SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-35829ef4/inputs/seq.fa: 1 curr_seq: _UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 33 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 170 n_atoms_counter: 170 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 33.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -125.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.398267 (E_RNA) where: Base-Base interactions energy: -2.907 where: short stacking energy: -2.907 Base-Backbone interact. energy: -0.000 local terms energy: -122.490911 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -30.418 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -8.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -202.383846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.383846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.383846 (E_RNA) where: Base-Base interactions energy: -94.228 where: short stacking energy: -94.228 Base-Backbone interact. energy: -0.001 local terms energy: -108.154188 where: bonds (distance) C4'-P energy: -22.120 bonds (distance) P-C4' energy: -20.623 flat angles C4'-P-C4' energy: -19.878 flat angles P-C4'-P energy: -17.738 tors. eta vs tors. theta energy: -27.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -170.894196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.894196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.894196 (E_RNA) where: Base-Base interactions energy: -75.806 where: short stacking energy: -64.368 Base-Backbone interact. energy: -0.598 local terms energy: -94.490065 where: bonds (distance) C4'-P energy: -20.375 bonds (distance) P-C4' energy: -20.268 flat angles C4'-P-C4' energy: -23.863 flat angles P-C4'-P energy: -17.598 tors. eta vs tors. theta energy: -12.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -171.547505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.547505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.547505 (E_RNA) where: Base-Base interactions energy: -76.986 where: short stacking energy: -74.177 Base-Backbone interact. energy: -0.268 local terms energy: -94.293935 where: bonds (distance) C4'-P energy: -16.351 bonds (distance) P-C4' energy: -18.485 flat angles C4'-P-C4' energy: -23.060 flat angles P-C4'-P energy: -14.889 tors. eta vs tors. theta energy: -21.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -165.440922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.440922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.440922 (E_RNA) where: Base-Base interactions energy: -77.833 where: short stacking energy: -49.859 Base-Backbone interact. energy: -0.109 local terms energy: -87.499204 where: bonds (distance) C4'-P energy: -18.604 bonds (distance) P-C4' energy: -22.152 flat angles C4'-P-C4' energy: -21.567 flat angles P-C4'-P energy: -15.463 tors. eta vs tors. theta energy: -9.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -153.183537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.183537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.183537 (E_RNA) where: Base-Base interactions energy: -72.247 where: short stacking energy: -65.462 Base-Backbone interact. energy: -0.241 local terms energy: -80.695003 where: bonds (distance) C4'-P energy: -24.182 bonds (distance) P-C4' energy: -21.866 flat angles C4'-P-C4' energy: -18.502 flat angles P-C4'-P energy: -7.170 tors. eta vs tors. theta energy: -8.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -142.496250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.496250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.496250 (E_RNA) where: Base-Base interactions energy: -52.829 where: short stacking energy: -49.471 Base-Backbone interact. energy: -0.538 local terms energy: -89.129212 where: bonds (distance) C4'-P energy: -14.207 bonds (distance) P-C4' energy: -21.987 flat angles C4'-P-C4' energy: -24.021 flat angles P-C4'-P energy: -16.707 tors. eta vs tors. theta energy: -12.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -132.107625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.107625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.107625 (E_RNA) where: Base-Base interactions energy: -42.325 where: short stacking energy: -41.489 Base-Backbone interact. energy: -0.663 local terms energy: -89.119827 where: bonds (distance) C4'-P energy: -21.058 bonds (distance) P-C4' energy: -19.272 flat angles C4'-P-C4' energy: -24.027 flat angles P-C4'-P energy: -13.935 tors. eta vs tors. theta energy: -10.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -124.690458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.690458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.690458 (E_RNA) where: Base-Base interactions energy: -2.814 where: short stacking energy: -2.814 Base-Backbone interact. energy: -0.000 local terms energy: -121.876705 where: bonds (distance) C4'-P energy: -31.946 bonds (distance) P-C4' energy: -30.411 flat angles C4'-P-C4' energy: -23.644 flat angles P-C4'-P energy: -27.641 tors. eta vs tors. theta energy: -8.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -124.727700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.727700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.727700 (E_RNA) where: Base-Base interactions energy: -2.814 where: short stacking energy: -2.814 Base-Backbone interact. energy: -0.000 local terms energy: -121.913947 where: bonds (distance) C4'-P energy: -31.946 bonds (distance) P-C4' energy: -30.411 flat angles C4'-P-C4' energy: -23.644 flat angles P-C4'-P energy: -27.679 tors. eta vs tors. theta energy: -8.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -124.727700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.727700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.727700 (E_RNA) where: Base-Base interactions energy: -2.814 where: short stacking energy: -2.814 Base-Backbone interact. energy: -0.000 local terms energy: -121.913947 where: bonds (distance) C4'-P energy: -31.946 bonds (distance) P-C4' energy: -30.411 flat angles C4'-P-C4' energy: -23.644 flat angles P-C4'-P energy: -27.679 tors. eta vs tors. theta energy: -8.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -217.716342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.716342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.716342 (E_RNA) where: Base-Base interactions energy: -111.542 where: short stacking energy: -83.190 Base-Backbone interact. energy: -1.311 local terms energy: -104.863100 where: bonds (distance) C4'-P energy: -19.641 bonds (distance) P-C4' energy: -26.185 flat angles C4'-P-C4' energy: -25.520 flat angles P-C4'-P energy: -13.993 tors. eta vs tors. theta energy: -19.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -207.777076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.777076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.777076 (E_RNA) where: Base-Base interactions energy: -112.282 where: short stacking energy: -78.095 Base-Backbone interact. energy: -0.053 local terms energy: -95.442705 where: bonds (distance) C4'-P energy: -21.896 bonds (distance) P-C4' energy: -21.515 flat angles C4'-P-C4' energy: -21.000 flat angles P-C4'-P energy: -12.408 tors. eta vs tors. theta energy: -18.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -206.961847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.961847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.961847 (E_RNA) where: Base-Base interactions energy: -111.542 where: short stacking energy: -67.292 Base-Backbone interact. energy: -0.180 local terms energy: -95.239832 where: bonds (distance) C4'-P energy: -20.499 bonds (distance) P-C4' energy: -25.138 flat angles C4'-P-C4' energy: -23.530 flat angles P-C4'-P energy: -11.469 tors. eta vs tors. theta energy: -14.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -258.149505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.149505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.149505 (E_RNA) where: Base-Base interactions energy: -164.003 where: short stacking energy: -81.193 Base-Backbone interact. energy: -1.135 local terms energy: -93.011820 where: bonds (distance) C4'-P energy: -20.122 bonds (distance) P-C4' energy: -27.117 flat angles C4'-P-C4' energy: -21.020 flat angles P-C4'-P energy: -11.699 tors. eta vs tors. theta energy: -13.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -136.909304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.909304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.909304 (E_RNA) where: Base-Base interactions energy: -52.411 where: short stacking energy: -52.611 Base-Backbone interact. energy: -0.162 local terms energy: -84.336053 where: bonds (distance) C4'-P energy: -21.046 bonds (distance) P-C4' energy: -23.781 flat angles C4'-P-C4' energy: -20.466 flat angles P-C4'-P energy: -15.348 tors. eta vs tors. theta energy: -3.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -198.277799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.277799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.277799 (E_RNA) where: Base-Base interactions energy: -119.097 where: short stacking energy: -51.087 Base-Backbone interact. energy: -0.360 local terms energy: -78.821502 where: bonds (distance) C4'-P energy: -14.702 bonds (distance) P-C4' energy: -24.693 flat angles C4'-P-C4' energy: -21.703 flat angles P-C4'-P energy: -12.387 tors. eta vs tors. theta energy: -5.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -124.373770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.373770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.373770 (E_RNA) where: Base-Base interactions energy: -45.336 where: short stacking energy: -43.116 Base-Backbone interact. energy: -0.507 local terms energy: -78.531164 where: bonds (distance) C4'-P energy: -16.670 bonds (distance) P-C4' energy: -14.019 flat angles C4'-P-C4' energy: -24.880 flat angles P-C4'-P energy: -14.247 tors. eta vs tors. theta energy: -8.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -131.205434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.205434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.205434 (E_RNA) where: Base-Base interactions energy: -43.861 where: short stacking energy: -43.861 Base-Backbone interact. energy: 0.793 local terms energy: -88.137609 where: bonds (distance) C4'-P energy: -24.008 bonds (distance) P-C4' energy: -23.365 flat angles C4'-P-C4' energy: -18.480 flat angles P-C4'-P energy: -13.800 tors. eta vs tors. theta energy: -8.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -104.840163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.840163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.840163 (E_RNA) where: Base-Base interactions energy: -44.259 where: short stacking energy: -34.117 Base-Backbone interact. energy: -0.259 local terms energy: -60.321247 where: bonds (distance) C4'-P energy: -20.211 bonds (distance) P-C4' energy: -21.714 flat angles C4'-P-C4' energy: -20.376 flat angles P-C4'-P energy: -6.979 tors. eta vs tors. theta energy: 8.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -97.004677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.004677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.004677 (E_RNA) where: Base-Base interactions energy: -34.939 where: short stacking energy: -28.634 Base-Backbone interact. energy: -1.393 local terms energy: -60.672292 where: bonds (distance) C4'-P energy: -19.380 bonds (distance) P-C4' energy: -19.157 flat angles C4'-P-C4' energy: -18.481 flat angles P-C4'-P energy: -8.619 tors. eta vs tors. theta energy: 4.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -245.433040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.433040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.433040 (E_RNA) where: Base-Base interactions energy: -131.144 where: short stacking energy: -62.202 Base-Backbone interact. energy: -1.141 local terms energy: -113.147745 where: bonds (distance) C4'-P energy: -26.243 bonds (distance) P-C4' energy: -23.428 flat angles C4'-P-C4' energy: -23.029 flat angles P-C4'-P energy: -18.173 tors. eta vs tors. theta energy: -22.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -215.144505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.144505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.144505 (E_RNA) where: Base-Base interactions energy: -119.272 where: short stacking energy: -82.888 Base-Backbone interact. energy: -1.306 local terms energy: -94.566751 where: bonds (distance) C4'-P energy: -22.302 bonds (distance) P-C4' energy: -22.171 flat angles C4'-P-C4' energy: -20.884 flat angles P-C4'-P energy: -13.498 tors. eta vs tors. theta energy: -15.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -294.080536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.080536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.080536 (E_RNA) where: Base-Base interactions energy: -197.122 where: short stacking energy: -89.630 Base-Backbone interact. energy: -0.142 local terms energy: -96.816575 where: bonds (distance) C4'-P energy: -19.719 bonds (distance) P-C4' energy: -22.822 flat angles C4'-P-C4' energy: -18.031 flat angles P-C4'-P energy: -14.241 tors. eta vs tors. theta energy: -22.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -216.657982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.657982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.657982 (E_RNA) where: Base-Base interactions energy: -136.245 where: short stacking energy: -52.130 Base-Backbone interact. energy: -0.352 local terms energy: -80.061148 where: bonds (distance) C4'-P energy: -21.046 bonds (distance) P-C4' energy: -20.851 flat angles C4'-P-C4' energy: -23.099 flat angles P-C4'-P energy: -10.745 tors. eta vs tors. theta energy: -4.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -222.252120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.252120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.252120 (E_RNA) where: Base-Base interactions energy: -136.423 where: short stacking energy: -70.584 Base-Backbone interact. energy: -0.021 local terms energy: -85.807284 where: bonds (distance) C4'-P energy: -22.292 bonds (distance) P-C4' energy: -22.220 flat angles C4'-P-C4' energy: -19.101 flat angles P-C4'-P energy: -9.742 tors. eta vs tors. theta energy: -12.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -161.094121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.094121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.094121 (E_RNA) where: Base-Base interactions energy: -79.267 where: short stacking energy: -54.203 Base-Backbone interact. energy: -0.398 local terms energy: -81.430023 where: bonds (distance) C4'-P energy: -20.509 bonds (distance) P-C4' energy: -20.360 flat angles C4'-P-C4' energy: -17.793 flat angles P-C4'-P energy: -14.034 tors. eta vs tors. theta energy: -8.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -129.364928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.364928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.364928 (E_RNA) where: Base-Base interactions energy: -49.996 where: short stacking energy: -35.534 Base-Backbone interact. energy: 0.567 local terms energy: -79.935665 where: bonds (distance) C4'-P energy: -17.995 bonds (distance) P-C4' energy: -21.268 flat angles C4'-P-C4' energy: -19.674 flat angles P-C4'-P energy: -17.106 tors. eta vs tors. theta energy: -3.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -126.858366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.858366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.858366 (E_RNA) where: Base-Base interactions energy: -53.451 where: short stacking energy: -44.171 Base-Backbone interact. energy: -0.128 local terms energy: -73.279431 where: bonds (distance) C4'-P energy: -16.853 bonds (distance) P-C4' energy: -20.460 flat angles C4'-P-C4' energy: -17.502 flat angles P-C4'-P energy: -6.615 tors. eta vs tors. theta energy: -11.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -134.420920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.420920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.420920 (E_RNA) where: Base-Base interactions energy: -70.054 where: short stacking energy: -30.582 Base-Backbone interact. energy: 0.112 local terms energy: -64.479069 where: bonds (distance) C4'-P energy: -17.863 bonds (distance) P-C4' energy: -15.849 flat angles C4'-P-C4' energy: -12.387 flat angles P-C4'-P energy: -18.296 tors. eta vs tors. theta energy: -0.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -109.801962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.801962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.801962 (E_RNA) where: Base-Base interactions energy: -50.542 where: short stacking energy: -44.482 Base-Backbone interact. energy: -0.466 local terms energy: -58.793937 where: bonds (distance) C4'-P energy: -12.955 bonds (distance) P-C4' energy: -17.745 flat angles C4'-P-C4' energy: -15.454 flat angles P-C4'-P energy: -13.464 tors. eta vs tors. theta energy: 0.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -261.067581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.067581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.067581 (E_RNA) where: Base-Base interactions energy: -150.569 where: short stacking energy: -95.245 Base-Backbone interact. energy: -0.006 local terms energy: -110.492912 where: bonds (distance) C4'-P energy: -23.493 bonds (distance) P-C4' energy: -25.145 flat angles C4'-P-C4' energy: -25.312 flat angles P-C4'-P energy: -6.774 tors. eta vs tors. theta energy: -29.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -294.745753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.745753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.745753 (E_RNA) where: Base-Base interactions energy: -184.326 where: short stacking energy: -91.279 Base-Backbone interact. energy: 0.226 local terms energy: -110.645796 where: bonds (distance) C4'-P energy: -25.366 bonds (distance) P-C4' energy: -23.243 flat angles C4'-P-C4' energy: -21.162 flat angles P-C4'-P energy: -13.834 tors. eta vs tors. theta energy: -27.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -206.136886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.136886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.136886 (E_RNA) where: Base-Base interactions energy: -109.823 where: short stacking energy: -65.422 Base-Backbone interact. energy: -0.431 local terms energy: -95.883139 where: bonds (distance) C4'-P energy: -21.937 bonds (distance) P-C4' energy: -24.270 flat angles C4'-P-C4' energy: -21.485 flat angles P-C4'-P energy: -10.890 tors. eta vs tors. theta energy: -17.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -250.617146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.617146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.617146 (E_RNA) where: Base-Base interactions energy: -157.743 where: short stacking energy: -73.739 Base-Backbone interact. energy: -0.423 local terms energy: -92.451000 where: bonds (distance) C4'-P energy: -20.257 bonds (distance) P-C4' energy: -17.629 flat angles C4'-P-C4' energy: -22.585 flat angles P-C4'-P energy: -16.808 tors. eta vs tors. theta energy: -15.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -235.857718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.857718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.857718 (E_RNA) where: Base-Base interactions energy: -138.739 where: short stacking energy: -56.715 Base-Backbone interact. energy: -0.541 local terms energy: -96.577733 where: bonds (distance) C4'-P energy: -24.670 bonds (distance) P-C4' energy: -22.866 flat angles C4'-P-C4' energy: -21.830 flat angles P-C4'-P energy: -13.386 tors. eta vs tors. theta energy: -13.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -159.987948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.987948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.987948 (E_RNA) where: Base-Base interactions energy: -69.860 where: short stacking energy: -51.650 Base-Backbone interact. energy: -0.093 local terms energy: -90.035346 where: bonds (distance) C4'-P energy: -19.376 bonds (distance) P-C4' energy: -19.419 flat angles C4'-P-C4' energy: -24.340 flat angles P-C4'-P energy: -14.740 tors. eta vs tors. theta energy: -12.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -139.580778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.580778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.580778 (E_RNA) where: Base-Base interactions energy: -59.901 where: short stacking energy: -45.894 Base-Backbone interact. energy: -0.343 local terms energy: -79.337524 where: bonds (distance) C4'-P energy: -17.768 bonds (distance) P-C4' energy: -23.431 flat angles C4'-P-C4' energy: -20.602 flat angles P-C4'-P energy: -8.067 tors. eta vs tors. theta energy: -9.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -125.117899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.117899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.117899 (E_RNA) where: Base-Base interactions energy: -55.145 where: short stacking energy: -34.799 Base-Backbone interact. energy: -0.130 local terms energy: -69.842321 where: bonds (distance) C4'-P energy: -12.554 bonds (distance) P-C4' energy: -23.660 flat angles C4'-P-C4' energy: -14.848 flat angles P-C4'-P energy: -16.875 tors. eta vs tors. theta energy: -1.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -110.204945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.204945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.204945 (E_RNA) where: Base-Base interactions energy: -36.901 where: short stacking energy: -36.901 Base-Backbone interact. energy: -0.237 local terms energy: -73.066873 where: bonds (distance) C4'-P energy: -22.261 bonds (distance) P-C4' energy: -22.315 flat angles C4'-P-C4' energy: -11.489 flat angles P-C4'-P energy: -10.001 tors. eta vs tors. theta energy: -7.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -113.193744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.193744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.193744 (E_RNA) where: Base-Base interactions energy: -45.720 where: short stacking energy: -23.961 Base-Backbone interact. energy: -0.279 local terms energy: -67.194936 where: bonds (distance) C4'-P energy: -21.200 bonds (distance) P-C4' energy: -18.141 flat angles C4'-P-C4' energy: -19.722 flat angles P-C4'-P energy: -7.469 tors. eta vs tors. theta energy: -0.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -343.131017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.131017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.131017 (E_RNA) where: Base-Base interactions energy: -224.271 where: short stacking energy: -97.991 Base-Backbone interact. energy: -0.775 local terms energy: -118.085428 where: bonds (distance) C4'-P energy: -24.616 bonds (distance) P-C4' energy: -26.502 flat angles C4'-P-C4' energy: -24.343 flat angles P-C4'-P energy: -10.803 tors. eta vs tors. theta energy: -31.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -247.219426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.219426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.219426 (E_RNA) where: Base-Base interactions energy: -140.621 where: short stacking energy: -88.219 Base-Backbone interact. energy: -0.224 local terms energy: -106.374935 where: bonds (distance) C4'-P energy: -22.735 bonds (distance) P-C4' energy: -27.184 flat angles C4'-P-C4' energy: -21.903 flat angles P-C4'-P energy: -10.906 tors. eta vs tors. theta energy: -23.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -272.213907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.213907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.213907 (E_RNA) where: Base-Base interactions energy: -166.381 where: short stacking energy: -78.294 Base-Backbone interact. energy: -0.422 local terms energy: -105.411026 where: bonds (distance) C4'-P energy: -22.487 bonds (distance) P-C4' energy: -23.958 flat angles C4'-P-C4' energy: -22.122 flat angles P-C4'-P energy: -18.337 tors. eta vs tors. theta energy: -18.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -217.270245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.270245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.270245 (E_RNA) where: Base-Base interactions energy: -128.949 where: short stacking energy: -55.951 Base-Backbone interact. energy: -0.659 local terms energy: -87.662697 where: bonds (distance) C4'-P energy: -19.017 bonds (distance) P-C4' energy: -23.808 flat angles C4'-P-C4' energy: -20.254 flat angles P-C4'-P energy: -14.449 tors. eta vs tors. theta energy: -10.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -236.694134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.694134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.694134 (E_RNA) where: Base-Base interactions energy: -144.908 where: short stacking energy: -57.041 Base-Backbone interact. energy: -0.661 local terms energy: -91.125109 where: bonds (distance) C4'-P energy: -19.081 bonds (distance) P-C4' energy: -24.680 flat angles C4'-P-C4' energy: -20.764 flat angles P-C4'-P energy: -14.715 tors. eta vs tors. theta energy: -11.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -138.452963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.452963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.452963 (E_RNA) where: Base-Base interactions energy: -56.625 where: short stacking energy: -53.478 Base-Backbone interact. energy: -0.066 local terms energy: -81.762428 where: bonds (distance) C4'-P energy: -18.019 bonds (distance) P-C4' energy: -18.472 flat angles C4'-P-C4' energy: -25.061 flat angles P-C4'-P energy: -11.367 tors. eta vs tors. theta energy: -8.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -138.581504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.581504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.581504 (E_RNA) where: Base-Base interactions energy: -60.743 where: short stacking energy: -44.241 Base-Backbone interact. energy: -0.325 local terms energy: -77.514142 where: bonds (distance) C4'-P energy: -17.590 bonds (distance) P-C4' energy: -25.260 flat angles C4'-P-C4' energy: -16.933 flat angles P-C4'-P energy: -12.638 tors. eta vs tors. theta energy: -5.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -130.039145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.039145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.039145 (E_RNA) where: Base-Base interactions energy: -64.355 where: short stacking energy: -50.593 Base-Backbone interact. energy: -0.304 local terms energy: -65.380761 where: bonds (distance) C4'-P energy: -15.771 bonds (distance) P-C4' energy: -24.001 flat angles C4'-P-C4' energy: -13.426 flat angles P-C4'-P energy: -5.750 tors. eta vs tors. theta energy: -6.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -115.079231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.079231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.079231 (E_RNA) where: Base-Base interactions energy: -53.418 where: short stacking energy: -35.221 Base-Backbone interact. energy: 0.752 local terms energy: -62.413786 where: bonds (distance) C4'-P energy: -16.987 bonds (distance) P-C4' energy: -24.026 flat angles C4'-P-C4' energy: -13.668 flat angles P-C4'-P energy: -8.070 tors. eta vs tors. theta energy: 0.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -122.588590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.588590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.588590 (E_RNA) where: Base-Base interactions energy: -50.236 where: short stacking energy: -23.409 Base-Backbone interact. energy: -0.329 local terms energy: -72.023536 where: bonds (distance) C4'-P energy: -14.057 bonds (distance) P-C4' energy: -25.942 flat angles C4'-P-C4' energy: -19.894 flat angles P-C4'-P energy: -8.829 tors. eta vs tors. theta energy: -3.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -343.173358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.173358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.173358 (E_RNA) where: Base-Base interactions energy: -222.369 where: short stacking energy: -94.454 Base-Backbone interact. energy: -0.365 local terms energy: -120.439699 where: bonds (distance) C4'-P energy: -21.844 bonds (distance) P-C4' energy: -25.252 flat angles C4'-P-C4' energy: -24.330 flat angles P-C4'-P energy: -21.100 tors. eta vs tors. theta energy: -27.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -323.769753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.769753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.769753 (E_RNA) where: Base-Base interactions energy: -214.475 where: short stacking energy: -103.788 Base-Backbone interact. energy: -0.243 local terms energy: -109.051404 where: bonds (distance) C4'-P energy: -22.798 bonds (distance) P-C4' energy: -21.376 flat angles C4'-P-C4' energy: -23.292 flat angles P-C4'-P energy: -16.104 tors. eta vs tors. theta energy: -25.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -211.926031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.926031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.926031 (E_RNA) where: Base-Base interactions energy: -109.940 where: short stacking energy: -73.850 Base-Backbone interact. energy: -0.090 local terms energy: -101.895397 where: bonds (distance) C4'-P energy: -22.082 bonds (distance) P-C4' energy: -22.641 flat angles C4'-P-C4' energy: -20.833 flat angles P-C4'-P energy: -15.812 tors. eta vs tors. theta energy: -20.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -247.401235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.401235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.401235 (E_RNA) where: Base-Base interactions energy: -143.821 where: short stacking energy: -77.284 Base-Backbone interact. energy: -0.140 local terms energy: -103.440329 where: bonds (distance) C4'-P energy: -26.110 bonds (distance) P-C4' energy: -23.113 flat angles C4'-P-C4' energy: -21.613 flat angles P-C4'-P energy: -16.052 tors. eta vs tors. theta energy: -16.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -277.200743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.200743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.200743 (E_RNA) where: Base-Base interactions energy: -179.959 where: short stacking energy: -68.849 Base-Backbone interact. energy: -0.955 local terms energy: -96.286362 where: bonds (distance) C4'-P energy: -20.351 bonds (distance) P-C4' energy: -21.557 flat angles C4'-P-C4' energy: -22.635 flat angles P-C4'-P energy: -13.188 tors. eta vs tors. theta energy: -18.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -135.995707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.995707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.995707 (E_RNA) where: Base-Base interactions energy: -58.685 where: short stacking energy: -38.520 Base-Backbone interact. energy: -0.174 local terms energy: -77.137253 where: bonds (distance) C4'-P energy: -23.645 bonds (distance) P-C4' energy: -20.746 flat angles C4'-P-C4' energy: -17.998 flat angles P-C4'-P energy: -8.116 tors. eta vs tors. theta energy: -6.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -162.792256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.792256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.792256 (E_RNA) where: Base-Base interactions energy: -100.062 where: short stacking energy: -42.279 Base-Backbone interact. energy: -0.226 local terms energy: -62.503912 where: bonds (distance) C4'-P energy: -22.980 bonds (distance) P-C4' energy: -19.572 flat angles C4'-P-C4' energy: -15.912 flat angles P-C4'-P energy: -7.210 tors. eta vs tors. theta energy: 3.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -129.695076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.695076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.695076 (E_RNA) where: Base-Base interactions energy: -50.198 where: short stacking energy: -38.395 Base-Backbone interact. energy: -0.257 local terms energy: -79.239870 where: bonds (distance) C4'-P energy: -21.147 bonds (distance) P-C4' energy: -18.996 flat angles C4'-P-C4' energy: -23.895 flat angles P-C4'-P energy: -8.960 tors. eta vs tors. theta energy: -6.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -123.515878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.515878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.515878 (E_RNA) where: Base-Base interactions energy: -48.618 where: short stacking energy: -45.215 Base-Backbone interact. energy: -0.077 local terms energy: -74.821193 where: bonds (distance) C4'-P energy: -22.273 bonds (distance) P-C4' energy: -16.921 flat angles C4'-P-C4' energy: -17.198 flat angles P-C4'-P energy: -12.564 tors. eta vs tors. theta energy: -5.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -110.493524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.493524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.493524 (E_RNA) where: Base-Base interactions energy: -46.127 where: short stacking energy: -39.798 Base-Backbone interact. energy: 1.277 local terms energy: -65.643459 where: bonds (distance) C4'-P energy: -16.638 bonds (distance) P-C4' energy: -24.066 flat angles C4'-P-C4' energy: -13.785 flat angles P-C4'-P energy: -11.382 tors. eta vs tors. theta energy: 0.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -332.226046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.226046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.226046 (E_RNA) where: Base-Base interactions energy: -210.696 where: short stacking energy: -89.652 Base-Backbone interact. energy: -0.064 local terms energy: -121.466240 where: bonds (distance) C4'-P energy: -25.704 bonds (distance) P-C4' energy: -24.632 flat angles C4'-P-C4' energy: -24.278 flat angles P-C4'-P energy: -19.783 tors. eta vs tors. theta energy: -27.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -336.237094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.237094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.237094 (E_RNA) where: Base-Base interactions energy: -227.838 where: short stacking energy: -100.531 Base-Backbone interact. energy: -0.305 local terms energy: -108.094403 where: bonds (distance) C4'-P energy: -22.952 bonds (distance) P-C4' energy: -21.095 flat angles C4'-P-C4' energy: -22.849 flat angles P-C4'-P energy: -15.709 tors. eta vs tors. theta energy: -25.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -252.845573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.845573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.845573 (E_RNA) where: Base-Base interactions energy: -160.564 where: short stacking energy: -91.006 Base-Backbone interact. energy: 1.417 local terms energy: -93.698266 where: bonds (distance) C4'-P energy: -20.704 bonds (distance) P-C4' energy: -15.504 flat angles C4'-P-C4' energy: -21.251 flat angles P-C4'-P energy: -15.963 tors. eta vs tors. theta energy: -20.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -164.716507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.716507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.716507 (E_RNA) where: Base-Base interactions energy: -81.861 where: short stacking energy: -55.949 Base-Backbone interact. energy: -1.491 local terms energy: -81.365133 where: bonds (distance) C4'-P energy: -15.591 bonds (distance) P-C4' energy: -24.762 flat angles C4'-P-C4' energy: -18.349 flat angles P-C4'-P energy: -9.905 tors. eta vs tors. theta energy: -12.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -269.241784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.241784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.241784 (E_RNA) where: Base-Base interactions energy: -176.700 where: short stacking energy: -78.459 Base-Backbone interact. energy: -0.303 local terms energy: -92.239141 where: bonds (distance) C4'-P energy: -22.698 bonds (distance) P-C4' energy: -22.908 flat angles C4'-P-C4' energy: -17.225 flat angles P-C4'-P energy: -13.011 tors. eta vs tors. theta energy: -16.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -130.427049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.427049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.427049 (E_RNA) where: Base-Base interactions energy: -44.552 where: short stacking energy: -41.039 Base-Backbone interact. energy: 0.009 local terms energy: -85.884093 where: bonds (distance) C4'-P energy: -22.141 bonds (distance) P-C4' energy: -17.045 flat angles C4'-P-C4' energy: -20.520 flat angles P-C4'-P energy: -17.397 tors. eta vs tors. theta energy: -8.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -131.797783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.797783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.797783 (E_RNA) where: Base-Base interactions energy: -53.454 where: short stacking energy: -44.249 Base-Backbone interact. energy: -0.230 local terms energy: -78.113239 where: bonds (distance) C4'-P energy: -21.249 bonds (distance) P-C4' energy: -25.194 flat angles C4'-P-C4' energy: -20.027 flat angles P-C4'-P energy: -9.815 tors. eta vs tors. theta energy: -1.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -126.479351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.479351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.479351 (E_RNA) where: Base-Base interactions energy: -57.993 where: short stacking energy: -28.884 Base-Backbone interact. energy: -1.676 local terms energy: -66.809914 where: bonds (distance) C4'-P energy: -20.508 bonds (distance) P-C4' energy: -20.835 flat angles C4'-P-C4' energy: -19.465 flat angles P-C4'-P energy: -9.731 tors. eta vs tors. theta energy: 3.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -109.067351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.067351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.067351 (E_RNA) where: Base-Base interactions energy: -42.004 where: short stacking energy: -35.243 Base-Backbone interact. energy: -0.304 local terms energy: -66.759069 where: bonds (distance) C4'-P energy: -17.159 bonds (distance) P-C4' energy: -20.381 flat angles C4'-P-C4' energy: -17.093 flat angles P-C4'-P energy: -17.473 tors. eta vs tors. theta energy: 5.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -109.356127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.356127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.356127 (E_RNA) where: Base-Base interactions energy: -34.470 where: short stacking energy: -31.021 Base-Backbone interact. energy: -0.353 local terms energy: -74.532830 where: bonds (distance) C4'-P energy: -19.929 bonds (distance) P-C4' energy: -23.000 flat angles C4'-P-C4' energy: -15.755 flat angles P-C4'-P energy: -15.283 tors. eta vs tors. theta energy: -0.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -329.227438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.227438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.227438 (E_RNA) where: Base-Base interactions energy: -212.125 where: short stacking energy: -100.405 Base-Backbone interact. energy: -0.005 local terms energy: -117.096952 where: bonds (distance) C4'-P energy: -22.611 bonds (distance) P-C4' energy: -26.210 flat angles C4'-P-C4' energy: -19.768 flat angles P-C4'-P energy: -19.880 tors. eta vs tors. theta energy: -28.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -348.607340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.607340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.607340 (E_RNA) where: Base-Base interactions energy: -244.565 where: short stacking energy: -106.003 Base-Backbone interact. energy: -0.043 local terms energy: -103.999041 where: bonds (distance) C4'-P energy: -17.480 bonds (distance) P-C4' energy: -21.355 flat angles C4'-P-C4' energy: -23.052 flat angles P-C4'-P energy: -16.278 tors. eta vs tors. theta energy: -25.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -231.007774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.007774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.007774 (E_RNA) where: Base-Base interactions energy: -138.284 where: short stacking energy: -82.118 Base-Backbone interact. energy: -0.181 local terms energy: -92.542998 where: bonds (distance) C4'-P energy: -13.950 bonds (distance) P-C4' energy: -17.684 flat angles C4'-P-C4' energy: -26.804 flat angles P-C4'-P energy: -17.450 tors. eta vs tors. theta energy: -16.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -291.112367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.112367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.112367 (E_RNA) where: Base-Base interactions energy: -184.597 where: short stacking energy: -87.850 Base-Backbone interact. energy: 1.019 local terms energy: -107.534202 where: bonds (distance) C4'-P energy: -22.560 bonds (distance) P-C4' energy: -23.962 flat angles C4'-P-C4' energy: -17.508 flat angles P-C4'-P energy: -19.564 tors. eta vs tors. theta energy: -23.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -203.726264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.726264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.726264 (E_RNA) where: Base-Base interactions energy: -125.998 where: short stacking energy: -59.598 Base-Backbone interact. energy: 1.157 local terms energy: -78.885271 where: bonds (distance) C4'-P energy: -17.739 bonds (distance) P-C4' energy: -23.265 flat angles C4'-P-C4' energy: -9.565 flat angles P-C4'-P energy: -18.386 tors. eta vs tors. theta energy: -9.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -142.137277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.137277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.137277 (E_RNA) where: Base-Base interactions energy: -68.371 where: short stacking energy: -48.454 Base-Backbone interact. energy: -0.511 local terms energy: -73.255418 where: bonds (distance) C4'-P energy: -14.732 bonds (distance) P-C4' energy: -21.183 flat angles C4'-P-C4' energy: -19.975 flat angles P-C4'-P energy: -11.588 tors. eta vs tors. theta energy: -5.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -130.322212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.322212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.322212 (E_RNA) where: Base-Base interactions energy: -47.108 where: short stacking energy: -45.484 Base-Backbone interact. energy: -0.303 local terms energy: -82.911156 where: bonds (distance) C4'-P energy: -23.704 bonds (distance) P-C4' energy: -18.081 flat angles C4'-P-C4' energy: -21.462 flat angles P-C4'-P energy: -14.092 tors. eta vs tors. theta energy: -5.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -134.843715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.843715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.843715 (E_RNA) where: Base-Base interactions energy: -59.164 where: short stacking energy: -36.938 Base-Backbone interact. energy: -0.198 local terms energy: -75.481216 where: bonds (distance) C4'-P energy: -15.461 bonds (distance) P-C4' energy: -23.782 flat angles C4'-P-C4' energy: -14.698 flat angles P-C4'-P energy: -11.084 tors. eta vs tors. theta energy: -10.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -165.275406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.275406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.275406 (E_RNA) where: Base-Base interactions energy: -94.516 where: short stacking energy: -54.963 Base-Backbone interact. energy: -0.645 local terms energy: -70.114085 where: bonds (distance) C4'-P energy: -19.752 bonds (distance) P-C4' energy: -21.719 flat angles C4'-P-C4' energy: -14.108 flat angles P-C4'-P energy: -11.612 tors. eta vs tors. theta energy: -2.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -134.113419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.113419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.113419 (E_RNA) where: Base-Base interactions energy: -55.188 where: short stacking energy: -41.853 Base-Backbone interact. energy: -0.250 local terms energy: -78.675221 where: bonds (distance) C4'-P energy: -15.441 bonds (distance) P-C4' energy: -25.592 flat angles C4'-P-C4' energy: -19.518 flat angles P-C4'-P energy: -9.162 tors. eta vs tors. theta energy: -8.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -367.157661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.157661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.157661 (E_RNA) where: Base-Base interactions energy: -241.701 where: short stacking energy: -116.911 Base-Backbone interact. energy: -0.319 local terms energy: -125.137924 where: bonds (distance) C4'-P energy: -26.788 bonds (distance) P-C4' energy: -21.834 flat angles C4'-P-C4' energy: -24.873 flat angles P-C4'-P energy: -18.883 tors. eta vs tors. theta energy: -32.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -344.703368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.703368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.703368 (E_RNA) where: Base-Base interactions energy: -221.263 where: short stacking energy: -98.056 Base-Backbone interact. energy: -0.013 local terms energy: -123.427034 where: bonds (distance) C4'-P energy: -25.165 bonds (distance) P-C4' energy: -24.580 flat angles C4'-P-C4' energy: -23.572 flat angles P-C4'-P energy: -15.880 tors. eta vs tors. theta energy: -34.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -306.638264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.638264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.638264 (E_RNA) where: Base-Base interactions energy: -209.204 where: short stacking energy: -95.337 Base-Backbone interact. energy: -0.043 local terms energy: -97.390663 where: bonds (distance) C4'-P energy: -16.305 bonds (distance) P-C4' energy: -23.802 flat angles C4'-P-C4' energy: -25.985 flat angles P-C4'-P energy: -9.285 tors. eta vs tors. theta energy: -22.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -214.995978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.995978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.995978 (E_RNA) where: Base-Base interactions energy: -119.613 where: short stacking energy: -58.752 Base-Backbone interact. energy: -0.726 local terms energy: -94.657319 where: bonds (distance) C4'-P energy: -20.284 bonds (distance) P-C4' energy: -20.999 flat angles C4'-P-C4' energy: -19.758 flat angles P-C4'-P energy: -15.748 tors. eta vs tors. theta energy: -17.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -227.689154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.689154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.689154 (E_RNA) where: Base-Base interactions energy: -148.801 where: short stacking energy: -62.942 Base-Backbone interact. energy: 0.332 local terms energy: -79.220287 where: bonds (distance) C4'-P energy: -14.755 bonds (distance) P-C4' energy: -19.222 flat angles C4'-P-C4' energy: -21.605 flat angles P-C4'-P energy: -8.267 tors. eta vs tors. theta energy: -15.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -158.130270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.130270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.130270 (E_RNA) where: Base-Base interactions energy: -66.746 where: short stacking energy: -59.443 Base-Backbone interact. energy: -0.117 local terms energy: -91.267284 where: bonds (distance) C4'-P energy: -22.645 bonds (distance) P-C4' energy: -21.415 flat angles C4'-P-C4' energy: -18.870 flat angles P-C4'-P energy: -19.220 tors. eta vs tors. theta energy: -9.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -135.309336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.309336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.309336 (E_RNA) where: Base-Base interactions energy: -65.121 where: short stacking energy: -43.930 Base-Backbone interact. energy: -0.380 local terms energy: -69.808697 where: bonds (distance) C4'-P energy: -17.975 bonds (distance) P-C4' energy: -19.127 flat angles C4'-P-C4' energy: -18.922 flat angles P-C4'-P energy: -14.699 tors. eta vs tors. theta energy: 0.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -144.594447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.594447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.594447 (E_RNA) where: Base-Base interactions energy: -77.415 where: short stacking energy: -44.038 Base-Backbone interact. energy: -0.331 local terms energy: -66.849023 where: bonds (distance) C4'-P energy: -13.770 bonds (distance) P-C4' energy: -18.269 flat angles C4'-P-C4' energy: -14.500 flat angles P-C4'-P energy: -11.798 tors. eta vs tors. theta energy: -8.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -136.918322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.918322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.918322 (E_RNA) where: Base-Base interactions energy: -70.936 where: short stacking energy: -36.647 Base-Backbone interact. energy: -1.834 local terms energy: -64.148006 where: bonds (distance) C4'-P energy: -15.743 bonds (distance) P-C4' energy: -18.603 flat angles C4'-P-C4' energy: -17.071 flat angles P-C4'-P energy: -12.254 tors. eta vs tors. theta energy: -0.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -108.432374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.432374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.432374 (E_RNA) where: Base-Base interactions energy: -45.106 where: short stacking energy: -30.570 Base-Backbone interact. energy: -0.502 local terms energy: -62.824368 where: bonds (distance) C4'-P energy: -14.882 bonds (distance) P-C4' energy: -21.932 flat angles C4'-P-C4' energy: -11.840 flat angles P-C4'-P energy: -12.501 tors. eta vs tors. theta energy: -1.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -380.797780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.797780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.797780 (E_RNA) where: Base-Base interactions energy: -257.455 where: short stacking energy: -115.921 Base-Backbone interact. energy: -0.006 local terms energy: -123.337373 where: bonds (distance) C4'-P energy: -21.309 bonds (distance) P-C4' energy: -22.486 flat angles C4'-P-C4' energy: -25.649 flat angles P-C4'-P energy: -21.937 tors. eta vs tors. theta energy: -31.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -347.086513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.086513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.086513 (E_RNA) where: Base-Base interactions energy: -239.855 where: short stacking energy: -102.617 Base-Backbone interact. energy: -0.484 local terms energy: -106.747796 where: bonds (distance) C4'-P energy: -22.534 bonds (distance) P-C4' energy: -22.890 flat angles C4'-P-C4' energy: -23.386 flat angles P-C4'-P energy: -12.078 tors. eta vs tors. theta energy: -25.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -303.142217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.142217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.142217 (E_RNA) where: Base-Base interactions energy: -191.683 where: short stacking energy: -96.980 Base-Backbone interact. energy: -0.620 local terms energy: -110.839381 where: bonds (distance) C4'-P energy: -19.669 bonds (distance) P-C4' energy: -20.336 flat angles C4'-P-C4' energy: -23.606 flat angles P-C4'-P energy: -16.918 tors. eta vs tors. theta energy: -30.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -242.775604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.775604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.775604 (E_RNA) where: Base-Base interactions energy: -147.408 where: short stacking energy: -77.214 Base-Backbone interact. energy: -0.061 local terms energy: -95.307151 where: bonds (distance) C4'-P energy: -19.918 bonds (distance) P-C4' energy: -27.608 flat angles C4'-P-C4' energy: -22.689 flat angles P-C4'-P energy: -11.485 tors. eta vs tors. theta energy: -13.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -207.267971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.267971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.267971 (E_RNA) where: Base-Base interactions energy: -130.774 where: short stacking energy: -51.880 Base-Backbone interact. energy: -0.224 local terms energy: -76.269562 where: bonds (distance) C4'-P energy: -19.884 bonds (distance) P-C4' energy: -17.795 flat angles C4'-P-C4' energy: -18.904 flat angles P-C4'-P energy: -16.472 tors. eta vs tors. theta energy: -3.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -133.569646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.569646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.569646 (E_RNA) where: Base-Base interactions energy: -48.470 where: short stacking energy: -48.470 Base-Backbone interact. energy: -1.095 local terms energy: -84.004483 where: bonds (distance) C4'-P energy: -25.845 bonds (distance) P-C4' energy: -21.643 flat angles C4'-P-C4' energy: -20.294 flat angles P-C4'-P energy: -7.265 tors. eta vs tors. theta energy: -8.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -136.291372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.291372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.291372 (E_RNA) where: Base-Base interactions energy: -49.052 where: short stacking energy: -45.091 Base-Backbone interact. energy: -0.201 local terms energy: -87.038345 where: bonds (distance) C4'-P energy: -19.428 bonds (distance) P-C4' energy: -22.443 flat angles C4'-P-C4' energy: -23.625 flat angles P-C4'-P energy: -8.985 tors. eta vs tors. theta energy: -12.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -129.636437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.636437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.636437 (E_RNA) where: Base-Base interactions energy: -60.165 where: short stacking energy: -33.741 Base-Backbone interact. energy: -0.189 local terms energy: -69.281900 where: bonds (distance) C4'-P energy: -19.315 bonds (distance) P-C4' energy: -22.531 flat angles C4'-P-C4' energy: -23.705 flat angles P-C4'-P energy: -4.405 tors. eta vs tors. theta energy: 0.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -131.336849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.336849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.336849 (E_RNA) where: Base-Base interactions energy: -54.308 where: short stacking energy: -47.062 Base-Backbone interact. energy: 0.121 local terms energy: -77.149772 where: bonds (distance) C4'-P energy: -22.744 bonds (distance) P-C4' energy: -20.028 flat angles C4'-P-C4' energy: -16.132 flat angles P-C4'-P energy: -12.878 tors. eta vs tors. theta energy: -5.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -125.256194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.256194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.256194 (E_RNA) where: Base-Base interactions energy: -51.554 where: short stacking energy: -29.108 Base-Backbone interact. energy: -0.397 local terms energy: -73.305074 where: bonds (distance) C4'-P energy: -19.081 bonds (distance) P-C4' energy: -21.628 flat angles C4'-P-C4' energy: -18.757 flat angles P-C4'-P energy: -9.950 tors. eta vs tors. theta energy: -3.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -357.991694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.991694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.991694 (E_RNA) where: Base-Base interactions energy: -241.023 where: short stacking energy: -99.362 Base-Backbone interact. energy: -0.495 local terms energy: -116.473778 where: bonds (distance) C4'-P energy: -25.158 bonds (distance) P-C4' energy: -19.539 flat angles C4'-P-C4' energy: -23.286 flat angles P-C4'-P energy: -17.376 tors. eta vs tors. theta energy: -31.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -384.469842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.469842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.469842 (E_RNA) where: Base-Base interactions energy: -268.607 where: short stacking energy: -113.610 Base-Backbone interact. energy: -0.017 local terms energy: -115.846411 where: bonds (distance) C4'-P energy: -22.244 bonds (distance) P-C4' energy: -21.083 flat angles C4'-P-C4' energy: -22.868 flat angles P-C4'-P energy: -16.010 tors. eta vs tors. theta energy: -33.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -323.858517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.858517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.858517 (E_RNA) where: Base-Base interactions energy: -215.277 where: short stacking energy: -96.068 Base-Backbone interact. energy: -0.010 local terms energy: -108.571217 where: bonds (distance) C4'-P energy: -19.743 bonds (distance) P-C4' energy: -22.939 flat angles C4'-P-C4' energy: -22.830 flat angles P-C4'-P energy: -16.703 tors. eta vs tors. theta energy: -26.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -254.748042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.748042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.748042 (E_RNA) where: Base-Base interactions energy: -159.196 where: short stacking energy: -79.039 Base-Backbone interact. energy: -0.826 local terms energy: -94.725647 where: bonds (distance) C4'-P energy: -22.764 bonds (distance) P-C4' energy: -20.390 flat angles C4'-P-C4' energy: -21.740 flat angles P-C4'-P energy: -11.350 tors. eta vs tors. theta energy: -18.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -201.528320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.528320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.528320 (E_RNA) where: Base-Base interactions energy: -107.260 where: short stacking energy: -61.153 Base-Backbone interact. energy: -0.799 local terms energy: -93.470081 where: bonds (distance) C4'-P energy: -19.154 bonds (distance) P-C4' energy: -21.193 flat angles C4'-P-C4' energy: -22.746 flat angles P-C4'-P energy: -12.429 tors. eta vs tors. theta energy: -17.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -133.919939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.919939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.919939 (E_RNA) where: Base-Base interactions energy: -50.518 where: short stacking energy: -47.455 Base-Backbone interact. energy: -0.425 local terms energy: -82.977028 where: bonds (distance) C4'-P energy: -12.114 bonds (distance) P-C4' energy: -17.290 flat angles C4'-P-C4' energy: -23.662 flat angles P-C4'-P energy: -18.050 tors. eta vs tors. theta energy: -11.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -135.097125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.097125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.097125 (E_RNA) where: Base-Base interactions energy: -49.594 where: short stacking energy: -46.129 Base-Backbone interact. energy: 0.245 local terms energy: -85.748471 where: bonds (distance) C4'-P energy: -17.883 bonds (distance) P-C4' energy: -21.723 flat angles C4'-P-C4' energy: -22.336 flat angles P-C4'-P energy: -12.810 tors. eta vs tors. theta energy: -10.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -124.724374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.724374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.724374 (E_RNA) where: Base-Base interactions energy: -44.882 where: short stacking energy: -30.959 Base-Backbone interact. energy: -0.527 local terms energy: -79.315376 where: bonds (distance) C4'-P energy: -15.234 bonds (distance) P-C4' energy: -20.222 flat angles C4'-P-C4' energy: -23.553 flat angles P-C4'-P energy: -13.934 tors. eta vs tors. theta energy: -6.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -118.565984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.565984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.565984 (E_RNA) where: Base-Base interactions energy: -58.962 where: short stacking energy: -33.579 Base-Backbone interact. energy: 0.512 local terms energy: -60.115462 where: bonds (distance) C4'-P energy: -14.469 bonds (distance) P-C4' energy: -18.511 flat angles C4'-P-C4' energy: -16.675 flat angles P-C4'-P energy: -13.109 tors. eta vs tors. theta energy: 2.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -102.162169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.162169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.162169 (E_RNA) where: Base-Base interactions energy: -34.934 where: short stacking energy: -22.577 Base-Backbone interact. energy: -0.555 local terms energy: -66.672864 where: bonds (distance) C4'-P energy: -17.907 bonds (distance) P-C4' energy: -18.828 flat angles C4'-P-C4' energy: -21.444 flat angles P-C4'-P energy: -9.874 tors. eta vs tors. theta energy: 1.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -361.153527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.153527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.153527 (E_RNA) where: Base-Base interactions energy: -246.464 where: short stacking energy: -101.235 Base-Backbone interact. energy: -0.468 local terms energy: -114.222068 where: bonds (distance) C4'-P energy: -20.694 bonds (distance) P-C4' energy: -24.645 flat angles C4'-P-C4' energy: -24.873 flat angles P-C4'-P energy: -14.598 tors. eta vs tors. theta energy: -29.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -373.150787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.150787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.150787 (E_RNA) where: Base-Base interactions energy: -257.760 where: short stacking energy: -118.398 Base-Backbone interact. energy: -0.031 local terms energy: -115.359723 where: bonds (distance) C4'-P energy: -19.710 bonds (distance) P-C4' energy: -23.856 flat angles C4'-P-C4' energy: -23.907 flat angles P-C4'-P energy: -15.057 tors. eta vs tors. theta energy: -32.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -299.805367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.805367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.805367 (E_RNA) where: Base-Base interactions energy: -198.829 where: short stacking energy: -89.603 Base-Backbone interact. energy: -0.135 local terms energy: -100.842074 where: bonds (distance) C4'-P energy: -17.720 bonds (distance) P-C4' energy: -21.540 flat angles C4'-P-C4' energy: -25.850 flat angles P-C4'-P energy: -13.610 tors. eta vs tors. theta energy: -22.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -242.658042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.658042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.658042 (E_RNA) where: Base-Base interactions energy: -139.275 where: short stacking energy: -72.423 Base-Backbone interact. energy: -0.737 local terms energy: -102.646567 where: bonds (distance) C4'-P energy: -16.974 bonds (distance) P-C4' energy: -26.350 flat angles C4'-P-C4' energy: -22.612 flat angles P-C4'-P energy: -16.485 tors. eta vs tors. theta energy: -20.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -199.664141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.664141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.664141 (E_RNA) where: Base-Base interactions energy: -111.155 where: short stacking energy: -51.261 Base-Backbone interact. energy: -0.299 local terms energy: -88.210014 where: bonds (distance) C4'-P energy: -21.586 bonds (distance) P-C4' energy: -25.054 flat angles C4'-P-C4' energy: -17.930 flat angles P-C4'-P energy: -12.436 tors. eta vs tors. theta energy: -11.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -155.540721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.540721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.540721 (E_RNA) where: Base-Base interactions energy: -71.259 where: short stacking energy: -59.508 Base-Backbone interact. energy: -0.675 local terms energy: -83.607361 where: bonds (distance) C4'-P energy: -21.037 bonds (distance) P-C4' energy: -21.361 flat angles C4'-P-C4' energy: -17.998 flat angles P-C4'-P energy: -14.102 tors. eta vs tors. theta energy: -9.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -178.383422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.383422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.383422 (E_RNA) where: Base-Base interactions energy: -81.656 where: short stacking energy: -55.302 Base-Backbone interact. energy: -1.142 local terms energy: -95.585612 where: bonds (distance) C4'-P energy: -21.081 bonds (distance) P-C4' energy: -25.069 flat angles C4'-P-C4' energy: -23.162 flat angles P-C4'-P energy: -15.128 tors. eta vs tors. theta energy: -11.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -135.083904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.083904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.083904 (E_RNA) where: Base-Base interactions energy: -59.915 where: short stacking energy: -40.989 Base-Backbone interact. energy: 3.400 local terms energy: -78.568928 where: bonds (distance) C4'-P energy: -20.636 bonds (distance) P-C4' energy: -21.791 flat angles C4'-P-C4' energy: -23.803 flat angles P-C4'-P energy: -11.164 tors. eta vs tors. theta energy: -1.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -128.569012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.569012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.569012 (E_RNA) where: Base-Base interactions energy: -50.932 where: short stacking energy: -49.513 Base-Backbone interact. energy: -0.310 local terms energy: -77.326778 where: bonds (distance) C4'-P energy: -5.572 bonds (distance) P-C4' energy: -25.293 flat angles C4'-P-C4' energy: -21.397 flat angles P-C4'-P energy: -13.507 tors. eta vs tors. theta energy: -11.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -120.911595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.911595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.911595 (E_RNA) where: Base-Base interactions energy: -56.102 where: short stacking energy: -35.137 Base-Backbone interact. energy: -0.065 local terms energy: -64.743878 where: bonds (distance) C4'-P energy: -12.942 bonds (distance) P-C4' energy: -14.643 flat angles C4'-P-C4' energy: -10.908 flat angles P-C4'-P energy: -18.715 tors. eta vs tors. theta energy: -7.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -389.039774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.039774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.039774 (E_RNA) where: Base-Base interactions energy: -256.955 where: short stacking energy: -119.433 Base-Backbone interact. energy: -0.631 local terms energy: -131.454143 where: bonds (distance) C4'-P energy: -23.453 bonds (distance) P-C4' energy: -22.270 flat angles C4'-P-C4' energy: -26.947 flat angles P-C4'-P energy: -19.941 tors. eta vs tors. theta energy: -38.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -352.769863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.769863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.769863 (E_RNA) where: Base-Base interactions energy: -241.004 where: short stacking energy: -101.705 Base-Backbone interact. energy: -0.239 local terms energy: -111.526603 where: bonds (distance) C4'-P energy: -21.526 bonds (distance) P-C4' energy: -23.067 flat angles C4'-P-C4' energy: -20.358 flat angles P-C4'-P energy: -15.943 tors. eta vs tors. theta energy: -30.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -352.659621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.659621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.659621 (E_RNA) where: Base-Base interactions energy: -241.599 where: short stacking energy: -102.673 Base-Backbone interact. energy: -0.447 local terms energy: -110.614170 where: bonds (distance) C4'-P energy: -20.655 bonds (distance) P-C4' energy: -22.798 flat angles C4'-P-C4' energy: -23.371 flat angles P-C4'-P energy: -15.318 tors. eta vs tors. theta energy: -28.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -253.341710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.341710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.341710 (E_RNA) where: Base-Base interactions energy: -152.497 where: short stacking energy: -74.480 Base-Backbone interact. energy: 0.238 local terms energy: -101.083365 where: bonds (distance) C4'-P energy: -19.500 bonds (distance) P-C4' energy: -24.649 flat angles C4'-P-C4' energy: -21.892 flat angles P-C4'-P energy: -13.655 tors. eta vs tors. theta energy: -21.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -185.077949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.077949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.077949 (E_RNA) where: Base-Base interactions energy: -100.335 where: short stacking energy: -66.022 Base-Backbone interact. energy: -0.137 local terms energy: -84.605156 where: bonds (distance) C4'-P energy: -17.030 bonds (distance) P-C4' energy: -21.755 flat angles C4'-P-C4' energy: -15.677 flat angles P-C4'-P energy: -19.352 tors. eta vs tors. theta energy: -10.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -144.704412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.704412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.704412 (E_RNA) where: Base-Base interactions energy: -55.657 where: short stacking energy: -40.091 Base-Backbone interact. energy: -0.156 local terms energy: -88.891278 where: bonds (distance) C4'-P energy: -21.390 bonds (distance) P-C4' energy: -24.595 flat angles C4'-P-C4' energy: -25.087 flat angles P-C4'-P energy: -11.467 tors. eta vs tors. theta energy: -6.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -172.336822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.336822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.336822 (E_RNA) where: Base-Base interactions energy: -86.964 where: short stacking energy: -51.235 Base-Backbone interact. energy: -0.190 local terms energy: -85.182777 where: bonds (distance) C4'-P energy: -18.107 bonds (distance) P-C4' energy: -23.220 flat angles C4'-P-C4' energy: -19.320 flat angles P-C4'-P energy: -12.120 tors. eta vs tors. theta energy: -12.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -143.105390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.105390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.105390 (E_RNA) where: Base-Base interactions energy: -67.909 where: short stacking energy: -43.643 Base-Backbone interact. energy: 0.126 local terms energy: -75.322773 where: bonds (distance) C4'-P energy: -17.044 bonds (distance) P-C4' energy: -25.216 flat angles C4'-P-C4' energy: -21.744 flat angles P-C4'-P energy: -7.042 tors. eta vs tors. theta energy: -4.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -123.240714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.240714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.240714 (E_RNA) where: Base-Base interactions energy: -47.603 where: short stacking energy: -47.603 Base-Backbone interact. energy: -0.349 local terms energy: -75.288867 where: bonds (distance) C4'-P energy: -16.559 bonds (distance) P-C4' energy: -24.094 flat angles C4'-P-C4' energy: -21.213 flat angles P-C4'-P energy: -9.223 tors. eta vs tors. theta energy: -4.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -114.230485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.230485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.230485 (E_RNA) where: Base-Base interactions energy: -38.656 where: short stacking energy: -38.122 Base-Backbone interact. energy: -0.743 local terms energy: -74.831090 where: bonds (distance) C4'-P energy: -19.719 bonds (distance) P-C4' energy: -19.980 flat angles C4'-P-C4' energy: -15.923 flat angles P-C4'-P energy: -10.935 tors. eta vs tors. theta energy: -8.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -398.922862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.922862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.922862 (E_RNA) where: Base-Base interactions energy: -271.245 where: short stacking energy: -125.300 Base-Backbone interact. energy: -0.029 local terms energy: -127.648913 where: bonds (distance) C4'-P energy: -23.939 bonds (distance) P-C4' energy: -21.198 flat angles C4'-P-C4' energy: -24.622 flat angles P-C4'-P energy: -19.322 tors. eta vs tors. theta energy: -38.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -370.944842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.944842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.944842 (E_RNA) where: Base-Base interactions energy: -253.764 where: short stacking energy: -103.198 Base-Backbone interact. energy: -0.094 local terms energy: -117.087466 where: bonds (distance) C4'-P energy: -18.785 bonds (distance) P-C4' energy: -24.705 flat angles C4'-P-C4' energy: -25.715 flat angles P-C4'-P energy: -20.408 tors. eta vs tors. theta energy: -27.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -350.319058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.319058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.319058 (E_RNA) where: Base-Base interactions energy: -237.737 where: short stacking energy: -88.595 Base-Backbone interact. energy: -1.087 local terms energy: -111.494841 where: bonds (distance) C4'-P energy: -22.160 bonds (distance) P-C4' energy: -25.704 flat angles C4'-P-C4' energy: -22.486 flat angles P-C4'-P energy: -15.034 tors. eta vs tors. theta energy: -26.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -257.131970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.131970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.131970 (E_RNA) where: Base-Base interactions energy: -153.190 where: short stacking energy: -76.954 Base-Backbone interact. energy: -0.288 local terms energy: -103.654100 where: bonds (distance) C4'-P energy: -23.838 bonds (distance) P-C4' energy: -23.278 flat angles C4'-P-C4' energy: -21.124 flat angles P-C4'-P energy: -11.108 tors. eta vs tors. theta energy: -24.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -205.068998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.068998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.068998 (E_RNA) where: Base-Base interactions energy: -108.677 where: short stacking energy: -66.280 Base-Backbone interact. energy: -0.120 local terms energy: -96.272095 where: bonds (distance) C4'-P energy: -19.105 bonds (distance) P-C4' energy: -21.506 flat angles C4'-P-C4' energy: -24.338 flat angles P-C4'-P energy: -15.591 tors. eta vs tors. theta energy: -15.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -171.333938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.333938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.333938 (E_RNA) where: Base-Base interactions energy: -83.532 where: short stacking energy: -35.146 Base-Backbone interact. energy: -0.313 local terms energy: -87.489458 where: bonds (distance) C4'-P energy: -21.871 bonds (distance) P-C4' energy: -25.761 flat angles C4'-P-C4' energy: -19.901 flat angles P-C4'-P energy: -16.467 tors. eta vs tors. theta energy: -3.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -129.682411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.682411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.682411 (E_RNA) where: Base-Base interactions energy: -50.660 where: short stacking energy: -50.660 Base-Backbone interact. energy: 1.278 local terms energy: -80.299882 where: bonds (distance) C4'-P energy: -21.696 bonds (distance) P-C4' energy: -22.172 flat angles C4'-P-C4' energy: -23.266 flat angles P-C4'-P energy: -9.522 tors. eta vs tors. theta energy: -3.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -134.573473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.573473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.573473 (E_RNA) where: Base-Base interactions energy: -46.164 where: short stacking energy: -42.246 Base-Backbone interact. energy: -0.187 local terms energy: -88.222513 where: bonds (distance) C4'-P energy: -24.433 bonds (distance) P-C4' energy: -22.681 flat angles C4'-P-C4' energy: -19.154 flat angles P-C4'-P energy: -17.364 tors. eta vs tors. theta energy: -4.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -111.028724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.028724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.028724 (E_RNA) where: Base-Base interactions energy: -42.025 where: short stacking energy: -31.263 Base-Backbone interact. energy: -0.247 local terms energy: -68.756085 where: bonds (distance) C4'-P energy: -17.742 bonds (distance) P-C4' energy: -23.593 flat angles C4'-P-C4' energy: -16.481 flat angles P-C4'-P energy: -10.844 tors. eta vs tors. theta energy: -0.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -106.944724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.944724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.944724 (E_RNA) where: Base-Base interactions energy: -36.009 where: short stacking energy: -33.860 Base-Backbone interact. energy: -0.473 local terms energy: -70.462648 where: bonds (distance) C4'-P energy: -20.459 bonds (distance) P-C4' energy: -21.320 flat angles C4'-P-C4' energy: -13.989 flat angles P-C4'-P energy: -13.408 tors. eta vs tors. theta energy: -1.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -389.433012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.433012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.433012 (E_RNA) where: Base-Base interactions energy: -263.841 where: short stacking energy: -119.558 Base-Backbone interact. energy: -0.007 local terms energy: -125.585363 where: bonds (distance) C4'-P energy: -22.826 bonds (distance) P-C4' energy: -22.624 flat angles C4'-P-C4' energy: -26.641 flat angles P-C4'-P energy: -20.957 tors. eta vs tors. theta energy: -32.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -378.650358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.650358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.650358 (E_RNA) where: Base-Base interactions energy: -254.297 where: short stacking energy: -120.068 Base-Backbone interact. energy: -0.550 local terms energy: -123.803153 where: bonds (distance) C4'-P energy: -21.529 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -27.064 flat angles P-C4'-P energy: -15.900 tors. eta vs tors. theta energy: -36.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -341.788488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.788488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.788488 (E_RNA) where: Base-Base interactions energy: -228.780 where: short stacking energy: -99.479 Base-Backbone interact. energy: -0.577 local terms energy: -112.431234 where: bonds (distance) C4'-P energy: -21.013 bonds (distance) P-C4' energy: -21.675 flat angles C4'-P-C4' energy: -25.331 flat angles P-C4'-P energy: -13.741 tors. eta vs tors. theta energy: -30.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -239.850555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.850555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.850555 (E_RNA) where: Base-Base interactions energy: -147.020 where: short stacking energy: -79.624 Base-Backbone interact. energy: -1.439 local terms energy: -91.392325 where: bonds (distance) C4'-P energy: -11.421 bonds (distance) P-C4' energy: -15.834 flat angles C4'-P-C4' energy: -22.671 flat angles P-C4'-P energy: -16.359 tors. eta vs tors. theta energy: -25.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -206.850740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.850740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.850740 (E_RNA) where: Base-Base interactions energy: -109.688 where: short stacking energy: -71.598 Base-Backbone interact. energy: 1.533 local terms energy: -98.696419 where: bonds (distance) C4'-P energy: -22.474 bonds (distance) P-C4' energy: -24.219 flat angles C4'-P-C4' energy: -17.691 flat angles P-C4'-P energy: -15.515 tors. eta vs tors. theta energy: -18.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -182.014685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.014685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.014685 (E_RNA) where: Base-Base interactions energy: -109.429 where: short stacking energy: -51.714 Base-Backbone interact. energy: -0.314 local terms energy: -72.270881 where: bonds (distance) C4'-P energy: -16.884 bonds (distance) P-C4' energy: -21.410 flat angles C4'-P-C4' energy: -17.649 flat angles P-C4'-P energy: -12.261 tors. eta vs tors. theta energy: -4.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -126.997516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.997516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.997516 (E_RNA) where: Base-Base interactions energy: -53.813 where: short stacking energy: -33.045 Base-Backbone interact. energy: -1.499 local terms energy: -71.685759 where: bonds (distance) C4'-P energy: -22.525 bonds (distance) P-C4' energy: -24.651 flat angles C4'-P-C4' energy: -15.771 flat angles P-C4'-P energy: -9.759 tors. eta vs tors. theta energy: 1.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -179.419980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.419980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.419980 (E_RNA) where: Base-Base interactions energy: -99.067 where: short stacking energy: -58.641 Base-Backbone interact. energy: -0.316 local terms energy: -80.036802 where: bonds (distance) C4'-P energy: -17.040 bonds (distance) P-C4' energy: -23.003 flat angles C4'-P-C4' energy: -19.591 flat angles P-C4'-P energy: -7.228 tors. eta vs tors. theta energy: -13.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -119.550219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.550219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.550219 (E_RNA) where: Base-Base interactions energy: -53.416 where: short stacking energy: -36.365 Base-Backbone interact. energy: -0.495 local terms energy: -65.639279 where: bonds (distance) C4'-P energy: -19.834 bonds (distance) P-C4' energy: -18.512 flat angles C4'-P-C4' energy: -17.839 flat angles P-C4'-P energy: -5.227 tors. eta vs tors. theta energy: -4.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -108.630943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.630943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.630943 (E_RNA) where: Base-Base interactions energy: -38.176 where: short stacking energy: -34.837 Base-Backbone interact. energy: -0.466 local terms energy: -69.988915 where: bonds (distance) C4'-P energy: -23.136 bonds (distance) P-C4' energy: -16.868 flat angles C4'-P-C4' energy: -17.467 flat angles P-C4'-P energy: -8.681 tors. eta vs tors. theta energy: -3.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -394.675265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.675265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.675265 (E_RNA) where: Base-Base interactions energy: -269.177 where: short stacking energy: -113.823 Base-Backbone interact. energy: -0.503 local terms energy: -124.995916 where: bonds (distance) C4'-P energy: -20.724 bonds (distance) P-C4' energy: -23.072 flat angles C4'-P-C4' energy: -27.113 flat angles P-C4'-P energy: -19.151 tors. eta vs tors. theta energy: -34.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -383.760285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.760285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.760285 (E_RNA) where: Base-Base interactions energy: -257.310 where: short stacking energy: -114.717 Base-Backbone interact. energy: -0.009 local terms energy: -126.441514 where: bonds (distance) C4'-P energy: -20.889 bonds (distance) P-C4' energy: -25.762 flat angles C4'-P-C4' energy: -26.366 flat angles P-C4'-P energy: -16.778 tors. eta vs tors. theta energy: -36.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -343.638836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.638836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.638836 (E_RNA) where: Base-Base interactions energy: -224.581 where: short stacking energy: -99.005 Base-Backbone interact. energy: -0.248 local terms energy: -118.809497 where: bonds (distance) C4'-P energy: -25.834 bonds (distance) P-C4' energy: -22.789 flat angles C4'-P-C4' energy: -20.756 flat angles P-C4'-P energy: -15.469 tors. eta vs tors. theta energy: -33.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -235.730225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.730225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.730225 (E_RNA) where: Base-Base interactions energy: -136.070 where: short stacking energy: -65.283 Base-Backbone interact. energy: 0.052 local terms energy: -99.712231 where: bonds (distance) C4'-P energy: -24.023 bonds (distance) P-C4' energy: -20.176 flat angles C4'-P-C4' energy: -23.822 flat angles P-C4'-P energy: -16.330 tors. eta vs tors. theta energy: -15.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -231.636104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.636104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.636104 (E_RNA) where: Base-Base interactions energy: -141.493 where: short stacking energy: -64.123 Base-Backbone interact. energy: -0.850 local terms energy: -89.292878 where: bonds (distance) C4'-P energy: -19.332 bonds (distance) P-C4' energy: -20.083 flat angles C4'-P-C4' energy: -21.820 flat angles P-C4'-P energy: -13.406 tors. eta vs tors. theta energy: -14.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -188.016929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.016929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.016929 (E_RNA) where: Base-Base interactions energy: -109.901 where: short stacking energy: -53.597 Base-Backbone interact. energy: -0.485 local terms energy: -77.630562 where: bonds (distance) C4'-P energy: -16.276 bonds (distance) P-C4' energy: -21.630 flat angles C4'-P-C4' energy: -15.572 flat angles P-C4'-P energy: -13.918 tors. eta vs tors. theta energy: -10.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -124.349865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.349865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.349865 (E_RNA) where: Base-Base interactions energy: -42.620 where: short stacking energy: -41.687 Base-Backbone interact. energy: -0.579 local terms energy: -81.150659 where: bonds (distance) C4'-P energy: -21.244 bonds (distance) P-C4' energy: -23.883 flat angles C4'-P-C4' energy: -19.850 flat angles P-C4'-P energy: -12.423 tors. eta vs tors. theta energy: -3.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -125.922345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.922345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.922345 (E_RNA) where: Base-Base interactions energy: -51.414 where: short stacking energy: -41.474 Base-Backbone interact. energy: 0.130 local terms energy: -74.637842 where: bonds (distance) C4'-P energy: -20.426 bonds (distance) P-C4' energy: -24.244 flat angles C4'-P-C4' energy: -20.368 flat angles P-C4'-P energy: -6.083 tors. eta vs tors. theta energy: -3.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -183.560663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.560663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.560663 (E_RNA) where: Base-Base interactions energy: -98.415 where: short stacking energy: -54.818 Base-Backbone interact. energy: -0.882 local terms energy: -84.263912 where: bonds (distance) C4'-P energy: -21.277 bonds (distance) P-C4' energy: -22.653 flat angles C4'-P-C4' energy: -21.927 flat angles P-C4'-P energy: -11.092 tors. eta vs tors. theta energy: -7.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -105.032019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.032019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.032019 (E_RNA) where: Base-Base interactions energy: -37.668 where: short stacking energy: -30.400 Base-Backbone interact. energy: -0.364 local terms energy: -67.000269 where: bonds (distance) C4'-P energy: -24.714 bonds (distance) P-C4' energy: -17.947 flat angles C4'-P-C4' energy: -11.931 flat angles P-C4'-P energy: -16.092 tors. eta vs tors. theta energy: 3.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -391.088555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.088555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.088555 (E_RNA) where: Base-Base interactions energy: -260.229 where: short stacking energy: -112.953 Base-Backbone interact. energy: -0.162 local terms energy: -130.697125 where: bonds (distance) C4'-P energy: -25.483 bonds (distance) P-C4' energy: -21.841 flat angles C4'-P-C4' energy: -25.149 flat angles P-C4'-P energy: -21.773 tors. eta vs tors. theta energy: -36.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -380.774428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.774428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.774428 (E_RNA) where: Base-Base interactions energy: -261.362 where: short stacking energy: -114.866 Base-Backbone interact. energy: -0.065 local terms energy: -119.347485 where: bonds (distance) C4'-P energy: -21.399 bonds (distance) P-C4' energy: -20.399 flat angles C4'-P-C4' energy: -26.895 flat angles P-C4'-P energy: -18.092 tors. eta vs tors. theta energy: -32.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -343.025117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.025117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.025117 (E_RNA) where: Base-Base interactions energy: -226.883 where: short stacking energy: -92.347 Base-Backbone interact. energy: -0.067 local terms energy: -116.075037 where: bonds (distance) C4'-P energy: -25.019 bonds (distance) P-C4' energy: -21.110 flat angles C4'-P-C4' energy: -21.279 flat angles P-C4'-P energy: -19.888 tors. eta vs tors. theta energy: -28.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -212.564868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.564868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.564868 (E_RNA) where: Base-Base interactions energy: -112.445 where: short stacking energy: -69.835 Base-Backbone interact. energy: -0.186 local terms energy: -99.933586 where: bonds (distance) C4'-P energy: -23.753 bonds (distance) P-C4' energy: -20.627 flat angles C4'-P-C4' energy: -23.688 flat angles P-C4'-P energy: -16.575 tors. eta vs tors. theta energy: -15.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -224.344177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.344177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.344177 (E_RNA) where: Base-Base interactions energy: -129.081 where: short stacking energy: -68.602 Base-Backbone interact. energy: -0.224 local terms energy: -95.038454 where: bonds (distance) C4'-P energy: -23.460 bonds (distance) P-C4' energy: -18.854 flat angles C4'-P-C4' energy: -21.343 flat angles P-C4'-P energy: -12.735 tors. eta vs tors. theta energy: -18.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -188.650708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.650708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.650708 (E_RNA) where: Base-Base interactions energy: -109.056 where: short stacking energy: -54.436 Base-Backbone interact. energy: -0.201 local terms energy: -79.394447 where: bonds (distance) C4'-P energy: -19.132 bonds (distance) P-C4' energy: -21.876 flat angles C4'-P-C4' energy: -20.004 flat angles P-C4'-P energy: -9.720 tors. eta vs tors. theta energy: -8.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -126.095625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.095625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.095625 (E_RNA) where: Base-Base interactions energy: -53.958 where: short stacking energy: -43.231 Base-Backbone interact. energy: 1.463 local terms energy: -73.600966 where: bonds (distance) C4'-P energy: -20.156 bonds (distance) P-C4' energy: -15.778 flat angles C4'-P-C4' energy: -18.578 flat angles P-C4'-P energy: -14.838 tors. eta vs tors. theta energy: -4.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -129.615517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.615517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.615517 (E_RNA) where: Base-Base interactions energy: -51.921 where: short stacking energy: -35.099 Base-Backbone interact. energy: 2.180 local terms energy: -79.874534 where: bonds (distance) C4'-P energy: -22.620 bonds (distance) P-C4' energy: -24.198 flat angles C4'-P-C4' energy: -18.077 flat angles P-C4'-P energy: -14.904 tors. eta vs tors. theta energy: -0.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -147.010166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.010166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.010166 (E_RNA) where: Base-Base interactions energy: -80.326 where: short stacking energy: -45.870 Base-Backbone interact. energy: 1.312 local terms energy: -67.995868 where: bonds (distance) C4'-P energy: -12.809 bonds (distance) P-C4' energy: -20.763 flat angles C4'-P-C4' energy: -21.176 flat angles P-C4'-P energy: -10.029 tors. eta vs tors. theta energy: -3.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -112.060621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.060621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.060621 (E_RNA) where: Base-Base interactions energy: -48.665 where: short stacking energy: -33.314 Base-Backbone interact. energy: 1.268 local terms energy: -64.664119 where: bonds (distance) C4'-P energy: -21.083 bonds (distance) P-C4' energy: -18.959 flat angles C4'-P-C4' energy: -9.349 flat angles P-C4'-P energy: -12.736 tors. eta vs tors. theta energy: -2.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -389.449550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.449550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.449550 (E_RNA) where: Base-Base interactions energy: -263.776 where: short stacking energy: -127.073 Base-Backbone interact. energy: -0.104 local terms energy: -125.568796 where: bonds (distance) C4'-P energy: -21.929 bonds (distance) P-C4' energy: -25.141 flat angles C4'-P-C4' energy: -24.667 flat angles P-C4'-P energy: -18.634 tors. eta vs tors. theta energy: -35.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -343.147071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.147071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.147071 (E_RNA) where: Base-Base interactions energy: -226.024 where: short stacking energy: -98.986 Base-Backbone interact. energy: -0.409 local terms energy: -116.713743 where: bonds (distance) C4'-P energy: -21.961 bonds (distance) P-C4' energy: -21.139 flat angles C4'-P-C4' energy: -26.359 flat angles P-C4'-P energy: -14.980 tors. eta vs tors. theta energy: -32.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -375.897959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.897959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.897959 (E_RNA) where: Base-Base interactions energy: -255.797 where: short stacking energy: -122.341 Base-Backbone interact. energy: -0.098 local terms energy: -120.003074 where: bonds (distance) C4'-P energy: -23.296 bonds (distance) P-C4' energy: -23.115 flat angles C4'-P-C4' energy: -26.829 flat angles P-C4'-P energy: -10.758 tors. eta vs tors. theta energy: -36.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -232.119374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.119374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.119374 (E_RNA) where: Base-Base interactions energy: -139.364 where: short stacking energy: -74.572 Base-Backbone interact. energy: 1.817 local terms energy: -94.572247 where: bonds (distance) C4'-P energy: -21.492 bonds (distance) P-C4' energy: -23.390 flat angles C4'-P-C4' energy: -25.910 flat angles P-C4'-P energy: -7.596 tors. eta vs tors. theta energy: -16.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -209.173149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.173149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.173149 (E_RNA) where: Base-Base interactions energy: -114.657 where: short stacking energy: -74.174 Base-Backbone interact. energy: -0.193 local terms energy: -94.323170 where: bonds (distance) C4'-P energy: -18.755 bonds (distance) P-C4' energy: -20.543 flat angles C4'-P-C4' energy: -19.857 flat angles P-C4'-P energy: -11.091 tors. eta vs tors. theta energy: -24.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -213.313368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.313368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.313368 (E_RNA) where: Base-Base interactions energy: -129.743 where: short stacking energy: -64.386 Base-Backbone interact. energy: -0.177 local terms energy: -83.393616 where: bonds (distance) C4'-P energy: -21.453 bonds (distance) P-C4' energy: -20.146 flat angles C4'-P-C4' energy: -23.558 flat angles P-C4'-P energy: -9.147 tors. eta vs tors. theta energy: -9.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -151.684144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.684144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.684144 (E_RNA) where: Base-Base interactions energy: -78.226 where: short stacking energy: -39.349 Base-Backbone interact. energy: -0.386 local terms energy: -73.071985 where: bonds (distance) C4'-P energy: -23.630 bonds (distance) P-C4' energy: -21.109 flat angles C4'-P-C4' energy: -9.546 flat angles P-C4'-P energy: -16.009 tors. eta vs tors. theta energy: -2.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -113.905234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.905234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.905234 (E_RNA) where: Base-Base interactions energy: -41.271 where: short stacking energy: -40.966 Base-Backbone interact. energy: 0.184 local terms energy: -72.818373 where: bonds (distance) C4'-P energy: -19.113 bonds (distance) P-C4' energy: -21.711 flat angles C4'-P-C4' energy: -18.295 flat angles P-C4'-P energy: -14.833 tors. eta vs tors. theta energy: 1.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -133.856059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.856059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.856059 (E_RNA) where: Base-Base interactions energy: -60.522 where: short stacking energy: -49.694 Base-Backbone interact. energy: -0.116 local terms energy: -73.217269 where: bonds (distance) C4'-P energy: -18.185 bonds (distance) P-C4' energy: -17.093 flat angles C4'-P-C4' energy: -14.284 flat angles P-C4'-P energy: -15.211 tors. eta vs tors. theta energy: -8.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -127.330113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.330113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.330113 (E_RNA) where: Base-Base interactions energy: -53.225 where: short stacking energy: -44.623 Base-Backbone interact. energy: -0.774 local terms energy: -73.331640 where: bonds (distance) C4'-P energy: -22.436 bonds (distance) P-C4' energy: -21.636 flat angles C4'-P-C4' energy: -20.724 flat angles P-C4'-P energy: -7.369 tors. eta vs tors. theta energy: -1.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -382.427491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.427491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.427491 (E_RNA) where: Base-Base interactions energy: -253.409 where: short stacking energy: -111.123 Base-Backbone interact. energy: -0.218 local terms energy: -128.800259 where: bonds (distance) C4'-P energy: -22.858 bonds (distance) P-C4' energy: -25.219 flat angles C4'-P-C4' energy: -24.327 flat angles P-C4'-P energy: -19.351 tors. eta vs tors. theta energy: -37.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -367.261568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.261568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.261568 (E_RNA) where: Base-Base interactions energy: -247.474 where: short stacking energy: -107.898 Base-Backbone interact. energy: -0.004 local terms energy: -119.782685 where: bonds (distance) C4'-P energy: -19.458 bonds (distance) P-C4' energy: -20.321 flat angles C4'-P-C4' energy: -24.759 flat angles P-C4'-P energy: -19.639 tors. eta vs tors. theta energy: -35.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -369.703960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.703960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.703960 (E_RNA) where: Base-Base interactions energy: -248.622 where: short stacking energy: -108.676 Base-Backbone interact. energy: -0.272 local terms energy: -120.809237 where: bonds (distance) C4'-P energy: -19.830 bonds (distance) P-C4' energy: -25.623 flat angles C4'-P-C4' energy: -24.782 flat angles P-C4'-P energy: -18.300 tors. eta vs tors. theta energy: -32.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -233.405014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.405014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.405014 (E_RNA) where: Base-Base interactions energy: -135.754 where: short stacking energy: -83.323 Base-Backbone interact. energy: 0.981 local terms energy: -98.631330 where: bonds (distance) C4'-P energy: -19.019 bonds (distance) P-C4' energy: -19.743 flat angles C4'-P-C4' energy: -23.462 flat angles P-C4'-P energy: -17.812 tors. eta vs tors. theta energy: -18.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -196.169007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.169007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.169007 (E_RNA) where: Base-Base interactions energy: -104.408 where: short stacking energy: -66.815 Base-Backbone interact. energy: -0.199 local terms energy: -91.562162 where: bonds (distance) C4'-P energy: -18.041 bonds (distance) P-C4' energy: -23.845 flat angles C4'-P-C4' energy: -25.499 flat angles P-C4'-P energy: -14.696 tors. eta vs tors. theta energy: -9.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -191.615104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.615104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.615104 (E_RNA) where: Base-Base interactions energy: -101.035 where: short stacking energy: -57.207 Base-Backbone interact. energy: -0.408 local terms energy: -90.171923 where: bonds (distance) C4'-P energy: -16.496 bonds (distance) P-C4' energy: -25.092 flat angles C4'-P-C4' energy: -20.720 flat angles P-C4'-P energy: -15.021 tors. eta vs tors. theta energy: -12.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -155.717115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.717115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.717115 (E_RNA) where: Base-Base interactions energy: -66.256 where: short stacking energy: -60.951 Base-Backbone interact. energy: -0.536 local terms energy: -88.924968 where: bonds (distance) C4'-P energy: -21.279 bonds (distance) P-C4' energy: -22.915 flat angles C4'-P-C4' energy: -13.521 flat angles P-C4'-P energy: -16.127 tors. eta vs tors. theta energy: -15.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -130.187373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.187373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.187373 (E_RNA) where: Base-Base interactions energy: -52.078 where: short stacking energy: -49.938 Base-Backbone interact. energy: 0.508 local terms energy: -78.617260 where: bonds (distance) C4'-P energy: -14.117 bonds (distance) P-C4' energy: -21.897 flat angles C4'-P-C4' energy: -21.302 flat angles P-C4'-P energy: -10.820 tors. eta vs tors. theta energy: -10.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -112.262202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.262202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.262202 (E_RNA) where: Base-Base interactions energy: -45.616 where: short stacking energy: -37.831 Base-Backbone interact. energy: 0.008 local terms energy: -66.654161 where: bonds (distance) C4'-P energy: -20.786 bonds (distance) P-C4' energy: -15.827 flat angles C4'-P-C4' energy: -14.756 flat angles P-C4'-P energy: -14.185 tors. eta vs tors. theta energy: -1.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -105.699749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.699749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.699749 (E_RNA) where: Base-Base interactions energy: -30.168 where: short stacking energy: -29.036 Base-Backbone interact. energy: -0.914 local terms energy: -74.617918 where: bonds (distance) C4'-P energy: -20.975 bonds (distance) P-C4' energy: -23.622 flat angles C4'-P-C4' energy: -21.200 flat angles P-C4'-P energy: -12.105 tors. eta vs tors. theta energy: 3.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -385.612667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.612667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.612667 (E_RNA) where: Base-Base interactions energy: -262.569 where: short stacking energy: -114.726 Base-Backbone interact. energy: -0.103 local terms energy: -122.940875 where: bonds (distance) C4'-P energy: -17.622 bonds (distance) P-C4' energy: -22.803 flat angles C4'-P-C4' energy: -26.500 flat angles P-C4'-P energy: -20.303 tors. eta vs tors. theta energy: -35.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -386.530777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.530777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.530777 (E_RNA) where: Base-Base interactions energy: -259.872 where: short stacking energy: -113.788 Base-Backbone interact. energy: -0.174 local terms energy: -126.485166 where: bonds (distance) C4'-P energy: -22.208 bonds (distance) P-C4' energy: -25.153 flat angles C4'-P-C4' energy: -21.906 flat angles P-C4'-P energy: -20.749 tors. eta vs tors. theta energy: -36.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -358.787414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.787414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.787414 (E_RNA) where: Base-Base interactions energy: -242.680 where: short stacking energy: -104.122 Base-Backbone interact. energy: -0.578 local terms energy: -115.529953 where: bonds (distance) C4'-P energy: -16.024 bonds (distance) P-C4' energy: -24.352 flat angles C4'-P-C4' energy: -22.246 flat angles P-C4'-P energy: -17.631 tors. eta vs tors. theta energy: -35.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -246.484800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.484800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.484800 (E_RNA) where: Base-Base interactions energy: -148.143 where: short stacking energy: -88.139 Base-Backbone interact. energy: -0.585 local terms energy: -97.757105 where: bonds (distance) C4'-P energy: -15.407 bonds (distance) P-C4' energy: -24.610 flat angles C4'-P-C4' energy: -24.084 flat angles P-C4'-P energy: -15.073 tors. eta vs tors. theta energy: -18.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -199.506606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.506606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.506606 (E_RNA) where: Base-Base interactions energy: -106.301 where: short stacking energy: -70.211 Base-Backbone interact. energy: -0.779 local terms energy: -92.426470 where: bonds (distance) C4'-P energy: -18.854 bonds (distance) P-C4' energy: -19.563 flat angles C4'-P-C4' energy: -21.793 flat angles P-C4'-P energy: -14.445 tors. eta vs tors. theta energy: -17.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -177.057576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.057576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.057576 (E_RNA) where: Base-Base interactions energy: -90.531 where: short stacking energy: -53.010 Base-Backbone interact. energy: -1.379 local terms energy: -85.146956 where: bonds (distance) C4'-P energy: -21.995 bonds (distance) P-C4' energy: -13.509 flat angles C4'-P-C4' energy: -22.844 flat angles P-C4'-P energy: -17.144 tors. eta vs tors. theta energy: -9.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -180.302281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.302281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.302281 (E_RNA) where: Base-Base interactions energy: -101.346 where: short stacking energy: -58.882 Base-Backbone interact. energy: -1.997 local terms energy: -76.958972 where: bonds (distance) C4'-P energy: -19.245 bonds (distance) P-C4' energy: -20.315 flat angles C4'-P-C4' energy: -19.551 flat angles P-C4'-P energy: -9.955 tors. eta vs tors. theta energy: -7.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -115.203719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.203719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.203719 (E_RNA) where: Base-Base interactions energy: -42.847 where: short stacking energy: -33.491 Base-Backbone interact. energy: -0.839 local terms energy: -71.517515 where: bonds (distance) C4'-P energy: -23.533 bonds (distance) P-C4' energy: -20.110 flat angles C4'-P-C4' energy: -19.060 flat angles P-C4'-P energy: -12.939 tors. eta vs tors. theta energy: 4.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -114.747567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.747567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.747567 (E_RNA) where: Base-Base interactions energy: -33.869 where: short stacking energy: -19.782 Base-Backbone interact. energy: -0.550 local terms energy: -80.328822 where: bonds (distance) C4'-P energy: -21.588 bonds (distance) P-C4' energy: -24.192 flat angles C4'-P-C4' energy: -16.756 flat angles P-C4'-P energy: -12.020 tors. eta vs tors. theta energy: -5.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -102.994094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.994094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.994094 (E_RNA) where: Base-Base interactions energy: -42.954 where: short stacking energy: -38.987 Base-Backbone interact. energy: 0.596 local terms energy: -60.635698 where: bonds (distance) C4'-P energy: -15.382 bonds (distance) P-C4' energy: -20.187 flat angles C4'-P-C4' energy: -11.645 flat angles P-C4'-P energy: -8.458 tors. eta vs tors. theta energy: -4.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -386.250843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.250843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.250843 (E_RNA) where: Base-Base interactions energy: -257.617 where: short stacking energy: -116.108 Base-Backbone interact. energy: -0.005 local terms energy: -128.628896 where: bonds (distance) C4'-P energy: -22.013 bonds (distance) P-C4' energy: -25.790 flat angles C4'-P-C4' energy: -24.623 flat angles P-C4'-P energy: -19.612 tors. eta vs tors. theta energy: -36.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -391.135590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.135590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.135590 (E_RNA) where: Base-Base interactions energy: -266.334 where: short stacking energy: -114.951 Base-Backbone interact. energy: -0.443 local terms energy: -124.359360 where: bonds (distance) C4'-P energy: -17.413 bonds (distance) P-C4' energy: -26.254 flat angles C4'-P-C4' energy: -26.738 flat angles P-C4'-P energy: -17.304 tors. eta vs tors. theta energy: -36.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -337.709494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.709494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.709494 (E_RNA) where: Base-Base interactions energy: -229.479 where: short stacking energy: -97.281 Base-Backbone interact. energy: -0.009 local terms energy: -108.221141 where: bonds (distance) C4'-P energy: -16.776 bonds (distance) P-C4' energy: -22.819 flat angles C4'-P-C4' energy: -26.100 flat angles P-C4'-P energy: -9.856 tors. eta vs tors. theta energy: -32.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -244.252554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.252554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.252554 (E_RNA) where: Base-Base interactions energy: -145.887 where: short stacking energy: -88.965 Base-Backbone interact. energy: -0.021 local terms energy: -98.345273 where: bonds (distance) C4'-P energy: -17.668 bonds (distance) P-C4' energy: -22.876 flat angles C4'-P-C4' energy: -25.222 flat angles P-C4'-P energy: -11.445 tors. eta vs tors. theta energy: -21.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -202.835209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.835209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.835209 (E_RNA) where: Base-Base interactions energy: -121.214 where: short stacking energy: -58.456 Base-Backbone interact. energy: 0.013 local terms energy: -81.633497 where: bonds (distance) C4'-P energy: -20.899 bonds (distance) P-C4' energy: -16.138 flat angles C4'-P-C4' energy: -19.234 flat angles P-C4'-P energy: -11.656 tors. eta vs tors. theta energy: -13.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -181.881232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.881232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.881232 (E_RNA) where: Base-Base interactions energy: -98.536 where: short stacking energy: -58.807 Base-Backbone interact. energy: -0.322 local terms energy: -83.023150 where: bonds (distance) C4'-P energy: -18.774 bonds (distance) P-C4' energy: -21.016 flat angles C4'-P-C4' energy: -19.127 flat angles P-C4'-P energy: -14.436 tors. eta vs tors. theta energy: -9.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -162.281361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.281361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.281361 (E_RNA) where: Base-Base interactions energy: -96.426 where: short stacking energy: -57.379 Base-Backbone interact. energy: -0.531 local terms energy: -65.324196 where: bonds (distance) C4'-P energy: -18.069 bonds (distance) P-C4' energy: -20.925 flat angles C4'-P-C4' energy: -7.423 flat angles P-C4'-P energy: -10.495 tors. eta vs tors. theta energy: -8.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -124.073524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.073524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.073524 (E_RNA) where: Base-Base interactions energy: -50.459 where: short stacking energy: -34.940 Base-Backbone interact. energy: 0.312 local terms energy: -73.925852 where: bonds (distance) C4'-P energy: -18.591 bonds (distance) P-C4' energy: -22.858 flat angles C4'-P-C4' energy: -22.135 flat angles P-C4'-P energy: -10.125 tors. eta vs tors. theta energy: -0.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -115.579521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.579521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.579521 (E_RNA) where: Base-Base interactions energy: -49.144 where: short stacking energy: -44.278 Base-Backbone interact. energy: -0.375 local terms energy: -66.060030 where: bonds (distance) C4'-P energy: -16.342 bonds (distance) P-C4' energy: -23.254 flat angles C4'-P-C4' energy: -18.432 flat angles P-C4'-P energy: -8.101 tors. eta vs tors. theta energy: 0.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -113.442592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.442592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.442592 (E_RNA) where: Base-Base interactions energy: -39.443 where: short stacking energy: -39.269 Base-Backbone interact. energy: -0.136 local terms energy: -73.863958 where: bonds (distance) C4'-P energy: -22.878 bonds (distance) P-C4' energy: -22.270 flat angles C4'-P-C4' energy: -16.586 flat angles P-C4'-P energy: -6.167 tors. eta vs tors. theta energy: -5.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -400.421191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.421191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.421191 (E_RNA) where: Base-Base interactions energy: -273.588 where: short stacking energy: -125.371 Base-Backbone interact. energy: -0.502 local terms energy: -126.331535 where: bonds (distance) C4'-P energy: -20.289 bonds (distance) P-C4' energy: -24.758 flat angles C4'-P-C4' energy: -26.297 flat angles P-C4'-P energy: -19.759 tors. eta vs tors. theta energy: -35.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -348.921920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.921920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.921920 (E_RNA) where: Base-Base interactions energy: -225.017 where: short stacking energy: -103.918 Base-Backbone interact. energy: -1.009 local terms energy: -122.896073 where: bonds (distance) C4'-P energy: -21.627 bonds (distance) P-C4' energy: -24.974 flat angles C4'-P-C4' energy: -26.113 flat angles P-C4'-P energy: -18.278 tors. eta vs tors. theta energy: -31.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -377.608120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.608120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.608120 (E_RNA) where: Base-Base interactions energy: -262.389 where: short stacking energy: -120.051 Base-Backbone interact. energy: -0.006 local terms energy: -115.212640 where: bonds (distance) C4'-P energy: -19.885 bonds (distance) P-C4' energy: -23.459 flat angles C4'-P-C4' energy: -21.496 flat angles P-C4'-P energy: -15.599 tors. eta vs tors. theta energy: -34.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -254.555259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.555259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.555259 (E_RNA) where: Base-Base interactions energy: -154.039 where: short stacking energy: -69.030 Base-Backbone interact. energy: -0.033 local terms energy: -100.482896 where: bonds (distance) C4'-P energy: -24.204 bonds (distance) P-C4' energy: -25.020 flat angles C4'-P-C4' energy: -21.750 flat angles P-C4'-P energy: -12.312 tors. eta vs tors. theta energy: -17.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -200.218481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.218481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.218481 (E_RNA) where: Base-Base interactions energy: -111.312 where: short stacking energy: -68.631 Base-Backbone interact. energy: 1.269 local terms energy: -90.174919 where: bonds (distance) C4'-P energy: -15.860 bonds (distance) P-C4' energy: -20.542 flat angles C4'-P-C4' energy: -25.940 flat angles P-C4'-P energy: -13.334 tors. eta vs tors. theta energy: -14.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -182.242536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.242536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.242536 (E_RNA) where: Base-Base interactions energy: -110.987 where: short stacking energy: -50.058 Base-Backbone interact. energy: -0.450 local terms energy: -70.805916 where: bonds (distance) C4'-P energy: -21.861 bonds (distance) P-C4' energy: -21.028 flat angles C4'-P-C4' energy: -15.917 flat angles P-C4'-P energy: -6.596 tors. eta vs tors. theta energy: -5.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -159.955449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.955449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.955449 (E_RNA) where: Base-Base interactions energy: -78.632 where: short stacking energy: -34.304 Base-Backbone interact. energy: -0.716 local terms energy: -80.607924 where: bonds (distance) C4'-P energy: -19.895 bonds (distance) P-C4' energy: -25.390 flat angles C4'-P-C4' energy: -17.971 flat angles P-C4'-P energy: -12.103 tors. eta vs tors. theta energy: -5.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -111.883329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.883329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.883329 (E_RNA) where: Base-Base interactions energy: -27.623 where: short stacking energy: -21.898 Base-Backbone interact. energy: -0.545 local terms energy: -83.716116 where: bonds (distance) C4'-P energy: -22.424 bonds (distance) P-C4' energy: -18.823 flat angles C4'-P-C4' energy: -22.797 flat angles P-C4'-P energy: -12.677 tors. eta vs tors. theta energy: -6.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -122.088756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.088756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.088756 (E_RNA) where: Base-Base interactions energy: -49.075 where: short stacking energy: -46.303 Base-Backbone interact. energy: -0.127 local terms energy: -72.886574 where: bonds (distance) C4'-P energy: -20.856 bonds (distance) P-C4' energy: -24.199 flat angles C4'-P-C4' energy: -14.174 flat angles P-C4'-P energy: -8.894 tors. eta vs tors. theta energy: -4.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -104.490611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.490611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.490611 (E_RNA) where: Base-Base interactions energy: -32.639 where: short stacking energy: -21.173 Base-Backbone interact. energy: -0.384 local terms energy: -71.466954 where: bonds (distance) C4'-P energy: -16.455 bonds (distance) P-C4' energy: -25.877 flat angles C4'-P-C4' energy: -18.091 flat angles P-C4'-P energy: -11.734 tors. eta vs tors. theta energy: 0.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -397.052021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.052021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.052021 (E_RNA) where: Base-Base interactions energy: -269.136 where: short stacking energy: -121.132 Base-Backbone interact. energy: -0.001 local terms energy: -127.914525 where: bonds (distance) C4'-P energy: -20.653 bonds (distance) P-C4' energy: -24.802 flat angles C4'-P-C4' energy: -25.549 flat angles P-C4'-P energy: -18.495 tors. eta vs tors. theta energy: -38.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -347.847095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.847095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.847095 (E_RNA) where: Base-Base interactions energy: -233.616 where: short stacking energy: -94.037 Base-Backbone interact. energy: -0.351 local terms energy: -113.880454 where: bonds (distance) C4'-P energy: -22.065 bonds (distance) P-C4' energy: -22.428 flat angles C4'-P-C4' energy: -21.118 flat angles P-C4'-P energy: -17.219 tors. eta vs tors. theta energy: -31.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -384.935847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.935847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.935847 (E_RNA) where: Base-Base interactions energy: -263.032 where: short stacking energy: -113.642 Base-Backbone interact. energy: -0.001 local terms energy: -121.902530 where: bonds (distance) C4'-P energy: -22.509 bonds (distance) P-C4' energy: -20.989 flat angles C4'-P-C4' energy: -28.779 flat angles P-C4'-P energy: -15.449 tors. eta vs tors. theta energy: -34.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -273.790208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.790208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.790208 (E_RNA) where: Base-Base interactions energy: -170.897 where: short stacking energy: -87.079 Base-Backbone interact. energy: 0.242 local terms energy: -103.135408 where: bonds (distance) C4'-P energy: -24.856 bonds (distance) P-C4' energy: -20.898 flat angles C4'-P-C4' energy: -25.584 flat angles P-C4'-P energy: -14.508 tors. eta vs tors. theta energy: -17.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -216.824917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.824917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.824917 (E_RNA) where: Base-Base interactions energy: -121.738 where: short stacking energy: -81.820 Base-Backbone interact. energy: 0.056 local terms energy: -95.142946 where: bonds (distance) C4'-P energy: -16.130 bonds (distance) P-C4' energy: -21.128 flat angles C4'-P-C4' energy: -21.984 flat angles P-C4'-P energy: -12.365 tors. eta vs tors. theta energy: -23.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -223.314411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.314411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.314411 (E_RNA) where: Base-Base interactions energy: -134.921 where: short stacking energy: -71.152 Base-Backbone interact. energy: -0.195 local terms energy: -88.198556 where: bonds (distance) C4'-P energy: -20.546 bonds (distance) P-C4' energy: -18.239 flat angles C4'-P-C4' energy: -16.914 flat angles P-C4'-P energy: -14.370 tors. eta vs tors. theta energy: -18.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -117.848235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.848235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.848235 (E_RNA) where: Base-Base interactions energy: -39.819 where: short stacking energy: -33.043 Base-Backbone interact. energy: -0.238 local terms energy: -77.791694 where: bonds (distance) C4'-P energy: -18.653 bonds (distance) P-C4' energy: -20.967 flat angles C4'-P-C4' energy: -17.594 flat angles P-C4'-P energy: -13.867 tors. eta vs tors. theta energy: -6.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -149.306805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.306805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.306805 (E_RNA) where: Base-Base interactions energy: -65.457 where: short stacking energy: -39.976 Base-Backbone interact. energy: 0.106 local terms energy: -83.955028 where: bonds (distance) C4'-P energy: -20.330 bonds (distance) P-C4' energy: -18.956 flat angles C4'-P-C4' energy: -20.647 flat angles P-C4'-P energy: -18.952 tors. eta vs tors. theta energy: -5.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -110.605515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.605515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.605515 (E_RNA) where: Base-Base interactions energy: -41.011 where: short stacking energy: -33.131 Base-Backbone interact. energy: -0.309 local terms energy: -69.285335 where: bonds (distance) C4'-P energy: -21.892 bonds (distance) P-C4' energy: -24.872 flat angles C4'-P-C4' energy: -12.511 flat angles P-C4'-P energy: -11.202 tors. eta vs tors. theta energy: 1.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -102.509601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.509601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.509601 (E_RNA) where: Base-Base interactions energy: -38.114 where: short stacking energy: -37.641 Base-Backbone interact. energy: -0.195 local terms energy: -64.200489 where: bonds (distance) C4'-P energy: -13.270 bonds (distance) P-C4' energy: -22.876 flat angles C4'-P-C4' energy: -9.857 flat angles P-C4'-P energy: -17.250 tors. eta vs tors. theta energy: -0.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -384.765355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.765355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.765355 (E_RNA) where: Base-Base interactions energy: -265.200 where: short stacking energy: -124.775 Base-Backbone interact. energy: -0.067 local terms energy: -119.498533 where: bonds (distance) C4'-P energy: -19.117 bonds (distance) P-C4' energy: -22.312 flat angles C4'-P-C4' energy: -23.136 flat angles P-C4'-P energy: -18.446 tors. eta vs tors. theta energy: -36.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -377.125870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.125870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.125870 (E_RNA) where: Base-Base interactions energy: -253.317 where: short stacking energy: -107.198 Base-Backbone interact. energy: -0.019 local terms energy: -123.789742 where: bonds (distance) C4'-P energy: -27.401 bonds (distance) P-C4' energy: -21.826 flat angles C4'-P-C4' energy: -23.277 flat angles P-C4'-P energy: -18.049 tors. eta vs tors. theta energy: -33.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -344.260279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.260279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.260279 (E_RNA) where: Base-Base interactions energy: -225.574 where: short stacking energy: -102.646 Base-Backbone interact. energy: -0.001 local terms energy: -118.685903 where: bonds (distance) C4'-P energy: -25.186 bonds (distance) P-C4' energy: -18.950 flat angles C4'-P-C4' energy: -21.466 flat angles P-C4'-P energy: -20.163 tors. eta vs tors. theta energy: -32.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -233.803875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.803875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.803875 (E_RNA) where: Base-Base interactions energy: -131.933 where: short stacking energy: -87.413 Base-Backbone interact. energy: 0.113 local terms energy: -101.984036 where: bonds (distance) C4'-P energy: -21.951 bonds (distance) P-C4' energy: -23.962 flat angles C4'-P-C4' energy: -24.474 flat angles P-C4'-P energy: -16.164 tors. eta vs tors. theta energy: -15.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -259.014812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.014812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.014812 (E_RNA) where: Base-Base interactions energy: -162.949 where: short stacking energy: -75.828 Base-Backbone interact. energy: 0.038 local terms energy: -96.103556 where: bonds (distance) C4'-P energy: -21.536 bonds (distance) P-C4' energy: -19.939 flat angles C4'-P-C4' energy: -19.279 flat angles P-C4'-P energy: -10.880 tors. eta vs tors. theta energy: -24.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -214.883074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.883074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.883074 (E_RNA) where: Base-Base interactions energy: -124.299 where: short stacking energy: -73.119 Base-Backbone interact. energy: -0.156 local terms energy: -90.427744 where: bonds (distance) C4'-P energy: -19.776 bonds (distance) P-C4' energy: -13.883 flat angles C4'-P-C4' energy: -22.834 flat angles P-C4'-P energy: -17.242 tors. eta vs tors. theta energy: -16.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -119.252623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.252623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.252623 (E_RNA) where: Base-Base interactions energy: -42.490 where: short stacking energy: -42.490 Base-Backbone interact. energy: -1.080 local terms energy: -75.682517 where: bonds (distance) C4'-P energy: -18.119 bonds (distance) P-C4' energy: -22.814 flat angles C4'-P-C4' energy: -19.747 flat angles P-C4'-P energy: -7.899 tors. eta vs tors. theta energy: -7.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -130.286893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.286893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.286893 (E_RNA) where: Base-Base interactions energy: -52.615 where: short stacking energy: -51.482 Base-Backbone interact. energy: -0.161 local terms energy: -77.510528 where: bonds (distance) C4'-P energy: -16.478 bonds (distance) P-C4' energy: -19.793 flat angles C4'-P-C4' energy: -22.502 flat angles P-C4'-P energy: -8.811 tors. eta vs tors. theta energy: -9.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -118.620532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.620532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.620532 (E_RNA) where: Base-Base interactions energy: -41.707 where: short stacking energy: -40.754 Base-Backbone interact. energy: -0.175 local terms energy: -76.738068 where: bonds (distance) C4'-P energy: -14.851 bonds (distance) P-C4' energy: -15.917 flat angles C4'-P-C4' energy: -21.029 flat angles P-C4'-P energy: -16.575 tors. eta vs tors. theta energy: -8.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -106.289061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.289061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.289061 (E_RNA) where: Base-Base interactions energy: -41.981 where: short stacking energy: -35.650 Base-Backbone interact. energy: 0.149 local terms energy: -64.457262 where: bonds (distance) C4'-P energy: -17.023 bonds (distance) P-C4' energy: -23.554 flat angles C4'-P-C4' energy: -15.424 flat angles P-C4'-P energy: -11.447 tors. eta vs tors. theta energy: 2.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -387.872596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.872596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.872596 (E_RNA) where: Base-Base interactions energy: -267.920 where: short stacking energy: -113.196 Base-Backbone interact. energy: -0.002 local terms energy: -119.950260 where: bonds (distance) C4'-P energy: -24.068 bonds (distance) P-C4' energy: -21.399 flat angles C4'-P-C4' energy: -24.150 flat angles P-C4'-P energy: -15.255 tors. eta vs tors. theta energy: -35.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -386.728000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.728000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.728000 (E_RNA) where: Base-Base interactions energy: -258.001 where: short stacking energy: -112.743 Base-Backbone interact. energy: 0.763 local terms energy: -129.489676 where: bonds (distance) C4'-P energy: -27.255 bonds (distance) P-C4' energy: -20.278 flat angles C4'-P-C4' energy: -28.295 flat angles P-C4'-P energy: -17.203 tors. eta vs tors. theta energy: -36.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -351.452861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.452861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.452861 (E_RNA) where: Base-Base interactions energy: -236.031 where: short stacking energy: -96.837 Base-Backbone interact. energy: -0.134 local terms energy: -115.287710 where: bonds (distance) C4'-P energy: -18.903 bonds (distance) P-C4' energy: -22.196 flat angles C4'-P-C4' energy: -21.979 flat angles P-C4'-P energy: -19.686 tors. eta vs tors. theta energy: -32.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -220.528216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.528216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.528216 (E_RNA) where: Base-Base interactions energy: -126.327 where: short stacking energy: -70.971 Base-Backbone interact. energy: -0.742 local terms energy: -93.459749 where: bonds (distance) C4'-P energy: -23.365 bonds (distance) P-C4' energy: -27.921 flat angles C4'-P-C4' energy: -17.218 flat angles P-C4'-P energy: -6.773 tors. eta vs tors. theta energy: -18.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -245.410324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.410324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.410324 (E_RNA) where: Base-Base interactions energy: -139.801 where: short stacking energy: -75.337 Base-Backbone interact. energy: -0.152 local terms energy: -105.457216 where: bonds (distance) C4'-P energy: -21.047 bonds (distance) P-C4' energy: -22.569 flat angles C4'-P-C4' energy: -21.516 flat angles P-C4'-P energy: -16.092 tors. eta vs tors. theta energy: -24.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -257.747788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.747788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.747788 (E_RNA) where: Base-Base interactions energy: -158.938 where: short stacking energy: -83.968 Base-Backbone interact. energy: 1.365 local terms energy: -100.174303 where: bonds (distance) C4'-P energy: -20.733 bonds (distance) P-C4' energy: -23.740 flat angles C4'-P-C4' energy: -21.338 flat angles P-C4'-P energy: -14.422 tors. eta vs tors. theta energy: -19.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -131.526954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.526954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.526954 (E_RNA) where: Base-Base interactions energy: -58.390 where: short stacking energy: -52.632 Base-Backbone interact. energy: -0.160 local terms energy: -72.977211 where: bonds (distance) C4'-P energy: -25.200 bonds (distance) P-C4' energy: -18.073 flat angles C4'-P-C4' energy: -13.125 flat angles P-C4'-P energy: -8.833 tors. eta vs tors. theta energy: -7.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -119.103441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.103441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.103441 (E_RNA) where: Base-Base interactions energy: -44.516 where: short stacking energy: -44.516 Base-Backbone interact. energy: -0.282 local terms energy: -74.304845 where: bonds (distance) C4'-P energy: -17.748 bonds (distance) P-C4' energy: -17.572 flat angles C4'-P-C4' energy: -24.718 flat angles P-C4'-P energy: -16.526 tors. eta vs tors. theta energy: 2.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -113.842971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.842971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.842971 (E_RNA) where: Base-Base interactions energy: -46.825 where: short stacking energy: -30.646 Base-Backbone interact. energy: -0.668 local terms energy: -66.350129 where: bonds (distance) C4'-P energy: -20.893 bonds (distance) P-C4' energy: -19.737 flat angles C4'-P-C4' energy: -22.754 flat angles P-C4'-P energy: -8.956 tors. eta vs tors. theta energy: 5.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -136.390339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.390339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.390339 (E_RNA) where: Base-Base interactions energy: -72.135 where: short stacking energy: -46.641 Base-Backbone interact. energy: -0.033 local terms energy: -64.222406 where: bonds (distance) C4'-P energy: -20.807 bonds (distance) P-C4' energy: -10.420 flat angles C4'-P-C4' energy: -14.437 flat angles P-C4'-P energy: -3.637 tors. eta vs tors. theta energy: -14.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -394.375000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.375000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.375000 (E_RNA) where: Base-Base interactions energy: -269.753 where: short stacking energy: -120.396 Base-Backbone interact. energy: -1.510 local terms energy: -123.112271 where: bonds (distance) C4'-P energy: -16.132 bonds (distance) P-C4' energy: -25.597 flat angles C4'-P-C4' energy: -25.025 flat angles P-C4'-P energy: -18.884 tors. eta vs tors. theta energy: -37.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -381.737728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.737728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.737728 (E_RNA) where: Base-Base interactions energy: -261.209 where: short stacking energy: -113.995 Base-Backbone interact. energy: -0.174 local terms energy: -120.355347 where: bonds (distance) C4'-P energy: -20.346 bonds (distance) P-C4' energy: -22.189 flat angles C4'-P-C4' energy: -25.309 flat angles P-C4'-P energy: -18.805 tors. eta vs tors. theta energy: -33.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -346.587073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.587073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.587073 (E_RNA) where: Base-Base interactions energy: -230.867 where: short stacking energy: -104.168 Base-Backbone interact. energy: -0.021 local terms energy: -115.699684 where: bonds (distance) C4'-P energy: -17.635 bonds (distance) P-C4' energy: -25.644 flat angles C4'-P-C4' energy: -24.069 flat angles P-C4'-P energy: -17.070 tors. eta vs tors. theta energy: -31.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -241.246027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.246027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.246027 (E_RNA) where: Base-Base interactions energy: -142.095 where: short stacking energy: -65.871 Base-Backbone interact. energy: 0.614 local terms energy: -99.765243 where: bonds (distance) C4'-P energy: -24.784 bonds (distance) P-C4' energy: -21.485 flat angles C4'-P-C4' energy: -19.406 flat angles P-C4'-P energy: -12.185 tors. eta vs tors. theta energy: -21.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -221.977343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.977343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.977343 (E_RNA) where: Base-Base interactions energy: -127.033 where: short stacking energy: -69.997 Base-Backbone interact. energy: -0.104 local terms energy: -94.839495 where: bonds (distance) C4'-P energy: -23.136 bonds (distance) P-C4' energy: -20.926 flat angles C4'-P-C4' energy: -21.893 flat angles P-C4'-P energy: -13.370 tors. eta vs tors. theta energy: -15.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -221.905129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.905129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.905129 (E_RNA) where: Base-Base interactions energy: -143.150 where: short stacking energy: -69.647 Base-Backbone interact. energy: -0.464 local terms energy: -78.291089 where: bonds (distance) C4'-P energy: -17.451 bonds (distance) P-C4' energy: -19.179 flat angles C4'-P-C4' energy: -16.228 flat angles P-C4'-P energy: -8.578 tors. eta vs tors. theta energy: -16.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -130.267537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.267537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.267537 (E_RNA) where: Base-Base interactions energy: -47.372 where: short stacking energy: -41.566 Base-Backbone interact. energy: -0.093 local terms energy: -82.802493 where: bonds (distance) C4'-P energy: -24.524 bonds (distance) P-C4' energy: -22.992 flat angles C4'-P-C4' energy: -21.373 flat angles P-C4'-P energy: -11.321 tors. eta vs tors. theta energy: -2.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -121.389379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.389379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.389379 (E_RNA) where: Base-Base interactions energy: -46.455 where: short stacking energy: -42.274 Base-Backbone interact. energy: -0.471 local terms energy: -74.463324 where: bonds (distance) C4'-P energy: -13.734 bonds (distance) P-C4' energy: -23.291 flat angles C4'-P-C4' energy: -17.736 flat angles P-C4'-P energy: -17.829 tors. eta vs tors. theta energy: -1.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -136.325330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.325330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.325330 (E_RNA) where: Base-Base interactions energy: -62.163 where: short stacking energy: -44.136 Base-Backbone interact. energy: -0.183 local terms energy: -73.979105 where: bonds (distance) C4'-P energy: -15.856 bonds (distance) P-C4' energy: -22.069 flat angles C4'-P-C4' energy: -22.186 flat angles P-C4'-P energy: -8.877 tors. eta vs tors. theta energy: -4.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -108.995271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.995271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.995271 (E_RNA) where: Base-Base interactions energy: -33.048 where: short stacking energy: -28.229 Base-Backbone interact. energy: -0.055 local terms energy: -75.891719 where: bonds (distance) C4'-P energy: -22.039 bonds (distance) P-C4' energy: -21.804 flat angles C4'-P-C4' energy: -17.257 flat angles P-C4'-P energy: -11.321 tors. eta vs tors. theta energy: -3.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -393.704405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.704405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.704405 (E_RNA) where: Base-Base interactions energy: -269.964 where: short stacking energy: -120.071 Base-Backbone interact. energy: -0.186 local terms energy: -123.555216 where: bonds (distance) C4'-P energy: -15.890 bonds (distance) P-C4' energy: -26.459 flat angles C4'-P-C4' energy: -28.094 flat angles P-C4'-P energy: -18.120 tors. eta vs tors. theta energy: -34.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -383.483198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.483198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.483198 (E_RNA) where: Base-Base interactions energy: -258.100 where: short stacking energy: -116.698 Base-Backbone interact. energy: -1.405 local terms energy: -123.977961 where: bonds (distance) C4'-P energy: -22.437 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -24.121 flat angles P-C4'-P energy: -17.694 tors. eta vs tors. theta energy: -36.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -352.929937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.929937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.929937 (E_RNA) where: Base-Base interactions energy: -235.004 where: short stacking energy: -98.366 Base-Backbone interact. energy: -0.323 local terms energy: -117.602406 where: bonds (distance) C4'-P energy: -23.689 bonds (distance) P-C4' energy: -21.357 flat angles C4'-P-C4' energy: -22.583 flat angles P-C4'-P energy: -15.128 tors. eta vs tors. theta energy: -34.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -265.193767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.193767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.193767 (E_RNA) where: Base-Base interactions energy: -160.246 where: short stacking energy: -94.592 Base-Backbone interact. energy: -0.013 local terms energy: -104.934570 where: bonds (distance) C4'-P energy: -18.799 bonds (distance) P-C4' energy: -20.481 flat angles C4'-P-C4' energy: -24.862 flat angles P-C4'-P energy: -13.179 tors. eta vs tors. theta energy: -27.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -252.766878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.766878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.766878 (E_RNA) where: Base-Base interactions energy: -139.888 where: short stacking energy: -84.090 Base-Backbone interact. energy: -1.513 local terms energy: -111.366175 where: bonds (distance) C4'-P energy: -23.986 bonds (distance) P-C4' energy: -21.520 flat angles C4'-P-C4' energy: -23.008 flat angles P-C4'-P energy: -16.997 tors. eta vs tors. theta energy: -25.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -201.869048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.869048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.869048 (E_RNA) where: Base-Base interactions energy: -113.916 where: short stacking energy: -57.726 Base-Backbone interact. energy: -0.529 local terms energy: -87.424239 where: bonds (distance) C4'-P energy: -22.921 bonds (distance) P-C4' energy: -17.142 flat angles C4'-P-C4' energy: -20.482 flat angles P-C4'-P energy: -15.261 tors. eta vs tors. theta energy: -11.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -138.755628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.755628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.755628 (E_RNA) where: Base-Base interactions energy: -65.037 where: short stacking energy: -52.679 Base-Backbone interact. energy: -0.100 local terms energy: -73.617968 where: bonds (distance) C4'-P energy: -17.594 bonds (distance) P-C4' energy: -21.940 flat angles C4'-P-C4' energy: -18.772 flat angles P-C4'-P energy: -11.186 tors. eta vs tors. theta energy: -4.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -115.720074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.720074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.720074 (E_RNA) where: Base-Base interactions energy: -40.825 where: short stacking energy: -38.329 Base-Backbone interact. energy: -0.367 local terms energy: -74.528897 where: bonds (distance) C4'-P energy: -20.256 bonds (distance) P-C4' energy: -22.659 flat angles C4'-P-C4' energy: -21.270 flat angles P-C4'-P energy: -8.817 tors. eta vs tors. theta energy: -1.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -120.347230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.347230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.347230 (E_RNA) where: Base-Base interactions energy: -50.997 where: short stacking energy: -45.970 Base-Backbone interact. energy: -0.061 local terms energy: -69.289070 where: bonds (distance) C4'-P energy: -17.015 bonds (distance) P-C4' energy: -24.554 flat angles C4'-P-C4' energy: -8.931 flat angles P-C4'-P energy: -13.255 tors. eta vs tors. theta energy: -5.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -116.924979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.924979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.924979 (E_RNA) where: Base-Base interactions energy: -44.221 where: short stacking energy: -37.880 Base-Backbone interact. energy: -0.212 local terms energy: -72.491397 where: bonds (distance) C4'-P energy: -20.865 bonds (distance) P-C4' energy: -25.296 flat angles C4'-P-C4' energy: -11.617 flat angles P-C4'-P energy: -11.916 tors. eta vs tors. theta energy: -2.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -391.133556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.133556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.133556 (E_RNA) where: Base-Base interactions energy: -266.619 where: short stacking energy: -119.148 Base-Backbone interact. energy: 0.602 local terms energy: -125.116454 where: bonds (distance) C4'-P energy: -22.599 bonds (distance) P-C4' energy: -24.686 flat angles C4'-P-C4' energy: -23.763 flat angles P-C4'-P energy: -16.219 tors. eta vs tors. theta energy: -37.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -387.368088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.368088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.368088 (E_RNA) where: Base-Base interactions energy: -264.620 where: short stacking energy: -113.522 Base-Backbone interact. energy: -0.788 local terms energy: -121.960297 where: bonds (distance) C4'-P energy: -18.770 bonds (distance) P-C4' energy: -22.685 flat angles C4'-P-C4' energy: -25.597 flat angles P-C4'-P energy: -19.622 tors. eta vs tors. theta energy: -35.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -345.797107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.797107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.797107 (E_RNA) where: Base-Base interactions energy: -240.417 where: short stacking energy: -103.706 Base-Backbone interact. energy: -0.017 local terms energy: -105.362915 where: bonds (distance) C4'-P energy: -15.229 bonds (distance) P-C4' energy: -19.796 flat angles C4'-P-C4' energy: -22.900 flat angles P-C4'-P energy: -14.357 tors. eta vs tors. theta energy: -33.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -258.386783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.386783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.386783 (E_RNA) where: Base-Base interactions energy: -171.377 where: short stacking energy: -76.717 Base-Backbone interact. energy: -0.336 local terms energy: -86.673413 where: bonds (distance) C4'-P energy: -18.268 bonds (distance) P-C4' energy: -15.633 flat angles C4'-P-C4' energy: -23.124 flat angles P-C4'-P energy: -15.673 tors. eta vs tors. theta energy: -13.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -216.431436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.431436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.431436 (E_RNA) where: Base-Base interactions energy: -120.228 where: short stacking energy: -63.916 Base-Backbone interact. energy: -0.303 local terms energy: -95.900724 where: bonds (distance) C4'-P energy: -21.683 bonds (distance) P-C4' energy: -20.178 flat angles C4'-P-C4' energy: -23.931 flat angles P-C4'-P energy: -17.202 tors. eta vs tors. theta energy: -12.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -204.437880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.437880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.437880 (E_RNA) where: Base-Base interactions energy: -113.232 where: short stacking energy: -57.868 Base-Backbone interact. energy: -0.066 local terms energy: -91.139406 where: bonds (distance) C4'-P energy: -18.191 bonds (distance) P-C4' energy: -22.976 flat angles C4'-P-C4' energy: -20.472 flat angles P-C4'-P energy: -12.116 tors. eta vs tors. theta energy: -17.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -149.695568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.695568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.695568 (E_RNA) where: Base-Base interactions energy: -62.815 where: short stacking energy: -62.815 Base-Backbone interact. energy: -0.189 local terms energy: -86.691259 where: bonds (distance) C4'-P energy: -21.478 bonds (distance) P-C4' energy: -24.586 flat angles C4'-P-C4' energy: -17.506 flat angles P-C4'-P energy: -10.074 tors. eta vs tors. theta energy: -13.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -119.487230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.487230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.487230 (E_RNA) where: Base-Base interactions energy: -49.073 where: short stacking energy: -38.517 Base-Backbone interact. energy: -0.498 local terms energy: -69.915558 where: bonds (distance) C4'-P energy: -20.170 bonds (distance) P-C4' energy: -21.652 flat angles C4'-P-C4' energy: -15.628 flat angles P-C4'-P energy: -10.714 tors. eta vs tors. theta energy: -1.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -125.191446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.191446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.191446 (E_RNA) where: Base-Base interactions energy: -50.663 where: short stacking energy: -49.461 Base-Backbone interact. energy: 2.801 local terms energy: -77.328987 where: bonds (distance) C4'-P energy: -19.261 bonds (distance) P-C4' energy: -23.323 flat angles C4'-P-C4' energy: -21.360 flat angles P-C4'-P energy: -8.111 tors. eta vs tors. theta energy: -5.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -108.773274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.773274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.773274 (E_RNA) where: Base-Base interactions energy: -40.304 where: short stacking energy: -38.301 Base-Backbone interact. energy: 0.938 local terms energy: -69.407766 where: bonds (distance) C4'-P energy: -16.607 bonds (distance) P-C4' energy: -15.164 flat angles C4'-P-C4' energy: -20.242 flat angles P-C4'-P energy: -11.803 tors. eta vs tors. theta energy: -5.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -395.419113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.419113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.419113 (E_RNA) where: Base-Base interactions energy: -264.231 where: short stacking energy: -120.080 Base-Backbone interact. energy: -0.895 local terms energy: -130.293736 where: bonds (distance) C4'-P energy: -26.540 bonds (distance) P-C4' energy: -25.216 flat angles C4'-P-C4' energy: -24.944 flat angles P-C4'-P energy: -16.917 tors. eta vs tors. theta energy: -36.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -380.863882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.863882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.863882 (E_RNA) where: Base-Base interactions energy: -255.756 where: short stacking energy: -112.806 Base-Backbone interact. energy: -0.022 local terms energy: -125.086153 where: bonds (distance) C4'-P energy: -26.031 bonds (distance) P-C4' energy: -20.635 flat angles C4'-P-C4' energy: -20.835 flat angles P-C4'-P energy: -20.507 tors. eta vs tors. theta energy: -37.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -356.137753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.137753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.137753 (E_RNA) where: Base-Base interactions energy: -249.179 where: short stacking energy: -100.276 Base-Backbone interact. energy: -0.739 local terms energy: -106.219730 where: bonds (distance) C4'-P energy: -16.381 bonds (distance) P-C4' energy: -23.926 flat angles C4'-P-C4' energy: -25.711 flat angles P-C4'-P energy: -9.498 tors. eta vs tors. theta energy: -30.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -268.913432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.913432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.913432 (E_RNA) where: Base-Base interactions energy: -165.365 where: short stacking energy: -81.647 Base-Backbone interact. energy: 0.001 local terms energy: -103.549544 where: bonds (distance) C4'-P energy: -23.441 bonds (distance) P-C4' energy: -21.730 flat angles C4'-P-C4' energy: -19.997 flat angles P-C4'-P energy: -19.294 tors. eta vs tors. theta energy: -19.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -233.332824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.332824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.332824 (E_RNA) where: Base-Base interactions energy: -138.101 where: short stacking energy: -61.714 Base-Backbone interact. energy: -0.306 local terms energy: -94.925893 where: bonds (distance) C4'-P energy: -23.307 bonds (distance) P-C4' energy: -23.775 flat angles C4'-P-C4' energy: -18.388 flat angles P-C4'-P energy: -14.672 tors. eta vs tors. theta energy: -14.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -235.085159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.085159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.085159 (E_RNA) where: Base-Base interactions energy: -130.204 where: short stacking energy: -71.720 Base-Backbone interact. energy: -0.042 local terms energy: -104.839212 where: bonds (distance) C4'-P energy: -18.571 bonds (distance) P-C4' energy: -27.746 flat angles C4'-P-C4' energy: -23.254 flat angles P-C4'-P energy: -12.555 tors. eta vs tors. theta energy: -22.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -136.032499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.032499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.032499 (E_RNA) where: Base-Base interactions energy: -61.865 where: short stacking energy: -42.320 Base-Backbone interact. energy: -0.282 local terms energy: -73.885793 where: bonds (distance) C4'-P energy: -20.694 bonds (distance) P-C4' energy: -15.980 flat angles C4'-P-C4' energy: -18.677 flat angles P-C4'-P energy: -12.407 tors. eta vs tors. theta energy: -6.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -111.178518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.178518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.178518 (E_RNA) where: Base-Base interactions energy: -36.269 where: short stacking energy: -36.144 Base-Backbone interact. energy: -0.262 local terms energy: -74.648141 where: bonds (distance) C4'-P energy: -19.585 bonds (distance) P-C4' energy: -21.476 flat angles C4'-P-C4' energy: -15.842 flat angles P-C4'-P energy: -12.698 tors. eta vs tors. theta energy: -5.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -121.015581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.015581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.015581 (E_RNA) where: Base-Base interactions energy: -51.254 where: short stacking energy: -42.885 Base-Backbone interact. energy: -0.397 local terms energy: -69.364030 where: bonds (distance) C4'-P energy: -19.528 bonds (distance) P-C4' energy: -11.673 flat angles C4'-P-C4' energy: -15.249 flat angles P-C4'-P energy: -12.179 tors. eta vs tors. theta energy: -10.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -112.996214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.996214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.996214 (E_RNA) where: Base-Base interactions energy: -33.156 where: short stacking energy: -21.678 Base-Backbone interact. energy: -0.099 local terms energy: -79.740908 where: bonds (distance) C4'-P energy: -18.497 bonds (distance) P-C4' energy: -23.578 flat angles C4'-P-C4' energy: -20.984 flat angles P-C4'-P energy: -12.880 tors. eta vs tors. theta energy: -3.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -388.761784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.761784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.761784 (E_RNA) where: Base-Base interactions energy: -262.387 where: short stacking energy: -125.004 Base-Backbone interact. energy: -0.009 local terms energy: -126.365716 where: bonds (distance) C4'-P energy: -23.910 bonds (distance) P-C4' energy: -22.667 flat angles C4'-P-C4' energy: -24.562 flat angles P-C4'-P energy: -17.204 tors. eta vs tors. theta energy: -38.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -380.084293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.084293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.084293 (E_RNA) where: Base-Base interactions energy: -256.968 where: short stacking energy: -111.981 Base-Backbone interact. energy: -0.171 local terms energy: -122.945148 where: bonds (distance) C4'-P energy: -25.034 bonds (distance) P-C4' energy: -23.714 flat angles C4'-P-C4' energy: -25.406 flat angles P-C4'-P energy: -15.897 tors. eta vs tors. theta energy: -32.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -340.988352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.988352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.988352 (E_RNA) where: Base-Base interactions energy: -231.196 where: short stacking energy: -99.099 Base-Backbone interact. energy: -0.601 local terms energy: -109.191731 where: bonds (distance) C4'-P energy: -17.421 bonds (distance) P-C4' energy: -24.676 flat angles C4'-P-C4' energy: -24.274 flat angles P-C4'-P energy: -14.945 tors. eta vs tors. theta energy: -27.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -240.590498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.590498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.590498 (E_RNA) where: Base-Base interactions energy: -149.105 where: short stacking energy: -74.473 Base-Backbone interact. energy: -1.110 local terms energy: -90.376150 where: bonds (distance) C4'-P energy: -13.891 bonds (distance) P-C4' energy: -18.630 flat angles C4'-P-C4' energy: -22.107 flat angles P-C4'-P energy: -16.839 tors. eta vs tors. theta energy: -18.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -249.869730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.869730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.869730 (E_RNA) where: Base-Base interactions energy: -159.099 where: short stacking energy: -69.001 Base-Backbone interact. energy: 1.452 local terms energy: -92.222671 where: bonds (distance) C4'-P energy: -23.962 bonds (distance) P-C4' energy: -19.380 flat angles C4'-P-C4' energy: -18.202 flat angles P-C4'-P energy: -14.865 tors. eta vs tors. theta energy: -15.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -204.090117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.090117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.090117 (E_RNA) where: Base-Base interactions energy: -118.996 where: short stacking energy: -65.516 Base-Backbone interact. energy: -0.053 local terms energy: -85.040786 where: bonds (distance) C4'-P energy: -17.515 bonds (distance) P-C4' energy: -15.748 flat angles C4'-P-C4' energy: -21.980 flat angles P-C4'-P energy: -11.243 tors. eta vs tors. theta energy: -18.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -160.978627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.978627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.978627 (E_RNA) where: Base-Base interactions energy: -79.704 where: short stacking energy: -54.285 Base-Backbone interact. energy: -0.347 local terms energy: -80.927179 where: bonds (distance) C4'-P energy: -19.406 bonds (distance) P-C4' energy: -23.261 flat angles C4'-P-C4' energy: -15.466 flat angles P-C4'-P energy: -14.186 tors. eta vs tors. theta energy: -8.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -127.482909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.482909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.482909 (E_RNA) where: Base-Base interactions energy: -56.064 where: short stacking energy: -38.664 Base-Backbone interact. energy: -0.361 local terms energy: -71.058199 where: bonds (distance) C4'-P energy: -17.401 bonds (distance) P-C4' energy: -16.827 flat angles C4'-P-C4' energy: -17.627 flat angles P-C4'-P energy: -18.180 tors. eta vs tors. theta energy: -1.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -119.433458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.433458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.433458 (E_RNA) where: Base-Base interactions energy: -55.426 where: short stacking energy: -29.074 Base-Backbone interact. energy: -0.227 local terms energy: -63.780545 where: bonds (distance) C4'-P energy: -20.975 bonds (distance) P-C4' energy: -22.808 flat angles C4'-P-C4' energy: -12.956 flat angles P-C4'-P energy: -11.011 tors. eta vs tors. theta energy: 3.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -104.489099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.489099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.489099 (E_RNA) where: Base-Base interactions energy: -27.142 where: short stacking energy: -27.130 Base-Backbone interact. energy: -0.419 local terms energy: -76.928001 where: bonds (distance) C4'-P energy: -22.032 bonds (distance) P-C4' energy: -23.174 flat angles C4'-P-C4' energy: -22.048 flat angles P-C4'-P energy: -10.215 tors. eta vs tors. theta energy: 0.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -386.106487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.106487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.106487 (E_RNA) where: Base-Base interactions energy: -265.262 where: short stacking energy: -118.708 Base-Backbone interact. energy: -0.598 local terms energy: -120.245591 where: bonds (distance) C4'-P energy: -22.300 bonds (distance) P-C4' energy: -22.142 flat angles C4'-P-C4' energy: -24.416 flat angles P-C4'-P energy: -16.649 tors. eta vs tors. theta energy: -34.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -376.855399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.855399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.855399 (E_RNA) where: Base-Base interactions energy: -253.927 where: short stacking energy: -116.861 Base-Backbone interact. energy: -0.369 local terms energy: -122.559445 where: bonds (distance) C4'-P energy: -19.070 bonds (distance) P-C4' energy: -22.437 flat angles C4'-P-C4' energy: -25.821 flat angles P-C4'-P energy: -17.579 tors. eta vs tors. theta energy: -37.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -352.961406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.961406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.961406 (E_RNA) where: Base-Base interactions energy: -231.769 where: short stacking energy: -102.324 Base-Backbone interact. energy: -1.086 local terms energy: -120.105638 where: bonds (distance) C4'-P energy: -23.034 bonds (distance) P-C4' energy: -24.875 flat angles C4'-P-C4' energy: -20.478 flat angles P-C4'-P energy: -17.648 tors. eta vs tors. theta energy: -34.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -246.624200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.624200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.624200 (E_RNA) where: Base-Base interactions energy: -152.813 where: short stacking energy: -79.552 Base-Backbone interact. energy: -0.592 local terms energy: -93.219820 where: bonds (distance) C4'-P energy: -24.733 bonds (distance) P-C4' energy: -21.341 flat angles C4'-P-C4' energy: -17.051 flat angles P-C4'-P energy: -15.310 tors. eta vs tors. theta energy: -14.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -197.065188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.065188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.065188 (E_RNA) where: Base-Base interactions energy: -110.034 where: short stacking energy: -66.395 Base-Backbone interact. energy: -0.116 local terms energy: -86.914382 where: bonds (distance) C4'-P energy: -15.077 bonds (distance) P-C4' energy: -21.940 flat angles C4'-P-C4' energy: -19.730 flat angles P-C4'-P energy: -21.061 tors. eta vs tors. theta energy: -9.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -262.536436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.536436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.536436 (E_RNA) where: Base-Base interactions energy: -169.644 where: short stacking energy: -89.955 Base-Backbone interact. energy: 0.397 local terms energy: -93.289834 where: bonds (distance) C4'-P energy: -19.337 bonds (distance) P-C4' energy: -18.779 flat angles C4'-P-C4' energy: -17.565 flat angles P-C4'-P energy: -11.790 tors. eta vs tors. theta energy: -25.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -149.115508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.115508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.115508 (E_RNA) where: Base-Base interactions energy: -80.734 where: short stacking energy: -43.507 Base-Backbone interact. energy: -0.474 local terms energy: -67.907779 where: bonds (distance) C4'-P energy: -17.495 bonds (distance) P-C4' energy: -14.642 flat angles C4'-P-C4' energy: -20.037 flat angles P-C4'-P energy: -15.161 tors. eta vs tors. theta energy: -0.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -109.511279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.511279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.511279 (E_RNA) where: Base-Base interactions energy: -31.751 where: short stacking energy: -31.923 Base-Backbone interact. energy: -0.349 local terms energy: -77.410351 where: bonds (distance) C4'-P energy: -18.151 bonds (distance) P-C4' energy: -25.460 flat angles C4'-P-C4' energy: -23.314 flat angles P-C4'-P energy: -9.032 tors. eta vs tors. theta energy: -1.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -116.864750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.864750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.864750 (E_RNA) where: Base-Base interactions energy: -47.294 where: short stacking energy: -31.564 Base-Backbone interact. energy: -1.184 local terms energy: -68.386277 where: bonds (distance) C4'-P energy: -16.432 bonds (distance) P-C4' energy: -26.669 flat angles C4'-P-C4' energy: -16.869 flat angles P-C4'-P energy: -10.270 tors. eta vs tors. theta energy: 1.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -108.528491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.528491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.528491 (E_RNA) where: Base-Base interactions energy: -39.423 where: short stacking energy: -33.701 Base-Backbone interact. energy: 0.025 local terms energy: -69.130390 where: bonds (distance) C4'-P energy: -18.745 bonds (distance) P-C4' energy: -26.323 flat angles C4'-P-C4' energy: -18.375 flat angles P-C4'-P energy: -6.681 tors. eta vs tors. theta energy: 0.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -388.099453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.099453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.099453 (E_RNA) where: Base-Base interactions energy: -262.126 where: short stacking energy: -117.905 Base-Backbone interact. energy: -0.170 local terms energy: -125.803973 where: bonds (distance) C4'-P energy: -24.547 bonds (distance) P-C4' energy: -25.002 flat angles C4'-P-C4' energy: -20.899 flat angles P-C4'-P energy: -17.012 tors. eta vs tors. theta energy: -38.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -359.242052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.242052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.242052 (E_RNA) where: Base-Base interactions energy: -244.623 where: short stacking energy: -112.617 Base-Backbone interact. energy: -0.792 local terms energy: -113.826480 where: bonds (distance) C4'-P energy: -20.872 bonds (distance) P-C4' energy: -18.008 flat angles C4'-P-C4' energy: -19.816 flat angles P-C4'-P energy: -20.571 tors. eta vs tors. theta energy: -34.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -380.740936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.740936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.740936 (E_RNA) where: Base-Base interactions energy: -255.968 where: short stacking energy: -122.171 Base-Backbone interact. energy: -0.696 local terms energy: -124.077419 where: bonds (distance) C4'-P energy: -17.203 bonds (distance) P-C4' energy: -26.284 flat angles C4'-P-C4' energy: -23.906 flat angles P-C4'-P energy: -18.820 tors. eta vs tors. theta energy: -37.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -245.759635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.759635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.759635 (E_RNA) where: Base-Base interactions energy: -137.560 where: short stacking energy: -74.558 Base-Backbone interact. energy: -1.145 local terms energy: -107.054687 where: bonds (distance) C4'-P energy: -23.700 bonds (distance) P-C4' energy: -24.081 flat angles C4'-P-C4' energy: -22.495 flat angles P-C4'-P energy: -17.505 tors. eta vs tors. theta energy: -19.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -211.963715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.963715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.963715 (E_RNA) where: Base-Base interactions energy: -112.543 where: short stacking energy: -74.543 Base-Backbone interact. energy: -0.097 local terms energy: -99.323017 where: bonds (distance) C4'-P energy: -21.556 bonds (distance) P-C4' energy: -25.668 flat angles C4'-P-C4' energy: -23.383 flat angles P-C4'-P energy: -9.638 tors. eta vs tors. theta energy: -19.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -267.521550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.521550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.521550 (E_RNA) where: Base-Base interactions energy: -170.208 where: short stacking energy: -82.216 Base-Backbone interact. energy: -0.431 local terms energy: -96.882435 where: bonds (distance) C4'-P energy: -23.129 bonds (distance) P-C4' energy: -15.318 flat angles C4'-P-C4' energy: -21.342 flat angles P-C4'-P energy: -8.557 tors. eta vs tors. theta energy: -28.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -135.205591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.205591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.205591 (E_RNA) where: Base-Base interactions energy: -63.017 where: short stacking energy: -45.866 Base-Backbone interact. energy: -0.340 local terms energy: -71.849047 where: bonds (distance) C4'-P energy: -16.114 bonds (distance) P-C4' energy: -19.599 flat angles C4'-P-C4' energy: -18.774 flat angles P-C4'-P energy: -13.566 tors. eta vs tors. theta energy: -3.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -130.582349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.582349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.582349 (E_RNA) where: Base-Base interactions energy: -51.048 where: short stacking energy: -48.809 Base-Backbone interact. energy: -0.089 local terms energy: -79.445928 where: bonds (distance) C4'-P energy: -18.476 bonds (distance) P-C4' energy: -21.570 flat angles C4'-P-C4' energy: -17.846 flat angles P-C4'-P energy: -10.543 tors. eta vs tors. theta energy: -11.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -108.698254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.698254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.698254 (E_RNA) where: Base-Base interactions energy: -42.455 where: short stacking energy: -35.808 Base-Backbone interact. energy: -0.281 local terms energy: -65.961931 where: bonds (distance) C4'-P energy: -17.628 bonds (distance) P-C4' energy: -20.807 flat angles C4'-P-C4' energy: -18.152 flat angles P-C4'-P energy: -9.946 tors. eta vs tors. theta energy: 0.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -118.118957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.118957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.118957 (E_RNA) where: Base-Base interactions energy: -38.793 where: short stacking energy: -38.456 Base-Backbone interact. energy: -1.083 local terms energy: -78.242794 where: bonds (distance) C4'-P energy: -14.961 bonds (distance) P-C4' energy: -24.589 flat angles C4'-P-C4' energy: -18.817 flat angles P-C4'-P energy: -13.508 tors. eta vs tors. theta energy: -6.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -392.687562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.687562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.687562 (E_RNA) where: Base-Base interactions energy: -266.449 where: short stacking energy: -114.262 Base-Backbone interact. energy: -0.420 local terms energy: -125.818113 where: bonds (distance) C4'-P energy: -22.671 bonds (distance) P-C4' energy: -25.175 flat angles C4'-P-C4' energy: -25.343 flat angles P-C4'-P energy: -15.008 tors. eta vs tors. theta energy: -37.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -353.760811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.760811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.760811 (E_RNA) where: Base-Base interactions energy: -240.978 where: short stacking energy: -112.551 Base-Backbone interact. energy: -0.016 local terms energy: -112.767427 where: bonds (distance) C4'-P energy: -21.490 bonds (distance) P-C4' energy: -18.350 flat angles C4'-P-C4' energy: -21.989 flat angles P-C4'-P energy: -16.240 tors. eta vs tors. theta energy: -34.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -388.452313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.452313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.452313 (E_RNA) where: Base-Base interactions energy: -254.450 where: short stacking energy: -118.703 Base-Backbone interact. energy: -0.724 local terms energy: -133.278914 where: bonds (distance) C4'-P energy: -23.573 bonds (distance) P-C4' energy: -25.281 flat angles C4'-P-C4' energy: -25.648 flat angles P-C4'-P energy: -20.997 tors. eta vs tors. theta energy: -37.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -244.247608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.247608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.247608 (E_RNA) where: Base-Base interactions energy: -146.088 where: short stacking energy: -85.171 Base-Backbone interact. energy: -0.178 local terms energy: -97.981515 where: bonds (distance) C4'-P energy: -22.563 bonds (distance) P-C4' energy: -20.544 flat angles C4'-P-C4' energy: -19.791 flat angles P-C4'-P energy: -11.249 tors. eta vs tors. theta energy: -23.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -288.925732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.925732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.925732 (E_RNA) where: Base-Base interactions energy: -177.162 where: short stacking energy: -91.218 Base-Backbone interact. energy: -0.149 local terms energy: -111.615584 where: bonds (distance) C4'-P energy: -24.910 bonds (distance) P-C4' energy: -23.326 flat angles C4'-P-C4' energy: -23.707 flat angles P-C4'-P energy: -10.766 tors. eta vs tors. theta energy: -28.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -206.126271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.126271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.126271 (E_RNA) where: Base-Base interactions energy: -117.936 where: short stacking energy: -68.459 Base-Backbone interact. energy: -0.198 local terms energy: -87.992379 where: bonds (distance) C4'-P energy: -10.695 bonds (distance) P-C4' energy: -18.893 flat angles C4'-P-C4' energy: -24.510 flat angles P-C4'-P energy: -14.402 tors. eta vs tors. theta energy: -19.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -129.371987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.371987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.371987 (E_RNA) where: Base-Base interactions energy: -59.387 where: short stacking energy: -33.172 Base-Backbone interact. energy: -0.491 local terms energy: -69.494440 where: bonds (distance) C4'-P energy: -19.831 bonds (distance) P-C4' energy: -24.490 flat angles C4'-P-C4' energy: -20.085 flat angles P-C4'-P energy: -11.915 tors. eta vs tors. theta energy: 6.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -116.003434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.003434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.003434 (E_RNA) where: Base-Base interactions energy: -51.139 where: short stacking energy: -35.086 Base-Backbone interact. energy: -0.165 local terms energy: -64.698681 where: bonds (distance) C4'-P energy: -24.157 bonds (distance) P-C4' energy: -25.963 flat angles C4'-P-C4' energy: -9.805 flat angles P-C4'-P energy: -9.678 tors. eta vs tors. theta energy: 4.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -122.526783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.526783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.526783 (E_RNA) where: Base-Base interactions energy: -49.088 where: short stacking energy: -42.716 Base-Backbone interact. energy: 0.094 local terms energy: -73.533619 where: bonds (distance) C4'-P energy: -20.757 bonds (distance) P-C4' energy: -21.496 flat angles C4'-P-C4' energy: -12.343 flat angles P-C4'-P energy: -15.393 tors. eta vs tors. theta energy: -3.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -124.362950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.362950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.362950 (E_RNA) where: Base-Base interactions energy: -58.707 where: short stacking energy: -46.784 Base-Backbone interact. energy: -0.545 local terms energy: -65.110631 where: bonds (distance) C4'-P energy: -19.766 bonds (distance) P-C4' energy: -13.336 flat angles C4'-P-C4' energy: -12.168 flat angles P-C4'-P energy: -13.228 tors. eta vs tors. theta energy: -6.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -398.274234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.274234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.274234 (E_RNA) where: Base-Base interactions energy: -271.994 where: short stacking energy: -125.373 Base-Backbone interact. energy: -0.032 local terms energy: -126.247802 where: bonds (distance) C4'-P energy: -21.527 bonds (distance) P-C4' energy: -24.158 flat angles C4'-P-C4' energy: -27.108 flat angles P-C4'-P energy: -15.267 tors. eta vs tors. theta energy: -38.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -390.889538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.889538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.889538 (E_RNA) where: Base-Base interactions energy: -261.733 where: short stacking energy: -114.102 Base-Backbone interact. energy: -0.046 local terms energy: -129.110282 where: bonds (distance) C4'-P energy: -21.298 bonds (distance) P-C4' energy: -27.135 flat angles C4'-P-C4' energy: -21.670 flat angles P-C4'-P energy: -22.060 tors. eta vs tors. theta energy: -36.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -340.726863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.726863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.726863 (E_RNA) where: Base-Base interactions energy: -230.506 where: short stacking energy: -91.954 Base-Backbone interact. energy: -0.595 local terms energy: -109.625116 where: bonds (distance) C4'-P energy: -26.331 bonds (distance) P-C4' energy: -17.382 flat angles C4'-P-C4' energy: -21.900 flat angles P-C4'-P energy: -16.353 tors. eta vs tors. theta energy: -27.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -304.884428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.884428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.884428 (E_RNA) where: Base-Base interactions energy: -198.859 where: short stacking energy: -89.548 Base-Backbone interact. energy: 1.128 local terms energy: -107.153976 where: bonds (distance) C4'-P energy: -18.778 bonds (distance) P-C4' energy: -21.511 flat angles C4'-P-C4' energy: -23.003 flat angles P-C4'-P energy: -17.455 tors. eta vs tors. theta energy: -26.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -224.696253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.696253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.696253 (E_RNA) where: Base-Base interactions energy: -119.980 where: short stacking energy: -70.181 Base-Backbone interact. energy: -0.155 local terms energy: -104.560672 where: bonds (distance) C4'-P energy: -21.837 bonds (distance) P-C4' energy: -19.235 flat angles C4'-P-C4' energy: -25.707 flat angles P-C4'-P energy: -17.023 tors. eta vs tors. theta energy: -20.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -203.273931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.273931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.273931 (E_RNA) where: Base-Base interactions energy: -109.769 where: short stacking energy: -65.877 Base-Backbone interact. energy: 0.374 local terms energy: -93.878993 where: bonds (distance) C4'-P energy: -20.600 bonds (distance) P-C4' energy: -24.229 flat angles C4'-P-C4' energy: -19.653 flat angles P-C4'-P energy: -16.036 tors. eta vs tors. theta energy: -13.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -136.693508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.693508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.693508 (E_RNA) where: Base-Base interactions energy: -55.301 where: short stacking energy: -44.318 Base-Backbone interact. energy: -0.100 local terms energy: -81.292730 where: bonds (distance) C4'-P energy: -18.837 bonds (distance) P-C4' energy: -20.222 flat angles C4'-P-C4' energy: -20.010 flat angles P-C4'-P energy: -14.639 tors. eta vs tors. theta energy: -7.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -118.701054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.701054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.701054 (E_RNA) where: Base-Base interactions energy: -37.632 where: short stacking energy: -35.393 Base-Backbone interact. energy: -1.600 local terms energy: -79.469397 where: bonds (distance) C4'-P energy: -21.116 bonds (distance) P-C4' energy: -23.188 flat angles C4'-P-C4' energy: -20.007 flat angles P-C4'-P energy: -15.687 tors. eta vs tors. theta energy: 0.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -108.720913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.720913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.720913 (E_RNA) where: Base-Base interactions energy: -31.907 where: short stacking energy: -26.831 Base-Backbone interact. energy: -0.493 local terms energy: -76.320395 where: bonds (distance) C4'-P energy: -22.143 bonds (distance) P-C4' energy: -19.857 flat angles C4'-P-C4' energy: -20.984 flat angles P-C4'-P energy: -15.043 tors. eta vs tors. theta energy: 1.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -113.407555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.407555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.407555 (E_RNA) where: Base-Base interactions energy: -50.571 where: short stacking energy: -44.856 Base-Backbone interact. energy: -1.316 local terms energy: -61.520759 where: bonds (distance) C4'-P energy: -19.924 bonds (distance) P-C4' energy: -17.481 flat angles C4'-P-C4' energy: -17.628 flat angles P-C4'-P energy: -9.158 tors. eta vs tors. theta energy: 2.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -411.625453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.625453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.625453 (E_RNA) where: Base-Base interactions energy: -276.016 where: short stacking energy: -125.900 Base-Backbone interact. energy: -0.700 local terms energy: -134.909821 where: bonds (distance) C4'-P energy: -23.509 bonds (distance) P-C4' energy: -26.924 flat angles C4'-P-C4' energy: -25.750 flat angles P-C4'-P energy: -19.899 tors. eta vs tors. theta energy: -38.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -385.733821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.733821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.733821 (E_RNA) where: Base-Base interactions energy: -263.381 where: short stacking energy: -116.066 Base-Backbone interact. energy: -0.610 local terms energy: -121.742822 where: bonds (distance) C4'-P energy: -21.537 bonds (distance) P-C4' energy: -20.522 flat angles C4'-P-C4' energy: -23.323 flat angles P-C4'-P energy: -20.210 tors. eta vs tors. theta energy: -36.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -342.079511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.079511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.079511 (E_RNA) where: Base-Base interactions energy: -224.952 where: short stacking energy: -97.985 Base-Backbone interact. energy: -0.589 local terms energy: -116.538261 where: bonds (distance) C4'-P energy: -24.512 bonds (distance) P-C4' energy: -24.499 flat angles C4'-P-C4' energy: -20.095 flat angles P-C4'-P energy: -17.681 tors. eta vs tors. theta energy: -29.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -293.167455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.167455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.167455 (E_RNA) where: Base-Base interactions energy: -186.197 where: short stacking energy: -90.614 Base-Backbone interact. energy: -0.443 local terms energy: -106.527441 where: bonds (distance) C4'-P energy: -22.529 bonds (distance) P-C4' energy: -23.664 flat angles C4'-P-C4' energy: -25.303 flat angles P-C4'-P energy: -12.805 tors. eta vs tors. theta energy: -22.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -206.470857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.470857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.470857 (E_RNA) where: Base-Base interactions energy: -107.504 where: short stacking energy: -58.835 Base-Backbone interact. energy: -0.069 local terms energy: -98.897252 where: bonds (distance) C4'-P energy: -26.582 bonds (distance) P-C4' energy: -24.688 flat angles C4'-P-C4' energy: -18.611 flat angles P-C4'-P energy: -12.557 tors. eta vs tors. theta energy: -16.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -204.916392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.916392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.916392 (E_RNA) where: Base-Base interactions energy: -111.850 where: short stacking energy: -63.629 Base-Backbone interact. energy: -0.573 local terms energy: -92.492602 where: bonds (distance) C4'-P energy: -16.633 bonds (distance) P-C4' energy: -27.212 flat angles C4'-P-C4' energy: -19.342 flat angles P-C4'-P energy: -15.848 tors. eta vs tors. theta energy: -13.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -200.515774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.515774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.515774 (E_RNA) where: Base-Base interactions energy: -114.377 where: short stacking energy: -49.761 Base-Backbone interact. energy: -0.448 local terms energy: -85.690969 where: bonds (distance) C4'-P energy: -19.944 bonds (distance) P-C4' energy: -19.636 flat angles C4'-P-C4' energy: -23.497 flat angles P-C4'-P energy: -10.983 tors. eta vs tors. theta energy: -11.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -131.375180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.375180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.375180 (E_RNA) where: Base-Base interactions energy: -51.913 where: short stacking energy: -44.607 Base-Backbone interact. energy: 0.043 local terms energy: -79.504500 where: bonds (distance) C4'-P energy: -22.573 bonds (distance) P-C4' energy: -22.299 flat angles C4'-P-C4' energy: -19.178 flat angles P-C4'-P energy: -10.441 tors. eta vs tors. theta energy: -5.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -106.180122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.180122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.180122 (E_RNA) where: Base-Base interactions energy: -37.541 where: short stacking energy: -31.970 Base-Backbone interact. energy: -0.305 local terms energy: -68.334227 where: bonds (distance) C4'-P energy: -11.773 bonds (distance) P-C4' energy: -19.956 flat angles C4'-P-C4' energy: -18.863 flat angles P-C4'-P energy: -12.581 tors. eta vs tors. theta energy: -5.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -113.761906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.761906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.761906 (E_RNA) where: Base-Base interactions energy: -47.096 where: short stacking energy: -31.600 Base-Backbone interact. energy: 0.374 local terms energy: -67.039511 where: bonds (distance) C4'-P energy: -12.012 bonds (distance) P-C4' energy: -26.383 flat angles C4'-P-C4' energy: -11.605 flat angles P-C4'-P energy: -17.036 tors. eta vs tors. theta energy: -0.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -398.894288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.894288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.894288 (E_RNA) where: Base-Base interactions energy: -272.651 where: short stacking energy: -118.343 Base-Backbone interact. energy: -0.251 local terms energy: -125.991905 where: bonds (distance) C4'-P energy: -23.648 bonds (distance) P-C4' energy: -23.084 flat angles C4'-P-C4' energy: -23.733 flat angles P-C4'-P energy: -18.035 tors. eta vs tors. theta energy: -37.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -388.308278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.308278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.308278 (E_RNA) where: Base-Base interactions energy: -270.997 where: short stacking energy: -118.387 Base-Backbone interact. energy: 0.360 local terms energy: -117.671354 where: bonds (distance) C4'-P energy: -20.293 bonds (distance) P-C4' energy: -22.842 flat angles C4'-P-C4' energy: -24.292 flat angles P-C4'-P energy: -13.512 tors. eta vs tors. theta energy: -36.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -350.940342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.940342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.940342 (E_RNA) where: Base-Base interactions energy: -237.170 where: short stacking energy: -98.942 Base-Backbone interact. energy: -0.249 local terms energy: -113.522004 where: bonds (distance) C4'-P energy: -21.373 bonds (distance) P-C4' energy: -20.536 flat angles C4'-P-C4' energy: -26.536 flat angles P-C4'-P energy: -14.530 tors. eta vs tors. theta energy: -30.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -291.453693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.453693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.453693 (E_RNA) where: Base-Base interactions energy: -188.011 where: short stacking energy: -73.980 Base-Backbone interact. energy: -0.136 local terms energy: -103.306892 where: bonds (distance) C4'-P energy: -21.318 bonds (distance) P-C4' energy: -25.480 flat angles C4'-P-C4' energy: -19.511 flat angles P-C4'-P energy: -15.943 tors. eta vs tors. theta energy: -21.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -236.674205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.674205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.674205 (E_RNA) where: Base-Base interactions energy: -136.420 where: short stacking energy: -83.019 Base-Backbone interact. energy: -0.351 local terms energy: -99.903822 where: bonds (distance) C4'-P energy: -22.715 bonds (distance) P-C4' energy: -20.601 flat angles C4'-P-C4' energy: -17.600 flat angles P-C4'-P energy: -15.538 tors. eta vs tors. theta energy: -23.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -192.457675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.457675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.457675 (E_RNA) where: Base-Base interactions energy: -112.835 where: short stacking energy: -70.000 Base-Backbone interact. energy: -0.576 local terms energy: -79.046656 where: bonds (distance) C4'-P energy: -19.128 bonds (distance) P-C4' energy: -13.599 flat angles C4'-P-C4' energy: -22.138 flat angles P-C4'-P energy: -15.841 tors. eta vs tors. theta energy: -8.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -189.114280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.114280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.114280 (E_RNA) where: Base-Base interactions energy: -94.504 where: short stacking energy: -63.679 Base-Backbone interact. energy: -0.731 local terms energy: -93.879244 where: bonds (distance) C4'-P energy: -19.302 bonds (distance) P-C4' energy: -23.979 flat angles C4'-P-C4' energy: -19.880 flat angles P-C4'-P energy: -14.588 tors. eta vs tors. theta energy: -16.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -113.255454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.255454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.255454 (E_RNA) where: Base-Base interactions energy: -34.467 where: short stacking energy: -26.689 Base-Backbone interact. energy: -0.907 local terms energy: -77.880662 where: bonds (distance) C4'-P energy: -19.726 bonds (distance) P-C4' energy: -24.679 flat angles C4'-P-C4' energy: -16.730 flat angles P-C4'-P energy: -15.780 tors. eta vs tors. theta energy: -0.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -114.126603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.126603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.126603 (E_RNA) where: Base-Base interactions energy: -44.699 where: short stacking energy: -34.756 Base-Backbone interact. energy: -0.837 local terms energy: -68.590542 where: bonds (distance) C4'-P energy: -24.332 bonds (distance) P-C4' energy: -24.538 flat angles C4'-P-C4' energy: -9.261 flat angles P-C4'-P energy: -8.696 tors. eta vs tors. theta energy: -1.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -111.427557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.427557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.427557 (E_RNA) where: Base-Base interactions energy: -45.593 where: short stacking energy: -28.075 Base-Backbone interact. energy: -0.844 local terms energy: -64.991178 where: bonds (distance) C4'-P energy: -16.789 bonds (distance) P-C4' energy: -19.258 flat angles C4'-P-C4' energy: -19.923 flat angles P-C4'-P energy: -11.900 tors. eta vs tors. theta energy: 2.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -398.225879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.225879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.225879 (E_RNA) where: Base-Base interactions energy: -270.822 where: short stacking energy: -120.808 Base-Backbone interact. energy: -0.854 local terms energy: -126.549834 where: bonds (distance) C4'-P energy: -23.949 bonds (distance) P-C4' energy: -22.034 flat angles C4'-P-C4' energy: -25.043 flat angles P-C4'-P energy: -17.383 tors. eta vs tors. theta energy: -38.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -385.744973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.744973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.744973 (E_RNA) where: Base-Base interactions energy: -263.319 where: short stacking energy: -119.968 Base-Backbone interact. energy: -0.401 local terms energy: -122.025377 where: bonds (distance) C4'-P energy: -18.817 bonds (distance) P-C4' energy: -23.893 flat angles C4'-P-C4' energy: -23.305 flat angles P-C4'-P energy: -18.434 tors. eta vs tors. theta energy: -37.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -336.318613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.318613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.318613 (E_RNA) where: Base-Base interactions energy: -226.073 where: short stacking energy: -89.953 Base-Backbone interact. energy: -0.870 local terms energy: -109.376265 where: bonds (distance) C4'-P energy: -22.722 bonds (distance) P-C4' energy: -18.717 flat angles C4'-P-C4' energy: -24.363 flat angles P-C4'-P energy: -17.167 tors. eta vs tors. theta energy: -26.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -281.808920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.808920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.808920 (E_RNA) where: Base-Base interactions energy: -182.888 where: short stacking energy: -83.817 Base-Backbone interact. energy: -0.015 local terms energy: -98.905592 where: bonds (distance) C4'-P energy: -19.690 bonds (distance) P-C4' energy: -18.657 flat angles C4'-P-C4' energy: -24.471 flat angles P-C4'-P energy: -14.579 tors. eta vs tors. theta energy: -21.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -241.801334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.801334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.801334 (E_RNA) where: Base-Base interactions energy: -134.505 where: short stacking energy: -71.322 Base-Backbone interact. energy: -0.215 local terms energy: -107.081812 where: bonds (distance) C4'-P energy: -21.357 bonds (distance) P-C4' energy: -25.954 flat angles C4'-P-C4' energy: -26.225 flat angles P-C4'-P energy: -12.535 tors. eta vs tors. theta energy: -21.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -204.635764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.635764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.635764 (E_RNA) where: Base-Base interactions energy: -125.384 where: short stacking energy: -72.220 Base-Backbone interact. energy: -0.166 local terms energy: -79.085709 where: bonds (distance) C4'-P energy: -18.949 bonds (distance) P-C4' energy: -21.087 flat angles C4'-P-C4' energy: -17.701 flat angles P-C4'-P energy: -9.728 tors. eta vs tors. theta energy: -11.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -144.636561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.636561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.636561 (E_RNA) where: Base-Base interactions energy: -63.987 where: short stacking energy: -56.310 Base-Backbone interact. energy: -0.206 local terms energy: -80.442914 where: bonds (distance) C4'-P energy: -19.647 bonds (distance) P-C4' energy: -19.391 flat angles C4'-P-C4' energy: -16.573 flat angles P-C4'-P energy: -10.873 tors. eta vs tors. theta energy: -13.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -124.938328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.938328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.938328 (E_RNA) where: Base-Base interactions energy: -56.974 where: short stacking energy: -37.439 Base-Backbone interact. energy: 0.580 local terms energy: -68.544215 where: bonds (distance) C4'-P energy: -21.723 bonds (distance) P-C4' energy: -22.039 flat angles C4'-P-C4' energy: -17.871 flat angles P-C4'-P energy: -5.174 tors. eta vs tors. theta energy: -1.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -124.380217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.380217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.380217 (E_RNA) where: Base-Base interactions energy: -66.371 where: short stacking energy: -41.596 Base-Backbone interact. energy: -0.303 local terms energy: -57.706577 where: bonds (distance) C4'-P energy: -10.562 bonds (distance) P-C4' energy: -22.403 flat angles C4'-P-C4' energy: -12.008 flat angles P-C4'-P energy: -3.831 tors. eta vs tors. theta energy: -8.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -127.689025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.689025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.689025 (E_RNA) where: Base-Base interactions energy: -61.380 where: short stacking energy: -33.349 Base-Backbone interact. energy: -0.327 local terms energy: -65.982117 where: bonds (distance) C4'-P energy: -19.578 bonds (distance) P-C4' energy: -19.113 flat angles C4'-P-C4' energy: -17.871 flat angles P-C4'-P energy: -6.643 tors. eta vs tors. theta energy: -2.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -398.096385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.096385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.096385 (E_RNA) where: Base-Base interactions energy: -266.305 where: short stacking energy: -122.372 Base-Backbone interact. energy: -0.108 local terms energy: -131.683268 where: bonds (distance) C4'-P energy: -25.605 bonds (distance) P-C4' energy: -25.946 flat angles C4'-P-C4' energy: -27.854 flat angles P-C4'-P energy: -13.711 tors. eta vs tors. theta energy: -38.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -391.632607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.632607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.632607 (E_RNA) where: Base-Base interactions energy: -271.536 where: short stacking energy: -117.432 Base-Backbone interact. energy: -0.233 local terms energy: -119.863154 where: bonds (distance) C4'-P energy: -20.986 bonds (distance) P-C4' energy: -23.894 flat angles C4'-P-C4' energy: -23.105 flat angles P-C4'-P energy: -18.441 tors. eta vs tors. theta energy: -33.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -330.472169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.472169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.472169 (E_RNA) where: Base-Base interactions energy: -216.475 where: short stacking energy: -88.695 Base-Backbone interact. energy: -0.099 local terms energy: -113.898164 where: bonds (distance) C4'-P energy: -23.978 bonds (distance) P-C4' energy: -24.881 flat angles C4'-P-C4' energy: -22.584 flat angles P-C4'-P energy: -15.798 tors. eta vs tors. theta energy: -26.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -279.693362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.693362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.693362 (E_RNA) where: Base-Base interactions energy: -179.413 where: short stacking energy: -87.843 Base-Backbone interact. energy: -0.563 local terms energy: -99.717068 where: bonds (distance) C4'-P energy: -22.151 bonds (distance) P-C4' energy: -22.102 flat angles C4'-P-C4' energy: -20.792 flat angles P-C4'-P energy: -14.804 tors. eta vs tors. theta energy: -19.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -252.094764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.094764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.094764 (E_RNA) where: Base-Base interactions energy: -163.744 where: short stacking energy: -79.946 Base-Backbone interact. energy: -1.444 local terms energy: -86.906682 where: bonds (distance) C4'-P energy: -12.659 bonds (distance) P-C4' energy: -16.425 flat angles C4'-P-C4' energy: -26.490 flat angles P-C4'-P energy: -12.854 tors. eta vs tors. theta energy: -18.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -217.910204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.910204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.910204 (E_RNA) where: Base-Base interactions energy: -140.547 where: short stacking energy: -69.052 Base-Backbone interact. energy: -1.377 local terms energy: -75.986079 where: bonds (distance) C4'-P energy: -14.319 bonds (distance) P-C4' energy: -19.060 flat angles C4'-P-C4' energy: -16.598 flat angles P-C4'-P energy: -10.079 tors. eta vs tors. theta energy: -15.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -124.189266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.189266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.189266 (E_RNA) where: Base-Base interactions energy: -44.411 where: short stacking energy: -44.167 Base-Backbone interact. energy: -0.269 local terms energy: -79.509538 where: bonds (distance) C4'-P energy: -21.162 bonds (distance) P-C4' energy: -22.390 flat angles C4'-P-C4' energy: -22.195 flat angles P-C4'-P energy: -10.590 tors. eta vs tors. theta energy: -3.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -146.057328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.057328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.057328 (E_RNA) where: Base-Base interactions energy: -71.206 where: short stacking energy: -35.528 Base-Backbone interact. energy: -0.512 local terms energy: -74.339771 where: bonds (distance) C4'-P energy: -24.551 bonds (distance) P-C4' energy: -18.473 flat angles C4'-P-C4' energy: -14.712 flat angles P-C4'-P energy: -16.179 tors. eta vs tors. theta energy: -0.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -149.167323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.167323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.167323 (E_RNA) where: Base-Base interactions energy: -72.226 where: short stacking energy: -43.589 Base-Backbone interact. energy: 0.274 local terms energy: -77.215328 where: bonds (distance) C4'-P energy: -18.700 bonds (distance) P-C4' energy: -22.721 flat angles C4'-P-C4' energy: -18.810 flat angles P-C4'-P energy: -16.123 tors. eta vs tors. theta energy: -0.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -113.616670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.616670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.616670 (E_RNA) where: Base-Base interactions energy: -44.339 where: short stacking energy: -44.063 Base-Backbone interact. energy: -0.265 local terms energy: -69.012489 where: bonds (distance) C4'-P energy: -19.216 bonds (distance) P-C4' energy: -17.894 flat angles C4'-P-C4' energy: -15.364 flat angles P-C4'-P energy: -10.435 tors. eta vs tors. theta energy: -6.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -393.500008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.500008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.500008 (E_RNA) where: Base-Base interactions energy: -271.262 where: short stacking energy: -120.459 Base-Backbone interact. energy: -0.497 local terms energy: -121.741433 where: bonds (distance) C4'-P energy: -21.349 bonds (distance) P-C4' energy: -22.040 flat angles C4'-P-C4' energy: -20.907 flat angles P-C4'-P energy: -22.172 tors. eta vs tors. theta energy: -35.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -391.040177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.040177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.040177 (E_RNA) where: Base-Base interactions energy: -264.328 where: short stacking energy: -122.680 Base-Backbone interact. energy: -0.317 local terms energy: -126.394781 where: bonds (distance) C4'-P energy: -24.751 bonds (distance) P-C4' energy: -23.314 flat angles C4'-P-C4' energy: -26.064 flat angles P-C4'-P energy: -14.553 tors. eta vs tors. theta energy: -37.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -326.594299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.594299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.594299 (E_RNA) where: Base-Base interactions energy: -227.197 where: short stacking energy: -97.957 Base-Backbone interact. energy: -0.687 local terms energy: -98.710343 where: bonds (distance) C4'-P energy: -16.922 bonds (distance) P-C4' energy: -18.943 flat angles C4'-P-C4' energy: -19.550 flat angles P-C4'-P energy: -10.993 tors. eta vs tors. theta energy: -32.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -291.661640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.661640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.661640 (E_RNA) where: Base-Base interactions energy: -186.768 where: short stacking energy: -91.031 Base-Backbone interact. energy: -0.183 local terms energy: -104.710251 where: bonds (distance) C4'-P energy: -21.083 bonds (distance) P-C4' energy: -24.337 flat angles C4'-P-C4' energy: -19.282 flat angles P-C4'-P energy: -14.427 tors. eta vs tors. theta energy: -25.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -250.882759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.882759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.882759 (E_RNA) where: Base-Base interactions energy: -148.948 where: short stacking energy: -62.520 Base-Backbone interact. energy: -1.616 local terms energy: -100.318474 where: bonds (distance) C4'-P energy: -22.683 bonds (distance) P-C4' energy: -26.318 flat angles C4'-P-C4' energy: -21.200 flat angles P-C4'-P energy: -13.769 tors. eta vs tors. theta energy: -16.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -210.469247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.469247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.469247 (E_RNA) where: Base-Base interactions energy: -130.882 where: short stacking energy: -61.796 Base-Backbone interact. energy: 0.476 local terms energy: -80.062811 where: bonds (distance) C4'-P energy: -19.992 bonds (distance) P-C4' energy: -15.191 flat angles C4'-P-C4' energy: -15.309 flat angles P-C4'-P energy: -13.707 tors. eta vs tors. theta energy: -15.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -135.257112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.257112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.257112 (E_RNA) where: Base-Base interactions energy: -53.755 where: short stacking energy: -51.260 Base-Backbone interact. energy: -0.116 local terms energy: -81.385664 where: bonds (distance) C4'-P energy: -22.680 bonds (distance) P-C4' energy: -19.191 flat angles C4'-P-C4' energy: -19.705 flat angles P-C4'-P energy: -14.912 tors. eta vs tors. theta energy: -4.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -145.931063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.931063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.931063 (E_RNA) where: Base-Base interactions energy: -65.521 where: short stacking energy: -49.153 Base-Backbone interact. energy: -0.372 local terms energy: -80.038818 where: bonds (distance) C4'-P energy: -22.665 bonds (distance) P-C4' energy: -23.085 flat angles C4'-P-C4' energy: -19.695 flat angles P-C4'-P energy: -7.769 tors. eta vs tors. theta energy: -6.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -126.427554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.427554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.427554 (E_RNA) where: Base-Base interactions energy: -47.346 where: short stacking energy: -41.218 Base-Backbone interact. energy: 0.809 local terms energy: -79.891255 where: bonds (distance) C4'-P energy: -20.543 bonds (distance) P-C4' energy: -22.400 flat angles C4'-P-C4' energy: -17.911 flat angles P-C4'-P energy: -10.425 tors. eta vs tors. theta energy: -8.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -106.078801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.078801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.078801 (E_RNA) where: Base-Base interactions energy: -42.146 where: short stacking energy: -23.115 Base-Backbone interact. energy: -1.634 local terms energy: -62.298881 where: bonds (distance) C4'-P energy: -21.896 bonds (distance) P-C4' energy: -22.917 flat angles C4'-P-C4' energy: -15.784 flat angles P-C4'-P energy: -8.422 tors. eta vs tors. theta energy: 6.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -388.605926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.605926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.605926 (E_RNA) where: Base-Base interactions energy: -264.678 where: short stacking energy: -118.548 Base-Backbone interact. energy: -0.106 local terms energy: -123.822070 where: bonds (distance) C4'-P energy: -17.340 bonds (distance) P-C4' energy: -25.234 flat angles C4'-P-C4' energy: -26.584 flat angles P-C4'-P energy: -20.051 tors. eta vs tors. theta energy: -34.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -390.829899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.829899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.829899 (E_RNA) where: Base-Base interactions energy: -266.375 where: short stacking energy: -115.333 Base-Backbone interact. energy: -0.242 local terms energy: -124.212377 where: bonds (distance) C4'-P energy: -21.817 bonds (distance) P-C4' energy: -23.562 flat angles C4'-P-C4' energy: -25.368 flat angles P-C4'-P energy: -16.495 tors. eta vs tors. theta energy: -36.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -336.289129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.289129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.289129 (E_RNA) where: Base-Base interactions energy: -233.244 where: short stacking energy: -94.872 Base-Backbone interact. energy: -0.108 local terms energy: -102.937121 where: bonds (distance) C4'-P energy: -21.163 bonds (distance) P-C4' energy: -21.630 flat angles C4'-P-C4' energy: -20.084 flat angles P-C4'-P energy: -11.561 tors. eta vs tors. theta energy: -28.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -249.605493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.605493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.605493 (E_RNA) where: Base-Base interactions energy: -138.675 where: short stacking energy: -81.502 Base-Backbone interact. energy: -0.057 local terms energy: -110.873615 where: bonds (distance) C4'-P energy: -24.956 bonds (distance) P-C4' energy: -25.280 flat angles C4'-P-C4' energy: -19.208 flat angles P-C4'-P energy: -15.245 tors. eta vs tors. theta energy: -26.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -270.336361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.336361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.336361 (E_RNA) where: Base-Base interactions energy: -182.237 where: short stacking energy: -84.958 Base-Backbone interact. energy: -0.122 local terms energy: -87.976776 where: bonds (distance) C4'-P energy: -17.102 bonds (distance) P-C4' energy: -20.273 flat angles C4'-P-C4' energy: -16.732 flat angles P-C4'-P energy: -14.007 tors. eta vs tors. theta energy: -19.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -193.425865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.425865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.425865 (E_RNA) where: Base-Base interactions energy: -101.050 where: short stacking energy: -54.385 Base-Backbone interact. energy: -0.209 local terms energy: -92.167216 where: bonds (distance) C4'-P energy: -17.635 bonds (distance) P-C4' energy: -24.951 flat angles C4'-P-C4' energy: -23.968 flat angles P-C4'-P energy: -16.124 tors. eta vs tors. theta energy: -9.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -121.916859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.916859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.916859 (E_RNA) where: Base-Base interactions energy: -48.471 where: short stacking energy: -29.591 Base-Backbone interact. energy: -1.326 local terms energy: -72.120186 where: bonds (distance) C4'-P energy: -20.985 bonds (distance) P-C4' energy: -26.643 flat angles C4'-P-C4' energy: -19.560 flat angles P-C4'-P energy: -8.192 tors. eta vs tors. theta energy: 3.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -122.480861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.480861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.480861 (E_RNA) where: Base-Base interactions energy: -44.269 where: short stacking energy: -38.591 Base-Backbone interact. energy: -0.180 local terms energy: -78.032113 where: bonds (distance) C4'-P energy: -18.614 bonds (distance) P-C4' energy: -20.974 flat angles C4'-P-C4' energy: -18.153 flat angles P-C4'-P energy: -13.490 tors. eta vs tors. theta energy: -6.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -113.142369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.142369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.142369 (E_RNA) where: Base-Base interactions energy: -40.303 where: short stacking energy: -30.797 Base-Backbone interact. energy: 0.223 local terms energy: -73.062717 where: bonds (distance) C4'-P energy: -19.690 bonds (distance) P-C4' energy: -18.880 flat angles C4'-P-C4' energy: -16.289 flat angles P-C4'-P energy: -15.225 tors. eta vs tors. theta energy: -2.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -116.339774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.339774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.339774 (E_RNA) where: Base-Base interactions energy: -46.964 where: short stacking energy: -47.258 Base-Backbone interact. energy: 1.624 local terms energy: -71.000429 where: bonds (distance) C4'-P energy: -21.755 bonds (distance) P-C4' energy: -11.206 flat angles C4'-P-C4' energy: -23.881 flat angles P-C4'-P energy: -9.050 tors. eta vs tors. theta energy: -5.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -389.936711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.936711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.936711 (E_RNA) where: Base-Base interactions energy: -266.751 where: short stacking energy: -113.324 Base-Backbone interact. energy: -0.016 local terms energy: -123.169944 where: bonds (distance) C4'-P energy: -20.116 bonds (distance) P-C4' energy: -23.902 flat angles C4'-P-C4' energy: -26.489 flat angles P-C4'-P energy: -17.700 tors. eta vs tors. theta energy: -34.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -386.759986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.759986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.759986 (E_RNA) where: Base-Base interactions energy: -260.898 where: short stacking energy: -118.028 Base-Backbone interact. energy: -0.094 local terms energy: -125.768921 where: bonds (distance) C4'-P energy: -22.163 bonds (distance) P-C4' energy: -25.226 flat angles C4'-P-C4' energy: -23.091 flat angles P-C4'-P energy: -18.098 tors. eta vs tors. theta energy: -37.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -357.756659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.756659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.756659 (E_RNA) where: Base-Base interactions energy: -237.555 where: short stacking energy: -98.991 Base-Backbone interact. energy: -0.113 local terms energy: -120.089120 where: bonds (distance) C4'-P energy: -20.462 bonds (distance) P-C4' energy: -24.093 flat angles C4'-P-C4' energy: -26.213 flat angles P-C4'-P energy: -13.609 tors. eta vs tors. theta energy: -35.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -298.064822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.064822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.064822 (E_RNA) where: Base-Base interactions energy: -178.336 where: short stacking energy: -94.052 Base-Backbone interact. energy: -0.907 local terms energy: -118.821233 where: bonds (distance) C4'-P energy: -23.840 bonds (distance) P-C4' energy: -23.158 flat angles C4'-P-C4' energy: -23.003 flat angles P-C4'-P energy: -17.730 tors. eta vs tors. theta energy: -31.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -258.649642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.649642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.649642 (E_RNA) where: Base-Base interactions energy: -159.000 where: short stacking energy: -70.845 Base-Backbone interact. energy: -0.571 local terms energy: -99.078714 where: bonds (distance) C4'-P energy: -17.115 bonds (distance) P-C4' energy: -27.403 flat angles C4'-P-C4' energy: -22.409 flat angles P-C4'-P energy: -15.636 tors. eta vs tors. theta energy: -16.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -197.971581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.971581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.971581 (E_RNA) where: Base-Base interactions energy: -111.296 where: short stacking energy: -60.070 Base-Backbone interact. energy: -0.123 local terms energy: -86.552752 where: bonds (distance) C4'-P energy: -15.277 bonds (distance) P-C4' energy: -23.956 flat angles C4'-P-C4' energy: -21.446 flat angles P-C4'-P energy: -15.283 tors. eta vs tors. theta energy: -10.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -128.346462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.346462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.346462 (E_RNA) where: Base-Base interactions energy: -47.415 where: short stacking energy: -47.415 Base-Backbone interact. energy: -0.163 local terms energy: -80.768486 where: bonds (distance) C4'-P energy: -19.063 bonds (distance) P-C4' energy: -26.047 flat angles C4'-P-C4' energy: -21.357 flat angles P-C4'-P energy: -9.292 tors. eta vs tors. theta energy: -5.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -133.514650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.514650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.514650 (E_RNA) where: Base-Base interactions energy: -59.336 where: short stacking energy: -29.722 Base-Backbone interact. energy: -0.525 local terms energy: -73.653812 where: bonds (distance) C4'-P energy: -18.696 bonds (distance) P-C4' energy: -25.008 flat angles C4'-P-C4' energy: -19.478 flat angles P-C4'-P energy: -9.008 tors. eta vs tors. theta energy: -1.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -116.615178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.615178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.615178 (E_RNA) where: Base-Base interactions energy: -46.700 where: short stacking energy: -41.217 Base-Backbone interact. energy: -1.134 local terms energy: -68.781026 where: bonds (distance) C4'-P energy: -24.751 bonds (distance) P-C4' energy: -17.918 flat angles C4'-P-C4' energy: -17.523 flat angles P-C4'-P energy: -8.321 tors. eta vs tors. theta energy: -0.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -113.959346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.959346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.959346 (E_RNA) where: Base-Base interactions energy: -40.344 where: short stacking energy: -27.923 Base-Backbone interact. energy: -0.141 local terms energy: -73.474232 where: bonds (distance) C4'-P energy: -19.440 bonds (distance) P-C4' energy: -18.273 flat angles C4'-P-C4' energy: -19.421 flat angles P-C4'-P energy: -14.055 tors. eta vs tors. theta energy: -2.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -389.228974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.228974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.228974 (E_RNA) where: Base-Base interactions energy: -256.568 where: short stacking energy: -119.534 Base-Backbone interact. energy: -0.001 local terms energy: -132.660659 where: bonds (distance) C4'-P energy: -25.287 bonds (distance) P-C4' energy: -25.014 flat angles C4'-P-C4' energy: -26.721 flat angles P-C4'-P energy: -19.615 tors. eta vs tors. theta energy: -36.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -392.567779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.567779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.567779 (E_RNA) where: Base-Base interactions energy: -263.798 where: short stacking energy: -116.231 Base-Backbone interact. energy: -0.434 local terms energy: -128.336533 where: bonds (distance) C4'-P energy: -22.015 bonds (distance) P-C4' energy: -25.381 flat angles C4'-P-C4' energy: -28.534 flat angles P-C4'-P energy: -18.134 tors. eta vs tors. theta energy: -34.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -347.565187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.565187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.565187 (E_RNA) where: Base-Base interactions energy: -225.828 where: short stacking energy: -89.739 Base-Backbone interact. energy: -0.782 local terms energy: -120.955759 where: bonds (distance) C4'-P energy: -19.055 bonds (distance) P-C4' energy: -25.682 flat angles C4'-P-C4' energy: -23.966 flat angles P-C4'-P energy: -19.151 tors. eta vs tors. theta energy: -33.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -287.869826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.869826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.869826 (E_RNA) where: Base-Base interactions energy: -185.452 where: short stacking energy: -90.238 Base-Backbone interact. energy: -0.726 local terms energy: -101.691987 where: bonds (distance) C4'-P energy: -16.617 bonds (distance) P-C4' energy: -23.361 flat angles C4'-P-C4' energy: -22.310 flat angles P-C4'-P energy: -13.406 tors. eta vs tors. theta energy: -25.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -266.984837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.984837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.984837 (E_RNA) where: Base-Base interactions energy: -162.777 where: short stacking energy: -74.896 Base-Backbone interact. energy: -0.005 local terms energy: -104.202771 where: bonds (distance) C4'-P energy: -19.540 bonds (distance) P-C4' energy: -24.335 flat angles C4'-P-C4' energy: -21.514 flat angles P-C4'-P energy: -15.808 tors. eta vs tors. theta energy: -23.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -196.959435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.959435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.959435 (E_RNA) where: Base-Base interactions energy: -111.866 where: short stacking energy: -52.709 Base-Backbone interact. energy: 0.083 local terms energy: -85.176569 where: bonds (distance) C4'-P energy: -23.071 bonds (distance) P-C4' energy: -21.006 flat angles C4'-P-C4' energy: -21.945 flat angles P-C4'-P energy: -11.368 tors. eta vs tors. theta energy: -7.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -145.572811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.572811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.572811 (E_RNA) where: Base-Base interactions energy: -64.280 where: short stacking energy: -46.534 Base-Backbone interact. energy: 0.166 local terms energy: -81.458838 where: bonds (distance) C4'-P energy: -18.327 bonds (distance) P-C4' energy: -23.864 flat angles C4'-P-C4' energy: -14.285 flat angles P-C4'-P energy: -12.841 tors. eta vs tors. theta energy: -12.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -124.172709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.172709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.172709 (E_RNA) where: Base-Base interactions energy: -57.665 where: short stacking energy: -20.417 Base-Backbone interact. energy: -0.772 local terms energy: -65.736404 where: bonds (distance) C4'-P energy: -21.539 bonds (distance) P-C4' energy: -22.217 flat angles C4'-P-C4' energy: -13.005 flat angles P-C4'-P energy: -10.354 tors. eta vs tors. theta energy: 1.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -122.836326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.836326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.836326 (E_RNA) where: Base-Base interactions energy: -47.662 where: short stacking energy: -38.611 Base-Backbone interact. energy: -2.032 local terms energy: -73.142064 where: bonds (distance) C4'-P energy: -20.083 bonds (distance) P-C4' energy: -18.314 flat angles C4'-P-C4' energy: -21.231 flat angles P-C4'-P energy: -15.041 tors. eta vs tors. theta energy: 1.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -117.008300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.008300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.008300 (E_RNA) where: Base-Base interactions energy: -42.589 where: short stacking energy: -37.378 Base-Backbone interact. energy: 0.192 local terms energy: -74.611516 where: bonds (distance) C4'-P energy: -22.260 bonds (distance) P-C4' energy: -22.473 flat angles C4'-P-C4' energy: -18.986 flat angles P-C4'-P energy: -8.063 tors. eta vs tors. theta energy: -2.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -391.109284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.109284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.109284 (E_RNA) where: Base-Base interactions energy: -263.676 where: short stacking energy: -112.854 Base-Backbone interact. energy: -1.411 local terms energy: -126.022199 where: bonds (distance) C4'-P energy: -25.609 bonds (distance) P-C4' energy: -24.835 flat angles C4'-P-C4' energy: -25.203 flat angles P-C4'-P energy: -16.745 tors. eta vs tors. theta energy: -33.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -389.257481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.257481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.257481 (E_RNA) where: Base-Base interactions energy: -262.878 where: short stacking energy: -119.576 Base-Backbone interact. energy: -0.422 local terms energy: -125.957835 where: bonds (distance) C4'-P energy: -22.736 bonds (distance) P-C4' energy: -26.664 flat angles C4'-P-C4' energy: -25.027 flat angles P-C4'-P energy: -13.051 tors. eta vs tors. theta energy: -38.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -348.244295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.244295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.244295 (E_RNA) where: Base-Base interactions energy: -226.663 where: short stacking energy: -102.965 Base-Backbone interact. energy: -0.165 local terms energy: -121.416062 where: bonds (distance) C4'-P energy: -25.390 bonds (distance) P-C4' energy: -22.874 flat angles C4'-P-C4' energy: -22.852 flat angles P-C4'-P energy: -13.241 tors. eta vs tors. theta energy: -37.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -292.388000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.388000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.388000 (E_RNA) where: Base-Base interactions energy: -188.013 where: short stacking energy: -86.874 Base-Backbone interact. energy: -0.407 local terms energy: -103.968207 where: bonds (distance) C4'-P energy: -16.629 bonds (distance) P-C4' energy: -19.333 flat angles C4'-P-C4' energy: -24.298 flat angles P-C4'-P energy: -9.595 tors. eta vs tors. theta energy: -34.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -238.948414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.948414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.948414 (E_RNA) where: Base-Base interactions energy: -151.308 where: short stacking energy: -74.984 Base-Backbone interact. energy: -0.456 local terms energy: -87.184025 where: bonds (distance) C4'-P energy: -17.549 bonds (distance) P-C4' energy: -16.571 flat angles C4'-P-C4' energy: -19.971 flat angles P-C4'-P energy: -15.525 tors. eta vs tors. theta energy: -17.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -207.804826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.804826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.804826 (E_RNA) where: Base-Base interactions energy: -114.953 where: short stacking energy: -57.748 Base-Backbone interact. energy: -0.172 local terms energy: -92.679647 where: bonds (distance) C4'-P energy: -21.867 bonds (distance) P-C4' energy: -24.430 flat angles C4'-P-C4' energy: -19.797 flat angles P-C4'-P energy: -8.434 tors. eta vs tors. theta energy: -18.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -118.030588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.030588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.030588 (E_RNA) where: Base-Base interactions energy: -45.332 where: short stacking energy: -29.752 Base-Backbone interact. energy: -0.385 local terms energy: -72.314023 where: bonds (distance) C4'-P energy: -22.892 bonds (distance) P-C4' energy: -14.775 flat angles C4'-P-C4' energy: -20.589 flat angles P-C4'-P energy: -12.661 tors. eta vs tors. theta energy: -1.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -119.918425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.918425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.918425 (E_RNA) where: Base-Base interactions energy: -46.639 where: short stacking energy: -44.798 Base-Backbone interact. energy: -0.228 local terms energy: -73.051220 where: bonds (distance) C4'-P energy: -20.456 bonds (distance) P-C4' energy: -20.725 flat angles C4'-P-C4' energy: -18.505 flat angles P-C4'-P energy: -4.330 tors. eta vs tors. theta energy: -9.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -110.630192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.630192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.630192 (E_RNA) where: Base-Base interactions energy: -36.791 where: short stacking energy: -31.233 Base-Backbone interact. energy: -0.058 local terms energy: -73.780307 where: bonds (distance) C4'-P energy: -23.791 bonds (distance) P-C4' energy: -19.701 flat angles C4'-P-C4' energy: -17.561 flat angles P-C4'-P energy: -9.318 tors. eta vs tors. theta energy: -3.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -108.248342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.248342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.248342 (E_RNA) where: Base-Base interactions energy: -34.726 where: short stacking energy: -34.726 Base-Backbone interact. energy: -0.225 local terms energy: -73.297460 where: bonds (distance) C4'-P energy: -20.580 bonds (distance) P-C4' energy: -23.185 flat angles C4'-P-C4' energy: -16.394 flat angles P-C4'-P energy: -10.797 tors. eta vs tors. theta energy: -2.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -398.528260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.528260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.528260 (E_RNA) where: Base-Base interactions energy: -270.518 where: short stacking energy: -122.090 Base-Backbone interact. energy: -0.000 local terms energy: -128.010540 where: bonds (distance) C4'-P energy: -27.521 bonds (distance) P-C4' energy: -22.791 flat angles C4'-P-C4' energy: -23.592 flat angles P-C4'-P energy: -17.745 tors. eta vs tors. theta energy: -36.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -366.222827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.222827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.222827 (E_RNA) where: Base-Base interactions energy: -250.770 where: short stacking energy: -103.465 Base-Backbone interact. energy: -0.010 local terms energy: -115.442990 where: bonds (distance) C4'-P energy: -17.494 bonds (distance) P-C4' energy: -23.453 flat angles C4'-P-C4' energy: -24.023 flat angles P-C4'-P energy: -16.608 tors. eta vs tors. theta energy: -33.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -380.656263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.656263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.656263 (E_RNA) where: Base-Base interactions energy: -260.605 where: short stacking energy: -113.407 Base-Backbone interact. energy: -0.609 local terms energy: -119.441847 where: bonds (distance) C4'-P energy: -18.155 bonds (distance) P-C4' energy: -25.940 flat angles C4'-P-C4' energy: -25.120 flat angles P-C4'-P energy: -14.574 tors. eta vs tors. theta energy: -35.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -293.409892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.409892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.409892 (E_RNA) where: Base-Base interactions energy: -181.899 where: short stacking energy: -89.781 Base-Backbone interact. energy: -0.906 local terms energy: -110.604736 where: bonds (distance) C4'-P energy: -24.254 bonds (distance) P-C4' energy: -19.539 flat angles C4'-P-C4' energy: -21.722 flat angles P-C4'-P energy: -17.274 tors. eta vs tors. theta energy: -27.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -294.567645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.567645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.567645 (E_RNA) where: Base-Base interactions energy: -192.689 where: short stacking energy: -92.849 Base-Backbone interact. energy: -1.102 local terms energy: -100.777027 where: bonds (distance) C4'-P energy: -16.752 bonds (distance) P-C4' energy: -20.714 flat angles C4'-P-C4' energy: -21.106 flat angles P-C4'-P energy: -16.074 tors. eta vs tors. theta energy: -26.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -171.281492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.281492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.281492 (E_RNA) where: Base-Base interactions energy: -89.917 where: short stacking energy: -53.672 Base-Backbone interact. energy: -1.175 local terms energy: -80.190235 where: bonds (distance) C4'-P energy: -18.944 bonds (distance) P-C4' energy: -22.036 flat angles C4'-P-C4' energy: -15.110 flat angles P-C4'-P energy: -16.503 tors. eta vs tors. theta energy: -7.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -190.985010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.985010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.985010 (E_RNA) where: Base-Base interactions energy: -107.402 where: short stacking energy: -60.133 Base-Backbone interact. energy: -0.015 local terms energy: -83.568211 where: bonds (distance) C4'-P energy: -17.030 bonds (distance) P-C4' energy: -22.843 flat angles C4'-P-C4' energy: -20.366 flat angles P-C4'-P energy: -11.914 tors. eta vs tors. theta energy: -11.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -118.110286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.110286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.110286 (E_RNA) where: Base-Base interactions energy: -47.842 where: short stacking energy: -47.805 Base-Backbone interact. energy: -0.285 local terms energy: -69.983449 where: bonds (distance) C4'-P energy: -22.958 bonds (distance) P-C4' energy: -18.035 flat angles C4'-P-C4' energy: -19.528 flat angles P-C4'-P energy: -5.405 tors. eta vs tors. theta energy: -4.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -115.542687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.542687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.542687 (E_RNA) where: Base-Base interactions energy: -41.960 where: short stacking energy: -41.406 Base-Backbone interact. energy: -0.397 local terms energy: -73.185244 where: bonds (distance) C4'-P energy: -23.178 bonds (distance) P-C4' energy: -18.594 flat angles C4'-P-C4' energy: -16.241 flat angles P-C4'-P energy: -12.265 tors. eta vs tors. theta energy: -2.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -112.741218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.741218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.741218 (E_RNA) where: Base-Base interactions energy: -54.589 where: short stacking energy: -47.500 Base-Backbone interact. energy: -0.085 local terms energy: -58.067169 where: bonds (distance) C4'-P energy: -13.867 bonds (distance) P-C4' energy: -18.727 flat angles C4'-P-C4' energy: -16.258 flat angles P-C4'-P energy: -5.431 tors. eta vs tors. theta energy: -3.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -390.707414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.707414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.707414 (E_RNA) where: Base-Base interactions energy: -264.909 where: short stacking energy: -119.475 Base-Backbone interact. energy: -0.021 local terms energy: -125.778241 where: bonds (distance) C4'-P energy: -19.281 bonds (distance) P-C4' energy: -23.098 flat angles C4'-P-C4' energy: -25.519 flat angles P-C4'-P energy: -20.043 tors. eta vs tors. theta energy: -37.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -365.854423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.854423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.854423 (E_RNA) where: Base-Base interactions energy: -249.615 where: short stacking energy: -104.526 Base-Backbone interact. energy: -0.014 local terms energy: -116.224626 where: bonds (distance) C4'-P energy: -23.638 bonds (distance) P-C4' energy: -24.131 flat angles C4'-P-C4' energy: -23.659 flat angles P-C4'-P energy: -12.361 tors. eta vs tors. theta energy: -32.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -372.408132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.408132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.408132 (E_RNA) where: Base-Base interactions energy: -248.443 where: short stacking energy: -118.181 Base-Backbone interact. energy: -0.020 local terms energy: -123.945211 where: bonds (distance) C4'-P energy: -17.899 bonds (distance) P-C4' energy: -25.322 flat angles C4'-P-C4' energy: -25.509 flat angles P-C4'-P energy: -17.836 tors. eta vs tors. theta energy: -37.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -283.981867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.981867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.981867 (E_RNA) where: Base-Base interactions energy: -175.425 where: short stacking energy: -82.873 Base-Backbone interact. energy: -0.037 local terms energy: -108.519635 where: bonds (distance) C4'-P energy: -27.468 bonds (distance) P-C4' energy: -20.957 flat angles C4'-P-C4' energy: -20.910 flat angles P-C4'-P energy: -14.141 tors. eta vs tors. theta energy: -25.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -294.782851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.782851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.782851 (E_RNA) where: Base-Base interactions energy: -190.263 where: short stacking energy: -89.960 Base-Backbone interact. energy: -0.368 local terms energy: -104.151706 where: bonds (distance) C4'-P energy: -17.447 bonds (distance) P-C4' energy: -23.895 flat angles C4'-P-C4' energy: -22.684 flat angles P-C4'-P energy: -12.025 tors. eta vs tors. theta energy: -28.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -136.972098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.972098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.972098 (E_RNA) where: Base-Base interactions energy: -57.108 where: short stacking energy: -55.687 Base-Backbone interact. energy: -1.561 local terms energy: -78.302865 where: bonds (distance) C4'-P energy: -15.663 bonds (distance) P-C4' energy: -22.558 flat angles C4'-P-C4' energy: -15.961 flat angles P-C4'-P energy: -12.123 tors. eta vs tors. theta energy: -11.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -129.710270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.710270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.710270 (E_RNA) where: Base-Base interactions energy: -46.083 where: short stacking energy: -46.083 Base-Backbone interact. energy: -0.118 local terms energy: -83.509284 where: bonds (distance) C4'-P energy: -21.935 bonds (distance) P-C4' energy: -24.839 flat angles C4'-P-C4' energy: -12.433 flat angles P-C4'-P energy: -13.016 tors. eta vs tors. theta energy: -11.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -195.750274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.750274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.750274 (E_RNA) where: Base-Base interactions energy: -104.180 where: short stacking energy: -57.653 Base-Backbone interact. energy: -0.499 local terms energy: -91.071168 where: bonds (distance) C4'-P energy: -21.668 bonds (distance) P-C4' energy: -21.655 flat angles C4'-P-C4' energy: -17.823 flat angles P-C4'-P energy: -14.620 tors. eta vs tors. theta energy: -15.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -119.458189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.458189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.458189 (E_RNA) where: Base-Base interactions energy: -43.097 where: short stacking energy: -35.591 Base-Backbone interact. energy: -1.492 local terms energy: -74.869064 where: bonds (distance) C4'-P energy: -19.866 bonds (distance) P-C4' energy: -22.355 flat angles C4'-P-C4' energy: -20.247 flat angles P-C4'-P energy: -8.713 tors. eta vs tors. theta energy: -3.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -106.724666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.724666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.724666 (E_RNA) where: Base-Base interactions energy: -35.481 where: short stacking energy: -33.619 Base-Backbone interact. energy: 0.336 local terms energy: -71.579798 where: bonds (distance) C4'-P energy: -19.830 bonds (distance) P-C4' energy: -23.719 flat angles C4'-P-C4' energy: -22.187 flat angles P-C4'-P energy: -3.716 tors. eta vs tors. theta energy: -2.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -390.555486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.555486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.555486 (E_RNA) where: Base-Base interactions energy: -258.953 where: short stacking energy: -116.408 Base-Backbone interact. energy: -0.572 local terms energy: -131.030471 where: bonds (distance) C4'-P energy: -25.608 bonds (distance) P-C4' energy: -25.407 flat angles C4'-P-C4' energy: -25.973 flat angles P-C4'-P energy: -18.770 tors. eta vs tors. theta energy: -35.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -380.379737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.379737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.379737 (E_RNA) where: Base-Base interactions energy: -259.235 where: short stacking energy: -114.288 Base-Backbone interact. energy: -0.005 local terms energy: -121.140381 where: bonds (distance) C4'-P energy: -22.988 bonds (distance) P-C4' energy: -18.664 flat angles C4'-P-C4' energy: -26.836 flat angles P-C4'-P energy: -16.289 tors. eta vs tors. theta energy: -36.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -356.453528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.453528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.453528 (E_RNA) where: Base-Base interactions energy: -242.744 where: short stacking energy: -98.610 Base-Backbone interact. energy: -0.649 local terms energy: -113.060670 where: bonds (distance) C4'-P energy: -17.835 bonds (distance) P-C4' energy: -21.121 flat angles C4'-P-C4' energy: -26.183 flat angles P-C4'-P energy: -15.690 tors. eta vs tors. theta energy: -32.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -291.180004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.180004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.180004 (E_RNA) where: Base-Base interactions energy: -180.193 where: short stacking energy: -82.481 Base-Backbone interact. energy: 0.243 local terms energy: -111.230004 where: bonds (distance) C4'-P energy: -24.101 bonds (distance) P-C4' energy: -22.908 flat angles C4'-P-C4' energy: -21.343 flat angles P-C4'-P energy: -14.950 tors. eta vs tors. theta energy: -27.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -261.877677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.877677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.877677 (E_RNA) where: Base-Base interactions energy: -159.854 where: short stacking energy: -81.882 Base-Backbone interact. energy: -0.118 local terms energy: -101.905644 where: bonds (distance) C4'-P energy: -22.582 bonds (distance) P-C4' energy: -27.048 flat angles C4'-P-C4' energy: -20.766 flat angles P-C4'-P energy: -13.812 tors. eta vs tors. theta energy: -17.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -136.655625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.655625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.655625 (E_RNA) where: Base-Base interactions energy: -56.315 where: short stacking energy: -40.595 Base-Backbone interact. energy: 2.724 local terms energy: -83.064003 where: bonds (distance) C4'-P energy: -20.984 bonds (distance) P-C4' energy: -20.015 flat angles C4'-P-C4' energy: -22.441 flat angles P-C4'-P energy: -13.446 tors. eta vs tors. theta energy: -6.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -139.021139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.021139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.021139 (E_RNA) where: Base-Base interactions energy: -64.889 where: short stacking energy: -43.139 Base-Backbone interact. energy: -0.649 local terms energy: -73.482902 where: bonds (distance) C4'-P energy: -24.112 bonds (distance) P-C4' energy: -19.370 flat angles C4'-P-C4' energy: -19.966 flat angles P-C4'-P energy: -6.155 tors. eta vs tors. theta energy: -3.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -125.455158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.455158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.455158 (E_RNA) where: Base-Base interactions energy: -58.605 where: short stacking energy: -38.629 Base-Backbone interact. energy: -0.382 local terms energy: -66.468179 where: bonds (distance) C4'-P energy: -19.867 bonds (distance) P-C4' energy: -20.480 flat angles C4'-P-C4' energy: -15.386 flat angles P-C4'-P energy: -8.176 tors. eta vs tors. theta energy: -2.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -173.258018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.258018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.258018 (E_RNA) where: Base-Base interactions energy: -99.417 where: short stacking energy: -50.525 Base-Backbone interact. energy: 0.002 local terms energy: -73.842401 where: bonds (distance) C4'-P energy: -16.708 bonds (distance) P-C4' energy: -22.976 flat angles C4'-P-C4' energy: -21.804 flat angles P-C4'-P energy: -8.030 tors. eta vs tors. theta energy: -4.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -119.010192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.010192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.010192 (E_RNA) where: Base-Base interactions energy: -53.032 where: short stacking energy: -40.416 Base-Backbone interact. energy: -0.396 local terms energy: -65.581655 where: bonds (distance) C4'-P energy: -22.739 bonds (distance) P-C4' energy: -8.804 flat angles C4'-P-C4' energy: -16.895 flat angles P-C4'-P energy: -16.902 tors. eta vs tors. theta energy: -0.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -381.733031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.733031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.733031 (E_RNA) where: Base-Base interactions energy: -260.369 where: short stacking energy: -108.391 Base-Backbone interact. energy: 0.498 local terms energy: -121.862376 where: bonds (distance) C4'-P energy: -24.015 bonds (distance) P-C4' energy: -19.608 flat angles C4'-P-C4' energy: -23.876 flat angles P-C4'-P energy: -19.507 tors. eta vs tors. theta energy: -34.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -390.531718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.531718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.531718 (E_RNA) where: Base-Base interactions energy: -261.562 where: short stacking energy: -124.494 Base-Backbone interact. energy: -0.006 local terms energy: -128.963496 where: bonds (distance) C4'-P energy: -23.663 bonds (distance) P-C4' energy: -22.243 flat angles C4'-P-C4' energy: -27.615 flat angles P-C4'-P energy: -18.132 tors. eta vs tors. theta energy: -37.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -343.346700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.346700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.346700 (E_RNA) where: Base-Base interactions energy: -232.740 where: short stacking energy: -107.075 Base-Backbone interact. energy: -0.152 local terms energy: -110.454557 where: bonds (distance) C4'-P energy: -18.132 bonds (distance) P-C4' energy: -22.812 flat angles C4'-P-C4' energy: -26.068 flat angles P-C4'-P energy: -13.595 tors. eta vs tors. theta energy: -29.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -270.211592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.211592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.211592 (E_RNA) where: Base-Base interactions energy: -171.818 where: short stacking energy: -82.786 Base-Backbone interact. energy: -0.096 local terms energy: -98.297355 where: bonds (distance) C4'-P energy: -26.928 bonds (distance) P-C4' energy: -19.390 flat angles C4'-P-C4' energy: -17.072 flat angles P-C4'-P energy: -13.143 tors. eta vs tors. theta energy: -21.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -270.442005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.442005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.442005 (E_RNA) where: Base-Base interactions energy: -168.513 where: short stacking energy: -79.754 Base-Backbone interact. energy: -0.185 local terms energy: -101.744132 where: bonds (distance) C4'-P energy: -25.455 bonds (distance) P-C4' energy: -22.295 flat angles C4'-P-C4' energy: -20.923 flat angles P-C4'-P energy: -11.764 tors. eta vs tors. theta energy: -21.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -208.242006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.242006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.242006 (E_RNA) where: Base-Base interactions energy: -126.550 where: short stacking energy: -70.468 Base-Backbone interact. energy: -0.172 local terms energy: -81.520638 where: bonds (distance) C4'-P energy: -18.037 bonds (distance) P-C4' energy: -19.572 flat angles C4'-P-C4' energy: -16.461 flat angles P-C4'-P energy: -12.784 tors. eta vs tors. theta energy: -14.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -137.055401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.055401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.055401 (E_RNA) where: Base-Base interactions energy: -65.682 where: short stacking energy: -44.265 Base-Backbone interact. energy: -0.174 local terms energy: -71.200272 where: bonds (distance) C4'-P energy: -14.132 bonds (distance) P-C4' energy: -18.373 flat angles C4'-P-C4' energy: -13.858 flat angles P-C4'-P energy: -11.485 tors. eta vs tors. theta energy: -13.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -122.963449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.963449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.963449 (E_RNA) where: Base-Base interactions energy: -49.631 where: short stacking energy: -40.682 Base-Backbone interact. energy: 0.114 local terms energy: -73.445738 where: bonds (distance) C4'-P energy: -17.999 bonds (distance) P-C4' energy: -25.085 flat angles C4'-P-C4' energy: -17.390 flat angles P-C4'-P energy: -10.713 tors. eta vs tors. theta energy: -2.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -115.974897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.974897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.974897 (E_RNA) where: Base-Base interactions energy: -44.180 where: short stacking energy: -36.631 Base-Backbone interact. energy: -0.172 local terms energy: -71.622744 where: bonds (distance) C4'-P energy: -21.637 bonds (distance) P-C4' energy: -25.649 flat angles C4'-P-C4' energy: -13.056 flat angles P-C4'-P energy: -13.364 tors. eta vs tors. theta energy: 2.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -151.412554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.412554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.412554 (E_RNA) where: Base-Base interactions energy: -84.989 where: short stacking energy: -40.937 Base-Backbone interact. energy: -1.448 local terms energy: -64.975216 where: bonds (distance) C4'-P energy: -15.491 bonds (distance) P-C4' energy: -24.392 flat angles C4'-P-C4' energy: -18.874 flat angles P-C4'-P energy: -8.145 tors. eta vs tors. theta energy: 1.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -401.275414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.275414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.275414 (E_RNA) where: Base-Base interactions energy: -274.417 where: short stacking energy: -124.664 Base-Backbone interact. energy: 0.471 local terms energy: -127.329329 where: bonds (distance) C4'-P energy: -24.123 bonds (distance) P-C4' energy: -19.826 flat angles C4'-P-C4' energy: -29.515 flat angles P-C4'-P energy: -19.053 tors. eta vs tors. theta energy: -34.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -386.861731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.861731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.861731 (E_RNA) where: Base-Base interactions energy: -257.452 where: short stacking energy: -117.064 Base-Backbone interact. energy: -1.209 local terms energy: -128.200610 where: bonds (distance) C4'-P energy: -19.386 bonds (distance) P-C4' energy: -25.138 flat angles C4'-P-C4' energy: -26.363 flat angles P-C4'-P energy: -17.914 tors. eta vs tors. theta energy: -39.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -334.724110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.724110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.724110 (E_RNA) where: Base-Base interactions energy: -215.900 where: short stacking energy: -97.434 Base-Backbone interact. energy: -0.043 local terms energy: -118.780428 where: bonds (distance) C4'-P energy: -25.122 bonds (distance) P-C4' energy: -23.016 flat angles C4'-P-C4' energy: -24.069 flat angles P-C4'-P energy: -18.285 tors. eta vs tors. theta energy: -28.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -275.757402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.757402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.757402 (E_RNA) where: Base-Base interactions energy: -182.680 where: short stacking energy: -82.445 Base-Backbone interact. energy: 1.375 local terms energy: -94.452459 where: bonds (distance) C4'-P energy: -18.700 bonds (distance) P-C4' energy: -21.888 flat angles C4'-P-C4' energy: -17.778 flat angles P-C4'-P energy: -16.605 tors. eta vs tors. theta energy: -19.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -288.245004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.245004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.245004 (E_RNA) where: Base-Base interactions energy: -182.780 where: short stacking energy: -96.071 Base-Backbone interact. energy: 1.542 local terms energy: -107.007028 where: bonds (distance) C4'-P energy: -22.562 bonds (distance) P-C4' energy: -20.966 flat angles C4'-P-C4' energy: -23.750 flat angles P-C4'-P energy: -13.253 tors. eta vs tors. theta energy: -26.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -232.670431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.670431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.670431 (E_RNA) where: Base-Base interactions energy: -148.093 where: short stacking energy: -73.581 Base-Backbone interact. energy: -0.810 local terms energy: -83.767415 where: bonds (distance) C4'-P energy: -18.562 bonds (distance) P-C4' energy: -23.495 flat angles C4'-P-C4' energy: -18.270 flat angles P-C4'-P energy: -8.063 tors. eta vs tors. theta energy: -15.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -117.765246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.765246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.765246 (E_RNA) where: Base-Base interactions energy: -41.221 where: short stacking energy: -29.582 Base-Backbone interact. energy: -0.153 local terms energy: -76.391222 where: bonds (distance) C4'-P energy: -24.819 bonds (distance) P-C4' energy: -22.600 flat angles C4'-P-C4' energy: -16.691 flat angles P-C4'-P energy: -11.981 tors. eta vs tors. theta energy: -0.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -123.741619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.741619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.741619 (E_RNA) where: Base-Base interactions energy: -46.039 where: short stacking energy: -40.009 Base-Backbone interact. energy: -0.255 local terms energy: -77.447651 where: bonds (distance) C4'-P energy: -20.144 bonds (distance) P-C4' energy: -26.371 flat angles C4'-P-C4' energy: -19.327 flat angles P-C4'-P energy: -10.169 tors. eta vs tors. theta energy: -1.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -122.981911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.981911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.981911 (E_RNA) where: Base-Base interactions energy: -51.040 where: short stacking energy: -37.857 Base-Backbone interact. energy: -0.355 local terms energy: -71.587507 where: bonds (distance) C4'-P energy: -11.516 bonds (distance) P-C4' energy: -18.179 flat angles C4'-P-C4' energy: -21.026 flat angles P-C4'-P energy: -9.161 tors. eta vs tors. theta energy: -11.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -109.941809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.941809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.941809 (E_RNA) where: Base-Base interactions energy: -44.374 where: short stacking energy: -44.374 Base-Backbone interact. energy: -0.374 local terms energy: -65.193977 where: bonds (distance) C4'-P energy: -12.415 bonds (distance) P-C4' energy: -18.363 flat angles C4'-P-C4' energy: -19.119 flat angles P-C4'-P energy: -15.191 tors. eta vs tors. theta energy: -0.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -390.767893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.767893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.767893 (E_RNA) where: Base-Base interactions energy: -268.988 where: short stacking energy: -121.952 Base-Backbone interact. energy: 0.116 local terms energy: -121.896389 where: bonds (distance) C4'-P energy: -23.956 bonds (distance) P-C4' energy: -23.495 flat angles C4'-P-C4' energy: -25.365 flat angles P-C4'-P energy: -16.530 tors. eta vs tors. theta energy: -32.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -390.046401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.046401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.046401 (E_RNA) where: Base-Base interactions energy: -257.441 where: short stacking energy: -121.017 Base-Backbone interact. energy: -0.452 local terms energy: -132.152676 where: bonds (distance) C4'-P energy: -23.729 bonds (distance) P-C4' energy: -26.439 flat angles C4'-P-C4' energy: -24.127 flat angles P-C4'-P energy: -19.527 tors. eta vs tors. theta energy: -38.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -338.763009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.763009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.763009 (E_RNA) where: Base-Base interactions energy: -215.083 where: short stacking energy: -106.158 Base-Backbone interact. energy: -0.992 local terms energy: -122.687411 where: bonds (distance) C4'-P energy: -22.499 bonds (distance) P-C4' energy: -21.368 flat angles C4'-P-C4' energy: -27.297 flat angles P-C4'-P energy: -17.475 tors. eta vs tors. theta energy: -34.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -294.669624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.669624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.669624 (E_RNA) where: Base-Base interactions energy: -197.649 where: short stacking energy: -93.520 Base-Backbone interact. energy: 1.303 local terms energy: -98.324009 where: bonds (distance) C4'-P energy: -16.403 bonds (distance) P-C4' energy: -20.205 flat angles C4'-P-C4' energy: -24.162 flat angles P-C4'-P energy: -15.480 tors. eta vs tors. theta energy: -22.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -280.713270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.713270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.713270 (E_RNA) where: Base-Base interactions energy: -177.518 where: short stacking energy: -75.414 Base-Backbone interact. energy: -0.280 local terms energy: -102.914500 where: bonds (distance) C4'-P energy: -25.579 bonds (distance) P-C4' energy: -19.717 flat angles C4'-P-C4' energy: -22.424 flat angles P-C4'-P energy: -16.503 tors. eta vs tors. theta energy: -18.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -253.619009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.619009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.619009 (E_RNA) where: Base-Base interactions energy: -155.814 where: short stacking energy: -72.434 Base-Backbone interact. energy: 0.908 local terms energy: -98.713513 where: bonds (distance) C4'-P energy: -20.234 bonds (distance) P-C4' energy: -26.680 flat angles C4'-P-C4' energy: -17.176 flat angles P-C4'-P energy: -13.150 tors. eta vs tors. theta energy: -21.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -133.814413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.814413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.814413 (E_RNA) where: Base-Base interactions energy: -53.142 where: short stacking energy: -42.840 Base-Backbone interact. energy: 1.545 local terms energy: -82.216965 where: bonds (distance) C4'-P energy: -19.049 bonds (distance) P-C4' energy: -23.505 flat angles C4'-P-C4' energy: -17.638 flat angles P-C4'-P energy: -12.662 tors. eta vs tors. theta energy: -9.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -121.583805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.583805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.583805 (E_RNA) where: Base-Base interactions energy: -44.007 where: short stacking energy: -42.424 Base-Backbone interact. energy: -0.393 local terms energy: -77.184047 where: bonds (distance) C4'-P energy: -21.672 bonds (distance) P-C4' energy: -23.740 flat angles C4'-P-C4' energy: -24.582 flat angles P-C4'-P energy: -4.513 tors. eta vs tors. theta energy: -2.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -121.462813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.462813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.462813 (E_RNA) where: Base-Base interactions energy: -46.701 where: short stacking energy: -35.804 Base-Backbone interact. energy: -0.443 local terms energy: -74.318820 where: bonds (distance) C4'-P energy: -20.951 bonds (distance) P-C4' energy: -19.664 flat angles C4'-P-C4' energy: -13.539 flat angles P-C4'-P energy: -16.956 tors. eta vs tors. theta energy: -3.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -117.637090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.637090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.637090 (E_RNA) where: Base-Base interactions energy: -38.840 where: short stacking energy: -38.840 Base-Backbone interact. energy: -0.114 local terms energy: -78.683576 where: bonds (distance) C4'-P energy: -18.323 bonds (distance) P-C4' energy: -22.640 flat angles C4'-P-C4' energy: -16.587 flat angles P-C4'-P energy: -15.386 tors. eta vs tors. theta energy: -5.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -379.259300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.259300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.259300 (E_RNA) where: Base-Base interactions energy: -254.545 where: short stacking energy: -106.651 Base-Backbone interact. energy: -0.035 local terms energy: -124.680085 where: bonds (distance) C4'-P energy: -23.219 bonds (distance) P-C4' energy: -23.308 flat angles C4'-P-C4' energy: -24.724 flat angles P-C4'-P energy: -18.413 tors. eta vs tors. theta energy: -35.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -348.014521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.014521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.014521 (E_RNA) where: Base-Base interactions energy: -231.749 where: short stacking energy: -101.830 Base-Backbone interact. energy: -0.335 local terms energy: -115.931180 where: bonds (distance) C4'-P energy: -23.100 bonds (distance) P-C4' energy: -21.152 flat angles C4'-P-C4' energy: -25.021 flat angles P-C4'-P energy: -16.550 tors. eta vs tors. theta energy: -30.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -382.890224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.890224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.890224 (E_RNA) where: Base-Base interactions energy: -262.154 where: short stacking energy: -117.216 Base-Backbone interact. energy: -0.008 local terms energy: -120.728483 where: bonds (distance) C4'-P energy: -23.228 bonds (distance) P-C4' energy: -22.257 flat angles C4'-P-C4' energy: -23.401 flat angles P-C4'-P energy: -16.141 tors. eta vs tors. theta energy: -35.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -275.302053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.302053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.302053 (E_RNA) where: Base-Base interactions energy: -171.512 where: short stacking energy: -91.191 Base-Backbone interact. energy: -0.534 local terms energy: -103.255893 where: bonds (distance) C4'-P energy: -23.514 bonds (distance) P-C4' energy: -21.718 flat angles C4'-P-C4' energy: -18.071 flat angles P-C4'-P energy: -15.598 tors. eta vs tors. theta energy: -24.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -289.907346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.907346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.907346 (E_RNA) where: Base-Base interactions energy: -187.513 where: short stacking energy: -81.313 Base-Backbone interact. energy: -0.693 local terms energy: -101.701550 where: bonds (distance) C4'-P energy: -23.409 bonds (distance) P-C4' energy: -19.858 flat angles C4'-P-C4' energy: -18.611 flat angles P-C4'-P energy: -16.873 tors. eta vs tors. theta energy: -22.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -253.074553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.074553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.074553 (E_RNA) where: Base-Base interactions energy: -161.975 where: short stacking energy: -84.312 Base-Backbone interact. energy: -0.087 local terms energy: -91.012678 where: bonds (distance) C4'-P energy: -23.957 bonds (distance) P-C4' energy: -7.968 flat angles C4'-P-C4' energy: -18.320 flat angles P-C4'-P energy: -13.636 tors. eta vs tors. theta energy: -27.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -135.381093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.381093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.381093 (E_RNA) where: Base-Base interactions energy: -40.838 where: short stacking energy: -37.910 Base-Backbone interact. energy: -0.154 local terms energy: -94.389440 where: bonds (distance) C4'-P energy: -23.846 bonds (distance) P-C4' energy: -25.533 flat angles C4'-P-C4' energy: -24.018 flat angles P-C4'-P energy: -12.042 tors. eta vs tors. theta energy: -8.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -117.921979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.921979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.921979 (E_RNA) where: Base-Base interactions energy: -44.316 where: short stacking energy: -40.004 Base-Backbone interact. energy: -0.125 local terms energy: -73.480408 where: bonds (distance) C4'-P energy: -22.942 bonds (distance) P-C4' energy: -22.925 flat angles C4'-P-C4' energy: -11.263 flat angles P-C4'-P energy: -17.189 tors. eta vs tors. theta energy: 0.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -114.750901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.750901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.750901 (E_RNA) where: Base-Base interactions energy: -47.792 where: short stacking energy: -35.018 Base-Backbone interact. energy: -0.722 local terms energy: -66.237164 where: bonds (distance) C4'-P energy: -21.833 bonds (distance) P-C4' energy: -14.401 flat angles C4'-P-C4' energy: -11.829 flat angles P-C4'-P energy: -10.349 tors. eta vs tors. theta energy: -7.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -98.840865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.840865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.840865 (E_RNA) where: Base-Base interactions energy: -28.590 where: short stacking energy: -28.131 Base-Backbone interact. energy: -0.260 local terms energy: -69.990355 where: bonds (distance) C4'-P energy: -19.616 bonds (distance) P-C4' energy: -25.455 flat angles C4'-P-C4' energy: -23.052 flat angles P-C4'-P energy: -7.894 tors. eta vs tors. theta energy: 6.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -384.234801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.234801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.234801 (E_RNA) where: Base-Base interactions energy: -263.061 where: short stacking energy: -118.537 Base-Backbone interact. energy: -0.016 local terms energy: -121.157631 where: bonds (distance) C4'-P energy: -20.012 bonds (distance) P-C4' energy: -21.462 flat angles C4'-P-C4' energy: -25.871 flat angles P-C4'-P energy: -18.108 tors. eta vs tors. theta energy: -35.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -341.371304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.371304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.371304 (E_RNA) where: Base-Base interactions energy: -235.278 where: short stacking energy: -91.488 Base-Backbone interact. energy: -0.738 local terms energy: -105.356132 where: bonds (distance) C4'-P energy: -19.451 bonds (distance) P-C4' energy: -19.883 flat angles C4'-P-C4' energy: -20.214 flat angles P-C4'-P energy: -17.042 tors. eta vs tors. theta energy: -28.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -376.192359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.192359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.192359 (E_RNA) where: Base-Base interactions energy: -258.455 where: short stacking energy: -117.225 Base-Backbone interact. energy: -0.004 local terms energy: -117.733446 where: bonds (distance) C4'-P energy: -23.753 bonds (distance) P-C4' energy: -16.976 flat angles C4'-P-C4' energy: -23.263 flat angles P-C4'-P energy: -19.401 tors. eta vs tors. theta energy: -34.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -290.928106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.928106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.928106 (E_RNA) where: Base-Base interactions energy: -185.380 where: short stacking energy: -83.553 Base-Backbone interact. energy: -0.993 local terms energy: -104.554746 where: bonds (distance) C4'-P energy: -19.814 bonds (distance) P-C4' energy: -24.797 flat angles C4'-P-C4' energy: -23.480 flat angles P-C4'-P energy: -13.755 tors. eta vs tors. theta energy: -22.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -331.655230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.655230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.655230 (E_RNA) where: Base-Base interactions energy: -224.572 where: short stacking energy: -95.955 Base-Backbone interact. energy: -0.735 local terms energy: -106.348495 where: bonds (distance) C4'-P energy: -17.491 bonds (distance) P-C4' energy: -18.552 flat angles C4'-P-C4' energy: -24.361 flat angles P-C4'-P energy: -16.400 tors. eta vs tors. theta energy: -29.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -253.175329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.175329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.175329 (E_RNA) where: Base-Base interactions energy: -153.710 where: short stacking energy: -75.383 Base-Backbone interact. energy: -0.192 local terms energy: -99.273908 where: bonds (distance) C4'-P energy: -17.234 bonds (distance) P-C4' energy: -25.337 flat angles C4'-P-C4' energy: -21.976 flat angles P-C4'-P energy: -12.252 tors. eta vs tors. theta energy: -22.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -131.696205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.696205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.696205 (E_RNA) where: Base-Base interactions energy: -56.595 where: short stacking energy: -53.689 Base-Backbone interact. energy: -1.150 local terms energy: -73.951012 where: bonds (distance) C4'-P energy: -21.885 bonds (distance) P-C4' energy: -16.934 flat angles C4'-P-C4' energy: -16.120 flat angles P-C4'-P energy: -12.590 tors. eta vs tors. theta energy: -6.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -132.350228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.350228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.350228 (E_RNA) where: Base-Base interactions energy: -54.643 where: short stacking energy: -36.434 Base-Backbone interact. energy: -1.136 local terms energy: -76.571637 where: bonds (distance) C4'-P energy: -21.357 bonds (distance) P-C4' energy: -23.802 flat angles C4'-P-C4' energy: -18.226 flat angles P-C4'-P energy: -8.266 tors. eta vs tors. theta energy: -4.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -118.277154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.277154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.277154 (E_RNA) where: Base-Base interactions energy: -43.142 where: short stacking energy: -32.592 Base-Backbone interact. energy: -1.228 local terms energy: -73.907180 where: bonds (distance) C4'-P energy: -14.038 bonds (distance) P-C4' energy: -23.204 flat angles C4'-P-C4' energy: -20.161 flat angles P-C4'-P energy: -13.527 tors. eta vs tors. theta energy: -2.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -112.840935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.840935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.840935 (E_RNA) where: Base-Base interactions energy: -39.713 where: short stacking energy: -39.380 Base-Backbone interact. energy: -0.059 local terms energy: -73.069093 where: bonds (distance) C4'-P energy: -18.279 bonds (distance) P-C4' energy: -16.308 flat angles C4'-P-C4' energy: -17.024 flat angles P-C4'-P energy: -10.688 tors. eta vs tors. theta energy: -10.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -395.636900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.636900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.636900 (E_RNA) where: Base-Base interactions energy: -267.487 where: short stacking energy: -122.592 Base-Backbone interact. energy: -0.580 local terms energy: -127.570397 where: bonds (distance) C4'-P energy: -23.808 bonds (distance) P-C4' energy: -25.498 flat angles C4'-P-C4' energy: -24.198 flat angles P-C4'-P energy: -19.065 tors. eta vs tors. theta energy: -35.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -386.875838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.875838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.875838 (E_RNA) where: Base-Base interactions energy: -263.243 where: short stacking energy: -118.423 Base-Backbone interact. energy: -1.011 local terms energy: -122.622088 where: bonds (distance) C4'-P energy: -24.260 bonds (distance) P-C4' energy: -17.788 flat angles C4'-P-C4' energy: -24.399 flat angles P-C4'-P energy: -18.431 tors. eta vs tors. theta energy: -37.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -340.972046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.972046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.972046 (E_RNA) where: Base-Base interactions energy: -228.491 where: short stacking energy: -97.980 Base-Backbone interact. energy: -0.066 local terms energy: -112.414342 where: bonds (distance) C4'-P energy: -20.156 bonds (distance) P-C4' energy: -22.939 flat angles C4'-P-C4' energy: -24.517 flat angles P-C4'-P energy: -15.296 tors. eta vs tors. theta energy: -29.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -364.286641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.286641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.286641 (E_RNA) where: Base-Base interactions energy: -256.535 where: short stacking energy: -112.972 Base-Backbone interact. energy: -0.001 local terms energy: -107.751403 where: bonds (distance) C4'-P energy: -14.575 bonds (distance) P-C4' energy: -21.590 flat angles C4'-P-C4' energy: -24.736 flat angles P-C4'-P energy: -17.254 tors. eta vs tors. theta energy: -29.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -264.156530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.156530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.156530 (E_RNA) where: Base-Base interactions energy: -164.138 where: short stacking energy: -80.906 Base-Backbone interact. energy: -0.545 local terms energy: -99.473931 where: bonds (distance) C4'-P energy: -20.998 bonds (distance) P-C4' energy: -23.425 flat angles C4'-P-C4' energy: -20.807 flat angles P-C4'-P energy: -13.767 tors. eta vs tors. theta energy: -20.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -183.109045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.109045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.109045 (E_RNA) where: Base-Base interactions energy: -99.430 where: short stacking energy: -55.072 Base-Backbone interact. energy: 0.566 local terms energy: -84.244740 where: bonds (distance) C4'-P energy: -16.820 bonds (distance) P-C4' energy: -23.475 flat angles C4'-P-C4' energy: -19.028 flat angles P-C4'-P energy: -10.426 tors. eta vs tors. theta energy: -14.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -138.900062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.900062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.900062 (E_RNA) where: Base-Base interactions energy: -52.991 where: short stacking energy: -47.688 Base-Backbone interact. energy: -0.201 local terms energy: -85.708655 where: bonds (distance) C4'-P energy: -23.939 bonds (distance) P-C4' energy: -22.305 flat angles C4'-P-C4' energy: -19.574 flat angles P-C4'-P energy: -14.026 tors. eta vs tors. theta energy: -5.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -115.353679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.353679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.353679 (E_RNA) where: Base-Base interactions energy: -41.179 where: short stacking energy: -28.121 Base-Backbone interact. energy: -0.130 local terms energy: -74.045085 where: bonds (distance) C4'-P energy: -22.867 bonds (distance) P-C4' energy: -16.036 flat angles C4'-P-C4' energy: -17.867 flat angles P-C4'-P energy: -18.599 tors. eta vs tors. theta energy: 1.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -103.970208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.970208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -103.970208 (E_RNA) where: Base-Base interactions energy: -43.538 where: short stacking energy: -30.474 Base-Backbone interact. energy: -0.585 local terms energy: -59.847366 where: bonds (distance) C4'-P energy: -13.496 bonds (distance) P-C4' energy: -22.430 flat angles C4'-P-C4' energy: -15.881 flat angles P-C4'-P energy: -14.778 tors. eta vs tors. theta energy: 6.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -113.895466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.895466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.895466 (E_RNA) where: Base-Base interactions energy: -36.336 where: short stacking energy: -35.123 Base-Backbone interact. energy: -0.119 local terms energy: -77.441021 where: bonds (distance) C4'-P energy: -23.401 bonds (distance) P-C4' energy: -13.802 flat angles C4'-P-C4' energy: -23.684 flat angles P-C4'-P energy: -11.331 tors. eta vs tors. theta energy: -5.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -382.481632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.481632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.481632 (E_RNA) where: Base-Base interactions energy: -266.482 where: short stacking energy: -121.115 Base-Backbone interact. energy: -0.090 local terms energy: -115.909752 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -14.835 flat angles C4'-P-C4' energy: -26.131 flat angles P-C4'-P energy: -17.915 tors. eta vs tors. theta energy: -35.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -390.398613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.398613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.398613 (E_RNA) where: Base-Base interactions energy: -265.795 where: short stacking energy: -123.273 Base-Backbone interact. energy: -0.241 local terms energy: -124.362882 where: bonds (distance) C4'-P energy: -17.950 bonds (distance) P-C4' energy: -20.604 flat angles C4'-P-C4' energy: -25.446 flat angles P-C4'-P energy: -20.228 tors. eta vs tors. theta energy: -40.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -382.434207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.434207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.434207 (E_RNA) where: Base-Base interactions energy: -263.150 where: short stacking energy: -112.628 Base-Backbone interact. energy: -0.020 local terms energy: -119.264141 where: bonds (distance) C4'-P energy: -17.043 bonds (distance) P-C4' energy: -25.792 flat angles C4'-P-C4' energy: -26.044 flat angles P-C4'-P energy: -15.172 tors. eta vs tors. theta energy: -35.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -337.807905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.807905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.807905 (E_RNA) where: Base-Base interactions energy: -230.151 where: short stacking energy: -87.742 Base-Backbone interact. energy: -0.104 local terms energy: -107.553285 where: bonds (distance) C4'-P energy: -23.337 bonds (distance) P-C4' energy: -18.355 flat angles C4'-P-C4' energy: -25.400 flat angles P-C4'-P energy: -11.977 tors. eta vs tors. theta energy: -28.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -262.121523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.121523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.121523 (E_RNA) where: Base-Base interactions energy: -167.181 where: short stacking energy: -79.681 Base-Backbone interact. energy: -0.461 local terms energy: -94.479630 where: bonds (distance) C4'-P energy: -22.413 bonds (distance) P-C4' energy: -18.777 flat angles C4'-P-C4' energy: -20.588 flat angles P-C4'-P energy: -9.756 tors. eta vs tors. theta energy: -22.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -212.843414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.843414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.843414 (E_RNA) where: Base-Base interactions energy: -119.396 where: short stacking energy: -70.800 Base-Backbone interact. energy: -0.097 local terms energy: -93.350031 where: bonds (distance) C4'-P energy: -21.767 bonds (distance) P-C4' energy: -23.437 flat angles C4'-P-C4' energy: -17.421 flat angles P-C4'-P energy: -15.378 tors. eta vs tors. theta energy: -15.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -132.400125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.400125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.400125 (E_RNA) where: Base-Base interactions energy: -63.742 where: short stacking energy: -49.267 Base-Backbone interact. energy: 0.950 local terms energy: -69.608123 where: bonds (distance) C4'-P energy: -17.796 bonds (distance) P-C4' energy: -19.503 flat angles C4'-P-C4' energy: -18.971 flat angles P-C4'-P energy: -12.192 tors. eta vs tors. theta energy: -1.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -134.482027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.482027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.482027 (E_RNA) where: Base-Base interactions energy: -64.720 where: short stacking energy: -48.934 Base-Backbone interact. energy: -0.466 local terms energy: -69.296048 where: bonds (distance) C4'-P energy: -15.929 bonds (distance) P-C4' energy: -24.121 flat angles C4'-P-C4' energy: -10.204 flat angles P-C4'-P energy: -11.424 tors. eta vs tors. theta energy: -7.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -108.668033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.668033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.668033 (E_RNA) where: Base-Base interactions energy: -43.643 where: short stacking energy: -40.065 Base-Backbone interact. energy: 2.668 local terms energy: -67.693005 where: bonds (distance) C4'-P energy: -20.432 bonds (distance) P-C4' energy: -17.645 flat angles C4'-P-C4' energy: -12.324 flat angles P-C4'-P energy: -12.705 tors. eta vs tors. theta energy: -4.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -95.271228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.271228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.271228 (E_RNA) where: Base-Base interactions energy: -33.969 where: short stacking energy: -27.280 Base-Backbone interact. energy: -0.328 local terms energy: -60.974687 where: bonds (distance) C4'-P energy: -16.471 bonds (distance) P-C4' energy: -22.977 flat angles C4'-P-C4' energy: -14.536 flat angles P-C4'-P energy: -8.884 tors. eta vs tors. theta energy: 1.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -395.328338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.328338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.328338 (E_RNA) where: Base-Base interactions energy: -263.934 where: short stacking energy: -120.044 Base-Backbone interact. energy: -0.646 local terms energy: -130.749112 where: bonds (distance) C4'-P energy: -23.273 bonds (distance) P-C4' energy: -24.905 flat angles C4'-P-C4' energy: -26.982 flat angles P-C4'-P energy: -19.630 tors. eta vs tors. theta energy: -35.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -390.844461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.844461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.844461 (E_RNA) where: Base-Base interactions energy: -262.595 where: short stacking energy: -113.672 Base-Backbone interact. energy: -1.913 local terms energy: -126.337137 where: bonds (distance) C4'-P energy: -21.659 bonds (distance) P-C4' energy: -24.278 flat angles C4'-P-C4' energy: -23.930 flat angles P-C4'-P energy: -19.663 tors. eta vs tors. theta energy: -36.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -372.504707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.504707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.504707 (E_RNA) where: Base-Base interactions energy: -264.951 where: short stacking energy: -115.598 Base-Backbone interact. energy: -0.810 local terms energy: -106.744140 where: bonds (distance) C4'-P energy: -21.530 bonds (distance) P-C4' energy: -18.793 flat angles C4'-P-C4' energy: -26.512 flat angles P-C4'-P energy: -6.444 tors. eta vs tors. theta energy: -33.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -346.048774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.048774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.048774 (E_RNA) where: Base-Base interactions energy: -232.066 where: short stacking energy: -98.512 Base-Backbone interact. energy: -0.039 local terms energy: -113.943427 where: bonds (distance) C4'-P energy: -19.851 bonds (distance) P-C4' energy: -22.909 flat angles C4'-P-C4' energy: -23.872 flat angles P-C4'-P energy: -19.313 tors. eta vs tors. theta energy: -27.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -268.768766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.768766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.768766 (E_RNA) where: Base-Base interactions energy: -160.742 where: short stacking energy: -88.875 Base-Backbone interact. energy: -0.153 local terms energy: -107.874270 where: bonds (distance) C4'-P energy: -19.573 bonds (distance) P-C4' energy: -24.752 flat angles C4'-P-C4' energy: -24.499 flat angles P-C4'-P energy: -13.565 tors. eta vs tors. theta energy: -25.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -202.886613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.886613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.886613 (E_RNA) where: Base-Base interactions energy: -111.724 where: short stacking energy: -48.927 Base-Backbone interact. energy: -0.758 local terms energy: -90.404933 where: bonds (distance) C4'-P energy: -18.877 bonds (distance) P-C4' energy: -22.784 flat angles C4'-P-C4' energy: -21.799 flat angles P-C4'-P energy: -13.160 tors. eta vs tors. theta energy: -13.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -136.418361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.418361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.418361 (E_RNA) where: Base-Base interactions energy: -58.438 where: short stacking energy: -42.488 Base-Backbone interact. energy: -0.028 local terms energy: -77.952512 where: bonds (distance) C4'-P energy: -20.928 bonds (distance) P-C4' energy: -20.476 flat angles C4'-P-C4' energy: -17.133 flat angles P-C4'-P energy: -11.696 tors. eta vs tors. theta energy: -7.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -128.504437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.504437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.504437 (E_RNA) where: Base-Base interactions energy: -46.032 where: short stacking energy: -46.032 Base-Backbone interact. energy: -0.142 local terms energy: -82.330765 where: bonds (distance) C4'-P energy: -24.571 bonds (distance) P-C4' energy: -22.473 flat angles C4'-P-C4' energy: -17.762 flat angles P-C4'-P energy: -12.565 tors. eta vs tors. theta energy: -4.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -104.983365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.983365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.983365 (E_RNA) where: Base-Base interactions energy: -45.845 where: short stacking energy: -35.644 Base-Backbone interact. energy: -0.305 local terms energy: -58.833329 where: bonds (distance) C4'-P energy: -18.122 bonds (distance) P-C4' energy: -20.285 flat angles C4'-P-C4' energy: -18.034 flat angles P-C4'-P energy: -11.165 tors. eta vs tors. theta energy: 8.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -108.878875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.878875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.878875 (E_RNA) where: Base-Base interactions energy: -52.450 where: short stacking energy: -26.528 Base-Backbone interact. energy: -0.654 local terms energy: -55.775141 where: bonds (distance) C4'-P energy: -14.406 bonds (distance) P-C4' energy: -18.411 flat angles C4'-P-C4' energy: -21.683 flat angles P-C4'-P energy: -6.907 tors. eta vs tors. theta energy: 5.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -392.098395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.098395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.098395 (E_RNA) where: Base-Base interactions energy: -260.473 where: short stacking energy: -118.967 Base-Backbone interact. energy: -0.010 local terms energy: -131.615257 where: bonds (distance) C4'-P energy: -22.327 bonds (distance) P-C4' energy: -24.435 flat angles C4'-P-C4' energy: -28.076 flat angles P-C4'-P energy: -20.435 tors. eta vs tors. theta energy: -36.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -386.969053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.969053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.969053 (E_RNA) where: Base-Base interactions energy: -258.209 where: short stacking energy: -122.382 Base-Backbone interact. energy: -0.009 local terms energy: -128.751500 where: bonds (distance) C4'-P energy: -19.356 bonds (distance) P-C4' energy: -24.790 flat angles C4'-P-C4' energy: -27.831 flat angles P-C4'-P energy: -20.175 tors. eta vs tors. theta energy: -36.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -377.613774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.613774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.613774 (E_RNA) where: Base-Base interactions energy: -259.680 where: short stacking energy: -117.665 Base-Backbone interact. energy: -0.001 local terms energy: -117.933124 where: bonds (distance) C4'-P energy: -19.481 bonds (distance) P-C4' energy: -21.184 flat angles C4'-P-C4' energy: -22.153 flat angles P-C4'-P energy: -19.638 tors. eta vs tors. theta energy: -35.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -342.986426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.986426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.986426 (E_RNA) where: Base-Base interactions energy: -227.350 where: short stacking energy: -93.406 Base-Backbone interact. energy: -0.637 local terms energy: -114.998767 where: bonds (distance) C4'-P energy: -24.850 bonds (distance) P-C4' energy: -22.886 flat angles C4'-P-C4' energy: -24.570 flat angles P-C4'-P energy: -13.788 tors. eta vs tors. theta energy: -28.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -242.821194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.821194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.821194 (E_RNA) where: Base-Base interactions energy: -148.110 where: short stacking energy: -75.624 Base-Backbone interact. energy: 0.515 local terms energy: -95.226842 where: bonds (distance) C4'-P energy: -20.455 bonds (distance) P-C4' energy: -22.657 flat angles C4'-P-C4' energy: -21.104 flat angles P-C4'-P energy: -11.895 tors. eta vs tors. theta energy: -19.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -238.748029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.748029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.748029 (E_RNA) where: Base-Base interactions energy: -147.919 where: short stacking energy: -74.526 Base-Backbone interact. energy: 0.410 local terms energy: -91.239429 where: bonds (distance) C4'-P energy: -17.759 bonds (distance) P-C4' energy: -18.817 flat angles C4'-P-C4' energy: -16.446 flat angles P-C4'-P energy: -15.493 tors. eta vs tors. theta energy: -22.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -173.414729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.414729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.414729 (E_RNA) where: Base-Base interactions energy: -99.686 where: short stacking energy: -52.411 Base-Backbone interact. energy: -0.809 local terms energy: -72.919746 where: bonds (distance) C4'-P energy: -17.229 bonds (distance) P-C4' energy: -19.125 flat angles C4'-P-C4' energy: -11.300 flat angles P-C4'-P energy: -14.563 tors. eta vs tors. theta energy: -10.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -125.305062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.305062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.305062 (E_RNA) where: Base-Base interactions energy: -53.245 where: short stacking energy: -39.443 Base-Backbone interact. energy: -0.339 local terms energy: -71.720639 where: bonds (distance) C4'-P energy: -15.056 bonds (distance) P-C4' energy: -26.855 flat angles C4'-P-C4' energy: -16.704 flat angles P-C4'-P energy: -10.424 tors. eta vs tors. theta energy: -2.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -120.895093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.895093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.895093 (E_RNA) where: Base-Base interactions energy: -52.487 where: short stacking energy: -39.667 Base-Backbone interact. energy: 2.296 local terms energy: -70.704228 where: bonds (distance) C4'-P energy: -14.947 bonds (distance) P-C4' energy: -21.477 flat angles C4'-P-C4' energy: -17.504 flat angles P-C4'-P energy: -17.336 tors. eta vs tors. theta energy: 0.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -124.812428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.812428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.812428 (E_RNA) where: Base-Base interactions energy: -62.836 where: short stacking energy: -38.936 Base-Backbone interact. energy: -0.212 local terms energy: -61.764549 where: bonds (distance) C4'-P energy: -12.852 bonds (distance) P-C4' energy: -25.744 flat angles C4'-P-C4' energy: -14.774 flat angles P-C4'-P energy: -10.679 tors. eta vs tors. theta energy: 2.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -398.091735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.091735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.091735 (E_RNA) where: Base-Base interactions energy: -270.193 where: short stacking energy: -121.716 Base-Backbone interact. energy: -0.032 local terms energy: -127.866755 where: bonds (distance) C4'-P energy: -22.705 bonds (distance) P-C4' energy: -23.812 flat angles C4'-P-C4' energy: -27.134 flat angles P-C4'-P energy: -15.616 tors. eta vs tors. theta energy: -38.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -394.055228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.055228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.055228 (E_RNA) where: Base-Base interactions energy: -270.329 where: short stacking energy: -117.081 Base-Backbone interact. energy: -0.218 local terms energy: -123.507927 where: bonds (distance) C4'-P energy: -20.023 bonds (distance) P-C4' energy: -23.086 flat angles C4'-P-C4' energy: -24.084 flat angles P-C4'-P energy: -20.596 tors. eta vs tors. theta energy: -35.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -376.915942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.915942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.915942 (E_RNA) where: Base-Base interactions energy: -255.568 where: short stacking energy: -118.205 Base-Backbone interact. energy: -0.032 local terms energy: -121.316657 where: bonds (distance) C4'-P energy: -19.688 bonds (distance) P-C4' energy: -19.957 flat angles C4'-P-C4' energy: -24.734 flat angles P-C4'-P energy: -18.778 tors. eta vs tors. theta energy: -38.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -341.073642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.073642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.073642 (E_RNA) where: Base-Base interactions energy: -229.914 where: short stacking energy: -94.771 Base-Backbone interact. energy: 0.182 local terms energy: -111.341893 where: bonds (distance) C4'-P energy: -18.762 bonds (distance) P-C4' energy: -17.699 flat angles C4'-P-C4' energy: -26.460 flat angles P-C4'-P energy: -17.201 tors. eta vs tors. theta energy: -31.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -237.181360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.181360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.181360 (E_RNA) where: Base-Base interactions energy: -155.458 where: short stacking energy: -80.378 Base-Backbone interact. energy: -0.402 local terms energy: -81.320763 where: bonds (distance) C4'-P energy: -22.587 bonds (distance) P-C4' energy: -20.125 flat angles C4'-P-C4' energy: -13.943 flat angles P-C4'-P energy: -6.619 tors. eta vs tors. theta energy: -18.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -223.148933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.148933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.148933 (E_RNA) where: Base-Base interactions energy: -141.517 where: short stacking energy: -70.352 Base-Backbone interact. energy: -0.182 local terms energy: -81.450501 where: bonds (distance) C4'-P energy: -18.654 bonds (distance) P-C4' energy: -19.391 flat angles C4'-P-C4' energy: -17.579 flat angles P-C4'-P energy: -9.982 tors. eta vs tors. theta energy: -15.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -190.002830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.002830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.002830 (E_RNA) where: Base-Base interactions energy: -108.091 where: short stacking energy: -62.225 Base-Backbone interact. energy: -0.227 local terms energy: -81.684985 where: bonds (distance) C4'-P energy: -15.570 bonds (distance) P-C4' energy: -18.196 flat angles C4'-P-C4' energy: -20.000 flat angles P-C4'-P energy: -14.775 tors. eta vs tors. theta energy: -13.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -125.400740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.400740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.400740 (E_RNA) where: Base-Base interactions energy: -38.424 where: short stacking energy: -22.462 Base-Backbone interact. energy: -1.135 local terms energy: -85.841089 where: bonds (distance) C4'-P energy: -21.638 bonds (distance) P-C4' energy: -24.702 flat angles C4'-P-C4' energy: -19.438 flat angles P-C4'-P energy: -13.642 tors. eta vs tors. theta energy: -6.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -123.229525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.229525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.229525 (E_RNA) where: Base-Base interactions energy: -41.122 where: short stacking energy: -39.805 Base-Backbone interact. energy: -0.239 local terms energy: -81.868732 where: bonds (distance) C4'-P energy: -22.014 bonds (distance) P-C4' energy: -20.680 flat angles C4'-P-C4' energy: -22.401 flat angles P-C4'-P energy: -12.091 tors. eta vs tors. theta energy: -4.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -97.416308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.416308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.416308 (E_RNA) where: Base-Base interactions energy: -25.993 where: short stacking energy: -25.357 Base-Backbone interact. energy: 0.090 local terms energy: -71.512574 where: bonds (distance) C4'-P energy: -16.733 bonds (distance) P-C4' energy: -19.668 flat angles C4'-P-C4' energy: -20.582 flat angles P-C4'-P energy: -9.722 tors. eta vs tors. theta energy: -4.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -385.213838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.213838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.213838 (E_RNA) where: Base-Base interactions energy: -272.459 where: short stacking energy: -123.796 Base-Backbone interact. energy: -0.350 local terms energy: -112.405109 where: bonds (distance) C4'-P energy: -21.050 bonds (distance) P-C4' energy: -21.542 flat angles C4'-P-C4' energy: -24.231 flat angles P-C4'-P energy: -14.512 tors. eta vs tors. theta energy: -31.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -383.986455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.986455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.986455 (E_RNA) where: Base-Base interactions energy: -261.675 where: short stacking energy: -123.247 Base-Backbone interact. energy: 0.898 local terms energy: -123.209239 where: bonds (distance) C4'-P energy: -25.309 bonds (distance) P-C4' energy: -25.488 flat angles C4'-P-C4' energy: -18.046 flat angles P-C4'-P energy: -18.526 tors. eta vs tors. theta energy: -35.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -374.657384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.657384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.657384 (E_RNA) where: Base-Base interactions energy: -258.209 where: short stacking energy: -113.811 Base-Backbone interact. energy: -0.944 local terms energy: -115.504892 where: bonds (distance) C4'-P energy: -17.458 bonds (distance) P-C4' energy: -22.567 flat angles C4'-P-C4' energy: -25.063 flat angles P-C4'-P energy: -15.556 tors. eta vs tors. theta energy: -34.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -330.200762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.200762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.200762 (E_RNA) where: Base-Base interactions energy: -218.610 where: short stacking energy: -83.473 Base-Backbone interact. energy: -0.033 local terms energy: -111.557347 where: bonds (distance) C4'-P energy: -20.633 bonds (distance) P-C4' energy: -22.114 flat angles C4'-P-C4' energy: -22.989 flat angles P-C4'-P energy: -15.501 tors. eta vs tors. theta energy: -30.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -228.322963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.322963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.322963 (E_RNA) where: Base-Base interactions energy: -126.002 where: short stacking energy: -79.103 Base-Backbone interact. energy: -0.095 local terms energy: -102.225666 where: bonds (distance) C4'-P energy: -20.306 bonds (distance) P-C4' energy: -23.713 flat angles C4'-P-C4' energy: -22.845 flat angles P-C4'-P energy: -15.469 tors. eta vs tors. theta energy: -19.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -216.390697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.390697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.390697 (E_RNA) where: Base-Base interactions energy: -134.598 where: short stacking energy: -50.839 Base-Backbone interact. energy: -0.362 local terms energy: -81.430119 where: bonds (distance) C4'-P energy: -13.343 bonds (distance) P-C4' energy: -24.219 flat angles C4'-P-C4' energy: -17.188 flat angles P-C4'-P energy: -12.313 tors. eta vs tors. theta energy: -14.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -193.738598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.738598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.738598 (E_RNA) where: Base-Base interactions energy: -108.554 where: short stacking energy: -47.964 Base-Backbone interact. energy: -0.391 local terms energy: -84.794040 where: bonds (distance) C4'-P energy: -20.854 bonds (distance) P-C4' energy: -14.801 flat angles C4'-P-C4' energy: -18.935 flat angles P-C4'-P energy: -16.704 tors. eta vs tors. theta energy: -13.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -121.257909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.257909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.257909 (E_RNA) where: Base-Base interactions energy: -42.420 where: short stacking energy: -41.642 Base-Backbone interact. energy: 1.506 local terms energy: -80.343601 where: bonds (distance) C4'-P energy: -19.623 bonds (distance) P-C4' energy: -22.866 flat angles C4'-P-C4' energy: -20.285 flat angles P-C4'-P energy: -11.439 tors. eta vs tors. theta energy: -6.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -106.436820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.436820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.436820 (E_RNA) where: Base-Base interactions energy: -36.011 where: short stacking energy: -33.831 Base-Backbone interact. energy: -0.464 local terms energy: -69.961510 where: bonds (distance) C4'-P energy: -13.048 bonds (distance) P-C4' energy: -18.207 flat angles C4'-P-C4' energy: -21.960 flat angles P-C4'-P energy: -12.489 tors. eta vs tors. theta energy: -4.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -136.999657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.999657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.999657 (E_RNA) where: Base-Base interactions energy: -70.108 where: short stacking energy: -35.630 Base-Backbone interact. energy: -0.957 local terms energy: -65.934969 where: bonds (distance) C4'-P energy: -18.759 bonds (distance) P-C4' energy: -17.953 flat angles C4'-P-C4' energy: -20.188 flat angles P-C4'-P energy: -8.584 tors. eta vs tors. theta energy: -0.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -386.300569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.300569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.300569 (E_RNA) where: Base-Base interactions energy: -264.485 where: short stacking energy: -120.803 Base-Backbone interact. energy: -0.029 local terms energy: -121.785915 where: bonds (distance) C4'-P energy: -22.718 bonds (distance) P-C4' energy: -22.996 flat angles C4'-P-C4' energy: -25.305 flat angles P-C4'-P energy: -15.240 tors. eta vs tors. theta energy: -35.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -385.179642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.179642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.179642 (E_RNA) where: Base-Base interactions energy: -260.803 where: short stacking energy: -119.631 Base-Backbone interact. energy: -0.079 local terms energy: -124.298441 where: bonds (distance) C4'-P energy: -19.134 bonds (distance) P-C4' energy: -19.362 flat angles C4'-P-C4' energy: -27.830 flat angles P-C4'-P energy: -20.312 tors. eta vs tors. theta energy: -37.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -389.128070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.128070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.128070 (E_RNA) where: Base-Base interactions energy: -261.531 where: short stacking energy: -125.556 Base-Backbone interact. energy: -0.431 local terms energy: -127.165223 where: bonds (distance) C4'-P energy: -19.333 bonds (distance) P-C4' energy: -24.767 flat angles C4'-P-C4' energy: -25.639 flat angles P-C4'-P energy: -19.864 tors. eta vs tors. theta energy: -37.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -334.785486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.785486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.785486 (E_RNA) where: Base-Base interactions energy: -225.372 where: short stacking energy: -101.545 Base-Backbone interact. energy: -0.087 local terms energy: -109.326577 where: bonds (distance) C4'-P energy: -21.084 bonds (distance) P-C4' energy: -15.724 flat angles C4'-P-C4' energy: -24.560 flat angles P-C4'-P energy: -16.613 tors. eta vs tors. theta energy: -31.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -232.292590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.292590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.292590 (E_RNA) where: Base-Base interactions energy: -127.508 where: short stacking energy: -80.061 Base-Backbone interact. energy: -0.036 local terms energy: -104.747947 where: bonds (distance) C4'-P energy: -19.378 bonds (distance) P-C4' energy: -24.659 flat angles C4'-P-C4' energy: -20.355 flat angles P-C4'-P energy: -16.471 tors. eta vs tors. theta energy: -23.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -203.109797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.109797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.109797 (E_RNA) where: Base-Base interactions energy: -109.634 where: short stacking energy: -61.922 Base-Backbone interact. energy: -0.093 local terms energy: -93.382345 where: bonds (distance) C4'-P energy: -20.768 bonds (distance) P-C4' energy: -20.128 flat angles C4'-P-C4' energy: -23.954 flat angles P-C4'-P energy: -14.952 tors. eta vs tors. theta energy: -13.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -201.280709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.280709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.280709 (E_RNA) where: Base-Base interactions energy: -119.201 where: short stacking energy: -56.262 Base-Backbone interact. energy: -0.491 local terms energy: -81.589475 where: bonds (distance) C4'-P energy: -21.890 bonds (distance) P-C4' energy: -23.206 flat angles C4'-P-C4' energy: -18.204 flat angles P-C4'-P energy: -11.397 tors. eta vs tors. theta energy: -6.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -119.025648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.025648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.025648 (E_RNA) where: Base-Base interactions energy: -55.690 where: short stacking energy: -54.743 Base-Backbone interact. energy: -0.746 local terms energy: -62.590525 where: bonds (distance) C4'-P energy: -16.616 bonds (distance) P-C4' energy: -15.966 flat angles C4'-P-C4' energy: -16.656 flat angles P-C4'-P energy: -4.229 tors. eta vs tors. theta energy: -9.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -115.514157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.514157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.514157 (E_RNA) where: Base-Base interactions energy: -45.754 where: short stacking energy: -42.913 Base-Backbone interact. energy: -0.503 local terms energy: -69.257700 where: bonds (distance) C4'-P energy: -18.166 bonds (distance) P-C4' energy: -21.588 flat angles C4'-P-C4' energy: -17.259 flat angles P-C4'-P energy: -8.541 tors. eta vs tors. theta energy: -3.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -122.753299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.753299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.753299 (E_RNA) where: Base-Base interactions energy: -60.847 where: short stacking energy: -36.814 Base-Backbone interact. energy: -1.039 local terms energy: -60.867821 where: bonds (distance) C4'-P energy: -13.366 bonds (distance) P-C4' energy: -21.792 flat angles C4'-P-C4' energy: -18.972 flat angles P-C4'-P energy: -8.067 tors. eta vs tors. theta energy: 1.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -395.088082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.088082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.088082 (E_RNA) where: Base-Base interactions energy: -258.534 where: short stacking energy: -121.864 Base-Backbone interact. energy: -0.138 local terms energy: -136.416051 where: bonds (distance) C4'-P energy: -25.222 bonds (distance) P-C4' energy: -25.607 flat angles C4'-P-C4' energy: -26.767 flat angles P-C4'-P energy: -19.920 tors. eta vs tors. theta energy: -38.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -383.819425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.819425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.819425 (E_RNA) where: Base-Base interactions energy: -265.181 where: short stacking energy: -117.637 Base-Backbone interact. energy: -0.002 local terms energy: -118.636373 where: bonds (distance) C4'-P energy: -19.444 bonds (distance) P-C4' energy: -22.639 flat angles C4'-P-C4' energy: -20.211 flat angles P-C4'-P energy: -21.443 tors. eta vs tors. theta energy: -34.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -381.731438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.731438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.731438 (E_RNA) where: Base-Base interactions energy: -252.003 where: short stacking energy: -110.399 Base-Backbone interact. energy: -0.020 local terms energy: -129.708566 where: bonds (distance) C4'-P energy: -26.274 bonds (distance) P-C4' energy: -23.023 flat angles C4'-P-C4' energy: -26.400 flat angles P-C4'-P energy: -17.941 tors. eta vs tors. theta energy: -36.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -318.300762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.300762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.300762 (E_RNA) where: Base-Base interactions energy: -209.254 where: short stacking energy: -99.443 Base-Backbone interact. energy: -0.028 local terms energy: -109.018685 where: bonds (distance) C4'-P energy: -19.147 bonds (distance) P-C4' energy: -22.415 flat angles C4'-P-C4' energy: -23.763 flat angles P-C4'-P energy: -12.564 tors. eta vs tors. theta energy: -31.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -217.683442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.683442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.683442 (E_RNA) where: Base-Base interactions energy: -114.012 where: short stacking energy: -64.888 Base-Backbone interact. energy: -0.145 local terms energy: -103.527125 where: bonds (distance) C4'-P energy: -22.231 bonds (distance) P-C4' energy: -24.162 flat angles C4'-P-C4' energy: -23.998 flat angles P-C4'-P energy: -17.395 tors. eta vs tors. theta energy: -15.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -223.665643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.665643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.665643 (E_RNA) where: Base-Base interactions energy: -137.895 where: short stacking energy: -82.649 Base-Backbone interact. energy: 0.039 local terms energy: -85.809704 where: bonds (distance) C4'-P energy: -13.631 bonds (distance) P-C4' energy: -19.762 flat angles C4'-P-C4' energy: -20.688 flat angles P-C4'-P energy: -13.264 tors. eta vs tors. theta energy: -18.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -217.893251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.893251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.893251 (E_RNA) where: Base-Base interactions energy: -128.719 where: short stacking energy: -66.293 Base-Backbone interact. energy: -0.399 local terms energy: -88.775308 where: bonds (distance) C4'-P energy: -15.401 bonds (distance) P-C4' energy: -22.609 flat angles C4'-P-C4' energy: -21.921 flat angles P-C4'-P energy: -16.590 tors. eta vs tors. theta energy: -12.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -137.349431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.349431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.349431 (E_RNA) where: Base-Base interactions energy: -49.631 where: short stacking energy: -49.631 Base-Backbone interact. energy: -0.157 local terms energy: -87.561162 where: bonds (distance) C4'-P energy: -21.509 bonds (distance) P-C4' energy: -19.559 flat angles C4'-P-C4' energy: -21.999 flat angles P-C4'-P energy: -14.167 tors. eta vs tors. theta energy: -10.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -123.990317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.990317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.990317 (E_RNA) where: Base-Base interactions energy: -50.369 where: short stacking energy: -38.631 Base-Backbone interact. energy: -0.536 local terms energy: -73.085255 where: bonds (distance) C4'-P energy: -21.000 bonds (distance) P-C4' energy: -23.871 flat angles C4'-P-C4' energy: -18.132 flat angles P-C4'-P energy: -8.529 tors. eta vs tors. theta energy: -1.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -129.276039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.276039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.276039 (E_RNA) where: Base-Base interactions energy: -54.267 where: short stacking energy: -41.485 Base-Backbone interact. energy: -0.315 local terms energy: -74.694153 where: bonds (distance) C4'-P energy: -18.524 bonds (distance) P-C4' energy: -19.583 flat angles C4'-P-C4' energy: -24.843 flat angles P-C4'-P energy: -9.591 tors. eta vs tors. theta energy: -2.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -401.454609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.454609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.454609 (E_RNA) where: Base-Base interactions energy: -271.051 where: short stacking energy: -126.641 Base-Backbone interact. energy: -0.637 local terms energy: -129.765876 where: bonds (distance) C4'-P energy: -22.381 bonds (distance) P-C4' energy: -24.558 flat angles C4'-P-C4' energy: -24.496 flat angles P-C4'-P energy: -22.214 tors. eta vs tors. theta energy: -36.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -384.521095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.521095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.521095 (E_RNA) where: Base-Base interactions energy: -265.888 where: short stacking energy: -118.903 Base-Backbone interact. energy: -0.125 local terms energy: -118.507356 where: bonds (distance) C4'-P energy: -21.238 bonds (distance) P-C4' energy: -18.360 flat angles C4'-P-C4' energy: -25.766 flat angles P-C4'-P energy: -17.480 tors. eta vs tors. theta energy: -35.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -383.393369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.393369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.393369 (E_RNA) where: Base-Base interactions energy: -257.327 where: short stacking energy: -110.434 Base-Backbone interact. energy: -0.000 local terms energy: -126.066196 where: bonds (distance) C4'-P energy: -21.880 bonds (distance) P-C4' energy: -23.521 flat angles C4'-P-C4' energy: -25.965 flat angles P-C4'-P energy: -18.860 tors. eta vs tors. theta energy: -35.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -329.772139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.772139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.772139 (E_RNA) where: Base-Base interactions energy: -227.398 where: short stacking energy: -90.111 Base-Backbone interact. energy: -0.224 local terms energy: -102.149598 where: bonds (distance) C4'-P energy: -15.578 bonds (distance) P-C4' energy: -19.503 flat angles C4'-P-C4' energy: -24.848 flat angles P-C4'-P energy: -15.655 tors. eta vs tors. theta energy: -26.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -224.716736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.716736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.716736 (E_RNA) where: Base-Base interactions energy: -119.623 where: short stacking energy: -67.517 Base-Backbone interact. energy: -0.205 local terms energy: -104.889012 where: bonds (distance) C4'-P energy: -21.154 bonds (distance) P-C4' energy: -20.783 flat angles C4'-P-C4' energy: -21.294 flat angles P-C4'-P energy: -18.994 tors. eta vs tors. theta energy: -22.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -249.657153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.657153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.657153 (E_RNA) where: Base-Base interactions energy: -170.088 where: short stacking energy: -74.070 Base-Backbone interact. energy: -0.428 local terms energy: -79.140827 where: bonds (distance) C4'-P energy: -16.069 bonds (distance) P-C4' energy: -17.319 flat angles C4'-P-C4' energy: -19.391 flat angles P-C4'-P energy: -10.309 tors. eta vs tors. theta energy: -16.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -204.932704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.932704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.932704 (E_RNA) where: Base-Base interactions energy: -110.274 where: short stacking energy: -64.702 Base-Backbone interact. energy: -0.149 local terms energy: -94.509953 where: bonds (distance) C4'-P energy: -17.379 bonds (distance) P-C4' energy: -22.227 flat angles C4'-P-C4' energy: -24.688 flat angles P-C4'-P energy: -13.587 tors. eta vs tors. theta energy: -16.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -120.417911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.417911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.417911 (E_RNA) where: Base-Base interactions energy: -46.750 where: short stacking energy: -41.471 Base-Backbone interact. energy: 0.911 local terms energy: -74.579013 where: bonds (distance) C4'-P energy: -17.921 bonds (distance) P-C4' energy: -25.269 flat angles C4'-P-C4' energy: -13.996 flat angles P-C4'-P energy: -11.163 tors. eta vs tors. theta energy: -6.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -131.421197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.421197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.421197 (E_RNA) where: Base-Base interactions energy: -50.250 where: short stacking energy: -23.716 Base-Backbone interact. energy: -0.916 local terms energy: -80.255207 where: bonds (distance) C4'-P energy: -24.867 bonds (distance) P-C4' energy: -18.115 flat angles C4'-P-C4' energy: -17.984 flat angles P-C4'-P energy: -17.062 tors. eta vs tors. theta energy: -2.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -114.656387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.656387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.656387 (E_RNA) where: Base-Base interactions energy: -51.093 where: short stacking energy: -30.347 Base-Backbone interact. energy: -0.334 local terms energy: -63.229310 where: bonds (distance) C4'-P energy: -15.864 bonds (distance) P-C4' energy: -21.021 flat angles C4'-P-C4' energy: -13.437 flat angles P-C4'-P energy: -7.216 tors. eta vs tors. theta energy: -5.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -394.426407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.426407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.426407 (E_RNA) where: Base-Base interactions energy: -268.882 where: short stacking energy: -123.175 Base-Backbone interact. energy: -0.024 local terms energy: -125.519893 where: bonds (distance) C4'-P energy: -21.952 bonds (distance) P-C4' energy: -25.533 flat angles C4'-P-C4' energy: -21.987 flat angles P-C4'-P energy: -17.934 tors. eta vs tors. theta energy: -38.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -382.359016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.359016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.359016 (E_RNA) where: Base-Base interactions energy: -262.287 where: short stacking energy: -117.448 Base-Backbone interact. energy: -0.274 local terms energy: -119.798226 where: bonds (distance) C4'-P energy: -20.923 bonds (distance) P-C4' energy: -18.937 flat angles C4'-P-C4' energy: -27.014 flat angles P-C4'-P energy: -15.700 tors. eta vs tors. theta energy: -37.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -362.621038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.621038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.621038 (E_RNA) where: Base-Base interactions energy: -242.338 where: short stacking energy: -103.927 Base-Backbone interact. energy: -0.019 local terms energy: -120.264375 where: bonds (distance) C4'-P energy: -22.470 bonds (distance) P-C4' energy: -23.250 flat angles C4'-P-C4' energy: -23.692 flat angles P-C4'-P energy: -17.128 tors. eta vs tors. theta energy: -33.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -315.964993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.964993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.964993 (E_RNA) where: Base-Base interactions energy: -213.213 where: short stacking energy: -97.598 Base-Backbone interact. energy: 0.316 local terms energy: -103.067729 where: bonds (distance) C4'-P energy: -19.527 bonds (distance) P-C4' energy: -19.176 flat angles C4'-P-C4' energy: -20.212 flat angles P-C4'-P energy: -21.037 tors. eta vs tors. theta energy: -23.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -313.925126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.925126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.925126 (E_RNA) where: Base-Base interactions energy: -221.515 where: short stacking energy: -86.398 Base-Backbone interact. energy: -0.217 local terms energy: -92.193066 where: bonds (distance) C4'-P energy: -22.792 bonds (distance) P-C4' energy: -20.595 flat angles C4'-P-C4' energy: -21.081 flat angles P-C4'-P energy: -8.567 tors. eta vs tors. theta energy: -19.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -207.837138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.837138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.837138 (E_RNA) where: Base-Base interactions energy: -115.610 where: short stacking energy: -70.801 Base-Backbone interact. energy: -0.078 local terms energy: -92.149313 where: bonds (distance) C4'-P energy: -14.025 bonds (distance) P-C4' energy: -22.220 flat angles C4'-P-C4' energy: -26.000 flat angles P-C4'-P energy: -12.612 tors. eta vs tors. theta energy: -17.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -179.522348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.522348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.522348 (E_RNA) where: Base-Base interactions energy: -95.687 where: short stacking energy: -55.352 Base-Backbone interact. energy: 0.673 local terms energy: -84.508236 where: bonds (distance) C4'-P energy: -22.988 bonds (distance) P-C4' energy: -22.908 flat angles C4'-P-C4' energy: -15.559 flat angles P-C4'-P energy: -15.832 tors. eta vs tors. theta energy: -7.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -115.256409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.256409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.256409 (E_RNA) where: Base-Base interactions energy: -47.177 where: short stacking energy: -36.395 Base-Backbone interact. energy: -0.116 local terms energy: -67.963331 where: bonds (distance) C4'-P energy: -18.507 bonds (distance) P-C4' energy: -20.063 flat angles C4'-P-C4' energy: -14.610 flat angles P-C4'-P energy: -14.799 tors. eta vs tors. theta energy: 0.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -122.374806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.374806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.374806 (E_RNA) where: Base-Base interactions energy: -52.837 where: short stacking energy: -40.659 Base-Backbone interact. energy: 2.485 local terms energy: -72.022686 where: bonds (distance) C4'-P energy: -18.454 bonds (distance) P-C4' energy: -23.712 flat angles C4'-P-C4' energy: -12.533 flat angles P-C4'-P energy: -11.272 tors. eta vs tors. theta energy: -6.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -111.718876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.718876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.718876 (E_RNA) where: Base-Base interactions energy: -38.825 where: short stacking energy: -33.019 Base-Backbone interact. energy: -0.320 local terms energy: -72.574410 where: bonds (distance) C4'-P energy: -21.668 bonds (distance) P-C4' energy: -20.897 flat angles C4'-P-C4' energy: -14.517 flat angles P-C4'-P energy: -9.535 tors. eta vs tors. theta energy: -5.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -386.590442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.590442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.590442 (E_RNA) where: Base-Base interactions energy: -261.770 where: short stacking energy: -119.502 Base-Backbone interact. energy: -0.413 local terms energy: -124.406685 where: bonds (distance) C4'-P energy: -23.426 bonds (distance) P-C4' energy: -25.814 flat angles C4'-P-C4' energy: -24.207 flat angles P-C4'-P energy: -17.496 tors. eta vs tors. theta energy: -33.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -382.215251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.215251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.215251 (E_RNA) where: Base-Base interactions energy: -253.179 where: short stacking energy: -115.588 Base-Backbone interact. energy: -0.280 local terms energy: -128.755791 where: bonds (distance) C4'-P energy: -24.697 bonds (distance) P-C4' energy: -24.659 flat angles C4'-P-C4' energy: -23.517 flat angles P-C4'-P energy: -19.752 tors. eta vs tors. theta energy: -36.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -377.241242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.241242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.241242 (E_RNA) where: Base-Base interactions energy: -253.208 where: short stacking energy: -113.791 Base-Backbone interact. energy: 0.365 local terms energy: -124.398236 where: bonds (distance) C4'-P energy: -20.777 bonds (distance) P-C4' energy: -22.856 flat angles C4'-P-C4' energy: -24.312 flat angles P-C4'-P energy: -20.426 tors. eta vs tors. theta energy: -36.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -329.055902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.055902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.055902 (E_RNA) where: Base-Base interactions energy: -223.379 where: short stacking energy: -97.078 Base-Backbone interact. energy: -0.056 local terms energy: -105.620346 where: bonds (distance) C4'-P energy: -19.673 bonds (distance) P-C4' energy: -22.996 flat angles C4'-P-C4' energy: -23.643 flat angles P-C4'-P energy: -14.227 tors. eta vs tors. theta energy: -25.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -304.122629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.122629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.122629 (E_RNA) where: Base-Base interactions energy: -208.358 where: short stacking energy: -89.872 Base-Backbone interact. energy: 1.081 local terms energy: -96.845709 where: bonds (distance) C4'-P energy: -24.168 bonds (distance) P-C4' energy: -17.818 flat angles C4'-P-C4' energy: -22.941 flat angles P-C4'-P energy: -11.365 tors. eta vs tors. theta energy: -20.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -204.869857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.869857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.869857 (E_RNA) where: Base-Base interactions energy: -110.320 where: short stacking energy: -65.720 Base-Backbone interact. energy: -0.120 local terms energy: -94.429682 where: bonds (distance) C4'-P energy: -22.773 bonds (distance) P-C4' energy: -22.268 flat angles C4'-P-C4' energy: -18.874 flat angles P-C4'-P energy: -14.992 tors. eta vs tors. theta energy: -15.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -192.415566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.415566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.415566 (E_RNA) where: Base-Base interactions energy: -116.721 where: short stacking energy: -65.044 Base-Backbone interact. energy: -0.201 local terms energy: -75.493448 where: bonds (distance) C4'-P energy: -14.256 bonds (distance) P-C4' energy: -20.928 flat angles C4'-P-C4' energy: -14.717 flat angles P-C4'-P energy: -10.592 tors. eta vs tors. theta energy: -15.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -135.740671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.740671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.740671 (E_RNA) where: Base-Base interactions energy: -59.216 where: short stacking energy: -42.140 Base-Backbone interact. energy: -0.217 local terms energy: -76.307555 where: bonds (distance) C4'-P energy: -17.337 bonds (distance) P-C4' energy: -22.014 flat angles C4'-P-C4' energy: -21.149 flat angles P-C4'-P energy: -14.018 tors. eta vs tors. theta energy: -1.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -131.196440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.196440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.196440 (E_RNA) where: Base-Base interactions energy: -43.686 where: short stacking energy: -42.364 Base-Backbone interact. energy: -0.156 local terms energy: -87.354748 where: bonds (distance) C4'-P energy: -18.409 bonds (distance) P-C4' energy: -23.564 flat angles C4'-P-C4' energy: -22.266 flat angles P-C4'-P energy: -12.804 tors. eta vs tors. theta energy: -10.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -110.986956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.986956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.986956 (E_RNA) where: Base-Base interactions energy: -40.480 where: short stacking energy: -39.504 Base-Backbone interact. energy: 1.269 local terms energy: -71.776148 where: bonds (distance) C4'-P energy: -22.003 bonds (distance) P-C4' energy: -23.038 flat angles C4'-P-C4' energy: -15.474 flat angles P-C4'-P energy: -9.492 tors. eta vs tors. theta energy: -1.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -393.073522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.073522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.073522 (E_RNA) where: Base-Base interactions energy: -265.242 where: short stacking energy: -122.811 Base-Backbone interact. energy: -0.569 local terms energy: -127.262226 where: bonds (distance) C4'-P energy: -23.650 bonds (distance) P-C4' energy: -23.340 flat angles C4'-P-C4' energy: -25.019 flat angles P-C4'-P energy: -17.499 tors. eta vs tors. theta energy: -37.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -391.020726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.020726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.020726 (E_RNA) where: Base-Base interactions energy: -270.667 where: short stacking energy: -127.337 Base-Backbone interact. energy: -0.314 local terms energy: -120.039745 where: bonds (distance) C4'-P energy: -15.339 bonds (distance) P-C4' energy: -23.680 flat angles C4'-P-C4' energy: -26.877 flat angles P-C4'-P energy: -16.223 tors. eta vs tors. theta energy: -37.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -376.227924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.227924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.227924 (E_RNA) where: Base-Base interactions energy: -255.088 where: short stacking energy: -104.971 Base-Backbone interact. energy: -0.601 local terms energy: -120.538266 where: bonds (distance) C4'-P energy: -20.901 bonds (distance) P-C4' energy: -22.608 flat angles C4'-P-C4' energy: -27.728 flat angles P-C4'-P energy: -15.381 tors. eta vs tors. theta energy: -33.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -357.657509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.657509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.657509 (E_RNA) where: Base-Base interactions energy: -241.889 where: short stacking energy: -106.276 Base-Backbone interact. energy: -0.681 local terms energy: -115.087497 where: bonds (distance) C4'-P energy: -23.183 bonds (distance) P-C4' energy: -21.259 flat angles C4'-P-C4' energy: -24.994 flat angles P-C4'-P energy: -15.855 tors. eta vs tors. theta energy: -29.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -297.754527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.754527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.754527 (E_RNA) where: Base-Base interactions energy: -196.084 where: short stacking energy: -85.580 Base-Backbone interact. energy: -0.056 local terms energy: -101.614328 where: bonds (distance) C4'-P energy: -24.796 bonds (distance) P-C4' energy: -19.954 flat angles C4'-P-C4' energy: -18.956 flat angles P-C4'-P energy: -13.872 tors. eta vs tors. theta energy: -24.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -199.564532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.564532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.564532 (E_RNA) where: Base-Base interactions energy: -121.640 where: short stacking energy: -70.278 Base-Backbone interact. energy: -0.325 local terms energy: -77.599619 where: bonds (distance) C4'-P energy: -18.909 bonds (distance) P-C4' energy: -18.667 flat angles C4'-P-C4' energy: -16.368 flat angles P-C4'-P energy: -15.166 tors. eta vs tors. theta energy: -8.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -193.663009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.663009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.663009 (E_RNA) where: Base-Base interactions energy: -115.629 where: short stacking energy: -54.689 Base-Backbone interact. energy: -0.449 local terms energy: -77.584868 where: bonds (distance) C4'-P energy: -21.780 bonds (distance) P-C4' energy: -24.387 flat angles C4'-P-C4' energy: -18.314 flat angles P-C4'-P energy: -8.738 tors. eta vs tors. theta energy: -4.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -128.055521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.055521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.055521 (E_RNA) where: Base-Base interactions energy: -50.271 where: short stacking energy: -34.553 Base-Backbone interact. energy: -0.182 local terms energy: -77.602038 where: bonds (distance) C4'-P energy: -19.051 bonds (distance) P-C4' energy: -21.000 flat angles C4'-P-C4' energy: -22.875 flat angles P-C4'-P energy: -11.139 tors. eta vs tors. theta energy: -3.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -108.458968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.458968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.458968 (E_RNA) where: Base-Base interactions energy: -38.802 where: short stacking energy: -32.278 Base-Backbone interact. energy: -0.358 local terms energy: -69.298647 where: bonds (distance) C4'-P energy: -21.627 bonds (distance) P-C4' energy: -21.601 flat angles C4'-P-C4' energy: -15.299 flat angles P-C4'-P energy: -8.100 tors. eta vs tors. theta energy: -2.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -107.063808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.063808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.063808 (E_RNA) where: Base-Base interactions energy: -42.993 where: short stacking energy: -25.188 Base-Backbone interact. energy: -0.647 local terms energy: -63.423767 where: bonds (distance) C4'-P energy: -11.587 bonds (distance) P-C4' energy: -18.243 flat angles C4'-P-C4' energy: -20.633 flat angles P-C4'-P energy: -13.802 tors. eta vs tors. theta energy: 0.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -389.228665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.228665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.228665 (E_RNA) where: Base-Base interactions energy: -266.481 where: short stacking energy: -124.149 Base-Backbone interact. energy: -0.009 local terms energy: -122.738607 where: bonds (distance) C4'-P energy: -21.795 bonds (distance) P-C4' energy: -25.473 flat angles C4'-P-C4' energy: -25.457 flat angles P-C4'-P energy: -13.510 tors. eta vs tors. theta energy: -36.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -378.333236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.333236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.333236 (E_RNA) where: Base-Base interactions energy: -254.106 where: short stacking energy: -115.896 Base-Backbone interact. energy: -0.657 local terms energy: -123.570535 where: bonds (distance) C4'-P energy: -23.150 bonds (distance) P-C4' energy: -21.111 flat angles C4'-P-C4' energy: -26.071 flat angles P-C4'-P energy: -18.639 tors. eta vs tors. theta energy: -34.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -374.470954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.470954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.470954 (E_RNA) where: Base-Base interactions energy: -250.874 where: short stacking energy: -113.451 Base-Backbone interact. energy: -0.124 local terms energy: -123.472945 where: bonds (distance) C4'-P energy: -26.502 bonds (distance) P-C4' energy: -21.497 flat angles C4'-P-C4' energy: -25.013 flat angles P-C4'-P energy: -14.204 tors. eta vs tors. theta energy: -36.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -376.220284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.220284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.220284 (E_RNA) where: Base-Base interactions energy: -253.486 where: short stacking energy: -112.597 Base-Backbone interact. energy: -0.068 local terms energy: -122.666494 where: bonds (distance) C4'-P energy: -23.319 bonds (distance) P-C4' energy: -24.361 flat angles C4'-P-C4' energy: -25.982 flat angles P-C4'-P energy: -16.138 tors. eta vs tors. theta energy: -32.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -297.128911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.128911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.128911 (E_RNA) where: Base-Base interactions energy: -193.194 where: short stacking energy: -82.663 Base-Backbone interact. energy: -0.175 local terms energy: -103.760097 where: bonds (distance) C4'-P energy: -20.403 bonds (distance) P-C4' energy: -21.284 flat angles C4'-P-C4' energy: -21.167 flat angles P-C4'-P energy: -17.216 tors. eta vs tors. theta energy: -23.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -211.113530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.113530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.113530 (E_RNA) where: Base-Base interactions energy: -139.855 where: short stacking energy: -78.831 Base-Backbone interact. energy: -0.223 local terms energy: -71.035632 where: bonds (distance) C4'-P energy: -18.713 bonds (distance) P-C4' energy: -15.367 flat angles C4'-P-C4' energy: -16.320 flat angles P-C4'-P energy: -4.364 tors. eta vs tors. theta energy: -16.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -199.624145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.624145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.624145 (E_RNA) where: Base-Base interactions energy: -109.945 where: short stacking energy: -66.963 Base-Backbone interact. energy: -0.461 local terms energy: -89.218492 where: bonds (distance) C4'-P energy: -15.761 bonds (distance) P-C4' energy: -21.322 flat angles C4'-P-C4' energy: -20.532 flat angles P-C4'-P energy: -11.985 tors. eta vs tors. theta energy: -19.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -138.856163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.856163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.856163 (E_RNA) where: Base-Base interactions energy: -67.102 where: short stacking energy: -42.927 Base-Backbone interact. energy: -0.352 local terms energy: -71.402935 where: bonds (distance) C4'-P energy: -18.989 bonds (distance) P-C4' energy: -17.133 flat angles C4'-P-C4' energy: -14.912 flat angles P-C4'-P energy: -9.659 tors. eta vs tors. theta energy: -10.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -110.129601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.129601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.129601 (E_RNA) where: Base-Base interactions energy: -28.353 where: short stacking energy: -28.353 Base-Backbone interact. energy: -2.168 local terms energy: -79.608708 where: bonds (distance) C4'-P energy: -16.931 bonds (distance) P-C4' energy: -19.639 flat angles C4'-P-C4' energy: -23.502 flat angles P-C4'-P energy: -15.365 tors. eta vs tors. theta energy: -4.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -112.623553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.623553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.623553 (E_RNA) where: Base-Base interactions energy: -45.508 where: short stacking energy: -32.738 Base-Backbone interact. energy: -0.581 local terms energy: -66.534522 where: bonds (distance) C4'-P energy: -24.524 bonds (distance) P-C4' energy: -14.735 flat angles C4'-P-C4' energy: -20.566 flat angles P-C4'-P energy: -8.399 tors. eta vs tors. theta energy: 1.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -394.842293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.842293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.842293 (E_RNA) where: Base-Base interactions energy: -276.529 where: short stacking energy: -118.160 Base-Backbone interact. energy: -0.003 local terms energy: -118.310386 where: bonds (distance) C4'-P energy: -21.816 bonds (distance) P-C4' energy: -17.813 flat angles C4'-P-C4' energy: -25.844 flat angles P-C4'-P energy: -18.640 tors. eta vs tors. theta energy: -34.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -380.907219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.907219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.907219 (E_RNA) where: Base-Base interactions energy: -255.715 where: short stacking energy: -120.686 Base-Backbone interact. energy: -0.080 local terms energy: -125.111915 where: bonds (distance) C4'-P energy: -22.620 bonds (distance) P-C4' energy: -21.184 flat angles C4'-P-C4' energy: -27.696 flat angles P-C4'-P energy: -17.546 tors. eta vs tors. theta energy: -36.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -385.912090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.912090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.912090 (E_RNA) where: Base-Base interactions energy: -264.746 where: short stacking energy: -114.239 Base-Backbone interact. energy: -0.088 local terms energy: -121.077654 where: bonds (distance) C4'-P energy: -22.070 bonds (distance) P-C4' energy: -21.781 flat angles C4'-P-C4' energy: -26.550 flat angles P-C4'-P energy: -17.249 tors. eta vs tors. theta energy: -33.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -375.826511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.826511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.826511 (E_RNA) where: Base-Base interactions energy: -256.033 where: short stacking energy: -114.297 Base-Backbone interact. energy: -0.732 local terms energy: -119.061589 where: bonds (distance) C4'-P energy: -21.663 bonds (distance) P-C4' energy: -21.975 flat angles C4'-P-C4' energy: -23.841 flat angles P-C4'-P energy: -14.867 tors. eta vs tors. theta energy: -36.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -317.414042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.414042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.414042 (E_RNA) where: Base-Base interactions energy: -221.882 where: short stacking energy: -83.652 Base-Backbone interact. energy: 0.291 local terms energy: -95.822899 where: bonds (distance) C4'-P energy: -13.825 bonds (distance) P-C4' energy: -22.038 flat angles C4'-P-C4' energy: -22.650 flat angles P-C4'-P energy: -16.398 tors. eta vs tors. theta energy: -20.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -201.578193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.578193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.578193 (E_RNA) where: Base-Base interactions energy: -111.567 where: short stacking energy: -61.661 Base-Backbone interact. energy: -0.067 local terms energy: -89.944016 where: bonds (distance) C4'-P energy: -16.841 bonds (distance) P-C4' energy: -22.900 flat angles C4'-P-C4' energy: -23.455 flat angles P-C4'-P energy: -12.708 tors. eta vs tors. theta energy: -14.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -180.074379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.074379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.074379 (E_RNA) where: Base-Base interactions energy: -100.122 where: short stacking energy: -49.690 Base-Backbone interact. energy: 1.535 local terms energy: -81.487405 where: bonds (distance) C4'-P energy: -21.854 bonds (distance) P-C4' energy: -25.449 flat angles C4'-P-C4' energy: -13.277 flat angles P-C4'-P energy: -12.706 tors. eta vs tors. theta energy: -8.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -130.652164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.652164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.652164 (E_RNA) where: Base-Base interactions energy: -58.113 where: short stacking energy: -44.544 Base-Backbone interact. energy: 1.291 local terms energy: -73.830359 where: bonds (distance) C4'-P energy: -17.939 bonds (distance) P-C4' energy: -21.214 flat angles C4'-P-C4' energy: -13.364 flat angles P-C4'-P energy: -15.199 tors. eta vs tors. theta energy: -6.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -117.921369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.921369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.921369 (E_RNA) where: Base-Base interactions energy: -44.968 where: short stacking energy: -27.326 Base-Backbone interact. energy: -1.545 local terms energy: -71.407577 where: bonds (distance) C4'-P energy: -17.180 bonds (distance) P-C4' energy: -22.835 flat angles C4'-P-C4' energy: -19.011 flat angles P-C4'-P energy: -13.126 tors. eta vs tors. theta energy: 0.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -130.441495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.441495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.441495 (E_RNA) where: Base-Base interactions energy: -57.775 where: short stacking energy: -33.417 Base-Backbone interact. energy: -0.948 local terms energy: -71.718391 where: bonds (distance) C4'-P energy: -19.489 bonds (distance) P-C4' energy: -22.438 flat angles C4'-P-C4' energy: -20.483 flat angles P-C4'-P energy: -6.348 tors. eta vs tors. theta energy: -2.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -391.474528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.474528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.474528 (E_RNA) where: Base-Base interactions energy: -272.636 where: short stacking energy: -124.376 Base-Backbone interact. energy: -0.211 local terms energy: -118.627875 where: bonds (distance) C4'-P energy: -17.118 bonds (distance) P-C4' energy: -20.366 flat angles C4'-P-C4' energy: -26.669 flat angles P-C4'-P energy: -18.254 tors. eta vs tors. theta energy: -36.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -395.378383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.378383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.378383 (E_RNA) where: Base-Base interactions energy: -269.173 where: short stacking energy: -120.495 Base-Backbone interact. energy: -0.069 local terms energy: -126.135510 where: bonds (distance) C4'-P energy: -22.606 bonds (distance) P-C4' energy: -21.710 flat angles C4'-P-C4' energy: -27.345 flat angles P-C4'-P energy: -19.684 tors. eta vs tors. theta energy: -34.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -373.755490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.755490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.755490 (E_RNA) where: Base-Base interactions energy: -258.322 where: short stacking energy: -111.903 Base-Backbone interact. energy: -0.104 local terms energy: -115.328867 where: bonds (distance) C4'-P energy: -19.469 bonds (distance) P-C4' energy: -21.233 flat angles C4'-P-C4' energy: -25.214 flat angles P-C4'-P energy: -14.251 tors. eta vs tors. theta energy: -35.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -322.171076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.171076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.171076 (E_RNA) where: Base-Base interactions energy: -214.140 where: short stacking energy: -93.088 Base-Backbone interact. energy: -0.555 local terms energy: -107.476099 where: bonds (distance) C4'-P energy: -21.882 bonds (distance) P-C4' energy: -20.570 flat angles C4'-P-C4' energy: -22.857 flat angles P-C4'-P energy: -17.074 tors. eta vs tors. theta energy: -25.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -356.630799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.630799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.630799 (E_RNA) where: Base-Base interactions energy: -237.072 where: short stacking energy: -107.931 Base-Backbone interact. energy: -0.035 local terms energy: -119.523608 where: bonds (distance) C4'-P energy: -22.239 bonds (distance) P-C4' energy: -19.623 flat angles C4'-P-C4' energy: -23.582 flat angles P-C4'-P energy: -21.278 tors. eta vs tors. theta energy: -32.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -219.599330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.599330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.599330 (E_RNA) where: Base-Base interactions energy: -119.234 where: short stacking energy: -53.049 Base-Backbone interact. energy: -0.290 local terms energy: -100.075238 where: bonds (distance) C4'-P energy: -21.018 bonds (distance) P-C4' energy: -21.425 flat angles C4'-P-C4' energy: -26.166 flat angles P-C4'-P energy: -19.510 tors. eta vs tors. theta energy: -11.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -194.646516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.646516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.646516 (E_RNA) where: Base-Base interactions energy: -114.174 where: short stacking energy: -59.455 Base-Backbone interact. energy: -0.550 local terms energy: -79.922941 where: bonds (distance) C4'-P energy: -18.707 bonds (distance) P-C4' energy: -17.554 flat angles C4'-P-C4' energy: -16.133 flat angles P-C4'-P energy: -15.677 tors. eta vs tors. theta energy: -11.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -123.609154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.609154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.609154 (E_RNA) where: Base-Base interactions energy: -45.480 where: short stacking energy: -29.269 Base-Backbone interact. energy: -1.391 local terms energy: -76.738437 where: bonds (distance) C4'-P energy: -14.484 bonds (distance) P-C4' energy: -22.539 flat angles C4'-P-C4' energy: -13.631 flat angles P-C4'-P energy: -18.048 tors. eta vs tors. theta energy: -8.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -122.086566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.086566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.086566 (E_RNA) where: Base-Base interactions energy: -49.990 where: short stacking energy: -38.770 Base-Backbone interact. energy: 0.383 local terms energy: -72.480013 where: bonds (distance) C4'-P energy: -24.905 bonds (distance) P-C4' energy: -19.752 flat angles C4'-P-C4' energy: -19.703 flat angles P-C4'-P energy: -4.475 tors. eta vs tors. theta energy: -3.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -118.073645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.073645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.073645 (E_RNA) where: Base-Base interactions energy: -40.328 where: short stacking energy: -40.328 Base-Backbone interact. energy: -0.272 local terms energy: -77.473586 where: bonds (distance) C4'-P energy: -15.597 bonds (distance) P-C4' energy: -22.988 flat angles C4'-P-C4' energy: -17.775 flat angles P-C4'-P energy: -12.535 tors. eta vs tors. theta energy: -8.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -398.873003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.873003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.873003 (E_RNA) where: Base-Base interactions energy: -271.590 where: short stacking energy: -125.874 Base-Backbone interact. energy: -0.042 local terms energy: -127.240878 where: bonds (distance) C4'-P energy: -22.511 bonds (distance) P-C4' energy: -26.915 flat angles C4'-P-C4' energy: -27.401 flat angles P-C4'-P energy: -16.274 tors. eta vs tors. theta energy: -34.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -387.277427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.277427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.277427 (E_RNA) where: Base-Base interactions energy: -263.663 where: short stacking energy: -118.622 Base-Backbone interact. energy: -0.017 local terms energy: -123.597323 where: bonds (distance) C4'-P energy: -19.842 bonds (distance) P-C4' energy: -24.635 flat angles C4'-P-C4' energy: -27.654 flat angles P-C4'-P energy: -14.417 tors. eta vs tors. theta energy: -37.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -387.650944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.650944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.650944 (E_RNA) where: Base-Base interactions energy: -263.677 where: short stacking energy: -119.772 Base-Backbone interact. energy: -0.607 local terms energy: -123.367251 where: bonds (distance) C4'-P energy: -18.417 bonds (distance) P-C4' energy: -23.343 flat angles C4'-P-C4' energy: -25.755 flat angles P-C4'-P energy: -16.215 tors. eta vs tors. theta energy: -39.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -330.969375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.969375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.969375 (E_RNA) where: Base-Base interactions energy: -223.188 where: short stacking energy: -91.357 Base-Backbone interact. energy: 3.440 local terms energy: -111.221650 where: bonds (distance) C4'-P energy: -22.052 bonds (distance) P-C4' energy: -20.764 flat angles C4'-P-C4' energy: -24.277 flat angles P-C4'-P energy: -17.871 tors. eta vs tors. theta energy: -26.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -366.251376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.251376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.251376 (E_RNA) where: Base-Base interactions energy: -242.283 where: short stacking energy: -110.677 Base-Backbone interact. energy: -0.003 local terms energy: -123.965672 where: bonds (distance) C4'-P energy: -26.519 bonds (distance) P-C4' energy: -23.977 flat angles C4'-P-C4' energy: -22.723 flat angles P-C4'-P energy: -17.224 tors. eta vs tors. theta energy: -33.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -225.099455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.099455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.099455 (E_RNA) where: Base-Base interactions energy: -146.990 where: short stacking energy: -77.692 Base-Backbone interact. energy: -0.228 local terms energy: -77.881580 where: bonds (distance) C4'-P energy: -16.001 bonds (distance) P-C4' energy: -13.367 flat angles C4'-P-C4' energy: -16.110 flat angles P-C4'-P energy: -14.136 tors. eta vs tors. theta energy: -18.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -186.798425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.798425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.798425 (E_RNA) where: Base-Base interactions energy: -107.851 where: short stacking energy: -60.508 Base-Backbone interact. energy: -1.097 local terms energy: -77.850745 where: bonds (distance) C4'-P energy: -22.389 bonds (distance) P-C4' energy: -17.306 flat angles C4'-P-C4' energy: -14.612 flat angles P-C4'-P energy: -12.068 tors. eta vs tors. theta energy: -11.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -117.597457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.597457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.597457 (E_RNA) where: Base-Base interactions energy: -39.111 where: short stacking energy: -39.111 Base-Backbone interact. energy: -0.683 local terms energy: -77.804189 where: bonds (distance) C4'-P energy: -17.888 bonds (distance) P-C4' energy: -22.327 flat angles C4'-P-C4' energy: -19.588 flat angles P-C4'-P energy: -12.970 tors. eta vs tors. theta energy: -5.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -105.706086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.706086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.706086 (E_RNA) where: Base-Base interactions energy: -40.736 where: short stacking energy: -33.713 Base-Backbone interact. energy: 2.825 local terms energy: -67.795256 where: bonds (distance) C4'-P energy: -12.643 bonds (distance) P-C4' energy: -21.981 flat angles C4'-P-C4' energy: -17.470 flat angles P-C4'-P energy: -13.495 tors. eta vs tors. theta energy: -2.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -107.954840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.954840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.954840 (E_RNA) where: Base-Base interactions energy: -37.736 where: short stacking energy: -28.039 Base-Backbone interact. energy: -0.317 local terms energy: -69.901714 where: bonds (distance) C4'-P energy: -18.085 bonds (distance) P-C4' energy: -19.502 flat angles C4'-P-C4' energy: -22.301 flat angles P-C4'-P energy: -10.731 tors. eta vs tors. theta energy: 0.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -389.397755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.397755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.397755 (E_RNA) where: Base-Base interactions energy: -264.893 where: short stacking energy: -116.992 Base-Backbone interact. energy: -0.388 local terms energy: -124.116740 where: bonds (distance) C4'-P energy: -24.419 bonds (distance) P-C4' energy: -24.070 flat angles C4'-P-C4' energy: -25.598 flat angles P-C4'-P energy: -16.316 tors. eta vs tors. theta energy: -33.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -387.208497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.208497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.208497 (E_RNA) where: Base-Base interactions energy: -260.287 where: short stacking energy: -112.426 Base-Backbone interact. energy: -0.002 local terms energy: -126.919485 where: bonds (distance) C4'-P energy: -23.249 bonds (distance) P-C4' energy: -20.590 flat angles C4'-P-C4' energy: -27.136 flat angles P-C4'-P energy: -17.594 tors. eta vs tors. theta energy: -38.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -386.732505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.732505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.732505 (E_RNA) where: Base-Base interactions energy: -263.541 where: short stacking energy: -119.585 Base-Backbone interact. energy: -0.530 local terms energy: -122.661796 where: bonds (distance) C4'-P energy: -20.042 bonds (distance) P-C4' energy: -23.113 flat angles C4'-P-C4' energy: -24.515 flat angles P-C4'-P energy: -18.528 tors. eta vs tors. theta energy: -36.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -367.900891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.900891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.900891 (E_RNA) where: Base-Base interactions energy: -254.846 where: short stacking energy: -113.432 Base-Backbone interact. energy: -0.131 local terms energy: -112.923945 where: bonds (distance) C4'-P energy: -19.667 bonds (distance) P-C4' energy: -17.667 flat angles C4'-P-C4' energy: -27.516 flat angles P-C4'-P energy: -14.102 tors. eta vs tors. theta energy: -33.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -308.788207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.788207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.788207 (E_RNA) where: Base-Base interactions energy: -205.285 where: short stacking energy: -93.348 Base-Backbone interact. energy: 0.107 local terms energy: -103.609673 where: bonds (distance) C4'-P energy: -22.554 bonds (distance) P-C4' energy: -21.234 flat angles C4'-P-C4' energy: -21.414 flat angles P-C4'-P energy: -12.243 tors. eta vs tors. theta energy: -26.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -199.770278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.770278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.770278 (E_RNA) where: Base-Base interactions energy: -108.832 where: short stacking energy: -69.439 Base-Backbone interact. energy: -1.355 local terms energy: -89.583495 where: bonds (distance) C4'-P energy: -20.090 bonds (distance) P-C4' energy: -20.858 flat angles C4'-P-C4' energy: -19.716 flat angles P-C4'-P energy: -16.185 tors. eta vs tors. theta energy: -12.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -210.392971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.392971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.392971 (E_RNA) where: Base-Base interactions energy: -129.730 where: short stacking energy: -65.290 Base-Backbone interact. energy: 1.649 local terms energy: -82.312003 where: bonds (distance) C4'-P energy: -10.861 bonds (distance) P-C4' energy: -16.700 flat angles C4'-P-C4' energy: -25.189 flat angles P-C4'-P energy: -17.925 tors. eta vs tors. theta energy: -11.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -144.914103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.914103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.914103 (E_RNA) where: Base-Base interactions energy: -59.559 where: short stacking energy: -40.798 Base-Backbone interact. energy: -0.176 local terms energy: -85.178378 where: bonds (distance) C4'-P energy: -20.545 bonds (distance) P-C4' energy: -22.689 flat angles C4'-P-C4' energy: -11.026 flat angles P-C4'-P energy: -14.673 tors. eta vs tors. theta energy: -16.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -111.178897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.178897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.178897 (E_RNA) where: Base-Base interactions energy: -38.097 where: short stacking energy: -30.924 Base-Backbone interact. energy: -0.296 local terms energy: -72.786282 where: bonds (distance) C4'-P energy: -20.090 bonds (distance) P-C4' energy: -20.409 flat angles C4'-P-C4' energy: -18.252 flat angles P-C4'-P energy: -14.961 tors. eta vs tors. theta energy: 0.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -109.329810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.329810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.329810 (E_RNA) where: Base-Base interactions energy: -46.201 where: short stacking energy: -30.352 Base-Backbone interact. energy: -0.065 local terms energy: -63.063509 where: bonds (distance) C4'-P energy: -17.804 bonds (distance) P-C4' energy: -17.864 flat angles C4'-P-C4' energy: -17.765 flat angles P-C4'-P energy: -8.826 tors. eta vs tors. theta energy: -0.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -383.856105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.856105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.856105 (E_RNA) where: Base-Base interactions energy: -267.763 where: short stacking energy: -118.641 Base-Backbone interact. energy: -0.015 local terms energy: -116.077931 where: bonds (distance) C4'-P energy: -20.701 bonds (distance) P-C4' energy: -20.780 flat angles C4'-P-C4' energy: -20.868 flat angles P-C4'-P energy: -22.599 tors. eta vs tors. theta energy: -31.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -394.126677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.126677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.126677 (E_RNA) where: Base-Base interactions energy: -266.148 where: short stacking energy: -125.706 Base-Backbone interact. energy: -0.006 local terms energy: -127.973224 where: bonds (distance) C4'-P energy: -26.280 bonds (distance) P-C4' energy: -23.286 flat angles C4'-P-C4' energy: -23.624 flat angles P-C4'-P energy: -18.401 tors. eta vs tors. theta energy: -36.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -392.473740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.473740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.473740 (E_RNA) where: Base-Base interactions energy: -263.710 where: short stacking energy: -118.083 Base-Backbone interact. energy: -0.330 local terms energy: -128.433232 where: bonds (distance) C4'-P energy: -25.597 bonds (distance) P-C4' energy: -26.576 flat angles C4'-P-C4' energy: -25.942 flat angles P-C4'-P energy: -14.517 tors. eta vs tors. theta energy: -35.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -382.797523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.797523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.797523 (E_RNA) where: Base-Base interactions energy: -260.910 where: short stacking energy: -115.034 Base-Backbone interact. energy: -0.391 local terms energy: -121.496369 where: bonds (distance) C4'-P energy: -15.856 bonds (distance) P-C4' energy: -22.015 flat angles C4'-P-C4' energy: -26.724 flat angles P-C4'-P energy: -19.066 tors. eta vs tors. theta energy: -37.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -307.913312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.913312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.913312 (E_RNA) where: Base-Base interactions energy: -201.682 where: short stacking energy: -80.349 Base-Backbone interact. energy: -0.649 local terms energy: -105.582192 where: bonds (distance) C4'-P energy: -19.859 bonds (distance) P-C4' energy: -18.418 flat angles C4'-P-C4' energy: -25.761 flat angles P-C4'-P energy: -17.091 tors. eta vs tors. theta energy: -24.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -200.299187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.299187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.299187 (E_RNA) where: Base-Base interactions energy: -102.282 where: short stacking energy: -50.941 Base-Backbone interact. energy: -0.640 local terms energy: -97.376391 where: bonds (distance) C4'-P energy: -19.938 bonds (distance) P-C4' energy: -25.378 flat angles C4'-P-C4' energy: -23.607 flat angles P-C4'-P energy: -15.849 tors. eta vs tors. theta energy: -12.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -134.847783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.847783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.847783 (E_RNA) where: Base-Base interactions energy: -70.153 where: short stacking energy: -39.197 Base-Backbone interact. energy: -0.091 local terms energy: -64.603732 where: bonds (distance) C4'-P energy: -21.166 bonds (distance) P-C4' energy: -14.492 flat angles C4'-P-C4' energy: -20.184 flat angles P-C4'-P energy: -10.492 tors. eta vs tors. theta energy: 1.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -183.269992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.269992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.269992 (E_RNA) where: Base-Base interactions energy: -101.761 where: short stacking energy: -59.910 Base-Backbone interact. energy: -0.640 local terms energy: -80.869657 where: bonds (distance) C4'-P energy: -18.724 bonds (distance) P-C4' energy: -18.350 flat angles C4'-P-C4' energy: -18.432 flat angles P-C4'-P energy: -9.475 tors. eta vs tors. theta energy: -15.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -118.048411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.048411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.048411 (E_RNA) where: Base-Base interactions energy: -46.104 where: short stacking energy: -39.424 Base-Backbone interact. energy: -0.316 local terms energy: -71.628484 where: bonds (distance) C4'-P energy: -20.317 bonds (distance) P-C4' energy: -21.280 flat angles C4'-P-C4' energy: -15.165 flat angles P-C4'-P energy: -9.983 tors. eta vs tors. theta energy: -4.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -104.372887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.372887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.372887 (E_RNA) where: Base-Base interactions energy: -30.512 where: short stacking energy: -27.478 Base-Backbone interact. energy: 0.231 local terms energy: -74.092196 where: bonds (distance) C4'-P energy: -17.498 bonds (distance) P-C4' energy: -23.032 flat angles C4'-P-C4' energy: -17.338 flat angles P-C4'-P energy: -16.215 tors. eta vs tors. theta energy: -0.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -387.203352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.203352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.203352 (E_RNA) where: Base-Base interactions energy: -266.152 where: short stacking energy: -117.412 Base-Backbone interact. energy: -0.040 local terms energy: -121.011768 where: bonds (distance) C4'-P energy: -16.908 bonds (distance) P-C4' energy: -26.369 flat angles C4'-P-C4' energy: -26.091 flat angles P-C4'-P energy: -19.057 tors. eta vs tors. theta energy: -32.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -377.423819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.423819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.423819 (E_RNA) where: Base-Base interactions energy: -259.242 where: short stacking energy: -113.509 Base-Backbone interact. energy: -0.001 local terms energy: -118.181039 where: bonds (distance) C4'-P energy: -14.195 bonds (distance) P-C4' energy: -22.171 flat angles C4'-P-C4' energy: -24.143 flat angles P-C4'-P energy: -19.537 tors. eta vs tors. theta energy: -38.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -385.969308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.969308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.969308 (E_RNA) where: Base-Base interactions energy: -264.371 where: short stacking energy: -121.395 Base-Backbone interact. energy: -0.255 local terms energy: -121.343588 where: bonds (distance) C4'-P energy: -23.776 bonds (distance) P-C4' energy: -20.858 flat angles C4'-P-C4' energy: -24.001 flat angles P-C4'-P energy: -15.295 tors. eta vs tors. theta energy: -37.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -364.652721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.652721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.652721 (E_RNA) where: Base-Base interactions energy: -252.378 where: short stacking energy: -117.150 Base-Backbone interact. energy: -0.480 local terms energy: -111.795508 where: bonds (distance) C4'-P energy: -14.739 bonds (distance) P-C4' energy: -20.439 flat angles C4'-P-C4' energy: -23.100 flat angles P-C4'-P energy: -16.854 tors. eta vs tors. theta energy: -36.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -310.309989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.309989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.309989 (E_RNA) where: Base-Base interactions energy: -204.878 where: short stacking energy: -98.787 Base-Backbone interact. energy: -0.660 local terms energy: -104.771914 where: bonds (distance) C4'-P energy: -21.502 bonds (distance) P-C4' energy: -21.018 flat angles C4'-P-C4' energy: -21.478 flat angles P-C4'-P energy: -13.855 tors. eta vs tors. theta energy: -26.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -212.856280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.856280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.856280 (E_RNA) where: Base-Base interactions energy: -115.233 where: short stacking energy: -67.835 Base-Backbone interact. energy: -0.712 local terms energy: -96.910657 where: bonds (distance) C4'-P energy: -17.749 bonds (distance) P-C4' energy: -21.448 flat angles C4'-P-C4' energy: -25.320 flat angles P-C4'-P energy: -17.935 tors. eta vs tors. theta energy: -14.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -132.282668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.282668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.282668 (E_RNA) where: Base-Base interactions energy: -50.097 where: short stacking energy: -41.268 Base-Backbone interact. energy: -0.099 local terms energy: -82.087180 where: bonds (distance) C4'-P energy: -20.458 bonds (distance) P-C4' energy: -16.910 flat angles C4'-P-C4' energy: -21.459 flat angles P-C4'-P energy: -16.303 tors. eta vs tors. theta energy: -6.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -128.674384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.674384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.674384 (E_RNA) where: Base-Base interactions energy: -53.805 where: short stacking energy: -42.780 Base-Backbone interact. energy: -0.186 local terms energy: -74.684024 where: bonds (distance) C4'-P energy: -17.776 bonds (distance) P-C4' energy: -18.511 flat angles C4'-P-C4' energy: -19.091 flat angles P-C4'-P energy: -13.257 tors. eta vs tors. theta energy: -6.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -160.523380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.523380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.523380 (E_RNA) where: Base-Base interactions energy: -79.782 where: short stacking energy: -45.787 Base-Backbone interact. energy: -0.124 local terms energy: -80.618144 where: bonds (distance) C4'-P energy: -23.029 bonds (distance) P-C4' energy: -18.991 flat angles C4'-P-C4' energy: -17.604 flat angles P-C4'-P energy: -11.713 tors. eta vs tors. theta energy: -9.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -117.871858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.871858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.871858 (E_RNA) where: Base-Base interactions energy: -35.465 where: short stacking energy: -35.465 Base-Backbone interact. energy: -0.642 local terms energy: -81.764983 where: bonds (distance) C4'-P energy: -23.518 bonds (distance) P-C4' energy: -20.116 flat angles C4'-P-C4' energy: -18.586 flat angles P-C4'-P energy: -14.749 tors. eta vs tors. theta energy: -4.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -391.116658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.116658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.116658 (E_RNA) where: Base-Base interactions energy: -261.723 where: short stacking energy: -116.567 Base-Backbone interact. energy: -0.002 local terms energy: -129.391453 where: bonds (distance) C4'-P energy: -22.268 bonds (distance) P-C4' energy: -27.346 flat angles C4'-P-C4' energy: -25.658 flat angles P-C4'-P energy: -19.660 tors. eta vs tors. theta energy: -34.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -391.496391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.496391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.496391 (E_RNA) where: Base-Base interactions energy: -271.549 where: short stacking energy: -118.761 Base-Backbone interact. energy: -0.009 local terms energy: -119.938050 where: bonds (distance) C4'-P energy: -21.616 bonds (distance) P-C4' energy: -19.412 flat angles C4'-P-C4' energy: -25.477 flat angles P-C4'-P energy: -19.223 tors. eta vs tors. theta energy: -34.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -393.133354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.133354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.133354 (E_RNA) where: Base-Base interactions energy: -269.698 where: short stacking energy: -121.537 Base-Backbone interact. energy: -0.001 local terms energy: -123.434968 where: bonds (distance) C4'-P energy: -17.411 bonds (distance) P-C4' energy: -23.914 flat angles C4'-P-C4' energy: -26.443 flat angles P-C4'-P energy: -20.963 tors. eta vs tors. theta energy: -34.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -377.408265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.408265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.408265 (E_RNA) where: Base-Base interactions energy: -250.114 where: short stacking energy: -116.514 Base-Backbone interact. energy: -0.069 local terms energy: -127.225877 where: bonds (distance) C4'-P energy: -19.182 bonds (distance) P-C4' energy: -25.975 flat angles C4'-P-C4' energy: -25.978 flat angles P-C4'-P energy: -18.702 tors. eta vs tors. theta energy: -37.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -305.334841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.334841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.334841 (E_RNA) where: Base-Base interactions energy: -194.036 where: short stacking energy: -88.576 Base-Backbone interact. energy: 0.193 local terms energy: -111.492303 where: bonds (distance) C4'-P energy: -21.975 bonds (distance) P-C4' energy: -23.416 flat angles C4'-P-C4' energy: -20.497 flat angles P-C4'-P energy: -18.779 tors. eta vs tors. theta energy: -26.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -230.241247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.241247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.241247 (E_RNA) where: Base-Base interactions energy: -135.886 where: short stacking energy: -71.831 Base-Backbone interact. energy: -0.051 local terms energy: -94.304385 where: bonds (distance) C4'-P energy: -20.467 bonds (distance) P-C4' energy: -20.489 flat angles C4'-P-C4' energy: -21.791 flat angles P-C4'-P energy: -9.636 tors. eta vs tors. theta energy: -21.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -132.740946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.740946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.740946 (E_RNA) where: Base-Base interactions energy: -44.709 where: short stacking energy: -44.507 Base-Backbone interact. energy: 1.373 local terms energy: -89.404301 where: bonds (distance) C4'-P energy: -19.238 bonds (distance) P-C4' energy: -25.925 flat angles C4'-P-C4' energy: -22.695 flat angles P-C4'-P energy: -14.031 tors. eta vs tors. theta energy: -7.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -119.153746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.153746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.153746 (E_RNA) where: Base-Base interactions energy: -48.201 where: short stacking energy: -37.237 Base-Backbone interact. energy: -0.440 local terms energy: -70.513535 where: bonds (distance) C4'-P energy: -18.333 bonds (distance) P-C4' energy: -21.862 flat angles C4'-P-C4' energy: -18.609 flat angles P-C4'-P energy: -11.140 tors. eta vs tors. theta energy: -0.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -113.981986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.981986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.981986 (E_RNA) where: Base-Base interactions energy: -33.858 where: short stacking energy: -27.802 Base-Backbone interact. energy: -0.718 local terms energy: -79.405273 where: bonds (distance) C4'-P energy: -23.283 bonds (distance) P-C4' energy: -24.414 flat angles C4'-P-C4' energy: -20.437 flat angles P-C4'-P energy: -6.141 tors. eta vs tors. theta energy: -5.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -118.687415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.687415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.687415 (E_RNA) where: Base-Base interactions energy: -38.967 where: short stacking energy: -35.593 Base-Backbone interact. energy: -0.864 local terms energy: -78.856197 where: bonds (distance) C4'-P energy: -23.308 bonds (distance) P-C4' energy: -21.169 flat angles C4'-P-C4' energy: -19.900 flat angles P-C4'-P energy: -9.945 tors. eta vs tors. theta energy: -4.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -394.711332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.711332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.711332 (E_RNA) where: Base-Base interactions energy: -261.756 where: short stacking energy: -113.025 Base-Backbone interact. energy: -1.537 local terms energy: -131.417867 where: bonds (distance) C4'-P energy: -22.785 bonds (distance) P-C4' energy: -26.166 flat angles C4'-P-C4' energy: -26.092 flat angles P-C4'-P energy: -18.761 tors. eta vs tors. theta energy: -37.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -389.630834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.630834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.630834 (E_RNA) where: Base-Base interactions energy: -267.236 where: short stacking energy: -124.423 Base-Backbone interact. energy: 1.406 local terms energy: -123.800257 where: bonds (distance) C4'-P energy: -22.205 bonds (distance) P-C4' energy: -23.176 flat angles C4'-P-C4' energy: -24.589 flat angles P-C4'-P energy: -18.565 tors. eta vs tors. theta energy: -35.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -363.959021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.959021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.959021 (E_RNA) where: Base-Base interactions energy: -254.306 where: short stacking energy: -112.051 Base-Backbone interact. energy: -0.635 local terms energy: -109.018373 where: bonds (distance) C4'-P energy: -17.461 bonds (distance) P-C4' energy: -18.468 flat angles C4'-P-C4' energy: -27.067 flat angles P-C4'-P energy: -15.172 tors. eta vs tors. theta energy: -30.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -359.568468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.568468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.568468 (E_RNA) where: Base-Base interactions energy: -248.021 where: short stacking energy: -111.500 Base-Backbone interact. energy: -0.033 local terms energy: -111.514571 where: bonds (distance) C4'-P energy: -15.806 bonds (distance) P-C4' energy: -23.525 flat angles C4'-P-C4' energy: -22.633 flat angles P-C4'-P energy: -18.020 tors. eta vs tors. theta energy: -31.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -314.680041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.680041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.680041 (E_RNA) where: Base-Base interactions energy: -208.741 where: short stacking energy: -91.243 Base-Backbone interact. energy: -0.182 local terms energy: -105.756814 where: bonds (distance) C4'-P energy: -21.927 bonds (distance) P-C4' energy: -21.583 flat angles C4'-P-C4' energy: -17.050 flat angles P-C4'-P energy: -17.574 tors. eta vs tors. theta energy: -27.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -264.680037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.680037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.680037 (E_RNA) where: Base-Base interactions energy: -160.501 where: short stacking energy: -82.895 Base-Backbone interact. energy: -0.304 local terms energy: -103.875298 where: bonds (distance) C4'-P energy: -17.969 bonds (distance) P-C4' energy: -20.442 flat angles C4'-P-C4' energy: -22.657 flat angles P-C4'-P energy: -17.006 tors. eta vs tors. theta energy: -25.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -118.884861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.884861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.884861 (E_RNA) where: Base-Base interactions energy: -49.563 where: short stacking energy: -30.684 Base-Backbone interact. energy: -1.168 local terms energy: -68.154539 where: bonds (distance) C4'-P energy: -21.986 bonds (distance) P-C4' energy: -20.730 flat angles C4'-P-C4' energy: -12.876 flat angles P-C4'-P energy: -12.581 tors. eta vs tors. theta energy: 0.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -124.758624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.758624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.758624 (E_RNA) where: Base-Base interactions energy: -41.694 where: short stacking energy: -38.341 Base-Backbone interact. energy: -0.749 local terms energy: -82.315563 where: bonds (distance) C4'-P energy: -24.951 bonds (distance) P-C4' energy: -21.203 flat angles C4'-P-C4' energy: -19.090 flat angles P-C4'-P energy: -14.082 tors. eta vs tors. theta energy: -2.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -108.750714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.750714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.750714 (E_RNA) where: Base-Base interactions energy: -38.578 where: short stacking energy: -37.727 Base-Backbone interact. energy: -0.340 local terms energy: -69.832003 where: bonds (distance) C4'-P energy: -23.588 bonds (distance) P-C4' energy: -22.909 flat angles C4'-P-C4' energy: -16.921 flat angles P-C4'-P energy: -8.622 tors. eta vs tors. theta energy: 2.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -115.142412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.142412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.142412 (E_RNA) where: Base-Base interactions energy: -43.437 where: short stacking energy: -39.507 Base-Backbone interact. energy: -0.314 local terms energy: -71.390958 where: bonds (distance) C4'-P energy: -24.330 bonds (distance) P-C4' energy: -18.605 flat angles C4'-P-C4' energy: -18.879 flat angles P-C4'-P energy: -9.310 tors. eta vs tors. theta energy: -0.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -394.865187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.865187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.865187 (E_RNA) where: Base-Base interactions energy: -265.256 where: short stacking energy: -122.250 Base-Backbone interact. energy: -0.041 local terms energy: -129.567873 where: bonds (distance) C4'-P energy: -23.314 bonds (distance) P-C4' energy: -23.064 flat angles C4'-P-C4' energy: -27.383 flat angles P-C4'-P energy: -18.882 tors. eta vs tors. theta energy: -36.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -381.521100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.521100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.521100 (E_RNA) where: Base-Base interactions energy: -250.056 where: short stacking energy: -110.865 Base-Backbone interact. energy: -0.185 local terms energy: -131.280355 where: bonds (distance) C4'-P energy: -24.359 bonds (distance) P-C4' energy: -23.753 flat angles C4'-P-C4' energy: -25.988 flat angles P-C4'-P energy: -19.278 tors. eta vs tors. theta energy: -37.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -361.142298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.142298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.142298 (E_RNA) where: Base-Base interactions energy: -243.642 where: short stacking energy: -108.694 Base-Backbone interact. energy: -0.090 local terms energy: -117.410547 where: bonds (distance) C4'-P energy: -26.698 bonds (distance) P-C4' energy: -17.234 flat angles C4'-P-C4' energy: -26.011 flat angles P-C4'-P energy: -15.580 tors. eta vs tors. theta energy: -31.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -365.436378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.436378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.436378 (E_RNA) where: Base-Base interactions energy: -254.013 where: short stacking energy: -106.729 Base-Backbone interact. energy: -0.304 local terms energy: -111.118860 where: bonds (distance) C4'-P energy: -20.433 bonds (distance) P-C4' energy: -21.361 flat angles C4'-P-C4' energy: -25.804 flat angles P-C4'-P energy: -15.869 tors. eta vs tors. theta energy: -27.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -300.837474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.837474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.837474 (E_RNA) where: Base-Base interactions energy: -190.752 where: short stacking energy: -86.417 Base-Backbone interact. energy: -0.215 local terms energy: -109.869647 where: bonds (distance) C4'-P energy: -19.407 bonds (distance) P-C4' energy: -23.781 flat angles C4'-P-C4' energy: -22.046 flat angles P-C4'-P energy: -17.080 tors. eta vs tors. theta energy: -27.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -268.972352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.972352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.972352 (E_RNA) where: Base-Base interactions energy: -170.134 where: short stacking energy: -73.600 Base-Backbone interact. energy: 2.101 local terms energy: -100.938748 where: bonds (distance) C4'-P energy: -21.705 bonds (distance) P-C4' energy: -15.981 flat angles C4'-P-C4' energy: -25.986 flat angles P-C4'-P energy: -17.095 tors. eta vs tors. theta energy: -20.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -146.669756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.669756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.669756 (E_RNA) where: Base-Base interactions energy: -78.225 where: short stacking energy: -45.115 Base-Backbone interact. energy: -0.379 local terms energy: -68.066158 where: bonds (distance) C4'-P energy: -22.735 bonds (distance) P-C4' energy: -20.604 flat angles C4'-P-C4' energy: -19.411 flat angles P-C4'-P energy: -3.795 tors. eta vs tors. theta energy: -1.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -137.938026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.938026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.938026 (E_RNA) where: Base-Base interactions energy: -71.724 where: short stacking energy: -50.451 Base-Backbone interact. energy: -0.367 local terms energy: -65.847014 where: bonds (distance) C4'-P energy: -15.690 bonds (distance) P-C4' energy: -22.340 flat angles C4'-P-C4' energy: -16.548 flat angles P-C4'-P energy: -3.547 tors. eta vs tors. theta energy: -7.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -110.435816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.435816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.435816 (E_RNA) where: Base-Base interactions energy: -35.432 where: short stacking energy: -26.829 Base-Backbone interact. energy: -0.693 local terms energy: -74.311732 where: bonds (distance) C4'-P energy: -18.947 bonds (distance) P-C4' energy: -22.059 flat angles C4'-P-C4' energy: -18.602 flat angles P-C4'-P energy: -13.922 tors. eta vs tors. theta energy: -0.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -110.047434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.047434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.047434 (E_RNA) where: Base-Base interactions energy: -48.715 where: short stacking energy: -48.715 Base-Backbone interact. energy: 0.339 local terms energy: -61.670899 where: bonds (distance) C4'-P energy: -16.268 bonds (distance) P-C4' energy: -16.252 flat angles C4'-P-C4' energy: -12.510 flat angles P-C4'-P energy: -11.738 tors. eta vs tors. theta energy: -4.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -395.464944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.464944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.464944 (E_RNA) where: Base-Base interactions energy: -264.089 where: short stacking energy: -119.545 Base-Backbone interact. energy: -0.306 local terms energy: -131.069643 where: bonds (distance) C4'-P energy: -24.338 bonds (distance) P-C4' energy: -23.380 flat angles C4'-P-C4' energy: -25.637 flat angles P-C4'-P energy: -19.341 tors. eta vs tors. theta energy: -38.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -382.506476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.506476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.506476 (E_RNA) where: Base-Base interactions energy: -261.856 where: short stacking energy: -117.719 Base-Backbone interact. energy: -0.707 local terms energy: -119.943645 where: bonds (distance) C4'-P energy: -21.944 bonds (distance) P-C4' energy: -24.130 flat angles C4'-P-C4' energy: -22.110 flat angles P-C4'-P energy: -18.537 tors. eta vs tors. theta energy: -33.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -366.183738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.183738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.183738 (E_RNA) where: Base-Base interactions energy: -246.027 where: short stacking energy: -109.522 Base-Backbone interact. energy: -0.006 local terms energy: -120.150610 where: bonds (distance) C4'-P energy: -22.587 bonds (distance) P-C4' energy: -23.572 flat angles C4'-P-C4' energy: -25.098 flat angles P-C4'-P energy: -16.998 tors. eta vs tors. theta energy: -31.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -365.045920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.045920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.045920 (E_RNA) where: Base-Base interactions energy: -250.686 where: short stacking energy: -108.344 Base-Backbone interact. energy: -0.078 local terms energy: -114.282343 where: bonds (distance) C4'-P energy: -14.011 bonds (distance) P-C4' energy: -18.790 flat angles C4'-P-C4' energy: -25.998 flat angles P-C4'-P energy: -20.277 tors. eta vs tors. theta energy: -35.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -297.304484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.304484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.304484 (E_RNA) where: Base-Base interactions energy: -195.526 where: short stacking energy: -80.157 Base-Backbone interact. energy: -0.090 local terms energy: -101.688064 where: bonds (distance) C4'-P energy: -19.716 bonds (distance) P-C4' energy: -21.872 flat angles C4'-P-C4' energy: -20.290 flat angles P-C4'-P energy: -13.573 tors. eta vs tors. theta energy: -26.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -291.686136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.686136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.686136 (E_RNA) where: Base-Base interactions energy: -192.115 where: short stacking energy: -77.339 Base-Backbone interact. energy: -0.346 local terms energy: -99.224588 where: bonds (distance) C4'-P energy: -21.284 bonds (distance) P-C4' energy: -22.310 flat angles C4'-P-C4' energy: -22.434 flat angles P-C4'-P energy: -17.337 tors. eta vs tors. theta energy: -15.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -134.755417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.755417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.755417 (E_RNA) where: Base-Base interactions energy: -50.828 where: short stacking energy: -41.155 Base-Backbone interact. energy: -0.312 local terms energy: -83.615731 where: bonds (distance) C4'-P energy: -25.080 bonds (distance) P-C4' energy: -22.055 flat angles C4'-P-C4' energy: -16.757 flat angles P-C4'-P energy: -11.829 tors. eta vs tors. theta energy: -7.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -116.595278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.595278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.595278 (E_RNA) where: Base-Base interactions energy: -49.856 where: short stacking energy: -38.977 Base-Backbone interact. energy: 0.817 local terms energy: -67.556810 where: bonds (distance) C4'-P energy: -17.974 bonds (distance) P-C4' energy: -19.945 flat angles C4'-P-C4' energy: -22.013 flat angles P-C4'-P energy: -11.770 tors. eta vs tors. theta energy: 4.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -131.608623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.608623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.608623 (E_RNA) where: Base-Base interactions energy: -51.397 where: short stacking energy: -51.164 Base-Backbone interact. energy: -0.014 local terms energy: -80.197140 where: bonds (distance) C4'-P energy: -22.524 bonds (distance) P-C4' energy: -18.673 flat angles C4'-P-C4' energy: -20.037 flat angles P-C4'-P energy: -9.343 tors. eta vs tors. theta energy: -9.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -106.971923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.971923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.971923 (E_RNA) where: Base-Base interactions energy: -33.102 where: short stacking energy: -32.819 Base-Backbone interact. energy: -0.137 local terms energy: -73.732241 where: bonds (distance) C4'-P energy: -20.827 bonds (distance) P-C4' energy: -21.103 flat angles C4'-P-C4' energy: -17.790 flat angles P-C4'-P energy: -11.188 tors. eta vs tors. theta energy: -2.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -391.620802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.620802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.620802 (E_RNA) where: Base-Base interactions energy: -264.158 where: short stacking energy: -119.317 Base-Backbone interact. energy: -1.060 local terms energy: -126.403306 where: bonds (distance) C4'-P energy: -19.904 bonds (distance) P-C4' energy: -24.986 flat angles C4'-P-C4' energy: -28.533 flat angles P-C4'-P energy: -16.698 tors. eta vs tors. theta energy: -36.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -387.729254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.729254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.729254 (E_RNA) where: Base-Base interactions energy: -259.032 where: short stacking energy: -118.291 Base-Backbone interact. energy: -0.016 local terms energy: -128.681542 where: bonds (distance) C4'-P energy: -20.616 bonds (distance) P-C4' energy: -24.299 flat angles C4'-P-C4' energy: -26.961 flat angles P-C4'-P energy: -17.253 tors. eta vs tors. theta energy: -39.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -368.949659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.949659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.949659 (E_RNA) where: Base-Base interactions energy: -252.445 where: short stacking energy: -112.779 Base-Backbone interact. energy: -0.010 local terms energy: -116.494629 where: bonds (distance) C4'-P energy: -18.878 bonds (distance) P-C4' energy: -21.932 flat angles C4'-P-C4' energy: -24.857 flat angles P-C4'-P energy: -18.026 tors. eta vs tors. theta energy: -32.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -380.696170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.696170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.696170 (E_RNA) where: Base-Base interactions energy: -263.624 where: short stacking energy: -119.548 Base-Backbone interact. energy: -1.165 local terms energy: -115.907337 where: bonds (distance) C4'-P energy: -18.390 bonds (distance) P-C4' energy: -18.107 flat angles C4'-P-C4' energy: -22.856 flat angles P-C4'-P energy: -21.447 tors. eta vs tors. theta energy: -35.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -324.296331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.296331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.296331 (E_RNA) where: Base-Base interactions energy: -215.249 where: short stacking energy: -89.932 Base-Backbone interact. energy: -0.054 local terms energy: -108.992732 where: bonds (distance) C4'-P energy: -21.583 bonds (distance) P-C4' energy: -19.598 flat angles C4'-P-C4' energy: -18.850 flat angles P-C4'-P energy: -17.452 tors. eta vs tors. theta energy: -31.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -309.216619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.216619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.216619 (E_RNA) where: Base-Base interactions energy: -207.245 where: short stacking energy: -85.764 Base-Backbone interact. energy: -0.652 local terms energy: -101.319989 where: bonds (distance) C4'-P energy: -19.328 bonds (distance) P-C4' energy: -16.624 flat angles C4'-P-C4' energy: -25.769 flat angles P-C4'-P energy: -12.717 tors. eta vs tors. theta energy: -26.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -123.465311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.465311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.465311 (E_RNA) where: Base-Base interactions energy: -55.968 where: short stacking energy: -31.711 Base-Backbone interact. energy: -0.937 local terms energy: -66.560087 where: bonds (distance) C4'-P energy: -12.306 bonds (distance) P-C4' energy: -21.302 flat angles C4'-P-C4' energy: -23.365 flat angles P-C4'-P energy: -15.178 tors. eta vs tors. theta energy: 5.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -127.943200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.943200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.943200 (E_RNA) where: Base-Base interactions energy: -44.781 where: short stacking energy: -43.388 Base-Backbone interact. energy: -0.056 local terms energy: -83.106416 where: bonds (distance) C4'-P energy: -21.332 bonds (distance) P-C4' energy: -25.247 flat angles C4'-P-C4' energy: -16.417 flat angles P-C4'-P energy: -11.311 tors. eta vs tors. theta energy: -8.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -112.577584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.577584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.577584 (E_RNA) where: Base-Base interactions energy: -47.861 where: short stacking energy: -34.469 Base-Backbone interact. energy: 0.011 local terms energy: -64.728404 where: bonds (distance) C4'-P energy: -15.350 bonds (distance) P-C4' energy: -23.780 flat angles C4'-P-C4' energy: -17.870 flat angles P-C4'-P energy: -6.715 tors. eta vs tors. theta energy: -1.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -140.522011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.522011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.522011 (E_RNA) where: Base-Base interactions energy: -55.666 where: short stacking energy: -39.025 Base-Backbone interact. energy: -1.264 local terms energy: -83.591492 where: bonds (distance) C4'-P energy: -22.815 bonds (distance) P-C4' energy: -19.677 flat angles C4'-P-C4' energy: -23.473 flat angles P-C4'-P energy: -15.738 tors. eta vs tors. theta energy: -1.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -391.078647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.078647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.078647 (E_RNA) where: Base-Base interactions energy: -266.299 where: short stacking energy: -118.706 Base-Backbone interact. energy: -0.039 local terms energy: -124.740828 where: bonds (distance) C4'-P energy: -20.480 bonds (distance) P-C4' energy: -24.825 flat angles C4'-P-C4' energy: -27.220 flat angles P-C4'-P energy: -17.137 tors. eta vs tors. theta energy: -35.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -376.565924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.565924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.565924 (E_RNA) where: Base-Base interactions energy: -256.987 where: short stacking energy: -111.919 Base-Backbone interact. energy: 1.638 local terms energy: -121.216841 where: bonds (distance) C4'-P energy: -21.323 bonds (distance) P-C4' energy: -20.226 flat angles C4'-P-C4' energy: -25.981 flat angles P-C4'-P energy: -20.708 tors. eta vs tors. theta energy: -32.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -377.920513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.920513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.920513 (E_RNA) where: Base-Base interactions energy: -254.691 where: short stacking energy: -113.598 Base-Backbone interact. energy: -0.022 local terms energy: -123.207160 where: bonds (distance) C4'-P energy: -22.654 bonds (distance) P-C4' energy: -21.534 flat angles C4'-P-C4' energy: -25.195 flat angles P-C4'-P energy: -18.283 tors. eta vs tors. theta energy: -35.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -355.833766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.833766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.833766 (E_RNA) where: Base-Base interactions energy: -239.242 where: short stacking energy: -101.749 Base-Backbone interact. energy: -0.007 local terms energy: -116.583859 where: bonds (distance) C4'-P energy: -23.037 bonds (distance) P-C4' energy: -23.545 flat angles C4'-P-C4' energy: -23.872 flat angles P-C4'-P energy: -12.780 tors. eta vs tors. theta energy: -33.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -356.994480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.994480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.994480 (E_RNA) where: Base-Base interactions energy: -243.514 where: short stacking energy: -110.296 Base-Backbone interact. energy: -0.243 local terms energy: -113.238380 where: bonds (distance) C4'-P energy: -22.262 bonds (distance) P-C4' energy: -14.930 flat angles C4'-P-C4' energy: -22.046 flat angles P-C4'-P energy: -18.300 tors. eta vs tors. theta energy: -35.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -306.448605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.448605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.448605 (E_RNA) where: Base-Base interactions energy: -214.151 where: short stacking energy: -81.103 Base-Backbone interact. energy: -0.633 local terms energy: -91.664716 where: bonds (distance) C4'-P energy: -14.343 bonds (distance) P-C4' energy: -16.339 flat angles C4'-P-C4' energy: -21.382 flat angles P-C4'-P energy: -16.641 tors. eta vs tors. theta energy: -22.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -130.793091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.793091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.793091 (E_RNA) where: Base-Base interactions energy: -55.030 where: short stacking energy: -34.245 Base-Backbone interact. energy: -0.214 local terms energy: -75.548823 where: bonds (distance) C4'-P energy: -24.155 bonds (distance) P-C4' energy: -19.552 flat angles C4'-P-C4' energy: -21.045 flat angles P-C4'-P energy: -7.962 tors. eta vs tors. theta energy: -2.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -144.754505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.754505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.754505 (E_RNA) where: Base-Base interactions energy: -61.980 where: short stacking energy: -49.527 Base-Backbone interact. energy: -0.507 local terms energy: -82.267378 where: bonds (distance) C4'-P energy: -21.945 bonds (distance) P-C4' energy: -20.797 flat angles C4'-P-C4' energy: -19.428 flat angles P-C4'-P energy: -12.753 tors. eta vs tors. theta energy: -7.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -114.915472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.915472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.915472 (E_RNA) where: Base-Base interactions energy: -41.775 where: short stacking energy: -33.839 Base-Backbone interact. energy: -0.222 local terms energy: -72.919302 where: bonds (distance) C4'-P energy: -14.808 bonds (distance) P-C4' energy: -17.914 flat angles C4'-P-C4' energy: -21.624 flat angles P-C4'-P energy: -16.319 tors. eta vs tors. theta energy: -2.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -111.717279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.717279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.717279 (E_RNA) where: Base-Base interactions energy: -35.137 where: short stacking energy: -33.389 Base-Backbone interact. energy: -0.291 local terms energy: -76.288942 where: bonds (distance) C4'-P energy: -16.816 bonds (distance) P-C4' energy: -18.169 flat angles C4'-P-C4' energy: -23.377 flat angles P-C4'-P energy: -14.734 tors. eta vs tors. theta energy: -3.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -389.803283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.803283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.803283 (E_RNA) where: Base-Base interactions energy: -265.133 where: short stacking energy: -122.035 Base-Backbone interact. energy: -0.337 local terms energy: -124.333653 where: bonds (distance) C4'-P energy: -22.102 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -27.489 flat angles P-C4'-P energy: -16.917 tors. eta vs tors. theta energy: -35.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -387.891442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.891442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.891442 (E_RNA) where: Base-Base interactions energy: -262.593 where: short stacking energy: -117.332 Base-Backbone interact. energy: -2.310 local terms energy: -122.988372 where: bonds (distance) C4'-P energy: -23.264 bonds (distance) P-C4' energy: -23.698 flat angles C4'-P-C4' energy: -23.194 flat angles P-C4'-P energy: -12.605 tors. eta vs tors. theta energy: -40.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -379.997724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.997724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.997724 (E_RNA) where: Base-Base interactions energy: -256.662 where: short stacking energy: -117.756 Base-Backbone interact. energy: -0.029 local terms energy: -123.305933 where: bonds (distance) C4'-P energy: -21.009 bonds (distance) P-C4' energy: -24.976 flat angles C4'-P-C4' energy: -24.479 flat angles P-C4'-P energy: -16.740 tors. eta vs tors. theta energy: -36.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -335.921323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.921323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.921323 (E_RNA) where: Base-Base interactions energy: -233.064 where: short stacking energy: -93.727 Base-Backbone interact. energy: 0.080 local terms energy: -102.936511 where: bonds (distance) C4'-P energy: -15.933 bonds (distance) P-C4' energy: -21.634 flat angles C4'-P-C4' energy: -19.757 flat angles P-C4'-P energy: -17.965 tors. eta vs tors. theta energy: -27.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -358.127085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.127085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.127085 (E_RNA) where: Base-Base interactions energy: -234.949 where: short stacking energy: -108.778 Base-Backbone interact. energy: -0.251 local terms energy: -122.927316 where: bonds (distance) C4'-P energy: -21.717 bonds (distance) P-C4' energy: -24.596 flat angles C4'-P-C4' energy: -24.484 flat angles P-C4'-P energy: -15.880 tors. eta vs tors. theta energy: -36.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -307.476575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.476575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.476575 (E_RNA) where: Base-Base interactions energy: -206.888 where: short stacking energy: -84.873 Base-Backbone interact. energy: -0.088 local terms energy: -100.499833 where: bonds (distance) C4'-P energy: -20.926 bonds (distance) P-C4' energy: -20.304 flat angles C4'-P-C4' energy: -24.324 flat angles P-C4'-P energy: -14.522 tors. eta vs tors. theta energy: -20.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -143.482222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.482222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.482222 (E_RNA) where: Base-Base interactions energy: -58.866 where: short stacking energy: -50.308 Base-Backbone interact. energy: -0.066 local terms energy: -84.549679 where: bonds (distance) C4'-P energy: -15.862 bonds (distance) P-C4' energy: -23.213 flat angles C4'-P-C4' energy: -18.259 flat angles P-C4'-P energy: -16.167 tors. eta vs tors. theta energy: -11.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -120.149098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.149098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.149098 (E_RNA) where: Base-Base interactions energy: -46.232 where: short stacking energy: -31.493 Base-Backbone interact. energy: -0.164 local terms energy: -73.753454 where: bonds (distance) C4'-P energy: -23.456 bonds (distance) P-C4' energy: -21.999 flat angles C4'-P-C4' energy: -21.598 flat angles P-C4'-P energy: -12.565 tors. eta vs tors. theta energy: 5.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -121.147674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.147674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.147674 (E_RNA) where: Base-Base interactions energy: -56.342 where: short stacking energy: -30.605 Base-Backbone interact. energy: -0.061 local terms energy: -64.744346 where: bonds (distance) C4'-P energy: -13.042 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -10.863 flat angles P-C4'-P energy: -13.956 tors. eta vs tors. theta energy: -2.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -102.921617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.921617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.921617 (E_RNA) where: Base-Base interactions energy: -25.630 where: short stacking energy: -24.284 Base-Backbone interact. energy: -0.444 local terms energy: -76.847362 where: bonds (distance) C4'-P energy: -18.803 bonds (distance) P-C4' energy: -24.119 flat angles C4'-P-C4' energy: -19.423 flat angles P-C4'-P energy: -14.288 tors. eta vs tors. theta energy: -0.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -393.266458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.266458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.266458 (E_RNA) where: Base-Base interactions energy: -264.407 where: short stacking energy: -114.996 Base-Backbone interact. energy: -0.056 local terms energy: -128.802501 where: bonds (distance) C4'-P energy: -22.214 bonds (distance) P-C4' energy: -21.660 flat angles C4'-P-C4' energy: -28.627 flat angles P-C4'-P energy: -21.551 tors. eta vs tors. theta energy: -34.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -389.431282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.431282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.431282 (E_RNA) where: Base-Base interactions energy: -259.302 where: short stacking energy: -117.828 Base-Backbone interact. energy: 1.276 local terms energy: -131.405179 where: bonds (distance) C4'-P energy: -21.542 bonds (distance) P-C4' energy: -25.446 flat angles C4'-P-C4' energy: -27.883 flat angles P-C4'-P energy: -19.543 tors. eta vs tors. theta energy: -36.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -370.100185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.100185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.100185 (E_RNA) where: Base-Base interactions energy: -252.287 where: short stacking energy: -113.858 Base-Backbone interact. energy: -0.016 local terms energy: -117.796757 where: bonds (distance) C4'-P energy: -19.663 bonds (distance) P-C4' energy: -21.675 flat angles C4'-P-C4' energy: -26.253 flat angles P-C4'-P energy: -17.683 tors. eta vs tors. theta energy: -32.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -362.683118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.683118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.683118 (E_RNA) where: Base-Base interactions energy: -248.184 where: short stacking energy: -116.194 Base-Backbone interact. energy: -0.158 local terms energy: -114.341483 where: bonds (distance) C4'-P energy: -18.568 bonds (distance) P-C4' energy: -20.333 flat angles C4'-P-C4' energy: -23.677 flat angles P-C4'-P energy: -14.950 tors. eta vs tors. theta energy: -36.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -333.691343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.691343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.691343 (E_RNA) where: Base-Base interactions energy: -223.116 where: short stacking energy: -97.447 Base-Backbone interact. energy: -0.514 local terms energy: -110.061347 where: bonds (distance) C4'-P energy: -18.372 bonds (distance) P-C4' energy: -26.065 flat angles C4'-P-C4' energy: -22.501 flat angles P-C4'-P energy: -16.325 tors. eta vs tors. theta energy: -26.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -311.020885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.020885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.020885 (E_RNA) where: Base-Base interactions energy: -210.787 where: short stacking energy: -96.035 Base-Backbone interact. energy: -0.104 local terms energy: -100.130374 where: bonds (distance) C4'-P energy: -14.428 bonds (distance) P-C4' energy: -20.569 flat angles C4'-P-C4' energy: -24.537 flat angles P-C4'-P energy: -11.632 tors. eta vs tors. theta energy: -28.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -126.618116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.618116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.618116 (E_RNA) where: Base-Base interactions energy: -55.578 where: short stacking energy: -48.287 Base-Backbone interact. energy: -0.305 local terms energy: -70.735365 where: bonds (distance) C4'-P energy: -16.092 bonds (distance) P-C4' energy: -16.979 flat angles C4'-P-C4' energy: -15.828 flat angles P-C4'-P energy: -12.027 tors. eta vs tors. theta energy: -9.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -129.561463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.561463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.561463 (E_RNA) where: Base-Base interactions energy: -55.102 where: short stacking energy: -41.571 Base-Backbone interact. energy: -0.322 local terms energy: -74.137443 where: bonds (distance) C4'-P energy: -12.911 bonds (distance) P-C4' energy: -22.302 flat angles C4'-P-C4' energy: -20.972 flat angles P-C4'-P energy: -13.031 tors. eta vs tors. theta energy: -4.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -106.820971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.820971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.820971 (E_RNA) where: Base-Base interactions energy: -48.230 where: short stacking energy: -29.567 Base-Backbone interact. energy: -0.401 local terms energy: -58.189668 where: bonds (distance) C4'-P energy: -18.074 bonds (distance) P-C4' energy: -19.033 flat angles C4'-P-C4' energy: -10.859 flat angles P-C4'-P energy: -13.984 tors. eta vs tors. theta energy: 3.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -104.707239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.707239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.707239 (E_RNA) where: Base-Base interactions energy: -36.958 where: short stacking energy: -36.958 Base-Backbone interact. energy: -0.342 local terms energy: -67.407809 where: bonds (distance) C4'-P energy: -16.626 bonds (distance) P-C4' energy: -23.991 flat angles C4'-P-C4' energy: -18.873 flat angles P-C4'-P energy: -10.966 tors. eta vs tors. theta energy: 3.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -388.767166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.767166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.767166 (E_RNA) where: Base-Base interactions energy: -262.675 where: short stacking energy: -115.885 Base-Backbone interact. energy: -0.619 local terms energy: -125.472617 where: bonds (distance) C4'-P energy: -19.863 bonds (distance) P-C4' energy: -24.510 flat angles C4'-P-C4' energy: -27.300 flat angles P-C4'-P energy: -18.984 tors. eta vs tors. theta energy: -34.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -388.117858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.117858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.117858 (E_RNA) where: Base-Base interactions energy: -263.267 where: short stacking energy: -115.990 Base-Backbone interact. energy: -0.055 local terms energy: -124.795365 where: bonds (distance) C4'-P energy: -23.700 bonds (distance) P-C4' energy: -20.351 flat angles C4'-P-C4' energy: -23.039 flat angles P-C4'-P energy: -17.751 tors. eta vs tors. theta energy: -39.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -386.066956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.066956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.066956 (E_RNA) where: Base-Base interactions energy: -265.522 where: short stacking energy: -118.610 Base-Backbone interact. energy: -0.092 local terms energy: -120.452138 where: bonds (distance) C4'-P energy: -25.402 bonds (distance) P-C4' energy: -16.502 flat angles C4'-P-C4' energy: -23.976 flat angles P-C4'-P energy: -16.087 tors. eta vs tors. theta energy: -38.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -375.504486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.504486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.504486 (E_RNA) where: Base-Base interactions energy: -256.621 where: short stacking energy: -112.663 Base-Backbone interact. energy: 0.074 local terms energy: -118.957979 where: bonds (distance) C4'-P energy: -23.604 bonds (distance) P-C4' energy: -17.638 flat angles C4'-P-C4' energy: -26.144 flat angles P-C4'-P energy: -16.841 tors. eta vs tors. theta energy: -34.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -312.152621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.152621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.152621 (E_RNA) where: Base-Base interactions energy: -206.963 where: short stacking energy: -95.622 Base-Backbone interact. energy: -0.165 local terms energy: -105.024567 where: bonds (distance) C4'-P energy: -24.259 bonds (distance) P-C4' energy: -16.399 flat angles C4'-P-C4' energy: -24.066 flat angles P-C4'-P energy: -12.307 tors. eta vs tors. theta energy: -27.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -312.329107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.329107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.329107 (E_RNA) where: Base-Base interactions energy: -207.772 where: short stacking energy: -84.906 Base-Backbone interact. energy: -1.501 local terms energy: -103.055247 where: bonds (distance) C4'-P energy: -18.153 bonds (distance) P-C4' energy: -22.305 flat angles C4'-P-C4' energy: -19.961 flat angles P-C4'-P energy: -14.405 tors. eta vs tors. theta energy: -28.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -144.940093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.940093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.940093 (E_RNA) where: Base-Base interactions energy: -75.013 where: short stacking energy: -40.659 Base-Backbone interact. energy: 0.392 local terms energy: -70.318603 where: bonds (distance) C4'-P energy: -22.754 bonds (distance) P-C4' energy: -21.651 flat angles C4'-P-C4' energy: -19.074 flat angles P-C4'-P energy: -3.396 tors. eta vs tors. theta energy: -3.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -118.147777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.147777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.147777 (E_RNA) where: Base-Base interactions energy: -41.001 where: short stacking energy: -38.466 Base-Backbone interact. energy: -0.254 local terms energy: -76.892563 where: bonds (distance) C4'-P energy: -19.384 bonds (distance) P-C4' energy: -22.810 flat angles C4'-P-C4' energy: -21.596 flat angles P-C4'-P energy: -13.966 tors. eta vs tors. theta energy: 0.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -104.780777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.780777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.780777 (E_RNA) where: Base-Base interactions energy: -34.399 where: short stacking energy: -32.981 Base-Backbone interact. energy: 0.460 local terms energy: -70.841215 where: bonds (distance) C4'-P energy: -22.577 bonds (distance) P-C4' energy: -22.694 flat angles C4'-P-C4' energy: -16.340 flat angles P-C4'-P energy: -12.770 tors. eta vs tors. theta energy: 3.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -94.709534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.709534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.709534 (E_RNA) where: Base-Base interactions energy: -34.414 where: short stacking energy: -31.129 Base-Backbone interact. energy: -0.289 local terms energy: -60.007508 where: bonds (distance) C4'-P energy: -20.967 bonds (distance) P-C4' energy: -19.461 flat angles C4'-P-C4' energy: -13.960 flat angles P-C4'-P energy: -8.923 tors. eta vs tors. theta energy: 3.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -392.643603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.643603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.643603 (E_RNA) where: Base-Base interactions energy: -271.989 where: short stacking energy: -119.796 Base-Backbone interact. energy: -0.057 local terms energy: -120.596817 where: bonds (distance) C4'-P energy: -23.014 bonds (distance) P-C4' energy: -18.772 flat angles C4'-P-C4' energy: -26.614 flat angles P-C4'-P energy: -17.508 tors. eta vs tors. theta energy: -34.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -375.677050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.677050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.677050 (E_RNA) where: Base-Base interactions energy: -255.467 where: short stacking energy: -120.846 Base-Backbone interact. energy: -0.601 local terms energy: -119.608542 where: bonds (distance) C4'-P energy: -21.143 bonds (distance) P-C4' energy: -17.956 flat angles C4'-P-C4' energy: -27.101 flat angles P-C4'-P energy: -17.771 tors. eta vs tors. theta energy: -35.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -376.779823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.779823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.779823 (E_RNA) where: Base-Base interactions energy: -257.832 where: short stacking energy: -118.130 Base-Backbone interact. energy: -0.022 local terms energy: -118.925677 where: bonds (distance) C4'-P energy: -14.834 bonds (distance) P-C4' energy: -21.701 flat angles C4'-P-C4' energy: -28.145 flat angles P-C4'-P energy: -18.047 tors. eta vs tors. theta energy: -36.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -362.147653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.147653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.147653 (E_RNA) where: Base-Base interactions energy: -247.516 where: short stacking energy: -105.729 Base-Backbone interact. energy: -0.001 local terms energy: -114.631073 where: bonds (distance) C4'-P energy: -21.236 bonds (distance) P-C4' energy: -20.367 flat angles C4'-P-C4' energy: -26.227 flat angles P-C4'-P energy: -13.080 tors. eta vs tors. theta energy: -33.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -326.171742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.171742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.171742 (E_RNA) where: Base-Base interactions energy: -219.465 where: short stacking energy: -90.120 Base-Backbone interact. energy: -0.212 local terms energy: -106.494451 where: bonds (distance) C4'-P energy: -20.567 bonds (distance) P-C4' energy: -19.673 flat angles C4'-P-C4' energy: -22.012 flat angles P-C4'-P energy: -17.454 tors. eta vs tors. theta energy: -26.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -290.351365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.351365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.351365 (E_RNA) where: Base-Base interactions energy: -190.072 where: short stacking energy: -73.573 Base-Backbone interact. energy: -0.231 local terms energy: -100.048183 where: bonds (distance) C4'-P energy: -24.221 bonds (distance) P-C4' energy: -15.357 flat angles C4'-P-C4' energy: -22.312 flat angles P-C4'-P energy: -16.380 tors. eta vs tors. theta energy: -21.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -122.054860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.054860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.054860 (E_RNA) where: Base-Base interactions energy: -48.856 where: short stacking energy: -45.824 Base-Backbone interact. energy: -0.353 local terms energy: -72.845767 where: bonds (distance) C4'-P energy: -21.140 bonds (distance) P-C4' energy: -16.348 flat angles C4'-P-C4' energy: -16.450 flat angles P-C4'-P energy: -11.728 tors. eta vs tors. theta energy: -7.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -127.265238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.265238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.265238 (E_RNA) where: Base-Base interactions energy: -50.695 where: short stacking energy: -33.029 Base-Backbone interact. energy: -1.296 local terms energy: -75.274840 where: bonds (distance) C4'-P energy: -22.839 bonds (distance) P-C4' energy: -17.158 flat angles C4'-P-C4' energy: -17.253 flat angles P-C4'-P energy: -12.151 tors. eta vs tors. theta energy: -5.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -121.024907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.024907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.024907 (E_RNA) where: Base-Base interactions energy: -44.579 where: short stacking energy: -43.019 Base-Backbone interact. energy: 1.215 local terms energy: -77.661058 where: bonds (distance) C4'-P energy: -19.569 bonds (distance) P-C4' energy: -20.738 flat angles C4'-P-C4' energy: -15.642 flat angles P-C4'-P energy: -15.972 tors. eta vs tors. theta energy: -5.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -128.775231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.775231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.775231 (E_RNA) where: Base-Base interactions energy: -59.444 where: short stacking energy: -46.915 Base-Backbone interact. energy: -1.310 local terms energy: -68.021419 where: bonds (distance) C4'-P energy: -20.509 bonds (distance) P-C4' energy: -11.161 flat angles C4'-P-C4' energy: -21.489 flat angles P-C4'-P energy: -11.758 tors. eta vs tors. theta energy: -3.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -391.521877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.521877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.521877 (E_RNA) where: Base-Base interactions energy: -271.186 where: short stacking energy: -114.300 Base-Backbone interact. energy: -0.047 local terms energy: -120.288188 where: bonds (distance) C4'-P energy: -23.401 bonds (distance) P-C4' energy: -25.167 flat angles C4'-P-C4' energy: -23.452 flat angles P-C4'-P energy: -10.642 tors. eta vs tors. theta energy: -37.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -382.148414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.148414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.148414 (E_RNA) where: Base-Base interactions energy: -266.551 where: short stacking energy: -120.540 Base-Backbone interact. energy: -0.651 local terms energy: -114.947233 where: bonds (distance) C4'-P energy: -22.663 bonds (distance) P-C4' energy: -13.514 flat angles C4'-P-C4' energy: -24.068 flat angles P-C4'-P energy: -19.685 tors. eta vs tors. theta energy: -35.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -374.199263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.199263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.199263 (E_RNA) where: Base-Base interactions energy: -252.711 where: short stacking energy: -114.248 Base-Backbone interact. energy: -0.003 local terms energy: -121.485031 where: bonds (distance) C4'-P energy: -21.572 bonds (distance) P-C4' energy: -23.379 flat angles C4'-P-C4' energy: -24.436 flat angles P-C4'-P energy: -18.343 tors. eta vs tors. theta energy: -33.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -370.341377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.341377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.341377 (E_RNA) where: Base-Base interactions energy: -253.880 where: short stacking energy: -119.509 Base-Backbone interact. energy: -0.002 local terms energy: -116.459037 where: bonds (distance) C4'-P energy: -24.169 bonds (distance) P-C4' energy: -14.997 flat angles C4'-P-C4' energy: -26.625 flat angles P-C4'-P energy: -15.486 tors. eta vs tors. theta energy: -35.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -320.284047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.284047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.284047 (E_RNA) where: Base-Base interactions energy: -212.731 where: short stacking energy: -95.939 Base-Backbone interact. energy: -0.248 local terms energy: -107.304840 where: bonds (distance) C4'-P energy: -21.622 bonds (distance) P-C4' energy: -16.221 flat angles C4'-P-C4' energy: -24.392 flat angles P-C4'-P energy: -18.212 tors. eta vs tors. theta energy: -26.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -321.898513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.898513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.898513 (E_RNA) where: Base-Base interactions energy: -215.918 where: short stacking energy: -91.725 Base-Backbone interact. energy: -0.622 local terms energy: -105.358824 where: bonds (distance) C4'-P energy: -22.515 bonds (distance) P-C4' energy: -18.702 flat angles C4'-P-C4' energy: -22.301 flat angles P-C4'-P energy: -11.712 tors. eta vs tors. theta energy: -30.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -118.681935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.681935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.681935 (E_RNA) where: Base-Base interactions energy: -40.272 where: short stacking energy: -35.790 Base-Backbone interact. energy: -0.475 local terms energy: -77.934201 where: bonds (distance) C4'-P energy: -15.397 bonds (distance) P-C4' energy: -21.490 flat angles C4'-P-C4' energy: -23.337 flat angles P-C4'-P energy: -13.092 tors. eta vs tors. theta energy: -4.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -125.388912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.388912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.388912 (E_RNA) where: Base-Base interactions energy: -52.015 where: short stacking energy: -47.350 Base-Backbone interact. energy: -0.006 local terms energy: -73.368199 where: bonds (distance) C4'-P energy: -23.136 bonds (distance) P-C4' energy: -17.189 flat angles C4'-P-C4' energy: -15.734 flat angles P-C4'-P energy: -9.090 tors. eta vs tors. theta energy: -8.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -118.123012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.123012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.123012 (E_RNA) where: Base-Base interactions energy: -44.437 where: short stacking energy: -35.660 Base-Backbone interact. energy: -0.663 local terms energy: -73.022654 where: bonds (distance) C4'-P energy: -20.104 bonds (distance) P-C4' energy: -23.198 flat angles C4'-P-C4' energy: -22.477 flat angles P-C4'-P energy: -8.260 tors. eta vs tors. theta energy: 1.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -101.530023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.530023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.530023 (E_RNA) where: Base-Base interactions energy: -39.245 where: short stacking energy: -38.088 Base-Backbone interact. energy: -0.226 local terms energy: -62.058980 where: bonds (distance) C4'-P energy: -13.590 bonds (distance) P-C4' energy: -22.503 flat angles C4'-P-C4' energy: -18.449 flat angles P-C4'-P energy: -8.626 tors. eta vs tors. theta energy: 1.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -394.595435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.595435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.595435 (E_RNA) where: Base-Base interactions energy: -267.695 where: short stacking energy: -122.083 Base-Backbone interact. energy: -0.032 local terms energy: -126.868364 where: bonds (distance) C4'-P energy: -24.943 bonds (distance) P-C4' energy: -20.234 flat angles C4'-P-C4' energy: -24.896 flat angles P-C4'-P energy: -17.548 tors. eta vs tors. theta energy: -39.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -384.800199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.800199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.800199 (E_RNA) where: Base-Base interactions energy: -257.358 where: short stacking energy: -117.656 Base-Backbone interact. energy: -0.295 local terms energy: -127.147451 where: bonds (distance) C4'-P energy: -22.870 bonds (distance) P-C4' energy: -25.544 flat angles C4'-P-C4' energy: -24.682 flat angles P-C4'-P energy: -18.524 tors. eta vs tors. theta energy: -35.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -382.028515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.028515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.028515 (E_RNA) where: Base-Base interactions energy: -259.917 where: short stacking energy: -110.134 Base-Backbone interact. energy: -0.876 local terms energy: -121.235583 where: bonds (distance) C4'-P energy: -19.907 bonds (distance) P-C4' energy: -25.622 flat angles C4'-P-C4' energy: -20.823 flat angles P-C4'-P energy: -18.908 tors. eta vs tors. theta energy: -35.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -326.683377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.683377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.683377 (E_RNA) where: Base-Base interactions energy: -212.135 where: short stacking energy: -99.386 Base-Backbone interact. energy: -0.446 local terms energy: -114.102179 where: bonds (distance) C4'-P energy: -23.270 bonds (distance) P-C4' energy: -20.762 flat angles C4'-P-C4' energy: -24.757 flat angles P-C4'-P energy: -17.965 tors. eta vs tors. theta energy: -27.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -366.078894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.078894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.078894 (E_RNA) where: Base-Base interactions energy: -243.887 where: short stacking energy: -101.836 Base-Backbone interact. energy: -0.002 local terms energy: -122.189749 where: bonds (distance) C4'-P energy: -21.174 bonds (distance) P-C4' energy: -23.574 flat angles C4'-P-C4' energy: -23.604 flat angles P-C4'-P energy: -18.460 tors. eta vs tors. theta energy: -35.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -301.601816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.601816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.601816 (E_RNA) where: Base-Base interactions energy: -200.296 where: short stacking energy: -81.442 Base-Backbone interact. energy: -1.180 local terms energy: -100.125205 where: bonds (distance) C4'-P energy: -22.624 bonds (distance) P-C4' energy: -22.759 flat angles C4'-P-C4' energy: -19.309 flat angles P-C4'-P energy: -11.574 tors. eta vs tors. theta energy: -23.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -131.037788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.037788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.037788 (E_RNA) where: Base-Base interactions energy: -55.284 where: short stacking energy: -52.494 Base-Backbone interact. energy: 0.581 local terms energy: -76.334029 where: bonds (distance) C4'-P energy: -18.982 bonds (distance) P-C4' energy: -15.758 flat angles C4'-P-C4' energy: -24.172 flat angles P-C4'-P energy: -12.101 tors. eta vs tors. theta energy: -5.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -113.773185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.773185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.773185 (E_RNA) where: Base-Base interactions energy: -33.234 where: short stacking energy: -33.234 Base-Backbone interact. energy: -0.185 local terms energy: -80.354343 where: bonds (distance) C4'-P energy: -13.453 bonds (distance) P-C4' energy: -22.238 flat angles C4'-P-C4' energy: -20.524 flat angles P-C4'-P energy: -16.271 tors. eta vs tors. theta energy: -7.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -111.998041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.998041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.998041 (E_RNA) where: Base-Base interactions energy: -44.279 where: short stacking energy: -22.406 Base-Backbone interact. energy: -0.380 local terms energy: -67.339732 where: bonds (distance) C4'-P energy: -14.658 bonds (distance) P-C4' energy: -17.288 flat angles C4'-P-C4' energy: -20.974 flat angles P-C4'-P energy: -11.048 tors. eta vs tors. theta energy: -3.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -100.066109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.066109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.066109 (E_RNA) where: Base-Base interactions energy: -34.339 where: short stacking energy: -29.325 Base-Backbone interact. energy: -0.457 local terms energy: -65.270435 where: bonds (distance) C4'-P energy: -20.350 bonds (distance) P-C4' energy: -23.650 flat angles C4'-P-C4' energy: -18.070 flat angles P-C4'-P energy: -5.268 tors. eta vs tors. theta energy: 2.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -390.063298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.063298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.063298 (E_RNA) where: Base-Base interactions energy: -264.892 where: short stacking energy: -121.968 Base-Backbone interact. energy: -0.748 local terms energy: -124.422673 where: bonds (distance) C4'-P energy: -22.211 bonds (distance) P-C4' energy: -22.365 flat angles C4'-P-C4' energy: -25.957 flat angles P-C4'-P energy: -19.248 tors. eta vs tors. theta energy: -34.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -383.539110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.539110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.539110 (E_RNA) where: Base-Base interactions energy: -263.206 where: short stacking energy: -116.204 Base-Backbone interact. energy: -0.010 local terms energy: -120.323573 where: bonds (distance) C4'-P energy: -19.612 bonds (distance) P-C4' energy: -21.756 flat angles C4'-P-C4' energy: -25.915 flat angles P-C4'-P energy: -16.559 tors. eta vs tors. theta energy: -36.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -385.190458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.190458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.190458 (E_RNA) where: Base-Base interactions energy: -269.597 where: short stacking energy: -120.223 Base-Backbone interact. energy: -1.627 local terms energy: -113.966587 where: bonds (distance) C4'-P energy: -18.438 bonds (distance) P-C4' energy: -19.068 flat angles C4'-P-C4' energy: -21.458 flat angles P-C4'-P energy: -18.447 tors. eta vs tors. theta energy: -36.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -327.991115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.991115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.991115 (E_RNA) where: Base-Base interactions energy: -220.428 where: short stacking energy: -98.272 Base-Backbone interact. energy: -0.464 local terms energy: -107.099236 where: bonds (distance) C4'-P energy: -20.259 bonds (distance) P-C4' energy: -23.303 flat angles C4'-P-C4' energy: -22.967 flat angles P-C4'-P energy: -12.620 tors. eta vs tors. theta energy: -27.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -367.664613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.664613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.664613 (E_RNA) where: Base-Base interactions energy: -248.617 where: short stacking energy: -108.505 Base-Backbone interact. energy: -0.637 local terms energy: -118.409943 where: bonds (distance) C4'-P energy: -22.624 bonds (distance) P-C4' energy: -18.708 flat angles C4'-P-C4' energy: -24.235 flat angles P-C4'-P energy: -16.710 tors. eta vs tors. theta energy: -36.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -256.520618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.520618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.520618 (E_RNA) where: Base-Base interactions energy: -162.818 where: short stacking energy: -76.986 Base-Backbone interact. energy: -0.101 local terms energy: -93.601810 where: bonds (distance) C4'-P energy: -21.800 bonds (distance) P-C4' energy: -19.690 flat angles C4'-P-C4' energy: -17.316 flat angles P-C4'-P energy: -13.951 tors. eta vs tors. theta energy: -20.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -124.130563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.130563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.130563 (E_RNA) where: Base-Base interactions energy: -39.662 where: short stacking energy: -38.597 Base-Backbone interact. energy: -0.271 local terms energy: -84.196727 where: bonds (distance) C4'-P energy: -17.808 bonds (distance) P-C4' energy: -25.254 flat angles C4'-P-C4' energy: -23.529 flat angles P-C4'-P energy: -11.618 tors. eta vs tors. theta energy: -5.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -130.013088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.013088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.013088 (E_RNA) where: Base-Base interactions energy: -68.504 where: short stacking energy: -45.896 Base-Backbone interact. energy: -0.192 local terms energy: -61.316996 where: bonds (distance) C4'-P energy: -20.338 bonds (distance) P-C4' energy: -17.987 flat angles C4'-P-C4' energy: -16.656 flat angles P-C4'-P energy: -3.269 tors. eta vs tors. theta energy: -3.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -115.323687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.323687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.323687 (E_RNA) where: Base-Base interactions energy: -45.040 where: short stacking energy: -36.899 Base-Backbone interact. energy: -0.161 local terms energy: -70.123076 where: bonds (distance) C4'-P energy: -19.359 bonds (distance) P-C4' energy: -18.354 flat angles C4'-P-C4' energy: -17.538 flat angles P-C4'-P energy: -9.360 tors. eta vs tors. theta energy: -5.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -100.827860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.827860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.827860 (E_RNA) where: Base-Base interactions energy: -37.700 where: short stacking energy: -29.229 Base-Backbone interact. energy: -0.110 local terms energy: -63.017373 where: bonds (distance) C4'-P energy: -18.434 bonds (distance) P-C4' energy: -16.759 flat angles C4'-P-C4' energy: -19.775 flat angles P-C4'-P energy: -7.810 tors. eta vs tors. theta energy: -0.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -383.818904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.818904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.818904 (E_RNA) where: Base-Base interactions energy: -256.616 where: short stacking energy: -122.698 Base-Backbone interact. energy: -0.037 local terms energy: -127.166171 where: bonds (distance) C4'-P energy: -24.917 bonds (distance) P-C4' energy: -22.753 flat angles C4'-P-C4' energy: -26.525 flat angles P-C4'-P energy: -16.188 tors. eta vs tors. theta energy: -36.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -392.509040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.509040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.509040 (E_RNA) where: Base-Base interactions energy: -270.495 where: short stacking energy: -121.026 Base-Backbone interact. energy: -0.283 local terms energy: -121.730954 where: bonds (distance) C4'-P energy: -24.011 bonds (distance) P-C4' energy: -21.571 flat angles C4'-P-C4' energy: -24.662 flat angles P-C4'-P energy: -18.655 tors. eta vs tors. theta energy: -32.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -376.923660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.923660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.923660 (E_RNA) where: Base-Base interactions energy: -253.925 where: short stacking energy: -121.249 Base-Backbone interact. energy: -0.176 local terms energy: -122.822376 where: bonds (distance) C4'-P energy: -23.141 bonds (distance) P-C4' energy: -20.622 flat angles C4'-P-C4' energy: -23.575 flat angles P-C4'-P energy: -18.900 tors. eta vs tors. theta energy: -36.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -350.558912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.558912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.558912 (E_RNA) where: Base-Base interactions energy: -235.336 where: short stacking energy: -97.750 Base-Backbone interact. energy: -0.746 local terms energy: -114.477073 where: bonds (distance) C4'-P energy: -16.721 bonds (distance) P-C4' energy: -24.386 flat angles C4'-P-C4' energy: -25.534 flat angles P-C4'-P energy: -17.815 tors. eta vs tors. theta energy: -30.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -319.280333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.280333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.280333 (E_RNA) where: Base-Base interactions energy: -212.373 where: short stacking energy: -86.529 Base-Backbone interact. energy: 0.193 local terms energy: -107.100137 where: bonds (distance) C4'-P energy: -20.434 bonds (distance) P-C4' energy: -25.734 flat angles C4'-P-C4' energy: -24.771 flat angles P-C4'-P energy: -12.629 tors. eta vs tors. theta energy: -23.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -269.234703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.234703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.234703 (E_RNA) where: Base-Base interactions energy: -161.019 where: short stacking energy: -68.009 Base-Backbone interact. energy: -0.327 local terms energy: -107.888716 where: bonds (distance) C4'-P energy: -24.760 bonds (distance) P-C4' energy: -25.142 flat angles C4'-P-C4' energy: -24.579 flat angles P-C4'-P energy: -16.436 tors. eta vs tors. theta energy: -16.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -141.536679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.536679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.536679 (E_RNA) where: Base-Base interactions energy: -64.531 where: short stacking energy: -54.510 Base-Backbone interact. energy: -0.207 local terms energy: -76.798890 where: bonds (distance) C4'-P energy: -19.750 bonds (distance) P-C4' energy: -14.481 flat angles C4'-P-C4' energy: -20.983 flat angles P-C4'-P energy: -9.176 tors. eta vs tors. theta energy: -12.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -126.245594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.245594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.245594 (E_RNA) where: Base-Base interactions energy: -54.209 where: short stacking energy: -39.875 Base-Backbone interact. energy: 1.294 local terms energy: -73.330522 where: bonds (distance) C4'-P energy: -22.372 bonds (distance) P-C4' energy: -14.735 flat angles C4'-P-C4' energy: -20.859 flat angles P-C4'-P energy: -11.298 tors. eta vs tors. theta energy: -4.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -124.109750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.109750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.109750 (E_RNA) where: Base-Base interactions energy: -48.946 where: short stacking energy: -48.663 Base-Backbone interact. energy: 0.252 local terms energy: -75.416193 where: bonds (distance) C4'-P energy: -17.827 bonds (distance) P-C4' energy: -17.442 flat angles C4'-P-C4' energy: -20.305 flat angles P-C4'-P energy: -11.451 tors. eta vs tors. theta energy: -8.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -107.109061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.109061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.109061 (E_RNA) where: Base-Base interactions energy: -41.543 where: short stacking energy: -37.358 Base-Backbone interact. energy: 0.694 local terms energy: -66.259939 where: bonds (distance) C4'-P energy: -20.165 bonds (distance) P-C4' energy: -20.016 flat angles C4'-P-C4' energy: -16.692 flat angles P-C4'-P energy: -6.411 tors. eta vs tors. theta energy: -2.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -390.892239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.892239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.892239 (E_RNA) where: Base-Base interactions energy: -266.747 where: short stacking energy: -115.346 Base-Backbone interact. energy: -0.165 local terms energy: -123.979933 where: bonds (distance) C4'-P energy: -21.285 bonds (distance) P-C4' energy: -23.204 flat angles C4'-P-C4' energy: -28.520 flat angles P-C4'-P energy: -16.554 tors. eta vs tors. theta energy: -34.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -385.411831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.411831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.411831 (E_RNA) where: Base-Base interactions energy: -264.668 where: short stacking energy: -115.468 Base-Backbone interact. energy: -0.369 local terms energy: -120.374985 where: bonds (distance) C4'-P energy: -19.484 bonds (distance) P-C4' energy: -26.569 flat angles C4'-P-C4' energy: -22.938 flat angles P-C4'-P energy: -19.005 tors. eta vs tors. theta energy: -32.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -379.191379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.191379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.191379 (E_RNA) where: Base-Base interactions energy: -255.585 where: short stacking energy: -117.433 Base-Backbone interact. energy: -0.023 local terms energy: -123.583348 where: bonds (distance) C4'-P energy: -18.368 bonds (distance) P-C4' energy: -26.600 flat angles C4'-P-C4' energy: -24.060 flat angles P-C4'-P energy: -17.352 tors. eta vs tors. theta energy: -37.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -368.452797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.452797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.452797 (E_RNA) where: Base-Base interactions energy: -250.854 where: short stacking energy: -100.861 Base-Backbone interact. energy: -0.065 local terms energy: -117.533600 where: bonds (distance) C4'-P energy: -23.370 bonds (distance) P-C4' energy: -19.615 flat angles C4'-P-C4' energy: -26.011 flat angles P-C4'-P energy: -17.771 tors. eta vs tors. theta energy: -30.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -319.441595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.441595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.441595 (E_RNA) where: Base-Base interactions energy: -226.486 where: short stacking energy: -88.397 Base-Backbone interact. energy: -0.190 local terms energy: -92.766223 where: bonds (distance) C4'-P energy: -20.715 bonds (distance) P-C4' energy: -17.625 flat angles C4'-P-C4' energy: -20.519 flat angles P-C4'-P energy: -11.253 tors. eta vs tors. theta energy: -22.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -236.368066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.368066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.368066 (E_RNA) where: Base-Base interactions energy: -146.422 where: short stacking energy: -70.022 Base-Backbone interact. energy: -0.512 local terms energy: -89.434464 where: bonds (distance) C4'-P energy: -20.441 bonds (distance) P-C4' energy: -21.286 flat angles C4'-P-C4' energy: -20.738 flat angles P-C4'-P energy: -15.393 tors. eta vs tors. theta energy: -11.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -128.793867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.793867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.793867 (E_RNA) where: Base-Base interactions energy: -52.288 where: short stacking energy: -48.386 Base-Backbone interact. energy: -0.318 local terms energy: -76.188080 where: bonds (distance) C4'-P energy: -17.462 bonds (distance) P-C4' energy: -24.936 flat angles C4'-P-C4' energy: -19.121 flat angles P-C4'-P energy: -10.417 tors. eta vs tors. theta energy: -4.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -115.776915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.776915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.776915 (E_RNA) where: Base-Base interactions energy: -46.882 where: short stacking energy: -42.667 Base-Backbone interact. energy: -0.285 local terms energy: -68.609515 where: bonds (distance) C4'-P energy: -17.464 bonds (distance) P-C4' energy: -20.677 flat angles C4'-P-C4' energy: -17.161 flat angles P-C4'-P energy: -11.929 tors. eta vs tors. theta energy: -1.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -113.337870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.337870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.337870 (E_RNA) where: Base-Base interactions energy: -32.657 where: short stacking energy: -29.920 Base-Backbone interact. energy: 1.558 local terms energy: -82.239034 where: bonds (distance) C4'-P energy: -22.157 bonds (distance) P-C4' energy: -23.176 flat angles C4'-P-C4' energy: -25.872 flat angles P-C4'-P energy: -7.649 tors. eta vs tors. theta energy: -3.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -97.397906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.397906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.397906 (E_RNA) where: Base-Base interactions energy: -23.065 where: short stacking energy: -23.065 Base-Backbone interact. energy: -0.634 local terms energy: -73.699057 where: bonds (distance) C4'-P energy: -24.880 bonds (distance) P-C4' energy: -26.239 flat angles C4'-P-C4' energy: -21.599 flat angles P-C4'-P energy: -6.353 tors. eta vs tors. theta energy: 5.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -386.281414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.281414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.281414 (E_RNA) where: Base-Base interactions energy: -263.723 where: short stacking energy: -124.456 Base-Backbone interact. energy: -0.001 local terms energy: -122.557458 where: bonds (distance) C4'-P energy: -20.609 bonds (distance) P-C4' energy: -26.364 flat angles C4'-P-C4' energy: -20.130 flat angles P-C4'-P energy: -17.034 tors. eta vs tors. theta energy: -38.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -390.047446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.047446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.047446 (E_RNA) where: Base-Base interactions energy: -265.944 where: short stacking energy: -122.414 Base-Backbone interact. energy: -0.001 local terms energy: -124.102980 where: bonds (distance) C4'-P energy: -23.994 bonds (distance) P-C4' energy: -22.246 flat angles C4'-P-C4' energy: -24.930 flat angles P-C4'-P energy: -16.457 tors. eta vs tors. theta energy: -36.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -377.530449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.530449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.530449 (E_RNA) where: Base-Base interactions energy: -253.997 where: short stacking energy: -115.711 Base-Backbone interact. energy: -0.340 local terms energy: -123.193029 where: bonds (distance) C4'-P energy: -22.923 bonds (distance) P-C4' energy: -20.099 flat angles C4'-P-C4' energy: -25.438 flat angles P-C4'-P energy: -17.579 tors. eta vs tors. theta energy: -37.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -341.081019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.081019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.081019 (E_RNA) where: Base-Base interactions energy: -240.089 where: short stacking energy: -107.055 Base-Backbone interact. energy: 0.346 local terms energy: -101.338621 where: bonds (distance) C4'-P energy: -19.761 bonds (distance) P-C4' energy: -18.161 flat angles C4'-P-C4' energy: -23.351 flat angles P-C4'-P energy: -11.647 tors. eta vs tors. theta energy: -28.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -357.778751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.778751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.778751 (E_RNA) where: Base-Base interactions energy: -240.976 where: short stacking energy: -104.696 Base-Backbone interact. energy: -0.006 local terms energy: -116.797236 where: bonds (distance) C4'-P energy: -21.903 bonds (distance) P-C4' energy: -21.686 flat angles C4'-P-C4' energy: -23.383 flat angles P-C4'-P energy: -19.088 tors. eta vs tors. theta energy: -30.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -259.043892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.043892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.043892 (E_RNA) where: Base-Base interactions energy: -173.255 where: short stacking energy: -84.041 Base-Backbone interact. energy: -0.551 local terms energy: -85.237884 where: bonds (distance) C4'-P energy: -13.562 bonds (distance) P-C4' energy: -20.015 flat angles C4'-P-C4' energy: -13.925 flat angles P-C4'-P energy: -15.765 tors. eta vs tors. theta energy: -21.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -123.507522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.507522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.507522 (E_RNA) where: Base-Base interactions energy: -50.972 where: short stacking energy: -48.642 Base-Backbone interact. energy: -0.208 local terms energy: -72.327987 where: bonds (distance) C4'-P energy: -16.919 bonds (distance) P-C4' energy: -26.031 flat angles C4'-P-C4' energy: -20.962 flat angles P-C4'-P energy: -6.652 tors. eta vs tors. theta energy: -1.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -116.231772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.231772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.231772 (E_RNA) where: Base-Base interactions energy: -43.926 where: short stacking energy: -42.693 Base-Backbone interact. energy: 1.612 local terms energy: -73.917049 where: bonds (distance) C4'-P energy: -19.532 bonds (distance) P-C4' energy: -19.220 flat angles C4'-P-C4' energy: -15.196 flat angles P-C4'-P energy: -16.655 tors. eta vs tors. theta energy: -3.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -113.299570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.299570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.299570 (E_RNA) where: Base-Base interactions energy: -42.989 where: short stacking energy: -38.906 Base-Backbone interact. energy: -0.448 local terms energy: -69.862790 where: bonds (distance) C4'-P energy: -17.954 bonds (distance) P-C4' energy: -14.694 flat angles C4'-P-C4' energy: -22.596 flat angles P-C4'-P energy: -14.281 tors. eta vs tors. theta energy: -0.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -119.256990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.256990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.256990 (E_RNA) where: Base-Base interactions energy: -52.272 where: short stacking energy: -49.164 Base-Backbone interact. energy: -0.155 local terms energy: -66.830025 where: bonds (distance) C4'-P energy: -19.675 bonds (distance) P-C4' energy: -15.948 flat angles C4'-P-C4' energy: -10.937 flat angles P-C4'-P energy: -8.281 tors. eta vs tors. theta energy: -11.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -383.792362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.792362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.792362 (E_RNA) where: Base-Base interactions energy: -262.090 where: short stacking energy: -117.612 Base-Backbone interact. energy: -0.173 local terms energy: -121.528471 where: bonds (distance) C4'-P energy: -22.934 bonds (distance) P-C4' energy: -22.826 flat angles C4'-P-C4' energy: -29.008 flat angles P-C4'-P energy: -14.689 tors. eta vs tors. theta energy: -32.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -387.557010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.557010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.557010 (E_RNA) where: Base-Base interactions energy: -263.386 where: short stacking energy: -119.943 Base-Backbone interact. energy: -0.360 local terms energy: -123.810953 where: bonds (distance) C4'-P energy: -19.850 bonds (distance) P-C4' energy: -21.778 flat angles C4'-P-C4' energy: -26.297 flat angles P-C4'-P energy: -18.286 tors. eta vs tors. theta energy: -37.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -368.753097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.753097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.753097 (E_RNA) where: Base-Base interactions energy: -244.832 where: short stacking energy: -116.231 Base-Backbone interact. energy: -0.058 local terms energy: -123.862672 where: bonds (distance) C4'-P energy: -21.836 bonds (distance) P-C4' energy: -23.637 flat angles C4'-P-C4' energy: -28.060 flat angles P-C4'-P energy: -15.971 tors. eta vs tors. theta energy: -34.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -337.730588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.730588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.730588 (E_RNA) where: Base-Base interactions energy: -231.161 where: short stacking energy: -96.672 Base-Backbone interact. energy: -0.459 local terms energy: -106.110317 where: bonds (distance) C4'-P energy: -17.694 bonds (distance) P-C4' energy: -22.595 flat angles C4'-P-C4' energy: -25.444 flat angles P-C4'-P energy: -13.449 tors. eta vs tors. theta energy: -26.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -357.181966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.181966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.181966 (E_RNA) where: Base-Base interactions energy: -248.511 where: short stacking energy: -109.380 Base-Backbone interact. energy: 1.469 local terms energy: -110.140154 where: bonds (distance) C4'-P energy: -17.834 bonds (distance) P-C4' energy: -22.664 flat angles C4'-P-C4' energy: -20.924 flat angles P-C4'-P energy: -13.970 tors. eta vs tors. theta energy: -34.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -307.987130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.987130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.987130 (E_RNA) where: Base-Base interactions energy: -197.176 where: short stacking energy: -86.186 Base-Backbone interact. energy: -0.058 local terms energy: -110.752361 where: bonds (distance) C4'-P energy: -24.217 bonds (distance) P-C4' energy: -25.664 flat angles C4'-P-C4' energy: -19.430 flat angles P-C4'-P energy: -18.868 tors. eta vs tors. theta energy: -22.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -123.715123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.715123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.715123 (E_RNA) where: Base-Base interactions energy: -45.540 where: short stacking energy: -37.137 Base-Backbone interact. energy: -0.301 local terms energy: -77.874358 where: bonds (distance) C4'-P energy: -21.631 bonds (distance) P-C4' energy: -19.936 flat angles C4'-P-C4' energy: -15.308 flat angles P-C4'-P energy: -17.475 tors. eta vs tors. theta energy: -3.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -122.045656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.045656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.045656 (E_RNA) where: Base-Base interactions energy: -52.449 where: short stacking energy: -40.867 Base-Backbone interact. energy: -1.258 local terms energy: -68.339179 where: bonds (distance) C4'-P energy: -17.701 bonds (distance) P-C4' energy: -18.639 flat angles C4'-P-C4' energy: -19.835 flat angles P-C4'-P energy: -10.550 tors. eta vs tors. theta energy: -1.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -130.563342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.563342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.563342 (E_RNA) where: Base-Base interactions energy: -54.618 where: short stacking energy: -45.681 Base-Backbone interact. energy: -0.990 local terms energy: -74.954955 where: bonds (distance) C4'-P energy: -18.483 bonds (distance) P-C4' energy: -19.701 flat angles C4'-P-C4' energy: -18.451 flat angles P-C4'-P energy: -10.098 tors. eta vs tors. theta energy: -8.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -105.481596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.481596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.481596 (E_RNA) where: Base-Base interactions energy: -29.606 where: short stacking energy: -29.606 Base-Backbone interact. energy: 1.445 local terms energy: -77.320069 where: bonds (distance) C4'-P energy: -25.293 bonds (distance) P-C4' energy: -22.224 flat angles C4'-P-C4' energy: -14.677 flat angles P-C4'-P energy: -10.431 tors. eta vs tors. theta energy: -4.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -396.028991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.028991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.028991 (E_RNA) where: Base-Base interactions energy: -268.363 where: short stacking energy: -118.679 Base-Backbone interact. energy: -0.000 local terms energy: -127.666072 where: bonds (distance) C4'-P energy: -23.571 bonds (distance) P-C4' energy: -23.320 flat angles C4'-P-C4' energy: -25.648 flat angles P-C4'-P energy: -16.118 tors. eta vs tors. theta energy: -39.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -377.302206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.302206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.302206 (E_RNA) where: Base-Base interactions energy: -254.404 where: short stacking energy: -117.972 Base-Backbone interact. energy: -0.300 local terms energy: -122.598666 where: bonds (distance) C4'-P energy: -21.510 bonds (distance) P-C4' energy: -25.808 flat angles C4'-P-C4' energy: -24.359 flat angles P-C4'-P energy: -16.221 tors. eta vs tors. theta energy: -34.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -384.192763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.192763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.192763 (E_RNA) where: Base-Base interactions energy: -258.925 where: short stacking energy: -112.395 Base-Backbone interact. energy: -0.004 local terms energy: -125.263790 where: bonds (distance) C4'-P energy: -23.423 bonds (distance) P-C4' energy: -22.953 flat angles C4'-P-C4' energy: -24.432 flat angles P-C4'-P energy: -19.808 tors. eta vs tors. theta energy: -34.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -342.829503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.829503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.829503 (E_RNA) where: Base-Base interactions energy: -232.602 where: short stacking energy: -107.046 Base-Backbone interact. energy: -0.001 local terms energy: -110.225770 where: bonds (distance) C4'-P energy: -15.460 bonds (distance) P-C4' energy: -23.267 flat angles C4'-P-C4' energy: -24.126 flat angles P-C4'-P energy: -17.224 tors. eta vs tors. theta energy: -30.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -327.977407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.977407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.977407 (E_RNA) where: Base-Base interactions energy: -220.468 where: short stacking energy: -95.034 Base-Backbone interact. energy: 2.424 local terms energy: -109.934168 where: bonds (distance) C4'-P energy: -23.991 bonds (distance) P-C4' energy: -22.764 flat angles C4'-P-C4' energy: -25.128 flat angles P-C4'-P energy: -13.850 tors. eta vs tors. theta energy: -24.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -312.302755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.302755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.302755 (E_RNA) where: Base-Base interactions energy: -206.834 where: short stacking energy: -95.329 Base-Backbone interact. energy: 1.466 local terms energy: -106.934643 where: bonds (distance) C4'-P energy: -19.645 bonds (distance) P-C4' energy: -18.662 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -16.176 tors. eta vs tors. theta energy: -28.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -133.077451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.077451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.077451 (E_RNA) where: Base-Base interactions energy: -53.590 where: short stacking energy: -52.609 Base-Backbone interact. energy: 0.892 local terms energy: -80.379509 where: bonds (distance) C4'-P energy: -20.753 bonds (distance) P-C4' energy: -20.106 flat angles C4'-P-C4' energy: -13.103 flat angles P-C4'-P energy: -14.339 tors. eta vs tors. theta energy: -12.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -126.100930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.100930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.100930 (E_RNA) where: Base-Base interactions energy: -40.267 where: short stacking energy: -28.925 Base-Backbone interact. energy: -0.158 local terms energy: -85.675769 where: bonds (distance) C4'-P energy: -23.953 bonds (distance) P-C4' energy: -22.964 flat angles C4'-P-C4' energy: -17.064 flat angles P-C4'-P energy: -13.886 tors. eta vs tors. theta energy: -7.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -114.779930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.779930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.779930 (E_RNA) where: Base-Base interactions energy: -50.032 where: short stacking energy: -43.549 Base-Backbone interact. energy: -0.670 local terms energy: -64.077810 where: bonds (distance) C4'-P energy: -13.553 bonds (distance) P-C4' energy: -14.351 flat angles C4'-P-C4' energy: -17.923 flat angles P-C4'-P energy: -12.083 tors. eta vs tors. theta energy: -6.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -107.345698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.345698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.345698 (E_RNA) where: Base-Base interactions energy: -44.328 where: short stacking energy: -44.242 Base-Backbone interact. energy: -0.320 local terms energy: -62.697499 where: bonds (distance) C4'-P energy: -15.165 bonds (distance) P-C4' energy: -22.718 flat angles C4'-P-C4' energy: -15.642 flat angles P-C4'-P energy: -11.391 tors. eta vs tors. theta energy: 2.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -391.355365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.355365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.355365 (E_RNA) where: Base-Base interactions energy: -271.897 where: short stacking energy: -123.878 Base-Backbone interact. energy: -0.723 local terms energy: -118.735962 where: bonds (distance) C4'-P energy: -25.053 bonds (distance) P-C4' energy: -22.260 flat angles C4'-P-C4' energy: -22.480 flat angles P-C4'-P energy: -13.219 tors. eta vs tors. theta energy: -35.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -377.520450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.520450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.520450 (E_RNA) where: Base-Base interactions energy: -253.491 where: short stacking energy: -110.077 Base-Backbone interact. energy: -0.010 local terms energy: -124.019282 where: bonds (distance) C4'-P energy: -17.662 bonds (distance) P-C4' energy: -26.405 flat angles C4'-P-C4' energy: -25.356 flat angles P-C4'-P energy: -18.948 tors. eta vs tors. theta energy: -35.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -357.999983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.999983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.999983 (E_RNA) where: Base-Base interactions energy: -245.980 where: short stacking energy: -106.140 Base-Backbone interact. energy: -0.113 local terms energy: -111.907000 where: bonds (distance) C4'-P energy: -18.016 bonds (distance) P-C4' energy: -20.666 flat angles C4'-P-C4' energy: -26.640 flat angles P-C4'-P energy: -17.310 tors. eta vs tors. theta energy: -29.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -364.499820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.499820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.499820 (E_RNA) where: Base-Base interactions energy: -249.118 where: short stacking energy: -111.905 Base-Backbone interact. energy: 0.306 local terms energy: -115.688032 where: bonds (distance) C4'-P energy: -14.123 bonds (distance) P-C4' energy: -20.704 flat angles C4'-P-C4' energy: -24.454 flat angles P-C4'-P energy: -18.847 tors. eta vs tors. theta energy: -37.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -370.311867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.311867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.311867 (E_RNA) where: Base-Base interactions energy: -254.597 where: short stacking energy: -112.750 Base-Backbone interact. energy: -0.023 local terms energy: -115.691163 where: bonds (distance) C4'-P energy: -20.069 bonds (distance) P-C4' energy: -19.790 flat angles C4'-P-C4' energy: -25.095 flat angles P-C4'-P energy: -19.182 tors. eta vs tors. theta energy: -31.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -304.025215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.025215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.025215 (E_RNA) where: Base-Base interactions energy: -201.630 where: short stacking energy: -84.226 Base-Backbone interact. energy: -0.093 local terms energy: -102.302375 where: bonds (distance) C4'-P energy: -24.461 bonds (distance) P-C4' energy: -19.677 flat angles C4'-P-C4' energy: -20.455 flat angles P-C4'-P energy: -17.860 tors. eta vs tors. theta energy: -19.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -132.188168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.188168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.188168 (E_RNA) where: Base-Base interactions energy: -55.373 where: short stacking energy: -52.153 Base-Backbone interact. energy: 0.281 local terms energy: -77.095905 where: bonds (distance) C4'-P energy: -15.808 bonds (distance) P-C4' energy: -22.344 flat angles C4'-P-C4' energy: -20.641 flat angles P-C4'-P energy: -12.140 tors. eta vs tors. theta energy: -6.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -113.135411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.135411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.135411 (E_RNA) where: Base-Base interactions energy: -43.824 where: short stacking energy: -40.259 Base-Backbone interact. energy: -0.249 local terms energy: -69.062368 where: bonds (distance) C4'-P energy: -13.719 bonds (distance) P-C4' energy: -18.169 flat angles C4'-P-C4' energy: -17.571 flat angles P-C4'-P energy: -16.029 tors. eta vs tors. theta energy: -3.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -129.995909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.995909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.995909 (E_RNA) where: Base-Base interactions energy: -50.889 where: short stacking energy: -42.832 Base-Backbone interact. energy: 1.428 local terms energy: -80.533948 where: bonds (distance) C4'-P energy: -20.405 bonds (distance) P-C4' energy: -26.511 flat angles C4'-P-C4' energy: -15.832 flat angles P-C4'-P energy: -12.526 tors. eta vs tors. theta energy: -5.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -106.296284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.296284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.296284 (E_RNA) where: Base-Base interactions energy: -41.477 where: short stacking energy: -38.453 Base-Backbone interact. energy: -0.567 local terms energy: -64.252623 where: bonds (distance) C4'-P energy: -19.978 bonds (distance) P-C4' energy: -23.356 flat angles C4'-P-C4' energy: -16.161 flat angles P-C4'-P energy: -6.345 tors. eta vs tors. theta energy: 1.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -389.667657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.667657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.667657 (E_RNA) where: Base-Base interactions energy: -265.699 where: short stacking energy: -121.928 Base-Backbone interact. energy: -0.003 local terms energy: -123.964732 where: bonds (distance) C4'-P energy: -21.853 bonds (distance) P-C4' energy: -22.495 flat angles C4'-P-C4' energy: -23.711 flat angles P-C4'-P energy: -19.784 tors. eta vs tors. theta energy: -36.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -386.087207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.087207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.087207 (E_RNA) where: Base-Base interactions energy: -258.156 where: short stacking energy: -115.337 Base-Backbone interact. energy: -0.026 local terms energy: -127.904639 where: bonds (distance) C4'-P energy: -22.165 bonds (distance) P-C4' energy: -22.915 flat angles C4'-P-C4' energy: -25.643 flat angles P-C4'-P energy: -19.882 tors. eta vs tors. theta energy: -37.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -382.893667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.893667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.893667 (E_RNA) where: Base-Base interactions energy: -260.835 where: short stacking energy: -122.133 Base-Backbone interact. energy: -1.943 local terms energy: -120.115608 where: bonds (distance) C4'-P energy: -20.621 bonds (distance) P-C4' energy: -21.646 flat angles C4'-P-C4' energy: -24.145 flat angles P-C4'-P energy: -18.226 tors. eta vs tors. theta energy: -35.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -374.889800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.889800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.889800 (E_RNA) where: Base-Base interactions energy: -251.648 where: short stacking energy: -109.821 Base-Backbone interact. energy: -0.743 local terms energy: -122.498313 where: bonds (distance) C4'-P energy: -22.217 bonds (distance) P-C4' energy: -18.984 flat angles C4'-P-C4' energy: -25.926 flat angles P-C4'-P energy: -20.531 tors. eta vs tors. theta energy: -34.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -362.606923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.606923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.606923 (E_RNA) where: Base-Base interactions energy: -246.996 where: short stacking energy: -112.677 Base-Backbone interact. energy: -0.001 local terms energy: -115.610210 where: bonds (distance) C4'-P energy: -16.219 bonds (distance) P-C4' energy: -21.619 flat angles C4'-P-C4' energy: -27.221 flat angles P-C4'-P energy: -12.166 tors. eta vs tors. theta energy: -38.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -319.490943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.490943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.490943 (E_RNA) where: Base-Base interactions energy: -221.791 where: short stacking energy: -82.973 Base-Backbone interact. energy: -0.209 local terms energy: -97.490691 where: bonds (distance) C4'-P energy: -16.300 bonds (distance) P-C4' energy: -18.589 flat angles C4'-P-C4' energy: -23.991 flat angles P-C4'-P energy: -14.537 tors. eta vs tors. theta energy: -24.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -136.123638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.123638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.123638 (E_RNA) where: Base-Base interactions energy: -59.072 where: short stacking energy: -40.000 Base-Backbone interact. energy: -0.081 local terms energy: -76.970786 where: bonds (distance) C4'-P energy: -16.291 bonds (distance) P-C4' energy: -21.316 flat angles C4'-P-C4' energy: -21.935 flat angles P-C4'-P energy: -11.569 tors. eta vs tors. theta energy: -5.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -119.964617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.964617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.964617 (E_RNA) where: Base-Base interactions energy: -47.173 where: short stacking energy: -44.031 Base-Backbone interact. energy: 0.874 local terms energy: -73.665681 where: bonds (distance) C4'-P energy: -18.557 bonds (distance) P-C4' energy: -18.645 flat angles C4'-P-C4' energy: -19.204 flat angles P-C4'-P energy: -11.605 tors. eta vs tors. theta energy: -5.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -110.712547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -110.712547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -110.712547 (E_RNA) where: Base-Base interactions energy: -31.119 where: short stacking energy: -28.164 Base-Backbone interact. energy: -0.621 local terms energy: -78.972160 where: bonds (distance) C4'-P energy: -23.126 bonds (distance) P-C4' energy: -21.631 flat angles C4'-P-C4' energy: -22.204 flat angles P-C4'-P energy: -12.953 tors. eta vs tors. theta energy: 0.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -114.322687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.322687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.322687 (E_RNA) where: Base-Base interactions energy: -47.638 where: short stacking energy: -45.986 Base-Backbone interact. energy: 1.969 local terms energy: -68.653701 where: bonds (distance) C4'-P energy: -14.324 bonds (distance) P-C4' energy: -17.202 flat angles C4'-P-C4' energy: -21.752 flat angles P-C4'-P energy: -8.239 tors. eta vs tors. theta energy: -7.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -390.304204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.304204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.304204 (E_RNA) where: Base-Base interactions energy: -269.464 where: short stacking energy: -123.921 Base-Backbone interact. energy: -0.007 local terms energy: -120.833182 where: bonds (distance) C4'-P energy: -20.386 bonds (distance) P-C4' energy: -21.861 flat angles C4'-P-C4' energy: -24.092 flat angles P-C4'-P energy: -18.055 tors. eta vs tors. theta energy: -36.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -393.530003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.530003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.530003 (E_RNA) where: Base-Base interactions energy: -266.916 where: short stacking energy: -121.161 Base-Backbone interact. energy: -0.045 local terms energy: -126.568648 where: bonds (distance) C4'-P energy: -20.348 bonds (distance) P-C4' energy: -22.521 flat angles C4'-P-C4' energy: -25.636 flat angles P-C4'-P energy: -20.272 tors. eta vs tors. theta energy: -37.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -380.998079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.998079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.998079 (E_RNA) where: Base-Base interactions energy: -259.696 where: short stacking energy: -112.987 Base-Backbone interact. energy: -0.166 local terms energy: -121.136787 where: bonds (distance) C4'-P energy: -19.242 bonds (distance) P-C4' energy: -21.460 flat angles C4'-P-C4' energy: -22.405 flat angles P-C4'-P energy: -21.912 tors. eta vs tors. theta energy: -36.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -364.607452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.607452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.607452 (E_RNA) where: Base-Base interactions energy: -243.255 where: short stacking energy: -105.652 Base-Backbone interact. energy: 0.399 local terms energy: -121.751299 where: bonds (distance) C4'-P energy: -20.438 bonds (distance) P-C4' energy: -22.282 flat angles C4'-P-C4' energy: -26.155 flat angles P-C4'-P energy: -18.584 tors. eta vs tors. theta energy: -34.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -368.857617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.857617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.857617 (E_RNA) where: Base-Base interactions energy: -242.064 where: short stacking energy: -103.512 Base-Backbone interact. energy: 2.687 local terms energy: -129.481160 where: bonds (distance) C4'-P energy: -26.448 bonds (distance) P-C4' energy: -22.636 flat angles C4'-P-C4' energy: -26.134 flat angles P-C4'-P energy: -19.360 tors. eta vs tors. theta energy: -34.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -325.221564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.221564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.221564 (E_RNA) where: Base-Base interactions energy: -230.541 where: short stacking energy: -91.817 Base-Backbone interact. energy: -0.484 local terms energy: -94.196202 where: bonds (distance) C4'-P energy: -20.562 bonds (distance) P-C4' energy: -15.831 flat angles C4'-P-C4' energy: -21.550 flat angles P-C4'-P energy: -11.352 tors. eta vs tors. theta energy: -24.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -123.412626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.412626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.412626 (E_RNA) where: Base-Base interactions energy: -49.126 where: short stacking energy: -48.259 Base-Backbone interact. energy: 0.977 local terms energy: -75.263402 where: bonds (distance) C4'-P energy: -18.324 bonds (distance) P-C4' energy: -21.832 flat angles C4'-P-C4' energy: -14.524 flat angles P-C4'-P energy: -17.670 tors. eta vs tors. theta energy: -2.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -121.652481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.652481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.652481 (E_RNA) where: Base-Base interactions energy: -44.964 where: short stacking energy: -44.640 Base-Backbone interact. energy: -0.027 local terms energy: -76.661616 where: bonds (distance) C4'-P energy: -22.409 bonds (distance) P-C4' energy: -23.383 flat angles C4'-P-C4' energy: -14.245 flat angles P-C4'-P energy: -12.243 tors. eta vs tors. theta energy: -4.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -122.185014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.185014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.185014 (E_RNA) where: Base-Base interactions energy: -40.737 where: short stacking energy: -40.474 Base-Backbone interact. energy: -0.094 local terms energy: -81.353497 where: bonds (distance) C4'-P energy: -20.374 bonds (distance) P-C4' energy: -22.063 flat angles C4'-P-C4' energy: -18.712 flat angles P-C4'-P energy: -9.661 tors. eta vs tors. theta energy: -10.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -108.256784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.256784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.256784 (E_RNA) where: Base-Base interactions energy: -39.179 where: short stacking energy: -33.210 Base-Backbone interact. energy: 0.609 local terms energy: -69.686780 where: bonds (distance) C4'-P energy: -14.047 bonds (distance) P-C4' energy: -21.933 flat angles C4'-P-C4' energy: -16.422 flat angles P-C4'-P energy: -13.148 tors. eta vs tors. theta energy: -4.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -388.155339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.155339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.155339 (E_RNA) where: Base-Base interactions energy: -261.637 where: short stacking energy: -116.326 Base-Backbone interact. energy: -1.516 local terms energy: -125.002392 where: bonds (distance) C4'-P energy: -23.568 bonds (distance) P-C4' energy: -23.791 flat angles C4'-P-C4' energy: -24.912 flat angles P-C4'-P energy: -17.524 tors. eta vs tors. theta energy: -35.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -384.069570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.069570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.069570 (E_RNA) where: Base-Base interactions energy: -260.922 where: short stacking energy: -120.031 Base-Backbone interact. energy: -0.000 local terms energy: -123.147127 where: bonds (distance) C4'-P energy: -19.044 bonds (distance) P-C4' energy: -23.009 flat angles C4'-P-C4' energy: -24.410 flat angles P-C4'-P energy: -19.580 tors. eta vs tors. theta energy: -37.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -374.537921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.537921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.537921 (E_RNA) where: Base-Base interactions energy: -254.266 where: short stacking energy: -117.591 Base-Backbone interact. energy: -0.606 local terms energy: -119.665422 where: bonds (distance) C4'-P energy: -18.773 bonds (distance) P-C4' energy: -21.412 flat angles C4'-P-C4' energy: -25.832 flat angles P-C4'-P energy: -16.983 tors. eta vs tors. theta energy: -36.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -376.469567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.469567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.469567 (E_RNA) where: Base-Base interactions energy: -259.991 where: short stacking energy: -113.759 Base-Backbone interact. energy: -0.230 local terms energy: -116.248762 where: bonds (distance) C4'-P energy: -23.539 bonds (distance) P-C4' energy: -22.064 flat angles C4'-P-C4' energy: -18.288 flat angles P-C4'-P energy: -19.869 tors. eta vs tors. theta energy: -32.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -357.714264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.714264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.714264 (E_RNA) where: Base-Base interactions energy: -253.086 where: short stacking energy: -111.897 Base-Backbone interact. energy: -0.004 local terms energy: -104.624936 where: bonds (distance) C4'-P energy: -14.965 bonds (distance) P-C4' energy: -19.636 flat angles C4'-P-C4' energy: -20.316 flat angles P-C4'-P energy: -15.604 tors. eta vs tors. theta energy: -34.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -332.498818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.498818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.498818 (E_RNA) where: Base-Base interactions energy: -226.199 where: short stacking energy: -101.792 Base-Backbone interact. energy: -0.701 local terms energy: -105.598433 where: bonds (distance) C4'-P energy: -21.668 bonds (distance) P-C4' energy: -22.636 flat angles C4'-P-C4' energy: -22.478 flat angles P-C4'-P energy: -12.895 tors. eta vs tors. theta energy: -25.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -138.747423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.747423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.747423 (E_RNA) where: Base-Base interactions energy: -61.674 where: short stacking energy: -52.430 Base-Backbone interact. energy: 1.182 local terms energy: -78.254540 where: bonds (distance) C4'-P energy: -23.561 bonds (distance) P-C4' energy: -23.433 flat angles C4'-P-C4' energy: -14.541 flat angles P-C4'-P energy: -10.189 tors. eta vs tors. theta energy: -6.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -120.778539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.778539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.778539 (E_RNA) where: Base-Base interactions energy: -52.655 where: short stacking energy: -38.633 Base-Backbone interact. energy: -2.690 local terms energy: -65.433474 where: bonds (distance) C4'-P energy: -16.778 bonds (distance) P-C4' energy: -21.827 flat angles C4'-P-C4' energy: -13.695 flat angles P-C4'-P energy: -9.325 tors. eta vs tors. theta energy: -3.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -107.319992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.319992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.319992 (E_RNA) where: Base-Base interactions energy: -46.181 where: short stacking energy: -46.099 Base-Backbone interact. energy: 0.140 local terms energy: -61.279248 where: bonds (distance) C4'-P energy: -16.616 bonds (distance) P-C4' energy: -18.675 flat angles C4'-P-C4' energy: -21.003 flat angles P-C4'-P energy: -8.148 tors. eta vs tors. theta energy: 3.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -114.157443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.157443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.157443 (E_RNA) where: Base-Base interactions energy: -56.640 where: short stacking energy: -36.771 Base-Backbone interact. energy: -0.385 local terms energy: -57.132065 where: bonds (distance) C4'-P energy: -18.935 bonds (distance) P-C4' energy: -18.961 flat angles C4'-P-C4' energy: -12.955 flat angles P-C4'-P energy: -7.266 tors. eta vs tors. theta energy: 0.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -393.004526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.004526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.004526 (E_RNA) where: Base-Base interactions energy: -259.092 where: short stacking energy: -117.888 Base-Backbone interact. energy: -0.702 local terms energy: -133.211306 where: bonds (distance) C4'-P energy: -23.963 bonds (distance) P-C4' energy: -22.531 flat angles C4'-P-C4' energy: -27.541 flat angles P-C4'-P energy: -20.695 tors. eta vs tors. theta energy: -38.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -393.919848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.919848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.919848 (E_RNA) where: Base-Base interactions energy: -264.255 where: short stacking energy: -120.618 Base-Backbone interact. energy: -0.000 local terms energy: -129.664265 where: bonds (distance) C4'-P energy: -26.163 bonds (distance) P-C4' energy: -24.069 flat angles C4'-P-C4' energy: -26.150 flat angles P-C4'-P energy: -18.478 tors. eta vs tors. theta energy: -34.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -380.282195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.282195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.282195 (E_RNA) where: Base-Base interactions energy: -263.522 where: short stacking energy: -110.012 Base-Backbone interact. energy: 1.420 local terms energy: -118.179517 where: bonds (distance) C4'-P energy: -22.457 bonds (distance) P-C4' energy: -18.648 flat angles C4'-P-C4' energy: -25.520 flat angles P-C4'-P energy: -15.641 tors. eta vs tors. theta energy: -35.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -369.201880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.201880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.201880 (E_RNA) where: Base-Base interactions energy: -250.269 where: short stacking energy: -110.283 Base-Backbone interact. energy: -0.006 local terms energy: -118.926872 where: bonds (distance) C4'-P energy: -18.044 bonds (distance) P-C4' energy: -26.148 flat angles C4'-P-C4' energy: -24.468 flat angles P-C4'-P energy: -18.160 tors. eta vs tors. theta energy: -32.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -353.447159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.447159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.447159 (E_RNA) where: Base-Base interactions energy: -255.688 where: short stacking energy: -114.308 Base-Backbone interact. energy: -0.002 local terms energy: -97.757285 where: bonds (distance) C4'-P energy: -19.151 bonds (distance) P-C4' energy: -10.931 flat angles C4'-P-C4' energy: -21.656 flat angles P-C4'-P energy: -14.383 tors. eta vs tors. theta energy: -31.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -326.365855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.365855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.365855 (E_RNA) where: Base-Base interactions energy: -215.209 where: short stacking energy: -93.056 Base-Backbone interact. energy: -0.577 local terms energy: -110.580354 where: bonds (distance) C4'-P energy: -17.816 bonds (distance) P-C4' energy: -22.911 flat angles C4'-P-C4' energy: -25.687 flat angles P-C4'-P energy: -15.978 tors. eta vs tors. theta energy: -28.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -125.292583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.292583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.292583 (E_RNA) where: Base-Base interactions energy: -53.012 where: short stacking energy: -49.856 Base-Backbone interact. energy: 0.269 local terms energy: -72.550119 where: bonds (distance) C4'-P energy: -15.113 bonds (distance) P-C4' energy: -22.599 flat angles C4'-P-C4' energy: -19.832 flat angles P-C4'-P energy: -9.296 tors. eta vs tors. theta energy: -5.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -133.145243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.145243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.145243 (E_RNA) where: Base-Base interactions energy: -52.597 where: short stacking energy: -36.342 Base-Backbone interact. energy: 1.078 local terms energy: -81.626499 where: bonds (distance) C4'-P energy: -21.892 bonds (distance) P-C4' energy: -21.101 flat angles C4'-P-C4' energy: -19.576 flat angles P-C4'-P energy: -12.278 tors. eta vs tors. theta energy: -6.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -124.607508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.607508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.607508 (E_RNA) where: Base-Base interactions energy: -58.113 where: short stacking energy: -40.422 Base-Backbone interact. energy: -0.282 local terms energy: -66.213210 where: bonds (distance) C4'-P energy: -18.626 bonds (distance) P-C4' energy: -20.796 flat angles C4'-P-C4' energy: -17.592 flat angles P-C4'-P energy: -11.554 tors. eta vs tors. theta energy: 2.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -101.490932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.490932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.490932 (E_RNA) where: Base-Base interactions energy: -33.414 where: short stacking energy: -30.348 Base-Backbone interact. energy: -0.285 local terms energy: -67.791822 where: bonds (distance) C4'-P energy: -18.932 bonds (distance) P-C4' energy: -20.063 flat angles C4'-P-C4' energy: -16.272 flat angles P-C4'-P energy: -7.666 tors. eta vs tors. theta energy: -4.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -390.931423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.931423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.931423 (E_RNA) where: Base-Base interactions energy: -259.429 where: short stacking energy: -109.519 Base-Backbone interact. energy: -0.459 local terms energy: -131.043938 where: bonds (distance) C4'-P energy: -25.468 bonds (distance) P-C4' energy: -25.106 flat angles C4'-P-C4' energy: -26.785 flat angles P-C4'-P energy: -18.446 tors. eta vs tors. theta energy: -35.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -386.485149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.485149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.485149 (E_RNA) where: Base-Base interactions energy: -259.392 where: short stacking energy: -123.606 Base-Backbone interact. energy: -0.008 local terms energy: -127.085892 where: bonds (distance) C4'-P energy: -25.754 bonds (distance) P-C4' energy: -26.861 flat angles C4'-P-C4' energy: -23.932 flat angles P-C4'-P energy: -16.294 tors. eta vs tors. theta energy: -34.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -379.967422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.967422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.967422 (E_RNA) where: Base-Base interactions energy: -251.818 where: short stacking energy: -115.846 Base-Backbone interact. energy: -1.236 local terms energy: -126.912657 where: bonds (distance) C4'-P energy: -24.036 bonds (distance) P-C4' energy: -25.014 flat angles C4'-P-C4' energy: -24.395 flat angles P-C4'-P energy: -17.184 tors. eta vs tors. theta energy: -36.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -355.209974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.209974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.209974 (E_RNA) where: Base-Base interactions energy: -245.304 where: short stacking energy: -105.768 Base-Backbone interact. energy: -0.853 local terms energy: -109.053079 where: bonds (distance) C4'-P energy: -19.427 bonds (distance) P-C4' energy: -21.893 flat angles C4'-P-C4' energy: -21.870 flat angles P-C4'-P energy: -17.116 tors. eta vs tors. theta energy: -28.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -361.669271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.669271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.669271 (E_RNA) where: Base-Base interactions energy: -249.721 where: short stacking energy: -111.793 Base-Backbone interact. energy: -0.229 local terms energy: -111.718453 where: bonds (distance) C4'-P energy: -18.762 bonds (distance) P-C4' energy: -17.846 flat angles C4'-P-C4' energy: -25.427 flat angles P-C4'-P energy: -17.864 tors. eta vs tors. theta energy: -31.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -334.616095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.616095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.616095 (E_RNA) where: Base-Base interactions energy: -238.130 where: short stacking energy: -88.138 Base-Backbone interact. energy: -0.136 local terms energy: -96.349751 where: bonds (distance) C4'-P energy: -19.175 bonds (distance) P-C4' energy: -19.022 flat angles C4'-P-C4' energy: -20.125 flat angles P-C4'-P energy: -13.223 tors. eta vs tors. theta energy: -24.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -134.201013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.201013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.201013 (E_RNA) where: Base-Base interactions energy: -49.905 where: short stacking energy: -35.192 Base-Backbone interact. energy: 0.638 local terms energy: -84.933799 where: bonds (distance) C4'-P energy: -21.817 bonds (distance) P-C4' energy: -21.686 flat angles C4'-P-C4' energy: -24.154 flat angles P-C4'-P energy: -13.789 tors. eta vs tors. theta energy: -3.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -127.835584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.835584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.835584 (E_RNA) where: Base-Base interactions energy: -50.650 where: short stacking energy: -38.530 Base-Backbone interact. energy: -0.968 local terms energy: -76.217953 where: bonds (distance) C4'-P energy: -20.503 bonds (distance) P-C4' energy: -25.491 flat angles C4'-P-C4' energy: -13.064 flat angles P-C4'-P energy: -13.203 tors. eta vs tors. theta energy: -3.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -106.526623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.526623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.526623 (E_RNA) where: Base-Base interactions energy: -33.885 where: short stacking energy: -33.113 Base-Backbone interact. energy: 0.209 local terms energy: -72.850822 where: bonds (distance) C4'-P energy: -18.286 bonds (distance) P-C4' energy: -23.455 flat angles C4'-P-C4' energy: -17.318 flat angles P-C4'-P energy: -10.206 tors. eta vs tors. theta energy: -3.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -117.333740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.333740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.333740 (E_RNA) where: Base-Base interactions energy: -49.166 where: short stacking energy: -29.970 Base-Backbone interact. energy: -0.959 local terms energy: -67.208685 where: bonds (distance) C4'-P energy: -24.834 bonds (distance) P-C4' energy: -15.735 flat angles C4'-P-C4' energy: -10.236 flat angles P-C4'-P energy: -15.461 tors. eta vs tors. theta energy: -0.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -399.494205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.494205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.494205 (E_RNA) where: Base-Base interactions energy: -264.302 where: short stacking energy: -115.940 Base-Backbone interact. energy: -0.184 local terms energy: -135.008570 where: bonds (distance) C4'-P energy: -25.142 bonds (distance) P-C4' energy: -22.685 flat angles C4'-P-C4' energy: -28.265 flat angles P-C4'-P energy: -19.637 tors. eta vs tors. theta energy: -39.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -373.291242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.291242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.291242 (E_RNA) where: Base-Base interactions energy: -252.943 where: short stacking energy: -109.255 Base-Backbone interact. energy: 1.186 local terms energy: -121.533694 where: bonds (distance) C4'-P energy: -21.619 bonds (distance) P-C4' energy: -23.693 flat angles C4'-P-C4' energy: -24.757 flat angles P-C4'-P energy: -16.404 tors. eta vs tors. theta energy: -35.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -373.414640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.414640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.414640 (E_RNA) where: Base-Base interactions energy: -258.070 where: short stacking energy: -110.503 Base-Backbone interact. energy: -0.006 local terms energy: -115.338525 where: bonds (distance) C4'-P energy: -16.377 bonds (distance) P-C4' energy: -23.490 flat angles C4'-P-C4' energy: -21.997 flat angles P-C4'-P energy: -17.652 tors. eta vs tors. theta energy: -35.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -367.788342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.788342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.788342 (E_RNA) where: Base-Base interactions energy: -248.306 where: short stacking energy: -109.221 Base-Backbone interact. energy: -0.286 local terms energy: -119.195771 where: bonds (distance) C4'-P energy: -18.091 bonds (distance) P-C4' energy: -25.292 flat angles C4'-P-C4' energy: -24.381 flat angles P-C4'-P energy: -16.961 tors. eta vs tors. theta energy: -34.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -339.387816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.387816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.387816 (E_RNA) where: Base-Base interactions energy: -225.038 where: short stacking energy: -86.224 Base-Backbone interact. energy: -0.753 local terms energy: -113.596718 where: bonds (distance) C4'-P energy: -20.604 bonds (distance) P-C4' energy: -24.384 flat angles C4'-P-C4' energy: -21.918 flat angles P-C4'-P energy: -16.001 tors. eta vs tors. theta energy: -30.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -370.512791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.512791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.512791 (E_RNA) where: Base-Base interactions energy: -255.381 where: short stacking energy: -110.000 Base-Backbone interact. energy: -0.103 local terms energy: -115.028339 where: bonds (distance) C4'-P energy: -23.287 bonds (distance) P-C4' energy: -20.784 flat angles C4'-P-C4' energy: -25.018 flat angles P-C4'-P energy: -10.959 tors. eta vs tors. theta energy: -34.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -120.750358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.750358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.750358 (E_RNA) where: Base-Base interactions energy: -48.872 where: short stacking energy: -46.027 Base-Backbone interact. energy: -0.806 local terms energy: -71.072209 where: bonds (distance) C4'-P energy: -18.256 bonds (distance) P-C4' energy: -17.935 flat angles C4'-P-C4' energy: -16.761 flat angles P-C4'-P energy: -16.316 tors. eta vs tors. theta energy: -1.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -120.559745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.559745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.559745 (E_RNA) where: Base-Base interactions energy: -45.375 where: short stacking energy: -38.794 Base-Backbone interact. energy: -0.276 local terms energy: -74.908423 where: bonds (distance) C4'-P energy: -18.588 bonds (distance) P-C4' energy: -23.226 flat angles C4'-P-C4' energy: -16.745 flat angles P-C4'-P energy: -18.022 tors. eta vs tors. theta energy: 1.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -122.616289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.616289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.616289 (E_RNA) where: Base-Base interactions energy: -46.940 where: short stacking energy: -41.979 Base-Backbone interact. energy: -1.210 local terms energy: -74.465465 where: bonds (distance) C4'-P energy: -24.777 bonds (distance) P-C4' energy: -20.022 flat angles C4'-P-C4' energy: -14.483 flat angles P-C4'-P energy: -16.781 tors. eta vs tors. theta energy: 1.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -109.233130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -109.233130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -109.233130 (E_RNA) where: Base-Base interactions energy: -35.297 where: short stacking energy: -35.297 Base-Backbone interact. energy: -0.172 local terms energy: -73.763484 where: bonds (distance) C4'-P energy: -17.825 bonds (distance) P-C4' energy: -18.270 flat angles C4'-P-C4' energy: -22.160 flat angles P-C4'-P energy: -9.385 tors. eta vs tors. theta energy: -6.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -397.327109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.327109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.327109 (E_RNA) where: Base-Base interactions energy: -270.600 where: short stacking energy: -121.308 Base-Backbone interact. energy: -0.001 local terms energy: -126.726039 where: bonds (distance) C4'-P energy: -27.008 bonds (distance) P-C4' energy: -23.425 flat angles C4'-P-C4' energy: -26.571 flat angles P-C4'-P energy: -18.717 tors. eta vs tors. theta energy: -31.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -386.585840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.585840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.585840 (E_RNA) where: Base-Base interactions energy: -265.302 where: short stacking energy: -126.737 Base-Backbone interact. energy: -0.251 local terms energy: -121.032886 where: bonds (distance) C4'-P energy: -23.319 bonds (distance) P-C4' energy: -17.666 flat angles C4'-P-C4' energy: -27.629 flat angles P-C4'-P energy: -17.046 tors. eta vs tors. theta energy: -35.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -369.255129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.255129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.255129 (E_RNA) where: Base-Base interactions energy: -250.301 where: short stacking energy: -110.300 Base-Backbone interact. energy: -0.517 local terms energy: -118.436953 where: bonds (distance) C4'-P energy: -21.518 bonds (distance) P-C4' energy: -23.195 flat angles C4'-P-C4' energy: -24.159 flat angles P-C4'-P energy: -13.459 tors. eta vs tors. theta energy: -36.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -347.453987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.453987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.453987 (E_RNA) where: Base-Base interactions energy: -229.845 where: short stacking energy: -99.276 Base-Backbone interact. energy: 0.895 local terms energy: -118.503947 where: bonds (distance) C4'-P energy: -23.005 bonds (distance) P-C4' energy: -17.924 flat angles C4'-P-C4' energy: -30.725 flat angles P-C4'-P energy: -17.800 tors. eta vs tors. theta energy: -29.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -363.167614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.167614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.167614 (E_RNA) where: Base-Base interactions energy: -242.460 where: short stacking energy: -107.861 Base-Backbone interact. energy: -0.011 local terms energy: -120.695784 where: bonds (distance) C4'-P energy: -19.785 bonds (distance) P-C4' energy: -22.814 flat angles C4'-P-C4' energy: -26.369 flat angles P-C4'-P energy: -15.140 tors. eta vs tors. theta energy: -36.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -349.345606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.345606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.345606 (E_RNA) where: Base-Base interactions energy: -241.569 where: short stacking energy: -98.577 Base-Backbone interact. energy: 1.509 local terms energy: -109.285938 where: bonds (distance) C4'-P energy: -20.927 bonds (distance) P-C4' energy: -22.786 flat angles C4'-P-C4' energy: -16.972 flat angles P-C4'-P energy: -15.662 tors. eta vs tors. theta energy: -32.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -137.035064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.035064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.035064 (E_RNA) where: Base-Base interactions energy: -50.358 where: short stacking energy: -48.498 Base-Backbone interact. energy: -0.382 local terms energy: -86.295082 where: bonds (distance) C4'-P energy: -19.608 bonds (distance) P-C4' energy: -18.173 flat angles C4'-P-C4' energy: -23.886 flat angles P-C4'-P energy: -14.794 tors. eta vs tors. theta energy: -9.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -129.684251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.684251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.684251 (E_RNA) where: Base-Base interactions energy: -33.739 where: short stacking energy: -31.038 Base-Backbone interact. energy: 1.543 local terms energy: -97.488633 where: bonds (distance) C4'-P energy: -23.249 bonds (distance) P-C4' energy: -25.045 flat angles C4'-P-C4' energy: -24.674 flat angles P-C4'-P energy: -16.369 tors. eta vs tors. theta energy: -8.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -104.428161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.428161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.428161 (E_RNA) where: Base-Base interactions energy: -31.136 where: short stacking energy: -17.151 Base-Backbone interact. energy: -0.690 local terms energy: -72.601757 where: bonds (distance) C4'-P energy: -19.137 bonds (distance) P-C4' energy: -20.592 flat angles C4'-P-C4' energy: -16.072 flat angles P-C4'-P energy: -16.681 tors. eta vs tors. theta energy: -0.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -111.120732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.120732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.120732 (E_RNA) where: Base-Base interactions energy: -46.440 where: short stacking energy: -42.258 Base-Backbone interact. energy: -0.116 local terms energy: -64.564897 where: bonds (distance) C4'-P energy: -18.355 bonds (distance) P-C4' energy: -14.523 flat angles C4'-P-C4' energy: -23.412 flat angles P-C4'-P energy: -2.881 tors. eta vs tors. theta energy: -5.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -401.866555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.866555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.866555 (E_RNA) where: Base-Base interactions energy: -284.295 where: short stacking energy: -124.133 Base-Backbone interact. energy: -0.160 local terms energy: -117.411098 where: bonds (distance) C4'-P energy: -20.391 bonds (distance) P-C4' energy: -23.404 flat angles C4'-P-C4' energy: -25.139 flat angles P-C4'-P energy: -14.989 tors. eta vs tors. theta energy: -33.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -394.958154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.958154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.958154 (E_RNA) where: Base-Base interactions energy: -274.953 where: short stacking energy: -127.914 Base-Backbone interact. energy: -0.404 local terms energy: -119.600801 where: bonds (distance) C4'-P energy: -19.979 bonds (distance) P-C4' energy: -18.819 flat angles C4'-P-C4' energy: -26.046 flat angles P-C4'-P energy: -18.821 tors. eta vs tors. theta energy: -35.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -379.166950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.166950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.166950 (E_RNA) where: Base-Base interactions energy: -258.277 where: short stacking energy: -118.341 Base-Backbone interact. energy: -0.623 local terms energy: -120.266143 where: bonds (distance) C4'-P energy: -18.156 bonds (distance) P-C4' energy: -23.996 flat angles C4'-P-C4' energy: -26.987 flat angles P-C4'-P energy: -15.309 tors. eta vs tors. theta energy: -35.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -339.560925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.560925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.560925 (E_RNA) where: Base-Base interactions energy: -230.750 where: short stacking energy: -84.372 Base-Backbone interact. energy: -0.235 local terms energy: -108.575966 where: bonds (distance) C4'-P energy: -21.650 bonds (distance) P-C4' energy: -21.559 flat angles C4'-P-C4' energy: -20.920 flat angles P-C4'-P energy: -21.039 tors. eta vs tors. theta energy: -23.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -370.341891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.341891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.341891 (E_RNA) where: Base-Base interactions energy: -259.652 where: short stacking energy: -114.617 Base-Backbone interact. energy: -0.010 local terms energy: -110.680098 where: bonds (distance) C4'-P energy: -21.639 bonds (distance) P-C4' energy: -18.143 flat angles C4'-P-C4' energy: -19.532 flat angles P-C4'-P energy: -16.615 tors. eta vs tors. theta energy: -34.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -361.317750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.317750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.317750 (E_RNA) where: Base-Base interactions energy: -239.698 where: short stacking energy: -100.284 Base-Backbone interact. energy: -0.035 local terms energy: -121.584062 where: bonds (distance) C4'-P energy: -19.817 bonds (distance) P-C4' energy: -23.876 flat angles C4'-P-C4' energy: -24.455 flat angles P-C4'-P energy: -20.774 tors. eta vs tors. theta energy: -32.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -138.731962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.731962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.731962 (E_RNA) where: Base-Base interactions energy: -65.886 where: short stacking energy: -54.514 Base-Backbone interact. energy: -1.285 local terms energy: -71.560314 where: bonds (distance) C4'-P energy: -16.998 bonds (distance) P-C4' energy: -19.442 flat angles C4'-P-C4' energy: -14.059 flat angles P-C4'-P energy: -15.837 tors. eta vs tors. theta energy: -5.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -114.869047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.869047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.869047 (E_RNA) where: Base-Base interactions energy: -42.785 where: short stacking energy: -23.083 Base-Backbone interact. energy: -0.725 local terms energy: -71.358830 where: bonds (distance) C4'-P energy: -22.692 bonds (distance) P-C4' energy: -18.855 flat angles C4'-P-C4' energy: -19.653 flat angles P-C4'-P energy: -12.141 tors. eta vs tors. theta energy: 1.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -125.204758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.204758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.204758 (E_RNA) where: Base-Base interactions energy: -49.220 where: short stacking energy: -43.323 Base-Backbone interact. energy: -0.116 local terms energy: -75.868669 where: bonds (distance) C4'-P energy: -17.370 bonds (distance) P-C4' energy: -22.834 flat angles C4'-P-C4' energy: -17.874 flat angles P-C4'-P energy: -6.332 tors. eta vs tors. theta energy: -11.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -108.835084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.835084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.835084 (E_RNA) where: Base-Base interactions energy: -44.291 where: short stacking energy: -42.596 Base-Backbone interact. energy: 0.944 local terms energy: -65.488148 where: bonds (distance) C4'-P energy: -16.327 bonds (distance) P-C4' energy: -18.189 flat angles C4'-P-C4' energy: -20.535 flat angles P-C4'-P energy: -6.143 tors. eta vs tors. theta energy: -4.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -389.354595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.354595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.354595 (E_RNA) where: Base-Base interactions energy: -261.020 where: short stacking energy: -115.314 Base-Backbone interact. energy: -0.617 local terms energy: -127.717024 where: bonds (distance) C4'-P energy: -21.688 bonds (distance) P-C4' energy: -24.277 flat angles C4'-P-C4' energy: -25.474 flat angles P-C4'-P energy: -19.676 tors. eta vs tors. theta energy: -36.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -386.911944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.911944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.911944 (E_RNA) where: Base-Base interactions energy: -263.658 where: short stacking energy: -119.078 Base-Backbone interact. energy: -0.013 local terms energy: -123.241139 where: bonds (distance) C4'-P energy: -27.169 bonds (distance) P-C4' energy: -22.474 flat angles C4'-P-C4' energy: -24.371 flat angles P-C4'-P energy: -15.107 tors. eta vs tors. theta energy: -34.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -371.988846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.988846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.988846 (E_RNA) where: Base-Base interactions energy: -250.527 where: short stacking energy: -114.620 Base-Backbone interact. energy: -0.818 local terms energy: -120.643058 where: bonds (distance) C4'-P energy: -26.552 bonds (distance) P-C4' energy: -15.042 flat angles C4'-P-C4' energy: -24.705 flat angles P-C4'-P energy: -19.162 tors. eta vs tors. theta energy: -35.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -373.424729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.424729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.424729 (E_RNA) where: Base-Base interactions energy: -255.740 where: short stacking energy: -108.870 Base-Backbone interact. energy: -0.059 local terms energy: -117.626040 where: bonds (distance) C4'-P energy: -15.880 bonds (distance) P-C4' energy: -24.486 flat angles C4'-P-C4' energy: -21.955 flat angles P-C4'-P energy: -19.426 tors. eta vs tors. theta energy: -35.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -341.612445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.612445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.612445 (E_RNA) where: Base-Base interactions energy: -240.638 where: short stacking energy: -93.232 Base-Backbone interact. energy: -0.035 local terms energy: -100.939429 where: bonds (distance) C4'-P energy: -15.553 bonds (distance) P-C4' energy: -18.577 flat angles C4'-P-C4' energy: -22.567 flat angles P-C4'-P energy: -15.390 tors. eta vs tors. theta energy: -28.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -351.320242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.320242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.320242 (E_RNA) where: Base-Base interactions energy: -241.019 where: short stacking energy: -112.286 Base-Backbone interact. energy: -0.306 local terms energy: -109.995286 where: bonds (distance) C4'-P energy: -15.812 bonds (distance) P-C4' energy: -25.316 flat angles C4'-P-C4' energy: -26.577 flat angles P-C4'-P energy: -14.474 tors. eta vs tors. theta energy: -27.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -132.033219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.033219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.033219 (E_RNA) where: Base-Base interactions energy: -42.187 where: short stacking energy: -38.099 Base-Backbone interact. energy: 0.178 local terms energy: -90.023571 where: bonds (distance) C4'-P energy: -20.314 bonds (distance) P-C4' energy: -17.613 flat angles C4'-P-C4' energy: -24.699 flat angles P-C4'-P energy: -16.476 tors. eta vs tors. theta energy: -10.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -136.110499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.110499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.110499 (E_RNA) where: Base-Base interactions energy: -60.207 where: short stacking energy: -44.086 Base-Backbone interact. energy: -0.332 local terms energy: -75.571673 where: bonds (distance) C4'-P energy: -18.133 bonds (distance) P-C4' energy: -18.824 flat angles C4'-P-C4' energy: -17.844 flat angles P-C4'-P energy: -12.130 tors. eta vs tors. theta energy: -8.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -121.265621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.265621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.265621 (E_RNA) where: Base-Base interactions energy: -43.461 where: short stacking energy: -34.517 Base-Backbone interact. energy: 0.765 local terms energy: -78.569742 where: bonds (distance) C4'-P energy: -21.299 bonds (distance) P-C4' energy: -22.598 flat angles C4'-P-C4' energy: -20.459 flat angles P-C4'-P energy: -14.143 tors. eta vs tors. theta energy: -0.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -106.368224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.368224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.368224 (E_RNA) where: Base-Base interactions energy: -38.326 where: short stacking energy: -30.136 Base-Backbone interact. energy: -1.080 local terms energy: -66.962015 where: bonds (distance) C4'-P energy: -13.488 bonds (distance) P-C4' energy: -18.732 flat angles C4'-P-C4' energy: -18.210 flat angles P-C4'-P energy: -12.263 tors. eta vs tors. theta energy: -4.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -388.537357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.537357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.537357 (E_RNA) where: Base-Base interactions energy: -277.499 where: short stacking energy: -121.050 Base-Backbone interact. energy: -0.021 local terms energy: -111.017748 where: bonds (distance) C4'-P energy: -17.089 bonds (distance) P-C4' energy: -24.033 flat angles C4'-P-C4' energy: -24.421 flat angles P-C4'-P energy: -12.508 tors. eta vs tors. theta energy: -32.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -388.507129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.507129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.507129 (E_RNA) where: Base-Base interactions energy: -269.554 where: short stacking energy: -120.589 Base-Backbone interact. energy: -1.056 local terms energy: -117.897088 where: bonds (distance) C4'-P energy: -19.884 bonds (distance) P-C4' energy: -26.008 flat angles C4'-P-C4' energy: -24.340 flat angles P-C4'-P energy: -12.134 tors. eta vs tors. theta energy: -35.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -370.758243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.758243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.758243 (E_RNA) where: Base-Base interactions energy: -254.425 where: short stacking energy: -111.962 Base-Backbone interact. energy: -0.000 local terms energy: -116.332930 where: bonds (distance) C4'-P energy: -18.876 bonds (distance) P-C4' energy: -20.573 flat angles C4'-P-C4' energy: -27.856 flat angles P-C4'-P energy: -15.324 tors. eta vs tors. theta energy: -33.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -368.024879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.024879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.024879 (E_RNA) where: Base-Base interactions energy: -248.891 where: short stacking energy: -116.723 Base-Backbone interact. energy: -0.010 local terms energy: -119.123201 where: bonds (distance) C4'-P energy: -20.346 bonds (distance) P-C4' energy: -23.408 flat angles C4'-P-C4' energy: -24.769 flat angles P-C4'-P energy: -16.539 tors. eta vs tors. theta energy: -34.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -364.761531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.761531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.761531 (E_RNA) where: Base-Base interactions energy: -251.401 where: short stacking energy: -103.821 Base-Backbone interact. energy: -0.004 local terms energy: -113.356334 where: bonds (distance) C4'-P energy: -21.809 bonds (distance) P-C4' energy: -17.675 flat angles C4'-P-C4' energy: -24.354 flat angles P-C4'-P energy: -16.824 tors. eta vs tors. theta energy: -32.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -314.636277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.636277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.636277 (E_RNA) where: Base-Base interactions energy: -223.858 where: short stacking energy: -81.539 Base-Backbone interact. energy: -0.629 local terms energy: -90.148582 where: bonds (distance) C4'-P energy: -14.190 bonds (distance) P-C4' energy: -20.901 flat angles C4'-P-C4' energy: -22.920 flat angles P-C4'-P energy: -13.292 tors. eta vs tors. theta energy: -18.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -134.922826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.922826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.922826 (E_RNA) where: Base-Base interactions energy: -55.164 where: short stacking energy: -39.602 Base-Backbone interact. energy: -2.655 local terms energy: -77.103476 where: bonds (distance) C4'-P energy: -16.442 bonds (distance) P-C4' energy: -18.864 flat angles C4'-P-C4' energy: -18.438 flat angles P-C4'-P energy: -16.094 tors. eta vs tors. theta energy: -7.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -121.916889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.916889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.916889 (E_RNA) where: Base-Base interactions energy: -50.179 where: short stacking energy: -42.033 Base-Backbone interact. energy: -0.725 local terms energy: -71.013094 where: bonds (distance) C4'-P energy: -14.866 bonds (distance) P-C4' energy: -23.231 flat angles C4'-P-C4' energy: -15.710 flat angles P-C4'-P energy: -12.654 tors. eta vs tors. theta energy: -4.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -125.911278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.911278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.911278 (E_RNA) where: Base-Base interactions energy: -50.821 where: short stacking energy: -49.417 Base-Backbone interact. energy: -0.242 local terms energy: -74.847906 where: bonds (distance) C4'-P energy: -17.890 bonds (distance) P-C4' energy: -24.928 flat angles C4'-P-C4' energy: -19.251 flat angles P-C4'-P energy: -9.791 tors. eta vs tors. theta energy: -2.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -111.473361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.473361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.473361 (E_RNA) where: Base-Base interactions energy: -49.905 where: short stacking energy: -43.562 Base-Backbone interact. energy: 4.165 local terms energy: -65.733449 where: bonds (distance) C4'-P energy: -22.218 bonds (distance) P-C4' energy: -20.112 flat angles C4'-P-C4' energy: -13.209 flat angles P-C4'-P energy: -5.497 tors. eta vs tors. theta energy: -4.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -395.539876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.539876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.539876 (E_RNA) where: Base-Base interactions energy: -266.094 where: short stacking energy: -121.788 Base-Backbone interact. energy: -0.070 local terms energy: -129.374985 where: bonds (distance) C4'-P energy: -20.003 bonds (distance) P-C4' energy: -26.761 flat angles C4'-P-C4' energy: -25.241 flat angles P-C4'-P energy: -18.498 tors. eta vs tors. theta energy: -38.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -392.402372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.402372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.402372 (E_RNA) where: Base-Base interactions energy: -260.263 where: short stacking energy: -121.376 Base-Backbone interact. energy: -0.006 local terms energy: -132.132934 where: bonds (distance) C4'-P energy: -22.742 bonds (distance) P-C4' energy: -26.146 flat angles C4'-P-C4' energy: -24.160 flat angles P-C4'-P energy: -20.058 tors. eta vs tors. theta energy: -39.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -375.216958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.216958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.216958 (E_RNA) where: Base-Base interactions energy: -264.141 where: short stacking energy: -117.499 Base-Backbone interact. energy: -0.001 local terms energy: -111.074217 where: bonds (distance) C4'-P energy: -18.522 bonds (distance) P-C4' energy: -24.166 flat angles C4'-P-C4' energy: -21.735 flat angles P-C4'-P energy: -15.002 tors. eta vs tors. theta energy: -31.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -370.442711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.442711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.442711 (E_RNA) where: Base-Base interactions energy: -252.556 where: short stacking energy: -110.872 Base-Backbone interact. energy: -0.019 local terms energy: -117.867822 where: bonds (distance) C4'-P energy: -24.799 bonds (distance) P-C4' energy: -18.487 flat angles C4'-P-C4' energy: -25.027 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -32.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -351.762168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.762168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.762168 (E_RNA) where: Base-Base interactions energy: -245.014 where: short stacking energy: -105.106 Base-Backbone interact. energy: 1.269 local terms energy: -108.017084 where: bonds (distance) C4'-P energy: -17.307 bonds (distance) P-C4' energy: -19.989 flat angles C4'-P-C4' energy: -21.494 flat angles P-C4'-P energy: -18.242 tors. eta vs tors. theta energy: -30.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -312.859838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.859838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.859838 (E_RNA) where: Base-Base interactions energy: -205.394 where: short stacking energy: -89.731 Base-Backbone interact. energy: -0.010 local terms energy: -107.455989 where: bonds (distance) C4'-P energy: -22.622 bonds (distance) P-C4' energy: -13.861 flat angles C4'-P-C4' energy: -23.722 flat angles P-C4'-P energy: -17.798 tors. eta vs tors. theta energy: -29.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -136.625746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.625746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.625746 (E_RNA) where: Base-Base interactions energy: -58.911 where: short stacking energy: -38.197 Base-Backbone interact. energy: -0.265 local terms energy: -77.450357 where: bonds (distance) C4'-P energy: -17.659 bonds (distance) P-C4' energy: -20.225 flat angles C4'-P-C4' energy: -26.657 flat angles P-C4'-P energy: -9.980 tors. eta vs tors. theta energy: -2.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -128.855695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.855695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.855695 (E_RNA) where: Base-Base interactions energy: -47.848 where: short stacking energy: -37.998 Base-Backbone interact. energy: -0.242 local terms energy: -80.765864 where: bonds (distance) C4'-P energy: -22.653 bonds (distance) P-C4' energy: -25.369 flat angles C4'-P-C4' energy: -12.436 flat angles P-C4'-P energy: -14.489 tors. eta vs tors. theta energy: -5.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -108.297989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.297989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.297989 (E_RNA) where: Base-Base interactions energy: -36.571 where: short stacking energy: -34.321 Base-Backbone interact. energy: -0.610 local terms energy: -71.116101 where: bonds (distance) C4'-P energy: -22.693 bonds (distance) P-C4' energy: -20.429 flat angles C4'-P-C4' energy: -16.202 flat angles P-C4'-P energy: -13.107 tors. eta vs tors. theta energy: 1.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -112.648571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.648571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.648571 (E_RNA) where: Base-Base interactions energy: -47.217 where: short stacking energy: -44.859 Base-Backbone interact. energy: -0.321 local terms energy: -65.109951 where: bonds (distance) C4'-P energy: -22.255 bonds (distance) P-C4' energy: -14.279 flat angles C4'-P-C4' energy: -16.112 flat angles P-C4'-P energy: -9.367 tors. eta vs tors. theta energy: -3.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 7 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 3206810 moves confirmed later: 3512948 all moves confirmed: 6719758 percent of confirmed moves: 4.199849 current total energy: -364.592936 recalc. total energy: -364.592936 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 4376650 moves confirmed later: 4979587 all moves confirmed: 9356237 percent of confirmed moves: 5.847648 current total energy: -336.604420 recalc. total energy: -336.604420 replica 9 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 5340102 moves confirmed later: 6284803 all moves confirmed: 11624905 percent of confirmed moves: 7.265566 current total energy: -326.391544 recalc. total energy: -326.391544 replica 4 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 6225311 moves confirmed later: 7463584 all moves confirmed: 13688895 percent of confirmed moves: 8.555559 current total energy: -295.954831 recalc. total energy: -295.954831 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 3354684 moves confirmed later: 3708011 all moves confirmed: 7062695 percent of confirmed moves: 4.414184 current total energy: -295.128231 recalc. total energy: -295.128231 replica 5 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 3771049 moves confirmed later: 4236223 all moves confirmed: 8007272 percent of confirmed moves: 5.004545 current total energy: -275.332962 recalc. total energy: -275.332962 replica 1 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 6177948 moves confirmed later: 7304423 all moves confirmed: 13482371 percent of confirmed moves: 8.426482 current total energy: -56.597214 recalc. total energy: -56.597214 replica 6 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 7927782 moves confirmed later: 9663791 all moves confirmed: 17591573 percent of confirmed moves: 10.994733 current total energy: -66.017618 recalc. total energy: -66.017618 replica 10 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 8052561 moves confirmed later: 9840166 all moves confirmed: 17892727 percent of confirmed moves: 11.182954 current total energy: -66.523193 recalc. total energy: -66.523193 replica 8 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 7501546 moves confirmed later: 9105174 all moves confirmed: 16606720 percent of confirmed moves: 10.379200 current total energy: -92.412308 recalc. total energy: -92.412308 out arg RESULTS//1/Tetraloop_10_steps-35829ef4_01 Time of doing 1600000 iterations: 757.444 seconds