136.389 flat angles P-C4'-P energy: -105.701 tors. eta vs tors. theta energy: -132.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1746.243071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.243071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.243071 (E_RNA) where: Base-Base interactions energy: -1157.793 where: short stacking energy: -516.869 Base-Backbone interact. energy: -6.059 local terms energy: -582.391486 where: bonds (distance) C4'-P energy: -115.870 bonds (distance) P-C4' energy: -140.864 flat angles C4'-P-C4' energy: -133.620 flat angles P-C4'-P energy: -83.021 tors. eta vs tors. theta energy: -109.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1574.201748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1574.201748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.201748 (E_RNA) where: Base-Base interactions energy: -1017.695 where: short stacking energy: -501.305 Base-Backbone interact. energy: -2.523 local terms energy: -553.984431 where: bonds (distance) C4'-P energy: -125.661 bonds (distance) P-C4' energy: -139.065 flat angles C4'-P-C4' energy: -112.889 flat angles P-C4'-P energy: -78.412 tors. eta vs tors. theta energy: -97.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1255.613385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.613385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.613385 (E_RNA) where: Base-Base interactions energy: -777.320 where: short stacking energy: -369.315 Base-Backbone interact. energy: 9.952 local terms energy: -488.245367 where: bonds (distance) C4'-P energy: -123.030 bonds (distance) P-C4' energy: -120.748 flat angles C4'-P-C4' energy: -128.710 flat angles P-C4'-P energy: -87.063 tors. eta vs tors. theta energy: -28.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -741.069680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.069680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.069680 (E_RNA) where: Base-Base interactions energy: -393.171 where: short stacking energy: -235.171 Base-Backbone interact. energy: 1.288 local terms energy: -349.186021 where: bonds (distance) C4'-P energy: -110.301 bonds (distance) P-C4' energy: -98.429 flat angles C4'-P-C4' energy: -112.818 flat angles P-C4'-P energy: -54.950 tors. eta vs tors. theta energy: 27.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -2528.639947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2528.639947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2528.639947 (E_RNA) where: Base-Base interactions energy: -1762.257 where: short stacking energy: -745.248 Base-Backbone interact. energy: -8.760 local terms energy: -757.622565 where: bonds (distance) C4'-P energy: -148.700 bonds (distance) P-C4' energy: -148.691 flat angles C4'-P-C4' energy: -174.580 flat angles P-C4'-P energy: -110.289 tors. eta vs tors. theta energy: -175.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -2415.052039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2415.052039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2415.052039 (E_RNA) where: Base-Base interactions energy: -1634.048 where: short stacking energy: -734.143 Base-Backbone interact. energy: -2.769 local terms energy: -778.234884 where: bonds (distance) C4'-P energy: -144.398 bonds (distance) P-C4' energy: -153.298 flat angles C4'-P-C4' energy: -179.003 flat angles P-C4'-P energy: -110.296 tors. eta vs tors. theta energy: -191.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -2351.395955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2351.395955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2351.395955 (E_RNA) where: Base-Base interactions energy: -1602.897 where: short stacking energy: -743.770 Base-Backbone interact. energy: -3.056 local terms energy: -745.443642 where: bonds (distance) C4'-P energy: -137.328 bonds (distance) P-C4' energy: -143.089 flat angles C4'-P-C4' energy: -169.056 flat angles P-C4'-P energy: -103.529 tors. eta vs tors. theta energy: -192.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -2208.095078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2208.095078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2208.095078 (E_RNA) where: Base-Base interactions energy: -1454.128 where: short stacking energy: -715.852 Base-Backbone interact. energy: -2.207 local terms energy: -751.759960 where: bonds (distance) C4'-P energy: -140.952 bonds (distance) P-C4' energy: -147.465 flat angles C4'-P-C4' energy: -178.166 flat angles P-C4'-P energy: -96.335 tors. eta vs tors. theta energy: -188.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -2156.114792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.114792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.114792 (E_RNA) where: Base-Base interactions energy: -1513.992 where: short stacking energy: -639.893 Base-Backbone interact. energy: 8.770 local terms energy: -650.892662 where: bonds (distance) C4'-P energy: -111.772 bonds (distance) P-C4' energy: -149.249 flat angles C4'-P-C4' energy: -143.785 flat angles P-C4'-P energy: -98.051 tors. eta vs tors. theta energy: -148.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1920.807966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1920.807966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1920.807966 (E_RNA) where: Base-Base interactions energy: -1285.071 where: short stacking energy: -614.768 Base-Backbone interact. energy: -2.027 local terms energy: -633.709842 where: bonds (distance) C4'-P energy: -138.819 bonds (distance) P-C4' energy: -137.296 flat angles C4'-P-C4' energy: -128.192 flat angles P-C4'-P energy: -89.595 tors. eta vs tors. theta energy: -139.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1780.563145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1780.563145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.563145 (E_RNA) where: Base-Base interactions energy: -1184.192 where: short stacking energy: -553.668 Base-Backbone interact. energy: 2.060 local terms energy: -598.431784 where: bonds (distance) C4'-P energy: -122.062 bonds (distance) P-C4' energy: -130.386 flat angles C4'-P-C4' energy: -135.422 flat angles P-C4'-P energy: -84.597 tors. eta vs tors. theta energy: -125.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1641.111523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1641.111523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.111523 (E_RNA) where: Base-Base interactions energy: -1063.405 where: short stacking energy: -461.181 Base-Backbone interact. energy: -3.519 local terms energy: -574.188155 where: bonds (distance) C4'-P energy: -136.753 bonds (distance) P-C4' energy: -132.187 flat angles C4'-P-C4' energy: -128.022 flat angles P-C4'-P energy: -90.376 tors. eta vs tors. theta energy: -86.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1265.698468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.698468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.698468 (E_RNA) where: Base-Base interactions energy: -796.176 where: short stacking energy: -404.877 Base-Backbone interact. energy: -1.799 local terms energy: -467.723046 where: bonds (distance) C4'-P energy: -107.857 bonds (distance) P-C4' energy: -116.208 flat angles C4'-P-C4' energy: -114.154 flat angles P-C4'-P energy: -68.361 tors. eta vs tors. theta energy: -61.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -770.805651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.805651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.805651 (E_RNA) where: Base-Base interactions energy: -351.263 where: short stacking energy: -219.963 Base-Backbone interact. energy: 1.375 local terms energy: -420.918231 where: bonds (distance) C4'-P energy: -130.249 bonds (distance) P-C4' energy: -120.297 flat angles C4'-P-C4' energy: -100.148 flat angles P-C4'-P energy: -84.144 tors. eta vs tors. theta energy: 13.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -2519.408993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2519.408993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2519.408993 (E_RNA) where: Base-Base interactions energy: -1753.097 where: short stacking energy: -732.612 Base-Backbone interact. energy: -6.038 local terms energy: -760.273749 where: bonds (distance) C4'-P energy: -154.159 bonds (distance) P-C4' energy: -156.124 flat angles C4'-P-C4' energy: -160.608 flat angles P-C4'-P energy: -111.747 tors. eta vs tors. theta energy: -177.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -2482.225170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2482.225170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2482.225170 (E_RNA) where: Base-Base interactions energy: -1693.519 where: short stacking energy: -772.615 Base-Backbone interact. energy: 8.059 local terms energy: -796.765215 where: bonds (distance) C4'-P energy: -150.704 bonds (distance) P-C4' energy: -149.445 flat angles C4'-P-C4' energy: -174.610 flat angles P-C4'-P energy: -118.771 tors. eta vs tors. theta energy: -203.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -2326.642661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.642661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.642661 (E_RNA) where: Base-Base interactions energy: -1608.074 where: short stacking energy: -718.403 Base-Backbone interact. energy: 0.376 local terms energy: -718.944691 where: bonds (distance) C4'-P energy: -143.360 bonds (distance) P-C4' energy: -150.389 flat angles C4'-P-C4' energy: -166.703 flat angles P-C4'-P energy: -77.186 tors. eta vs tors. theta energy: -181.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -2193.964062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.964062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.964062 (E_RNA) where: Base-Base interactions energy: -1506.075 where: short stacking energy: -689.208 Base-Backbone interact. energy: -3.698 local terms energy: -684.191701 where: bonds (distance) C4'-P energy: -135.649 bonds (distance) P-C4' energy: -142.301 flat angles C4'-P-C4' energy: -141.371 flat angles P-C4'-P energy: -95.676 tors. eta vs tors. theta energy: -169.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -2135.156692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2135.156692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2135.156692 (E_RNA) where: Base-Base interactions energy: -1510.896 where: short stacking energy: -637.767 Base-Backbone interact. energy: -3.192 local terms energy: -621.069130 where: bonds (distance) C4'-P energy: -111.957 bonds (distance) P-C4' energy: -128.982 flat angles C4'-P-C4' energy: -141.574 flat angles P-C4'-P energy: -92.370 tors. eta vs tors. theta energy: -146.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1846.404461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1846.404461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1846.404461 (E_RNA) where: Base-Base interactions energy: -1183.770 where: short stacking energy: -551.269 Base-Backbone interact. energy: -1.808 local terms energy: -660.827275 where: bonds (distance) C4'-P energy: -142.893 bonds (distance) P-C4' energy: -141.543 flat angles C4'-P-C4' energy: -152.285 flat angles P-C4'-P energy: -92.438 tors. eta vs tors. theta energy: -131.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1892.182853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1892.182853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1892.182853 (E_RNA) where: Base-Base interactions energy: -1270.549 where: short stacking energy: -605.265 Base-Backbone interact. energy: -0.337 local terms energy: -621.297109 where: bonds (distance) C4'-P energy: -127.081 bonds (distance) P-C4' energy: -128.146 flat angles C4'-P-C4' energy: -130.995 flat angles P-C4'-P energy: -95.329 tors. eta vs tors. theta energy: -139.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1626.991527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.991527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.991527 (E_RNA) where: Base-Base interactions energy: -1052.176 where: short stacking energy: -472.991 Base-Backbone interact. energy: -2.930 local terms energy: -571.885629 where: bonds (distance) C4'-P energy: -126.233 bonds (distance) P-C4' energy: -134.471 flat angles C4'-P-C4' energy: -132.177 flat angles P-C4'-P energy: -78.010 tors. eta vs tors. theta energy: -100.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1174.937822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.937822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.937822 (E_RNA) where: Base-Base interactions energy: -720.966 where: short stacking energy: -345.121 Base-Backbone interact. energy: 3.672 local terms energy: -457.643518 where: bonds (distance) C4'-P energy: -120.196 bonds (distance) P-C4' energy: -124.286 flat angles C4'-P-C4' energy: -130.765 flat angles P-C4'-P energy: -51.221 tors. eta vs tors. theta energy: -31.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -831.507538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.507538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.507538 (E_RNA) where: Base-Base interactions energy: -420.365 where: short stacking energy: -233.804 Base-Backbone interact. energy: 2.638 local terms energy: -413.780473 where: bonds (distance) C4'-P energy: -139.464 bonds (distance) P-C4' energy: -107.246 flat angles C4'-P-C4' energy: -104.707 flat angles P-C4'-P energy: -69.313 tors. eta vs tors. theta energy: 6.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -2517.435591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2517.435591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2517.435591 (E_RNA) where: Base-Base interactions energy: -1756.964 where: short stacking energy: -750.056 Base-Backbone interact. energy: -5.876 local terms energy: -754.595724 where: bonds (distance) C4'-P energy: -144.442 bonds (distance) P-C4' energy: -146.033 flat angles C4'-P-C4' energy: -163.165 flat angles P-C4'-P energy: -109.107 tors. eta vs tors. theta energy: -191.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -2500.576011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2500.576011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2500.576011 (E_RNA) where: Base-Base interactions energy: -1718.969 where: short stacking energy: -768.026 Base-Backbone interact. energy: -0.452 local terms energy: -781.154667 where: bonds (distance) C4'-P energy: -148.030 bonds (distance) P-C4' energy: -169.262 flat angles C4'-P-C4' energy: -160.694 flat angles P-C4'-P energy: -95.005 tors. eta vs tors. theta energy: -208.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -2337.077705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2337.077705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.077705 (E_RNA) where: Base-Base interactions energy: -1606.839 where: short stacking energy: -711.145 Base-Backbone interact. energy: -3.732 local terms energy: -726.506728 where: bonds (distance) C4'-P energy: -133.238 bonds (distance) P-C4' energy: -134.450 flat angles C4'-P-C4' energy: -164.838 flat angles P-C4'-P energy: -106.059 tors. eta vs tors. theta energy: -187.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -2235.468682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2235.468682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.468682 (E_RNA) where: Base-Base interactions energy: -1516.484 where: short stacking energy: -707.818 Base-Backbone interact. energy: -0.543 local terms energy: -718.440947 where: bonds (distance) C4'-P energy: -133.738 bonds (distance) P-C4' energy: -130.395 flat angles C4'-P-C4' energy: -172.182 flat angles P-C4'-P energy: -99.976 tors. eta vs tors. theta energy: -182.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -2151.572014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2151.572014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2151.572014 (E_RNA) where: Base-Base interactions energy: -1471.339 where: short stacking energy: -647.565 Base-Backbone interact. energy: -1.832 local terms energy: -678.400501 where: bonds (distance) C4'-P energy: -141.774 bonds (distance) P-C4' energy: -144.821 flat angles C4'-P-C4' energy: -153.183 flat angles P-C4'-P energy: -88.106 tors. eta vs tors. theta energy: -150.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1796.793169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1796.793169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1796.793169 (E_RNA) where: Base-Base interactions energy: -1175.079 where: short stacking energy: -540.234 Base-Backbone interact. energy: -1.804 local terms energy: -619.910008 where: bonds (distance) C4'-P energy: -126.822 bonds (distance) P-C4' energy: -144.005 flat angles C4'-P-C4' energy: -142.322 flat angles P-C4'-P energy: -97.662 tors. eta vs tors. theta energy: -109.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1825.161807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1825.161807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1825.161807 (E_RNA) where: Base-Base interactions energy: -1205.373 where: short stacking energy: -512.062 Base-Backbone interact. energy: 0.536 local terms energy: -620.325098 where: bonds (distance) C4'-P energy: -142.213 bonds (distance) P-C4' energy: -141.741 flat angles C4'-P-C4' energy: -126.963 flat angles P-C4'-P energy: -85.977 tors. eta vs tors. theta energy: -123.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1592.772597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.772597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.772597 (E_RNA) where: Base-Base interactions energy: -1043.871 where: short stacking energy: -439.667 Base-Backbone interact. energy: 3.949 local terms energy: -552.850630 where: bonds (distance) C4'-P energy: -140.910 bonds (distance) P-C4' energy: -143.757 flat angles C4'-P-C4' energy: -112.372 flat angles P-C4'-P energy: -87.560 tors. eta vs tors. theta energy: -68.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1251.252637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.252637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.252637 (E_RNA) where: Base-Base interactions energy: -770.165 where: short stacking energy: -370.036 Base-Backbone interact. energy: 3.344 local terms energy: -484.430900 where: bonds (distance) C4'-P energy: -115.093 bonds (distance) P-C4' energy: -129.233 flat angles C4'-P-C4' energy: -126.539 flat angles P-C4'-P energy: -71.980 tors. eta vs tors. theta energy: -41.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -905.746720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.746720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.746720 (E_RNA) where: Base-Base interactions energy: -521.274 where: short stacking energy: -287.893 Base-Backbone interact. energy: 2.965 local terms energy: -387.437816 where: bonds (distance) C4'-P energy: -105.240 bonds (distance) P-C4' energy: -124.494 flat angles C4'-P-C4' energy: -107.023 flat angles P-C4'-P energy: -50.995 tors. eta vs tors. theta energy: 0.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -2542.615127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.615127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2542.615127 (E_RNA) where: Base-Base interactions energy: -1772.866 where: short stacking energy: -741.229 Base-Backbone interact. energy: -3.323 local terms energy: -766.426448 where: bonds (distance) C4'-P energy: -139.806 bonds (distance) P-C4' energy: -153.950 flat angles C4'-P-C4' energy: -174.501 flat angles P-C4'-P energy: -113.272 tors. eta vs tors. theta energy: -184.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -2485.039901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2485.039901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2485.039901 (E_RNA) where: Base-Base interactions energy: -1742.950 where: short stacking energy: -780.437 Base-Backbone interact. energy: 0.977 local terms energy: -743.067725 where: bonds (distance) C4'-P energy: -136.271 bonds (distance) P-C4' energy: -154.433 flat angles C4'-P-C4' energy: -152.916 flat angles P-C4'-P energy: -102.093 tors. eta vs tors. theta energy: -197.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -2347.607067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2347.607067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2347.607067 (E_RNA) where: Base-Base interactions energy: -1619.217 where: short stacking energy: -722.939 Base-Backbone interact. energy: -3.540 local terms energy: -724.849576 where: bonds (distance) C4'-P energy: -129.762 bonds (distance) P-C4' energy: -145.290 flat angles C4'-P-C4' energy: -161.918 flat angles P-C4'-P energy: -103.274 tors. eta vs tors. theta energy: -184.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -2235.030143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2235.030143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.030143 (E_RNA) where: Base-Base interactions energy: -1508.971 where: short stacking energy: -712.360 Base-Backbone interact. energy: -1.522 local terms energy: -724.537314 where: bonds (distance) C4'-P energy: -140.380 bonds (distance) P-C4' energy: -146.897 flat angles C4'-P-C4' energy: -140.653 flat angles P-C4'-P energy: -101.394 tors. eta vs tors. theta energy: -195.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -2174.724867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2174.724867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.724867 (E_RNA) where: Base-Base interactions energy: -1504.696 where: short stacking energy: -632.962 Base-Backbone interact. energy: -2.247 local terms energy: -667.782433 where: bonds (distance) C4'-P energy: -128.042 bonds (distance) P-C4' energy: -144.062 flat angles C4'-P-C4' energy: -141.104 flat angles P-C4'-P energy: -90.984 tors. eta vs tors. theta energy: -163.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1838.687564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1838.687564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.687564 (E_RNA) where: Base-Base interactions energy: -1214.321 where: short stacking energy: -546.384 Base-Backbone interact. energy: -4.242 local terms energy: -620.124767 where: bonds (distance) C4'-P energy: -127.496 bonds (distance) P-C4' energy: -134.400 flat angles C4'-P-C4' energy: -144.586 flat angles P-C4'-P energy: -95.273 tors. eta vs tors. theta energy: -118.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1804.656523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1804.656523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1804.656523 (E_RNA) where: Base-Base interactions energy: -1231.965 where: short stacking energy: -527.467 Base-Backbone interact. energy: -0.099 local terms energy: -572.592743 where: bonds (distance) C4'-P energy: -118.201 bonds (distance) P-C4' energy: -129.495 flat angles C4'-P-C4' energy: -144.254 flat angles P-C4'-P energy: -76.387 tors. eta vs tors. theta energy: -104.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1659.967353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.967353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.967353 (E_RNA) where: Base-Base interactions energy: -1087.106 where: short stacking energy: -505.153 Base-Backbone interact. energy: 0.299 local terms energy: -573.160381 where: bonds (distance) C4'-P energy: -108.651 bonds (distance) P-C4' energy: -134.716 flat angles C4'-P-C4' energy: -144.298 flat angles P-C4'-P energy: -90.790 tors. eta vs tors. theta energy: -94.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1274.624123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.624123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.624123 (E_RNA) where: Base-Base interactions energy: -808.155 where: short stacking energy: -401.576 Base-Backbone interact. energy: 3.616 local terms energy: -470.085086 where: bonds (distance) C4'-P energy: -106.475 bonds (distance) P-C4' energy: -117.466 flat angles C4'-P-C4' energy: -118.651 flat angles P-C4'-P energy: -66.967 tors. eta vs tors. theta energy: -60.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -893.968876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.968876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.968876 (E_RNA) where: Base-Base interactions energy: -505.127 where: short stacking energy: -257.042 Base-Backbone interact. energy: 9.728 local terms energy: -398.570475 where: bonds (distance) C4'-P energy: -123.769 bonds (distance) P-C4' energy: -106.379 flat angles C4'-P-C4' energy: -106.152 flat angles P-C4'-P energy: -51.526 tors. eta vs tors. theta energy: -10.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -2547.097483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.097483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2547.097483 (E_RNA) where: Base-Base interactions energy: -1773.838 where: short stacking energy: -736.032 Base-Backbone interact. energy: -0.940 local terms energy: -772.319767 where: bonds (distance) C4'-P energy: -146.168 bonds (distance) P-C4' energy: -157.661 flat angles C4'-P-C4' energy: -169.129 flat angles P-C4'-P energy: -111.238 tors. eta vs tors. theta energy: -188.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -2495.047995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2495.047995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2495.047995 (E_RNA) where: Base-Base interactions energy: -1703.713 where: short stacking energy: -750.509 Base-Backbone interact. energy: -1.049 local terms energy: -790.285464 where: bonds (distance) C4'-P energy: -155.497 bonds (distance) P-C4' energy: -152.108 flat angles C4'-P-C4' energy: -168.223 flat angles P-C4'-P energy: -119.440 tors. eta vs tors. theta energy: -195.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -2366.611214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.611214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2366.611214 (E_RNA) where: Base-Base interactions energy: -1609.515 where: short stacking energy: -693.760 Base-Backbone interact. energy: -6.648 local terms energy: -750.448495 where: bonds (distance) C4'-P energy: -143.515 bonds (distance) P-C4' energy: -139.322 flat angles C4'-P-C4' energy: -161.723 flat angles P-C4'-P energy: -101.292 tors. eta vs tors. theta energy: -204.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -2241.607245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2241.607245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.607245 (E_RNA) where: Base-Base interactions energy: -1524.005 where: short stacking energy: -700.919 Base-Backbone interact. energy: -6.290 local terms energy: -711.311554 where: bonds (distance) C4'-P energy: -124.073 bonds (distance) P-C4' energy: -150.943 flat angles C4'-P-C4' energy: -160.017 flat angles P-C4'-P energy: -85.810 tors. eta vs tors. theta energy: -190.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -2137.979307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2137.979307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2137.979307 (E_RNA) where: Base-Base interactions energy: -1463.296 where: short stacking energy: -635.479 Base-Backbone interact. energy: -2.630 local terms energy: -672.053888 where: bonds (distance) C4'-P energy: -148.766 bonds (distance) P-C4' energy: -130.707 flat angles C4'-P-C4' energy: -147.202 flat angles P-C4'-P energy: -99.907 tors. eta vs tors. theta energy: -145.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1748.844368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.844368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.844368 (E_RNA) where: Base-Base interactions energy: -1131.126 where: short stacking energy: -514.974 Base-Backbone interact. energy: -1.650 local terms energy: -616.068214 where: bonds (distance) C4'-P energy: -131.504 bonds (distance) P-C4' energy: -136.387 flat angles C4'-P-C4' energy: -139.260 flat angles P-C4'-P energy: -87.843 tors. eta vs tors. theta energy: -121.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1835.154162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1835.154162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1835.154162 (E_RNA) where: Base-Base interactions energy: -1267.254 where: short stacking energy: -535.814 Base-Backbone interact. energy: -2.696 local terms energy: -565.203862 where: bonds (distance) C4'-P energy: -130.491 bonds (distance) P-C4' energy: -117.716 flat angles C4'-P-C4' energy: -132.024 flat angles P-C4'-P energy: -86.309 tors. eta vs tors. theta energy: -98.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1630.658271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.658271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.658271 (E_RNA) where: Base-Base interactions energy: -1084.235 where: short stacking energy: -467.272 Base-Backbone interact. energy: -0.044 local terms energy: -546.379452 where: bonds (distance) C4'-P energy: -132.648 bonds (distance) P-C4' energy: -113.648 flat angles C4'-P-C4' energy: -140.690 flat angles P-C4'-P energy: -72.472 tors. eta vs tors. theta energy: -86.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1331.670653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.670653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.670653 (E_RNA) where: Base-Base interactions energy: -833.539 where: short stacking energy: -394.564 Base-Backbone interact. energy: -0.631 local terms energy: -497.500268 where: bonds (distance) C4'-P energy: -132.095 bonds (distance) P-C4' energy: -121.989 flat angles C4'-P-C4' energy: -122.963 flat angles P-C4'-P energy: -63.990 tors. eta vs tors. theta energy: -56.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -886.676973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.676973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.676973 (E_RNA) where: Base-Base interactions energy: -501.192 where: short stacking energy: -264.941 Base-Backbone interact. energy: 6.442 local terms energy: -391.926579 where: bonds (distance) C4'-P energy: -112.507 bonds (distance) P-C4' energy: -129.192 flat angles C4'-P-C4' energy: -85.968 flat angles P-C4'-P energy: -60.839 tors. eta vs tors. theta energy: -3.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -2524.676949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2524.676949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2524.676949 (E_RNA) where: Base-Base interactions energy: -1777.156 where: short stacking energy: -737.147 Base-Backbone interact. energy: -7.078 local terms energy: -740.443326 where: bonds (distance) C4'-P energy: -139.538 bonds (distance) P-C4' energy: -142.999 flat angles C4'-P-C4' energy: -159.233 flat angles P-C4'-P energy: -106.926 tors. eta vs tors. theta energy: -191.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -2526.234243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.234243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.234243 (E_RNA) where: Base-Base interactions energy: -1754.310 where: short stacking energy: -752.760 Base-Backbone interact. energy: -3.800 local terms energy: -768.123663 where: bonds (distance) C4'-P energy: -156.340 bonds (distance) P-C4' energy: -145.181 flat angles C4'-P-C4' energy: -171.228 flat angles P-C4'-P energy: -110.685 tors. eta vs tors. theta energy: -184.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -2345.166885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2345.166885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2345.166885 (E_RNA) where: Base-Base interactions energy: -1606.266 where: short stacking energy: -673.626 Base-Backbone interact. energy: -4.615 local terms energy: -734.285324 where: bonds (distance) C4'-P energy: -137.346 bonds (distance) P-C4' energy: -149.297 flat angles C4'-P-C4' energy: -156.197 flat angles P-C4'-P energy: -96.179 tors. eta vs tors. theta energy: -195.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -2285.666376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2285.666376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2285.666376 (E_RNA) where: Base-Base interactions energy: -1564.697 where: short stacking energy: -703.011 Base-Backbone interact. energy: -5.905 local terms energy: -715.064558 where: bonds (distance) C4'-P energy: -124.569 bonds (distance) P-C4' energy: -124.168 flat angles C4'-P-C4' energy: -157.417 flat angles P-C4'-P energy: -109.443 tors. eta vs tors. theta energy: -199.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -2137.625748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2137.625748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2137.625748 (E_RNA) where: Base-Base interactions energy: -1488.000 where: short stacking energy: -627.579 Base-Backbone interact. energy: -1.226 local terms energy: -648.399025 where: bonds (distance) C4'-P energy: -136.272 bonds (distance) P-C4' energy: -139.745 flat angles C4'-P-C4' energy: -133.735 flat angles P-C4'-P energy: -96.398 tors. eta vs tors. theta energy: -142.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1928.317980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.317980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.317980 (E_RNA) where: Base-Base interactions energy: -1298.852 where: short stacking energy: -579.813 Base-Backbone interact. energy: 0.790 local terms energy: -630.255240 where: bonds (distance) C4'-P energy: -125.716 bonds (distance) P-C4' energy: -142.721 flat angles C4'-P-C4' energy: -137.250 flat angles P-C4'-P energy: -105.605 tors. eta vs tors. theta energy: -118.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1695.997925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.997925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.997925 (E_RNA) where: Base-Base interactions energy: -1116.522 where: short stacking energy: -489.662 Base-Backbone interact. energy: -0.905 local terms energy: -578.570591 where: bonds (distance) C4'-P energy: -121.650 bonds (distance) P-C4' energy: -131.633 flat angles C4'-P-C4' energy: -141.127 flat angles P-C4'-P energy: -85.699 tors. eta vs tors. theta energy: -98.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1614.658616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.658616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.658616 (E_RNA) where: Base-Base interactions energy: -1061.283 where: short stacking energy: -464.187 Base-Backbone interact. energy: -0.837 local terms energy: -552.538204 where: bonds (distance) C4'-P energy: -108.280 bonds (distance) P-C4' energy: -122.884 flat angles C4'-P-C4' energy: -138.174 flat angles P-C4'-P energy: -85.385 tors. eta vs tors. theta energy: -97.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1258.962986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1258.962986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.962986 (E_RNA) where: Base-Base interactions energy: -765.776 where: short stacking energy: -380.536 Base-Backbone interact. energy: 0.150 local terms energy: -493.336467 where: bonds (distance) C4'-P energy: -119.481 bonds (distance) P-C4' energy: -139.584 flat angles C4'-P-C4' energy: -123.386 flat angles P-C4'-P energy: -61.525 tors. eta vs tors. theta energy: -49.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -885.977449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.977449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.977449 (E_RNA) where: Base-Base interactions energy: -517.404 where: short stacking energy: -267.126 Base-Backbone interact. energy: -1.716 local terms energy: -366.857004 where: bonds (distance) C4'-P energy: -114.048 bonds (distance) P-C4' energy: -109.456 flat angles C4'-P-C4' energy: -95.682 flat angles P-C4'-P energy: -43.125 tors. eta vs tors. theta energy: -4.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -2532.633747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2532.633747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2532.633747 (E_RNA) where: Base-Base interactions energy: -1772.047 where: short stacking energy: -768.173 Base-Backbone interact. energy: -4.014 local terms energy: -756.572070 where: bonds (distance) C4'-P energy: -143.418 bonds (distance) P-C4' energy: -137.225 flat angles C4'-P-C4' energy: -171.746 flat angles P-C4'-P energy: -113.971 tors. eta vs tors. theta energy: -190.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -2489.927643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2489.927643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2489.927643 (E_RNA) where: Base-Base interactions energy: -1713.500 where: short stacking energy: -761.574 Base-Backbone interact. energy: 1.784 local terms energy: -778.211594 where: bonds (distance) C4'-P energy: -146.077 bonds (distance) P-C4' energy: -143.975 flat angles C4'-P-C4' energy: -175.803 flat angles P-C4'-P energy: -121.193 tors. eta vs tors. theta energy: -191.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -2353.407055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2353.407055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2353.407055 (E_RNA) where: Base-Base interactions energy: -1631.503 where: short stacking energy: -719.054 Base-Backbone interact. energy: -3.844 local terms energy: -718.060460 where: bonds (distance) C4'-P energy: -138.004 bonds (distance) P-C4' energy: -142.444 flat angles C4'-P-C4' energy: -158.577 flat angles P-C4'-P energy: -98.719 tors. eta vs tors. theta energy: -180.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -2284.026384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2284.026384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2284.026384 (E_RNA) where: Base-Base interactions energy: -1544.955 where: short stacking energy: -721.003 Base-Backbone interact. energy: -3.884 local terms energy: -735.187361 where: bonds (distance) C4'-P energy: -136.350 bonds (distance) P-C4' energy: -158.766 flat angles C4'-P-C4' energy: -153.482 flat angles P-C4'-P energy: -91.573 tors. eta vs tors. theta energy: -195.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -2106.956240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.956240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.956240 (E_RNA) where: Base-Base interactions energy: -1442.531 where: short stacking energy: -611.187 Base-Backbone interact. energy: -4.338 local terms energy: -660.087532 where: bonds (distance) C4'-P energy: -135.414 bonds (distance) P-C4' energy: -134.987 flat angles C4'-P-C4' energy: -151.680 flat angles P-C4'-P energy: -90.863 tors. eta vs tors. theta energy: -147.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1910.534267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1910.534267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1910.534267 (E_RNA) where: Base-Base interactions energy: -1297.696 where: short stacking energy: -579.170 Base-Backbone interact. energy: -2.024 local terms energy: -610.813654 where: bonds (distance) C4'-P energy: -114.227 bonds (distance) P-C4' energy: -124.481 flat angles C4'-P-C4' energy: -151.324 flat angles P-C4'-P energy: -99.240 tors. eta vs tors. theta energy: -121.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1665.192320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.192320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.192320 (E_RNA) where: Base-Base interactions energy: -1093.461 where: short stacking energy: -491.020 Base-Backbone interact. energy: -2.384 local terms energy: -569.347441 where: bonds (distance) C4'-P energy: -125.803 bonds (distance) P-C4' energy: -135.647 flat angles C4'-P-C4' energy: -112.860 flat angles P-C4'-P energy: -90.752 tors. eta vs tors. theta energy: -104.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1681.465252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.465252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.465252 (E_RNA) where: Base-Base interactions energy: -1124.713 where: short stacking energy: -489.986 Base-Backbone interact. energy: -5.990 local terms energy: -550.762815 where: bonds (distance) C4'-P energy: -122.225 bonds (distance) P-C4' energy: -129.598 flat angles C4'-P-C4' energy: -122.695 flat angles P-C4'-P energy: -78.951 tors. eta vs tors. theta energy: -97.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1320.390462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.390462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.390462 (E_RNA) where: Base-Base interactions energy: -805.806 where: short stacking energy: -416.419 Base-Backbone interact. energy: -2.734 local terms energy: -511.850467 where: bonds (distance) C4'-P energy: -126.075 bonds (distance) P-C4' energy: -123.805 flat angles C4'-P-C4' energy: -149.279 flat angles P-C4'-P energy: -56.969 tors. eta vs tors. theta energy: -55.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -917.051325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.051325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.051325 (E_RNA) where: Base-Base interactions energy: -495.042 where: short stacking energy: -281.357 Base-Backbone interact. energy: 1.827 local terms energy: -423.835899 where: bonds (distance) C4'-P energy: -121.278 bonds (distance) P-C4' energy: -129.268 flat angles C4'-P-C4' energy: -104.004 flat angles P-C4'-P energy: -56.682 tors. eta vs tors. theta energy: -12.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -2563.156907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2563.156907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2563.156907 (E_RNA) where: Base-Base interactions energy: -1788.688 where: short stacking energy: -763.316 Base-Backbone interact. energy: -0.725 local terms energy: -773.744319 where: bonds (distance) C4'-P energy: -149.230 bonds (distance) P-C4' energy: -147.510 flat angles C4'-P-C4' energy: -167.123 flat angles P-C4'-P energy: -122.284 tors. eta vs tors. theta energy: -187.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -2505.183406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.183406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.183406 (E_RNA) where: Base-Base interactions energy: -1730.948 where: short stacking energy: -751.004 Base-Backbone interact. energy: -7.697 local terms energy: -766.537907 where: bonds (distance) C4'-P energy: -154.469 bonds (distance) P-C4' energy: -147.040 flat angles C4'-P-C4' energy: -164.076 flat angles P-C4'-P energy: -112.390 tors. eta vs tors. theta energy: -188.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -2358.480951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2358.480951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2358.480951 (E_RNA) where: Base-Base interactions energy: -1645.542 where: short stacking energy: -710.526 Base-Backbone interact. energy: -3.619 local terms energy: -709.319763 where: bonds (distance) C4'-P energy: -125.892 bonds (distance) P-C4' energy: -139.111 flat angles C4'-P-C4' energy: -155.634 flat angles P-C4'-P energy: -99.075 tors. eta vs tors. theta energy: -189.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -2290.140164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2290.140164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2290.140164 (E_RNA) where: Base-Base interactions energy: -1545.774 where: short stacking energy: -709.888 Base-Backbone interact. energy: -7.109 local terms energy: -737.257187 where: bonds (distance) C4'-P energy: -132.118 bonds (distance) P-C4' energy: -146.627 flat angles C4'-P-C4' energy: -162.956 flat angles P-C4'-P energy: -102.087 tors. eta vs tors. theta energy: -193.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -2114.859640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2114.859640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2114.859640 (E_RNA) where: Base-Base interactions energy: -1432.063 where: short stacking energy: -612.084 Base-Backbone interact. energy: -5.849 local terms energy: -676.947731 where: bonds (distance) C4'-P energy: -140.814 bonds (distance) P-C4' energy: -127.729 flat angles C4'-P-C4' energy: -155.803 flat angles P-C4'-P energy: -93.633 tors. eta vs tors. theta energy: -158.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1947.618015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1947.618015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1947.618015 (E_RNA) where: Base-Base interactions energy: -1340.163 where: short stacking energy: -599.614 Base-Backbone interact. energy: -1.134 local terms energy: -606.321292 where: bonds (distance) C4'-P energy: -124.090 bonds (distance) P-C4' energy: -144.949 flat angles C4'-P-C4' energy: -136.874 flat angles P-C4'-P energy: -68.723 tors. eta vs tors. theta energy: -131.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1779.988638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1779.988638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1779.988638 (E_RNA) where: Base-Base interactions energy: -1188.338 where: short stacking energy: -535.417 Base-Backbone interact. energy: -2.474 local terms energy: -589.175955 where: bonds (distance) C4'-P energy: -117.596 bonds (distance) P-C4' energy: -142.132 flat angles C4'-P-C4' energy: -125.273 flat angles P-C4'-P energy: -89.375 tors. eta vs tors. theta energy: -114.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1663.202011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1663.202011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.202011 (E_RNA) where: Base-Base interactions energy: -1102.532 where: short stacking energy: -498.513 Base-Backbone interact. energy: -1.608 local terms energy: -559.061754 where: bonds (distance) C4'-P energy: -115.262 bonds (distance) P-C4' energy: -123.606 flat angles C4'-P-C4' energy: -155.354 flat angles P-C4'-P energy: -74.886 tors. eta vs tors. theta energy: -89.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1283.690261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.690261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.690261 (E_RNA) where: Base-Base interactions energy: -789.437 where: short stacking energy: -386.821 Base-Backbone interact. energy: -1.443 local terms energy: -492.810532 where: bonds (distance) C4'-P energy: -112.698 bonds (distance) P-C4' energy: -124.307 flat angles C4'-P-C4' energy: -112.634 flat angles P-C4'-P energy: -68.463 tors. eta vs tors. theta energy: -74.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -907.605638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.605638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.605638 (E_RNA) where: Base-Base interactions energy: -514.873 where: short stacking energy: -268.772 Base-Backbone interact. energy: -0.806 local terms energy: -391.926547 where: bonds (distance) C4'-P energy: -108.949 bonds (distance) P-C4' energy: -138.650 flat angles C4'-P-C4' energy: -89.017 flat angles P-C4'-P energy: -54.299 tors. eta vs tors. theta energy: -1.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -2558.782277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2558.782277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2558.782277 (E_RNA) where: Base-Base interactions energy: -1777.902 where: short stacking energy: -774.629 Base-Backbone interact. energy: -7.979 local terms energy: -772.902066 where: bonds (distance) C4'-P energy: -153.942 bonds (distance) P-C4' energy: -148.991 flat angles C4'-P-C4' energy: -178.081 flat angles P-C4'-P energy: -109.963 tors. eta vs tors. theta energy: -181.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -2494.821758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2494.821758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2494.821758 (E_RNA) where: Base-Base interactions energy: -1734.425 where: short stacking energy: -760.351 Base-Backbone interact. energy: -5.402 local terms energy: -754.995237 where: bonds (distance) C4'-P energy: -151.174 bonds (distance) P-C4' energy: -141.207 flat angles C4'-P-C4' energy: -166.477 flat angles P-C4'-P energy: -97.326 tors. eta vs tors. theta energy: -198.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -2374.271924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2374.271924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2374.271924 (E_RNA) where: Base-Base interactions energy: -1610.274 where: short stacking energy: -764.493 Base-Backbone interact. energy: -1.609 local terms energy: -762.389049 where: bonds (distance) C4'-P energy: -151.659 bonds (distance) P-C4' energy: -136.410 flat angles C4'-P-C4' energy: -171.824 flat angles P-C4'-P energy: -91.323 tors. eta vs tors. theta energy: -211.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -2291.633275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2291.633275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2291.633275 (E_RNA) where: Base-Base interactions energy: -1590.556 where: short stacking energy: -686.954 Base-Backbone interact. energy: -0.834 local terms energy: -700.243421 where: bonds (distance) C4'-P energy: -131.871 bonds (distance) P-C4' energy: -142.038 flat angles C4'-P-C4' energy: -159.433 flat angles P-C4'-P energy: -79.866 tors. eta vs tors. theta energy: -187.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -2092.119053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2092.119053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2092.119053 (E_RNA) where: Base-Base interactions energy: -1450.809 where: short stacking energy: -610.558 Base-Backbone interact. energy: 0.378 local terms energy: -641.687417 where: bonds (distance) C4'-P energy: -138.689 bonds (distance) P-C4' energy: -130.825 flat angles C4'-P-C4' energy: -138.305 flat angles P-C4'-P energy: -87.065 tors. eta vs tors. theta energy: -146.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1978.920170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1978.920170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1978.920170 (E_RNA) where: Base-Base interactions energy: -1349.405 where: short stacking energy: -621.235 Base-Backbone interact. energy: -1.761 local terms energy: -627.753943 where: bonds (distance) C4'-P energy: -115.142 bonds (distance) P-C4' energy: -127.655 flat angles C4'-P-C4' energy: -157.585 flat angles P-C4'-P energy: -87.447 tors. eta vs tors. theta energy: -139.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1802.658135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1802.658135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1802.658135 (E_RNA) where: Base-Base interactions energy: -1222.257 where: short stacking energy: -543.621 Base-Backbone interact. energy: 0.494 local terms energy: -580.895126 where: bonds (distance) C4'-P energy: -136.868 bonds (distance) P-C4' energy: -120.503 flat angles C4'-P-C4' energy: -140.873 flat angles P-C4'-P energy: -67.126 tors. eta vs tors. theta energy: -115.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1627.864847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.864847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.864847 (E_RNA) where: Base-Base interactions energy: -1057.598 where: short stacking energy: -453.764 Base-Backbone interact. energy: -2.428 local terms energy: -567.838930 where: bonds (distance) C4'-P energy: -129.523 bonds (distance) P-C4' energy: -150.805 flat angles C4'-P-C4' energy: -125.758 flat angles P-C4'-P energy: -81.644 tors. eta vs tors. theta energy: -80.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1299.903889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.903889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.903889 (E_RNA) where: Base-Base interactions energy: -840.673 where: short stacking energy: -388.241 Base-Backbone interact. energy: 2.001 local terms energy: -461.232690 where: bonds (distance) C4'-P energy: -109.481 bonds (distance) P-C4' energy: -119.823 flat angles C4'-P-C4' energy: -115.736 flat angles P-C4'-P energy: -75.905 tors. eta vs tors. theta energy: -40.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -827.411025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.411025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.411025 (E_RNA) where: Base-Base interactions energy: -428.054 where: short stacking energy: -245.816 Base-Backbone interact. energy: -2.491 local terms energy: -396.865910 where: bonds (distance) C4'-P energy: -116.003 bonds (distance) P-C4' energy: -134.328 flat angles C4'-P-C4' energy: -111.005 flat angles P-C4'-P energy: -50.976 tors. eta vs tors. theta energy: 15.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -2542.168009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.168009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2542.168009 (E_RNA) where: Base-Base interactions energy: -1753.442 where: short stacking energy: -733.953 Base-Backbone interact. energy: -4.147 local terms energy: -784.579089 where: bonds (distance) C4'-P energy: -157.459 bonds (distance) P-C4' energy: -158.733 flat angles C4'-P-C4' energy: -166.422 flat angles P-C4'-P energy: -118.664 tors. eta vs tors. theta energy: -183.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -2516.667502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.667502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2516.667502 (E_RNA) where: Base-Base interactions energy: -1746.838 where: short stacking energy: -737.219 Base-Backbone interact. energy: -0.012 local terms energy: -769.818020 where: bonds (distance) C4'-P energy: -157.485 bonds (distance) P-C4' energy: -144.938 flat angles C4'-P-C4' energy: -165.848 flat angles P-C4'-P energy: -108.384 tors. eta vs tors. theta energy: -193.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -2318.806862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.806862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2318.806862 (E_RNA) where: Base-Base interactions energy: -1565.080 where: short stacking energy: -734.013 Base-Backbone interact. energy: 1.638 local terms energy: -755.364941 where: bonds (distance) C4'-P energy: -136.453 bonds (distance) P-C4' energy: -143.527 flat angles C4'-P-C4' energy: -167.633 flat angles P-C4'-P energy: -109.649 tors. eta vs tors. theta energy: -198.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -2265.016265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2265.016265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2265.016265 (E_RNA) where: Base-Base interactions energy: -1533.830 where: short stacking energy: -682.750 Base-Backbone interact. energy: -0.742 local terms energy: -730.443558 where: bonds (distance) C4'-P energy: -135.285 bonds (distance) P-C4' energy: -132.653 flat angles C4'-P-C4' energy: -158.893 flat angles P-C4'-P energy: -106.504 tors. eta vs tors. theta energy: -197.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -2091.405624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2091.405624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2091.405624 (E_RNA) where: Base-Base interactions energy: -1455.117 where: short stacking energy: -613.431 Base-Backbone interact. energy: -3.556 local terms energy: -632.732155 where: bonds (distance) C4'-P energy: -129.694 bonds (distance) P-C4' energy: -109.321 flat angles C4'-P-C4' energy: -155.006 flat angles P-C4'-P energy: -94.858 tors. eta vs tors. theta energy: -143.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1983.617123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.617123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1983.617123 (E_RNA) where: Base-Base interactions energy: -1344.425 where: short stacking energy: -619.129 Base-Backbone interact. energy: 2.629 local terms energy: -641.821098 where: bonds (distance) C4'-P energy: -131.475 bonds (distance) P-C4' energy: -131.411 flat angles C4'-P-C4' energy: -156.178 flat angles P-C4'-P energy: -90.388 tors. eta vs tors. theta energy: -132.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1775.502387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1775.502387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1775.502387 (E_RNA) where: Base-Base interactions energy: -1212.717 where: short stacking energy: -521.099 Base-Backbone interact. energy: -1.894 local terms energy: -560.891306 where: bonds (distance) C4'-P energy: -117.374 bonds (distance) P-C4' energy: -134.369 flat angles C4'-P-C4' energy: -151.923 flat angles P-C4'-P energy: -66.970 tors. eta vs tors. theta energy: -90.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1580.248758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.248758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.248758 (E_RNA) where: Base-Base interactions energy: -1033.094 where: short stacking energy: -483.773 Base-Backbone interact. energy: -1.312 local terms energy: -545.842977 where: bonds (distance) C4'-P energy: -115.024 bonds (distance) P-C4' energy: -118.714 flat angles C4'-P-C4' energy: -126.346 flat angles P-C4'-P energy: -81.672 tors. eta vs tors. theta energy: -104.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1263.625460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.625460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.625460 (E_RNA) where: Base-Base interactions energy: -801.366 where: short stacking energy: -406.187 Base-Backbone interact. energy: -1.571 local terms energy: -460.688032 where: bonds (distance) C4'-P energy: -106.667 bonds (distance) P-C4' energy: -124.854 flat angles C4'-P-C4' energy: -108.193 flat angles P-C4'-P energy: -68.220 tors. eta vs tors. theta energy: -52.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -820.948672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.948672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.948672 (E_RNA) where: Base-Base interactions energy: -429.589 where: short stacking energy: -232.282 Base-Backbone interact. energy: -2.484 local terms energy: -388.875336 where: bonds (distance) C4'-P energy: -119.517 bonds (distance) P-C4' energy: -121.571 flat angles C4'-P-C4' energy: -95.810 flat angles P-C4'-P energy: -59.265 tors. eta vs tors. theta energy: 7.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -2516.824933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.824933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2516.824933 (E_RNA) where: Base-Base interactions energy: -1742.565 where: short stacking energy: -722.006 Base-Backbone interact. energy: -8.399 local terms energy: -765.861187 where: bonds (distance) C4'-P energy: -149.762 bonds (distance) P-C4' energy: -161.373 flat angles C4'-P-C4' energy: -164.619 flat angles P-C4'-P energy: -110.777 tors. eta vs tors. theta energy: -179.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -2485.761470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2485.761470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2485.761470 (E_RNA) where: Base-Base interactions energy: -1725.109 where: short stacking energy: -756.353 Base-Backbone interact. energy: -4.663 local terms energy: -755.988902 where: bonds (distance) C4'-P energy: -143.712 bonds (distance) P-C4' energy: -146.949 flat angles C4'-P-C4' energy: -167.787 flat angles P-C4'-P energy: -97.648 tors. eta vs tors. theta energy: -199.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -2351.229568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2351.229568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2351.229568 (E_RNA) where: Base-Base interactions energy: -1599.188 where: short stacking energy: -724.140 Base-Backbone interact. energy: -0.420 local terms energy: -751.621938 where: bonds (distance) C4'-P energy: -129.459 bonds (distance) P-C4' energy: -149.092 flat angles C4'-P-C4' energy: -164.581 flat angles P-C4'-P energy: -109.768 tors. eta vs tors. theta energy: -198.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -2271.646745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2271.646745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2271.646745 (E_RNA) where: Base-Base interactions energy: -1550.360 where: short stacking energy: -669.067 Base-Backbone interact. energy: -2.270 local terms energy: -719.016699 where: bonds (distance) C4'-P energy: -141.756 bonds (distance) P-C4' energy: -146.855 flat angles C4'-P-C4' energy: -158.392 flat angles P-C4'-P energy: -97.703 tors. eta vs tors. theta energy: -174.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -2103.088240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2103.088240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2103.088240 (E_RNA) where: Base-Base interactions energy: -1445.250 where: short stacking energy: -616.420 Base-Backbone interact. energy: -3.961 local terms energy: -653.877467 where: bonds (distance) C4'-P energy: -118.136 bonds (distance) P-C4' energy: -152.235 flat angles C4'-P-C4' energy: -148.237 flat angles P-C4'-P energy: -101.467 tors. eta vs tors. theta energy: -133.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1931.680898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.680898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.680898 (E_RNA) where: Base-Base interactions energy: -1297.402 where: short stacking energy: -598.849 Base-Backbone interact. energy: -1.424 local terms energy: -632.855046 where: bonds (distance) C4'-P energy: -121.811 bonds (distance) P-C4' energy: -128.728 flat angles C4'-P-C4' energy: -155.840 flat angles P-C4'-P energy: -94.606 tors. eta vs tors. theta energy: -131.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1765.789364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1765.789364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.789364 (E_RNA) where: Base-Base interactions energy: -1164.818 where: short stacking energy: -524.958 Base-Backbone interact. energy: -1.237 local terms energy: -599.734218 where: bonds (distance) C4'-P energy: -118.772 bonds (distance) P-C4' energy: -129.675 flat angles C4'-P-C4' energy: -154.862 flat angles P-C4'-P energy: -69.556 tors. eta vs tors. theta energy: -126.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1669.065483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.065483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.065483 (E_RNA) where: Base-Base interactions energy: -1099.833 where: short stacking energy: -478.812 Base-Backbone interact. energy: -3.902 local terms energy: -565.330540 where: bonds (distance) C4'-P energy: -146.121 bonds (distance) P-C4' energy: -120.287 flat angles C4'-P-C4' energy: -126.977 flat angles P-C4'-P energy: -72.420 tors. eta vs tors. theta energy: -99.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1318.976948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1318.976948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1318.976948 (E_RNA) where: Base-Base interactions energy: -824.695 where: short stacking energy: -395.585 Base-Backbone interact. energy: -5.746 local terms energy: -488.535787 where: bonds (distance) C4'-P energy: -112.448 bonds (distance) P-C4' energy: -138.198 flat angles C4'-P-C4' energy: -117.049 flat angles P-C4'-P energy: -61.027 tors. eta vs tors. theta energy: -59.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -866.833733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.833733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.833733 (E_RNA) where: Base-Base interactions energy: -456.563 where: short stacking energy: -283.734 Base-Backbone interact. energy: -0.610 local terms energy: -409.660557 where: bonds (distance) C4'-P energy: -103.010 bonds (distance) P-C4' energy: -125.025 flat angles C4'-P-C4' energy: -118.212 flat angles P-C4'-P energy: -64.329 tors. eta vs tors. theta energy: 0.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -2507.443552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2507.443552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2507.443552 (E_RNA) where: Base-Base interactions energy: -1747.966 where: short stacking energy: -714.797 Base-Backbone interact. energy: -4.548 local terms energy: -754.929437 where: bonds (distance) C4'-P energy: -163.134 bonds (distance) P-C4' energy: -165.212 flat angles C4'-P-C4' energy: -161.970 flat angles P-C4'-P energy: -101.370 tors. eta vs tors. theta energy: -163.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -2526.843466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.843466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.843466 (E_RNA) where: Base-Base interactions energy: -1760.929 where: short stacking energy: -793.627 Base-Backbone interact. energy: -2.363 local terms energy: -763.551051 where: bonds (distance) C4'-P energy: -143.068 bonds (distance) P-C4' energy: -147.970 flat angles C4'-P-C4' energy: -159.906 flat angles P-C4'-P energy: -105.965 tors. eta vs tors. theta energy: -206.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -2345.946112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2345.946112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2345.946112 (E_RNA) where: Base-Base interactions energy: -1552.895 where: short stacking energy: -735.638 Base-Backbone interact. energy: -3.158 local terms energy: -789.893796 where: bonds (distance) C4'-P energy: -152.472 bonds (distance) P-C4' energy: -159.340 flat angles C4'-P-C4' energy: -173.694 flat angles P-C4'-P energy: -109.612 tors. eta vs tors. theta energy: -194.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -2242.374177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2242.374177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2242.374177 (E_RNA) where: Base-Base interactions energy: -1515.778 where: short stacking energy: -676.340 Base-Backbone interact. energy: -3.973 local terms energy: -722.623348 where: bonds (distance) C4'-P energy: -145.928 bonds (distance) P-C4' energy: -146.304 flat angles C4'-P-C4' energy: -159.835 flat angles P-C4'-P energy: -86.993 tors. eta vs tors. theta energy: -183.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -2089.540953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.540953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.540953 (E_RNA) where: Base-Base interactions energy: -1456.374 where: short stacking energy: -623.236 Base-Backbone interact. energy: -3.265 local terms energy: -629.901501 where: bonds (distance) C4'-P energy: -126.954 bonds (distance) P-C4' energy: -127.548 flat angles C4'-P-C4' energy: -154.731 flat angles P-C4'-P energy: -86.112 tors. eta vs tors. theta energy: -134.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1964.603025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.603025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.603025 (E_RNA) where: Base-Base interactions energy: -1314.749 where: short stacking energy: -586.410 Base-Backbone interact. energy: -0.506 local terms energy: -649.347864 where: bonds (distance) C4'-P energy: -131.800 bonds (distance) P-C4' energy: -134.616 flat angles C4'-P-C4' energy: -141.685 flat angles P-C4'-P energy: -104.247 tors. eta vs tors. theta energy: -136.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1781.459721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1781.459721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1781.459721 (E_RNA) where: Base-Base interactions energy: -1175.132 where: short stacking energy: -521.824 Base-Backbone interact. energy: -3.713 local terms energy: -602.614622 where: bonds (distance) C4'-P energy: -145.110 bonds (distance) P-C4' energy: -124.841 flat angles C4'-P-C4' energy: -145.628 flat angles P-C4'-P energy: -79.200 tors. eta vs tors. theta energy: -107.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1602.012605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.012605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.012605 (E_RNA) where: Base-Base interactions energy: -1044.855 where: short stacking energy: -505.133 Base-Backbone interact. energy: 7.235 local terms energy: -564.392524 where: bonds (distance) C4'-P energy: -132.542 bonds (distance) P-C4' energy: -134.267 flat angles C4'-P-C4' energy: -133.329 flat angles P-C4'-P energy: -88.200 tors. eta vs tors. theta energy: -76.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1326.159557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.159557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.159557 (E_RNA) where: Base-Base interactions energy: -793.914 where: short stacking energy: -385.192 Base-Backbone interact. energy: 2.924 local terms energy: -535.169426 where: bonds (distance) C4'-P energy: -138.741 bonds (distance) P-C4' energy: -128.710 flat angles C4'-P-C4' energy: -130.991 flat angles P-C4'-P energy: -72.432 tors. eta vs tors. theta energy: -64.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -798.927171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.927171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.927171 (E_RNA) where: Base-Base interactions energy: -374.035 where: short stacking energy: -253.274 Base-Backbone interact. energy: -0.577 local terms energy: -424.314675 where: bonds (distance) C4'-P energy: -103.479 bonds (distance) P-C4' energy: -137.827 flat angles C4'-P-C4' energy: -101.880 flat angles P-C4'-P energy: -65.637 tors. eta vs tors. theta energy: -15.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -2597.127026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2597.127026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2597.127026 (E_RNA) where: Base-Base interactions energy: -1774.706 where: short stacking energy: -796.379 Base-Backbone interact. energy: -4.064 local terms energy: -818.356778 where: bonds (distance) C4'-P energy: -151.152 bonds (distance) P-C4' energy: -161.672 flat angles C4'-P-C4' energy: -161.656 flat angles P-C4'-P energy: -126.928 tors. eta vs tors. theta energy: -216.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -2446.403855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2446.403855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2446.403855 (E_RNA) where: Base-Base interactions energy: -1736.347 where: short stacking energy: -728.257 Base-Backbone interact. energy: -6.159 local terms energy: -703.898112 where: bonds (distance) C4'-P energy: -148.082 bonds (distance) P-C4' energy: -145.104 flat angles C4'-P-C4' energy: -167.766 flat angles P-C4'-P energy: -81.041 tors. eta vs tors. theta energy: -161.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -2356.142317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2356.142317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2356.142317 (E_RNA) where: Base-Base interactions energy: -1607.000 where: short stacking energy: -767.068 Base-Backbone interact. energy: -2.307 local terms energy: -746.835509 where: bonds (distance) C4'-P energy: -149.534 bonds (distance) P-C4' energy: -152.260 flat angles C4'-P-C4' energy: -152.260 flat angles P-C4'-P energy: -92.492 tors. eta vs tors. theta energy: -200.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -2218.822574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.822574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.822574 (E_RNA) where: Base-Base interactions energy: -1494.809 where: short stacking energy: -663.892 Base-Backbone interact. energy: -2.648 local terms energy: -721.366132 where: bonds (distance) C4'-P energy: -143.380 bonds (distance) P-C4' energy: -145.550 flat angles C4'-P-C4' energy: -147.232 flat angles P-C4'-P energy: -105.902 tors. eta vs tors. theta energy: -179.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -2145.958462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2145.958462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2145.958462 (E_RNA) where: Base-Base interactions energy: -1465.556 where: short stacking energy: -643.981 Base-Backbone interact. energy: -2.382 local terms energy: -678.020268 where: bonds (distance) C4'-P energy: -117.934 bonds (distance) P-C4' energy: -132.902 flat angles C4'-P-C4' energy: -164.552 flat angles P-C4'-P energy: -92.173 tors. eta vs tors. theta energy: -170.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -2024.035019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.035019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.035019 (E_RNA) where: Base-Base interactions energy: -1401.716 where: short stacking energy: -621.190 Base-Backbone interact. energy: -2.273 local terms energy: -620.045710 where: bonds (distance) C4'-P energy: -113.785 bonds (distance) P-C4' energy: -132.943 flat angles C4'-P-C4' energy: -135.307 flat angles P-C4'-P energy: -99.727 tors. eta vs tors. theta energy: -138.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1740.080491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.080491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.080491 (E_RNA) where: Base-Base interactions energy: -1120.565 where: short stacking energy: -538.898 Base-Backbone interact. energy: 0.068 local terms energy: -619.583234 where: bonds (distance) C4'-P energy: -122.946 bonds (distance) P-C4' energy: -135.575 flat angles C4'-P-C4' energy: -144.324 flat angles P-C4'-P energy: -91.846 tors. eta vs tors. theta energy: -124.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1589.283381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.283381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.283381 (E_RNA) where: Base-Base interactions energy: -1066.966 where: short stacking energy: -485.442 Base-Backbone interact. energy: -2.909 local terms energy: -519.408614 where: bonds (distance) C4'-P energy: -118.209 bonds (distance) P-C4' energy: -127.705 flat angles C4'-P-C4' energy: -106.578 flat angles P-C4'-P energy: -76.218 tors. eta vs tors. theta energy: -90.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1325.155358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.155358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.155358 (E_RNA) where: Base-Base interactions energy: -847.811 where: short stacking energy: -398.314 Base-Backbone interact. energy: 2.528 local terms energy: -479.872108 where: bonds (distance) C4'-P energy: -124.991 bonds (distance) P-C4' energy: -123.012 flat angles C4'-P-C4' energy: -114.556 flat angles P-C4'-P energy: -62.831 tors. eta vs tors. theta energy: -54.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -843.285777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.285777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.285777 (E_RNA) where: Base-Base interactions energy: -422.292 where: short stacking energy: -243.096 Base-Backbone interact. energy: -0.917 local terms energy: -420.077199 where: bonds (distance) C4'-P energy: -108.857 bonds (distance) P-C4' energy: -115.747 flat angles C4'-P-C4' energy: -111.101 flat angles P-C4'-P energy: -76.344 tors. eta vs tors. theta energy: -8.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -2537.899616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2537.899616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2537.899616 (E_RNA) where: Base-Base interactions energy: -1735.703 where: short stacking energy: -772.557 Base-Backbone interact. energy: -1.616 local terms energy: -800.579828 where: bonds (distance) C4'-P energy: -138.882 bonds (distance) P-C4' energy: -157.898 flat angles C4'-P-C4' energy: -181.426 flat angles P-C4'-P energy: -118.215 tors. eta vs tors. theta energy: -204.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -2458.503517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2458.503517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2458.503517 (E_RNA) where: Base-Base interactions energy: -1713.575 where: short stacking energy: -735.314 Base-Backbone interact. energy: -5.580 local terms energy: -739.347796 where: bonds (distance) C4'-P energy: -138.943 bonds (distance) P-C4' energy: -144.225 flat angles C4'-P-C4' energy: -173.331 flat angles P-C4'-P energy: -99.745 tors. eta vs tors. theta energy: -183.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -2359.365982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2359.365982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2359.365982 (E_RNA) where: Base-Base interactions energy: -1603.901 where: short stacking energy: -753.343 Base-Backbone interact. energy: 0.119 local terms energy: -755.583897 where: bonds (distance) C4'-P energy: -143.375 bonds (distance) P-C4' energy: -147.299 flat angles C4'-P-C4' energy: -169.759 flat angles P-C4'-P energy: -95.819 tors. eta vs tors. theta energy: -199.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -2229.394292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2229.394292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2229.394292 (E_RNA) where: Base-Base interactions energy: -1547.032 where: short stacking energy: -678.245 Base-Backbone interact. energy: -2.722 local terms energy: -679.639965 where: bonds (distance) C4'-P energy: -140.709 bonds (distance) P-C4' energy: -123.415 flat angles C4'-P-C4' energy: -144.364 flat angles P-C4'-P energy: -100.489 tors. eta vs tors. theta energy: -170.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -2181.101661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.101661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.101661 (E_RNA) where: Base-Base interactions energy: -1493.638 where: short stacking energy: -652.567 Base-Backbone interact. energy: -3.448 local terms energy: -684.015368 where: bonds (distance) C4'-P energy: -132.788 bonds (distance) P-C4' energy: -139.879 flat angles C4'-P-C4' energy: -149.479 flat angles P-C4'-P energy: -97.945 tors. eta vs tors. theta energy: -163.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1914.982944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.982944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.982944 (E_RNA) where: Base-Base interactions energy: -1283.831 where: short stacking energy: -562.434 Base-Backbone interact. energy: -1.895 local terms energy: -629.257427 where: bonds (distance) C4'-P energy: -137.756 bonds (distance) P-C4' energy: -131.606 flat angles C4'-P-C4' energy: -149.560 flat angles P-C4'-P energy: -92.241 tors. eta vs tors. theta energy: -118.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1833.517215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1833.517215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1833.517215 (E_RNA) where: Base-Base interactions energy: -1221.671 where: short stacking energy: -522.443 Base-Backbone interact. energy: -2.386 local terms energy: -609.459595 where: bonds (distance) C4'-P energy: -136.882 bonds (distance) P-C4' energy: -131.570 flat angles C4'-P-C4' energy: -138.456 flat angles P-C4'-P energy: -75.228 tors. eta vs tors. theta energy: -127.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -1591.232669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.232669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.232669 (E_RNA) where: Base-Base interactions energy: -1041.090 where: short stacking energy: -489.759 Base-Backbone interact. energy: -2.324 local terms energy: -547.818102 where: bonds (distance) C4'-P energy: -120.985 bonds (distance) P-C4' energy: -126.474 flat angles C4'-P-C4' energy: -130.607 flat angles P-C4'-P energy: -90.388 tors. eta vs tors. theta energy: -79.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -1346.149883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.149883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.149883 (E_RNA) where: Base-Base interactions energy: -839.713 where: short stacking energy: -397.756 Base-Backbone interact. energy: 2.752 local terms energy: -509.188942 where: bonds (distance) C4'-P energy: -121.780 bonds (distance) P-C4' energy: -112.283 flat angles C4'-P-C4' energy: -140.312 flat angles P-C4'-P energy: -64.580 tors. eta vs tors. theta energy: -70.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -762.529256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.529256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.529256 (E_RNA) where: Base-Base interactions energy: -367.090 where: short stacking energy: -240.179 Base-Backbone interact. energy: 5.874 local terms energy: -401.313581 where: bonds (distance) C4'-P energy: -141.371 bonds (distance) P-C4' energy: -132.942 flat angles C4'-P-C4' energy: -90.874 flat angles P-C4'-P energy: -33.889 tors. eta vs tors. theta energy: -2.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -2567.106473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2567.106473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2567.106473 (E_RNA) where: Base-Base interactions energy: -1767.522 where: short stacking energy: -796.211 Base-Backbone interact. energy: -5.754 local terms energy: -793.830516 where: bonds (distance) C4'-P energy: -150.099 bonds (distance) P-C4' energy: -159.075 flat angles C4'-P-C4' energy: -169.386 flat angles P-C4'-P energy: -113.289 tors. eta vs tors. theta energy: -201.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -2448.845859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2448.845859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2448.845859 (E_RNA) where: Base-Base interactions energy: -1727.131 where: short stacking energy: -712.702 Base-Backbone interact. energy: -3.349 local terms energy: -718.365152 where: bonds (distance) C4'-P energy: -140.545 bonds (distance) P-C4' energy: -147.874 flat angles C4'-P-C4' energy: -164.005 flat angles P-C4'-P energy: -94.427 tors. eta vs tors. theta energy: -171.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -2388.622093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2388.622093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2388.622093 (E_RNA) where: Base-Base interactions energy: -1597.964 where: short stacking energy: -754.303 Base-Backbone interact. energy: -5.058 local terms energy: -785.600038 where: bonds (distance) C4'-P energy: -131.026 bonds (distance) P-C4' energy: -162.102 flat angles C4'-P-C4' energy: -174.754 flat angles P-C4'-P energy: -115.402 tors. eta vs tors. theta energy: -202.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -2240.384232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2240.384232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.384232 (E_RNA) where: Base-Base interactions energy: -1548.517 where: short stacking energy: -675.560 Base-Backbone interact. energy: -1.334 local terms energy: -690.532627 where: bonds (distance) C4'-P energy: -131.178 bonds (distance) P-C4' energy: -140.169 flat angles C4'-P-C4' energy: -150.981 flat angles P-C4'-P energy: -98.536 tors. eta vs tors. theta energy: -169.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -2166.736503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2166.736503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2166.736503 (E_RNA) where: Base-Base interactions energy: -1501.128 where: short stacking energy: -684.100 Base-Backbone interact. energy: -4.116 local terms energy: -661.492616 where: bonds (distance) C4'-P energy: -118.080 bonds (distance) P-C4' energy: -124.306 flat angles C4'-P-C4' energy: -161.062 flat angles P-C4'-P energy: -99.105 tors. eta vs tors. theta energy: -158.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1979.176857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.176857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.176857 (E_RNA) where: Base-Base interactions energy: -1317.628 where: short stacking energy: -586.592 Base-Backbone interact. energy: 2.735 local terms energy: -664.284534 where: bonds (distance) C4'-P energy: -128.496 bonds (distance) P-C4' energy: -140.564 flat angles C4'-P-C4' energy: -152.678 flat angles P-C4'-P energy: -100.907 tors. eta vs tors. theta energy: -141.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1840.119882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1840.119882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1840.119882 (E_RNA) where: Base-Base interactions energy: -1219.144 where: short stacking energy: -540.612 Base-Backbone interact. energy: -2.213 local terms energy: -618.763068 where: bonds (distance) C4'-P energy: -114.877 bonds (distance) P-C4' energy: -125.451 flat angles C4'-P-C4' energy: -144.380 flat angles P-C4'-P energy: -89.327 tors. eta vs tors. theta energy: -144.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1609.419162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.419162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.419162 (E_RNA) where: Base-Base interactions energy: -1059.935 where: short stacking energy: -487.342 Base-Backbone interact. energy: 0.859 local terms energy: -550.343623 where: bonds (distance) C4'-P energy: -113.947 bonds (distance) P-C4' energy: -141.246 flat angles C4'-P-C4' energy: -121.549 flat angles P-C4'-P energy: -78.223 tors. eta vs tors. theta energy: -95.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -1314.417847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.417847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.417847 (E_RNA) where: Base-Base interactions energy: -816.504 where: short stacking energy: -410.065 Base-Backbone interact. energy: 1.216 local terms energy: -499.129899 where: bonds (distance) C4'-P energy: -122.558 bonds (distance) P-C4' energy: -135.469 flat angles C4'-P-C4' energy: -122.571 flat angles P-C4'-P energy: -67.033 tors. eta vs tors. theta energy: -51.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -757.113093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.113093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.113093 (E_RNA) where: Base-Base interactions energy: -341.741 where: short stacking energy: -204.297 Base-Backbone interact. energy: 0.974 local terms energy: -416.346412 where: bonds (distance) C4'-P energy: -127.967 bonds (distance) P-C4' energy: -132.042 flat angles C4'-P-C4' energy: -101.780 flat angles P-C4'-P energy: -67.553 tors. eta vs tors. theta energy: 12.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -2528.832885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2528.832885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2528.832885 (E_RNA) where: Base-Base interactions energy: -1725.966 where: short stacking energy: -790.121 Base-Backbone interact. energy: -0.155 local terms energy: -802.711220 where: bonds (distance) C4'-P energy: -157.060 bonds (distance) P-C4' energy: -147.211 flat angles C4'-P-C4' energy: -175.046 flat angles P-C4'-P energy: -116.567 tors. eta vs tors. theta energy: -206.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -2476.529998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2476.529998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2476.529998 (E_RNA) where: Base-Base interactions energy: -1753.796 where: short stacking energy: -708.608 Base-Backbone interact. energy: -6.555 local terms energy: -716.179227 where: bonds (distance) C4'-P energy: -139.677 bonds (distance) P-C4' energy: -140.871 flat angles C4'-P-C4' energy: -166.918 flat angles P-C4'-P energy: -86.559 tors. eta vs tors. theta energy: -182.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -2344.868949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2344.868949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.868949 (E_RNA) where: Base-Base interactions energy: -1583.012 where: short stacking energy: -745.547 Base-Backbone interact. energy: -3.847 local terms energy: -758.010160 where: bonds (distance) C4'-P energy: -141.854 bonds (distance) P-C4' energy: -148.273 flat angles C4'-P-C4' energy: -165.139 flat angles P-C4'-P energy: -105.610 tors. eta vs tors. theta energy: -197.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -2286.700971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2286.700971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2286.700971 (E_RNA) where: Base-Base interactions energy: -1549.920 where: short stacking energy: -671.787 Base-Backbone interact. energy: -8.921 local terms energy: -727.860051 where: bonds (distance) C4'-P energy: -146.803 bonds (distance) P-C4' energy: -153.867 flat angles C4'-P-C4' energy: -149.175 flat angles P-C4'-P energy: -105.199 tors. eta vs tors. theta energy: -172.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -2200.178764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2200.178764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.178764 (E_RNA) where: Base-Base interactions energy: -1537.978 where: short stacking energy: -638.159 Base-Backbone interact. energy: -3.375 local terms energy: -658.825546 where: bonds (distance) C4'-P energy: -113.284 bonds (distance) P-C4' energy: -143.458 flat angles C4'-P-C4' energy: -152.568 flat angles P-C4'-P energy: -85.906 tors. eta vs tors. theta energy: -163.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -1939.214760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1939.214760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1939.214760 (E_RNA) where: Base-Base interactions energy: -1319.128 where: short stacking energy: -590.492 Base-Backbone interact. energy: -1.338 local terms energy: -618.748075 where: bonds (distance) C4'-P energy: -130.436 bonds (distance) P-C4' energy: -135.686 flat angles C4'-P-C4' energy: -144.427 flat angles P-C4'-P energy: -80.732 tors. eta vs tors. theta energy: -127.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -1763.582924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1763.582924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.582924 (E_RNA) where: Base-Base interactions energy: -1177.924 where: short stacking energy: -513.582 Base-Backbone interact. energy: -1.163 local terms energy: -584.496132 where: bonds (distance) C4'-P energy: -109.675 bonds (distance) P-C4' energy: -136.249 flat angles C4'-P-C4' energy: -136.850 flat angles P-C4'-P energy: -91.618 tors. eta vs tors. theta energy: -110.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -1613.239273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.239273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.239273 (E_RNA) where: Base-Base interactions energy: -1082.807 where: short stacking energy: -508.465 Base-Backbone interact. energy: 5.569 local terms energy: -536.001486 where: bonds (distance) C4'-P energy: -130.017 bonds (distance) P-C4' energy: -106.074 flat angles C4'-P-C4' energy: -135.081 flat angles P-C4'-P energy: -81.947 tors. eta vs tors. theta energy: -82.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -1343.731890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.731890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.731890 (E_RNA) where: Base-Base interactions energy: -837.336 where: short stacking energy: -411.573 Base-Backbone interact. energy: 2.595 local terms energy: -508.991415 where: bonds (distance) C4'-P energy: -102.777 bonds (distance) P-C4' energy: -130.690 flat angles C4'-P-C4' energy: -124.290 flat angles P-C4'-P energy: -73.207 tors. eta vs tors. theta energy: -78.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -851.419622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.419622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.419622 (E_RNA) where: Base-Base interactions energy: -450.197 where: short stacking energy: -248.030 Base-Backbone interact. energy: 3.180 local terms energy: -404.402356 where: bonds (distance) C4'-P energy: -134.077 bonds (distance) P-C4' energy: -112.547 flat angles C4'-P-C4' energy: -94.974 flat angles P-C4'-P energy: -67.110 tors. eta vs tors. theta energy: 4.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -2547.166474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.166474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2547.166474 (E_RNA) where: Base-Base interactions energy: -1772.757 where: short stacking energy: -731.993 Base-Backbone interact. energy: -1.439 local terms energy: -772.970970 where: bonds (distance) C4'-P energy: -156.102 bonds (distance) P-C4' energy: -149.593 flat angles C4'-P-C4' energy: -164.072 flat angles P-C4'-P energy: -109.412 tors. eta vs tors. theta energy: -193.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -2434.170637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2434.170637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2434.170637 (E_RNA) where: Base-Base interactions energy: -1714.980 where: short stacking energy: -701.815 Base-Backbone interact. energy: -4.889 local terms energy: -714.302474 where: bonds (distance) C4'-P energy: -150.992 bonds (distance) P-C4' energy: -140.579 flat angles C4'-P-C4' energy: -155.000 flat angles P-C4'-P energy: -95.538 tors. eta vs tors. theta energy: -172.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -2395.148534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2395.148534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2395.148534 (E_RNA) where: Base-Base interactions energy: -1621.634 where: short stacking energy: -787.230 Base-Backbone interact. energy: -4.214 local terms energy: -769.300616 where: bonds (distance) C4'-P energy: -147.229 bonds (distance) P-C4' energy: -157.294 flat angles C4'-P-C4' energy: -157.096 flat angles P-C4'-P energy: -106.040 tors. eta vs tors. theta energy: -201.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -2187.014096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.014096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2187.014096 (E_RNA) where: Base-Base interactions energy: -1488.860 where: short stacking energy: -645.335 Base-Backbone interact. energy: -2.762 local terms energy: -695.391717 where: bonds (distance) C4'-P energy: -135.020 bonds (distance) P-C4' energy: -133.493 flat angles C4'-P-C4' energy: -159.782 flat angles P-C4'-P energy: -100.708 tors. eta vs tors. theta energy: -166.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -2186.875419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.875419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.875419 (E_RNA) where: Base-Base interactions energy: -1489.411 where: short stacking energy: -638.638 Base-Backbone interact. energy: -3.291 local terms energy: -694.173557 where: bonds (distance) C4'-P energy: -128.555 bonds (distance) P-C4' energy: -150.326 flat angles C4'-P-C4' energy: -140.936 flat angles P-C4'-P energy: -113.438 tors. eta vs tors. theta energy: -160.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1945.807511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1945.807511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.807511 (E_RNA) where: Base-Base interactions energy: -1353.527 where: short stacking energy: -573.425 Base-Backbone interact. energy: 3.419 local terms energy: -595.699981 where: bonds (distance) C4'-P energy: -114.260 bonds (distance) P-C4' energy: -141.358 flat angles C4'-P-C4' energy: -124.977 flat angles P-C4'-P energy: -99.285 tors. eta vs tors. theta energy: -115.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1662.445314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.445314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.445314 (E_RNA) where: Base-Base interactions energy: -1095.184 where: short stacking energy: -520.595 Base-Backbone interact. energy: -2.840 local terms energy: -564.421934 where: bonds (distance) C4'-P energy: -126.833 bonds (distance) P-C4' energy: -130.886 flat angles C4'-P-C4' energy: -132.487 flat angles P-C4'-P energy: -68.285 tors. eta vs tors. theta energy: -105.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1616.636003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.636003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.636003 (E_RNA) where: Base-Base interactions energy: -1066.337 where: short stacking energy: -491.625 Base-Backbone interact. energy: -2.526 local terms energy: -547.773176 where: bonds (distance) C4'-P energy: -120.809 bonds (distance) P-C4' energy: -120.117 flat angles C4'-P-C4' energy: -133.312 flat angles P-C4'-P energy: -76.091 tors. eta vs tors. theta energy: -97.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1327.196562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.196562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.196562 (E_RNA) where: Base-Base interactions energy: -815.039 where: short stacking energy: -387.105 Base-Backbone interact. energy: -3.201 local terms energy: -508.956256 where: bonds (distance) C4'-P energy: -137.901 bonds (distance) P-C4' energy: -136.831 flat angles C4'-P-C4' energy: -114.247 flat angles P-C4'-P energy: -68.196 tors. eta vs tors. theta energy: -51.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -901.573642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.573642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.573642 (E_RNA) where: Base-Base interactions energy: -494.615 where: short stacking energy: -290.537 Base-Backbone interact. energy: 3.898 local terms energy: -410.857136 where: bonds (distance) C4'-P energy: -123.403 bonds (distance) P-C4' energy: -129.591 flat angles C4'-P-C4' energy: -107.984 flat angles P-C4'-P energy: -35.503 tors. eta vs tors. theta energy: -14.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -2569.785250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2569.785250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2569.785250 (E_RNA) where: Base-Base interactions energy: -1788.948 where: short stacking energy: -778.316 Base-Backbone interact. energy: -1.488 local terms energy: -779.348749 where: bonds (distance) C4'-P energy: -170.933 bonds (distance) P-C4' energy: -142.602 flat angles C4'-P-C4' energy: -160.998 flat angles P-C4'-P energy: -104.513 tors. eta vs tors. theta energy: -200.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -2495.673148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2495.673148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2495.673148 (E_RNA) where: Base-Base interactions energy: -1740.457 where: short stacking energy: -739.722 Base-Backbone interact. energy: -3.155 local terms energy: -752.061371 where: bonds (distance) C4'-P energy: -162.363 bonds (distance) P-C4' energy: -139.788 flat angles C4'-P-C4' energy: -157.243 flat angles P-C4'-P energy: -99.451 tors. eta vs tors. theta energy: -193.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -2333.179164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2333.179164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2333.179164 (E_RNA) where: Base-Base interactions energy: -1579.139 where: short stacking energy: -738.142 Base-Backbone interact. energy: -3.450 local terms energy: -750.590078 where: bonds (distance) C4'-P energy: -151.968 bonds (distance) P-C4' energy: -142.326 flat angles C4'-P-C4' energy: -156.129 flat angles P-C4'-P energy: -101.855 tors. eta vs tors. theta energy: -198.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -2251.222557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.222557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.222557 (E_RNA) where: Base-Base interactions energy: -1573.983 where: short stacking energy: -703.903 Base-Backbone interact. energy: -1.721 local terms energy: -675.518889 where: bonds (distance) C4'-P energy: -140.048 bonds (distance) P-C4' energy: -127.206 flat angles C4'-P-C4' energy: -149.516 flat angles P-C4'-P energy: -88.605 tors. eta vs tors. theta energy: -170.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -2152.411137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2152.411137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2152.411137 (E_RNA) where: Base-Base interactions energy: -1495.983 where: short stacking energy: -654.456 Base-Backbone interact. energy: -2.045 local terms energy: -654.383247 where: bonds (distance) C4'-P energy: -120.873 bonds (distance) P-C4' energy: -129.798 flat angles C4'-P-C4' energy: -156.887 flat angles P-C4'-P energy: -84.174 tors. eta vs tors. theta energy: -162.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -2001.956508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.956508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.956508 (E_RNA) where: Base-Base interactions energy: -1366.558 where: short stacking energy: -567.967 Base-Backbone interact. energy: -3.780 local terms energy: -631.618496 where: bonds (distance) C4'-P energy: -124.631 bonds (distance) P-C4' energy: -128.246 flat angles C4'-P-C4' energy: -148.021 flat angles P-C4'-P energy: -98.531 tors. eta vs tors. theta energy: -132.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1708.652050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.652050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.652050 (E_RNA) where: Base-Base interactions energy: -1114.793 where: short stacking energy: -502.521 Base-Backbone interact. energy: -0.336 local terms energy: -593.523396 where: bonds (distance) C4'-P energy: -143.985 bonds (distance) P-C4' energy: -127.284 flat angles C4'-P-C4' energy: -140.672 flat angles P-C4'-P energy: -74.892 tors. eta vs tors. theta energy: -106.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1548.859952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.859952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.859952 (E_RNA) where: Base-Base interactions energy: -1022.787 where: short stacking energy: -462.911 Base-Backbone interact. energy: -1.364 local terms energy: -524.709515 where: bonds (distance) C4'-P energy: -116.972 bonds (distance) P-C4' energy: -137.675 flat angles C4'-P-C4' energy: -126.344 flat angles P-C4'-P energy: -71.278 tors. eta vs tors. theta energy: -72.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -1365.171768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.171768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.171768 (E_RNA) where: Base-Base interactions energy: -867.518 where: short stacking energy: -413.939 Base-Backbone interact. energy: 3.081 local terms energy: -500.734022 where: bonds (distance) C4'-P energy: -124.823 bonds (distance) P-C4' energy: -112.397 flat angles C4'-P-C4' energy: -119.780 flat angles P-C4'-P energy: -84.129 tors. eta vs tors. theta energy: -59.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -959.992434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.992434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.992434 (E_RNA) where: Base-Base interactions energy: -519.550 where: short stacking energy: -274.216 Base-Backbone interact. energy: 0.076 local terms energy: -440.518452 where: bonds (distance) C4'-P energy: -128.128 bonds (distance) P-C4' energy: -142.781 flat angles C4'-P-C4' energy: -100.010 flat angles P-C4'-P energy: -47.832 tors. eta vs tors. theta energy: -21.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 4 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 28753102 moves confirmed later: 31897078 all moves confirmed: 60650180 percent of confirmed moves: 37.906363 current total energy: -2399.365404 recalc. total energy: -2399.365404 replica 8 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 28040906 moves confirmed later: 31269780 all moves confirmed: 59310686 percent of confirmed moves: 37.069179 current total energy: -2367.969459 recalc. total energy: -2367.969459 replica 10 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 31063289 moves confirmed later: 35116433 all moves confirmed: 66179722 percent of confirmed moves: 41.362326 current total energy: -2264.540645 recalc. total energy: -2264.540645 replica 1 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 35506805 moves confirmed later: 40865937 all moves confirmed: 76372742 percent of confirmed moves: 47.732964 current total energy: -2169.844945 recalc. total energy: -2169.844945 replica 5 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 31805177 moves confirmed later: 36155982 all moves confirmed: 67961159 percent of confirmed moves: 42.475724 current total energy: -2057.495611 recalc. total energy: -2057.495611 replica 2 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 40715140 moves confirmed later: 47791741 all moves confirmed: 88506881 percent of confirmed moves: 55.316801 current total energy: -1849.222103 recalc. total energy: -1849.222103 replica 9 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 43415364 moves confirmed later: 51520532 all moves confirmed: 94935896 percent of confirmed moves: 59.334935 current total energy: -1581.591540 recalc. total energy: -1581.591540 replica 7 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 34794830 moves confirmed later: 39936432 all moves confirmed: 74731262 percent of confirmed moves: 46.707039 current total energy: -1362.611547 recalc. total energy: -1362.611547 replica 6 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 46275948 moves confirmed later: 55403905 all moves confirmed: 101679853 percent of confirmed moves: 63.549908 current total energy: -1083.374824 recalc. total energy: -1083.374824 replica 3 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 52505070 moves confirmed later: 63200577 all moves confirmed: 115705647 percent of confirmed moves: 72.316029 current total energy: -850.827009 recalc. total energy: -850.827009 out arg RESULTS//1/Tetraloop_10_steps-66ff36fb_01 Time of doing 1600000 iterations: 7928.490 seconds