SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-78de5341/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) out arg RESULTS//1/T1_TA_timPR-78de5341_01 ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -942.424679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.424679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.931780 (E_RNA) where: Base-Base interactions energy: -704.766 where: short stacking energy: -338.686 Base-Backbone interact. energy: 5.542 local terms energy: -395.708044 where: bonds (distance) C4'-P energy: -90.120 bonds (distance) P-C4' energy: -86.553 flat angles C4'-P-C4' energy: -88.315 flat angles P-C4'-P energy: -48.216 tors. eta vs tors. theta energy: -82.504 Dist. restrs. and SS energy: 115.757 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -763.911097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.911097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.378765 (E_RNA) where: Base-Base interactions energy: -562.606 where: short stacking energy: -283.418 Base-Backbone interact. energy: -0.911 local terms energy: -367.862668 where: bonds (distance) C4'-P energy: -85.767 bonds (distance) P-C4' energy: -90.552 flat angles C4'-P-C4' energy: -87.733 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -67.317 Dist. restrs. and SS energy: 130.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1021.759205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.759205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.096235 (E_RNA) where: Base-Base interactions energy: -744.113 where: short stacking energy: -321.431 Base-Backbone interact. energy: -1.122 local terms energy: -382.860745 where: bonds (distance) C4'-P energy: -82.968 bonds (distance) P-C4' energy: -84.277 flat angles C4'-P-C4' energy: -86.296 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -74.252 Dist. restrs. and SS energy: 69.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1143.816791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.816791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.011950 (E_RNA) where: Base-Base interactions energy: -849.288 where: short stacking energy: -362.345 Base-Backbone interact. energy: 0.467 local terms energy: -376.190629 where: bonds (distance) C4'-P energy: -75.970 bonds (distance) P-C4' energy: -80.390 flat angles C4'-P-C4' energy: -92.523 flat angles P-C4'-P energy: -48.293 tors. eta vs tors. theta energy: -79.014 Dist. restrs. and SS energy: 44.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -959.406718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.406718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.573247 (E_RNA) where: Base-Base interactions energy: -701.170 where: short stacking energy: -292.773 Base-Backbone interact. energy: -0.611 local terms energy: -357.792064 where: bonds (distance) C4'-P energy: -82.004 bonds (distance) P-C4' energy: -86.498 flat angles C4'-P-C4' energy: -75.058 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -65.999 Dist. restrs. and SS energy: 63.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -830.519889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.519889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.588220 (E_RNA) where: Base-Base interactions energy: -587.651 where: short stacking energy: -250.886 Base-Backbone interact. energy: 0.146 local terms energy: -343.083926 where: bonds (distance) C4'-P energy: -78.035 bonds (distance) P-C4' energy: -85.640 flat angles C4'-P-C4' energy: -67.732 flat angles P-C4'-P energy: -56.409 tors. eta vs tors. theta energy: -55.268 Dist. restrs. and SS energy: 63.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -795.384900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.384900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.979442 (E_RNA) where: Base-Base interactions energy: -622.390 where: short stacking energy: -281.645 Base-Backbone interact. energy: -1.915 local terms energy: -321.673884 where: bonds (distance) C4'-P energy: -70.826 bonds (distance) P-C4' energy: -83.034 flat angles C4'-P-C4' energy: -78.020 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -66.254 Dist. restrs. and SS energy: 113.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -806.874339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.874339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.366854 (E_RNA) where: Base-Base interactions energy: -617.485 where: short stacking energy: -250.218 Base-Backbone interact. energy: 1.181 local terms energy: -298.063707 where: bonds (distance) C4'-P energy: -74.177 bonds (distance) P-C4' energy: -65.043 flat angles C4'-P-C4' energy: -56.925 flat angles P-C4'-P energy: -51.683 tors. eta vs tors. theta energy: -50.235 Dist. restrs. and SS energy: 70.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -789.982367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.982367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.006648 (E_RNA) where: Base-Base interactions energy: -567.006 where: short stacking energy: -252.460 Base-Backbone interact. energy: -1.564 local terms energy: -305.436563 where: bonds (distance) C4'-P energy: -81.847 bonds (distance) P-C4' energy: -79.212 flat angles C4'-P-C4' energy: -57.190 flat angles P-C4'-P energy: -35.753 tors. eta vs tors. theta energy: -51.435 Dist. restrs. and SS energy: 47.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -812.038704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.038704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.122381 (E_RNA) where: Base-Base interactions energy: -582.071 where: short stacking energy: -238.267 Base-Backbone interact. energy: -1.819 local terms energy: -313.232753 where: bonds (distance) C4'-P energy: -60.002 bonds (distance) P-C4' energy: -73.807 flat angles C4'-P-C4' energy: -78.279 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -54.962 Dist. restrs. and SS energy: 48.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1129.355488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.355488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.459639 (E_RNA) where: Base-Base interactions energy: -786.230 where: short stacking energy: -348.679 Base-Backbone interact. energy: -3.708 local terms energy: -425.521660 where: bonds (distance) C4'-P energy: -87.818 bonds (distance) P-C4' energy: -90.185 flat angles C4'-P-C4' energy: -100.426 flat angles P-C4'-P energy: -58.988 tors. eta vs tors. theta energy: -88.104 Dist. restrs. and SS energy: 49.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1244.623799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.623799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.297907 (E_RNA) where: Base-Base interactions energy: -926.094 where: short stacking energy: -369.587 Base-Backbone interact. energy: -1.506 local terms energy: -385.697836 where: bonds (distance) C4'-P energy: -79.202 bonds (distance) P-C4' energy: -96.117 flat angles C4'-P-C4' energy: -84.255 flat angles P-C4'-P energy: -53.278 tors. eta vs tors. theta energy: -72.846 Dist. restrs. and SS energy: 31.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1085.898049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.898049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.290618 (E_RNA) where: Base-Base interactions energy: -802.171 where: short stacking energy: -307.823 Base-Backbone interact. energy: -0.534 local terms energy: -351.585368 where: bonds (distance) C4'-P energy: -95.110 bonds (distance) P-C4' energy: -82.809 flat angles C4'-P-C4' energy: -72.719 flat angles P-C4'-P energy: -33.219 tors. eta vs tors. theta energy: -67.729 Dist. restrs. and SS energy: 31.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1267.613586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.613586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.267954 (E_RNA) where: Base-Base interactions energy: -918.549 where: short stacking energy: -370.349 Base-Backbone interact. energy: -1.073 local terms energy: -409.645336 where: bonds (distance) C4'-P energy: -85.424 bonds (distance) P-C4' energy: -85.051 flat angles C4'-P-C4' energy: -84.280 flat angles P-C4'-P energy: -61.472 tors. eta vs tors. theta energy: -93.418 Dist. restrs. and SS energy: 24.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1083.635692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.635692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.357267 (E_RNA) where: Base-Base interactions energy: -772.514 where: short stacking energy: -304.507 Base-Backbone interact. energy: -2.664 local terms energy: -380.179430 where: bonds (distance) C4'-P energy: -71.586 bonds (distance) P-C4' energy: -88.324 flat angles C4'-P-C4' energy: -96.097 flat angles P-C4'-P energy: -60.416 tors. eta vs tors. theta energy: -63.757 Dist. restrs. and SS energy: 34.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1107.821370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.821370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.974861 (E_RNA) where: Base-Base interactions energy: -802.661 where: short stacking energy: -328.185 Base-Backbone interact. energy: 0.747 local terms energy: -369.060462 where: bonds (distance) C4'-P energy: -91.292 bonds (distance) P-C4' energy: -70.932 flat angles C4'-P-C4' energy: -70.089 flat angles P-C4'-P energy: -50.974 tors. eta vs tors. theta energy: -85.773 Dist. restrs. and SS energy: 26.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -994.966860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.966860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.779293 (E_RNA) where: Base-Base interactions energy: -734.511 where: short stacking energy: -317.206 Base-Backbone interact. energy: -2.520 local terms energy: -324.748238 where: bonds (distance) C4'-P energy: -67.528 bonds (distance) P-C4' energy: -69.939 flat angles C4'-P-C4' energy: -72.363 flat angles P-C4'-P energy: -51.615 tors. eta vs tors. theta energy: -63.304 Dist. restrs. and SS energy: 30.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -1011.085545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.085545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.905474 (E_RNA) where: Base-Base interactions energy: -728.884 where: short stacking energy: -312.450 Base-Backbone interact. energy: -2.702 local terms energy: -352.319042 where: bonds (distance) C4'-P energy: -83.261 bonds (distance) P-C4' energy: -67.498 flat angles C4'-P-C4' energy: -74.617 flat angles P-C4'-P energy: -39.230 tors. eta vs tors. theta energy: -87.713 Dist. restrs. and SS energy: 36.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -1067.847790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.847790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.267662 (E_RNA) where: Base-Base interactions energy: -767.980 where: short stacking energy: -308.442 Base-Backbone interact. energy: -0.543 local terms energy: -355.744554 where: bonds (distance) C4'-P energy: -77.627 bonds (distance) P-C4' energy: -75.262 flat angles C4'-P-C4' energy: -83.580 flat angles P-C4'-P energy: -45.903 tors. eta vs tors. theta energy: -73.372 Dist. restrs. and SS energy: 19.670 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -1045.009204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.009204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.410720 (E_RNA) where: Base-Base interactions energy: -790.563 where: short stacking energy: -316.334 Base-Backbone interact. energy: 2.538 local terms energy: -317.385466 where: bonds (distance) C4'-P energy: -68.369 bonds (distance) P-C4' energy: -73.964 flat angles C4'-P-C4' energy: -79.185 flat angles P-C4'-P energy: -25.419 tors. eta vs tors. theta energy: -70.448 Dist. restrs. and SS energy: 23.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1347.051083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.051083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.271850 (E_RNA) where: Base-Base interactions energy: -986.947 where: short stacking energy: -387.352 Base-Backbone interact. energy: -0.507 local terms energy: -413.816937 where: bonds (distance) C4'-P energy: -83.226 bonds (distance) P-C4' energy: -88.371 flat angles C4'-P-C4' energy: -94.322 flat angles P-C4'-P energy: -53.740 tors. eta vs tors. theta energy: -94.158 Dist. restrs. and SS energy: 17.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1209.523942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.523942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.465513 (E_RNA) where: Base-Base interactions energy: -843.849 where: short stacking energy: -377.675 Base-Backbone interact. energy: -1.548 local terms energy: -436.068369 where: bonds (distance) C4'-P energy: -88.227 bonds (distance) P-C4' energy: -89.560 flat angles C4'-P-C4' energy: -102.532 flat angles P-C4'-P energy: -55.216 tors. eta vs tors. theta energy: -100.534 Dist. restrs. and SS energy: 35.192 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1370.553453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.553453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.581177 (E_RNA) where: Base-Base interactions energy: -973.328 where: short stacking energy: -388.387 Base-Backbone interact. energy: -2.116 local terms energy: -452.137318 where: bonds (distance) C4'-P energy: -80.434 bonds (distance) P-C4' energy: -92.977 flat angles C4'-P-C4' energy: -100.482 flat angles P-C4'-P energy: -69.382 tors. eta vs tors. theta energy: -108.862 Dist. restrs. and SS energy: 20.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1103.824086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.824086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.472670 (E_RNA) where: Base-Base interactions energy: -792.721 where: short stacking energy: -320.390 Base-Backbone interact. energy: -2.250 local terms energy: -378.501781 where: bonds (distance) C4'-P energy: -77.136 bonds (distance) P-C4' energy: -98.065 flat angles C4'-P-C4' energy: -89.233 flat angles P-C4'-P energy: -46.747 tors. eta vs tors. theta energy: -67.321 Dist. restrs. and SS energy: 32.899 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1243.871903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.871903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.961408 (E_RNA) where: Base-Base interactions energy: -891.049 where: short stacking energy: -387.307 Base-Backbone interact. energy: -2.163 local terms energy: -407.749222 where: bonds (distance) C4'-P energy: -90.988 bonds (distance) P-C4' energy: -78.893 flat angles C4'-P-C4' energy: -90.801 flat angles P-C4'-P energy: -41.631 tors. eta vs tors. theta energy: -105.435 Dist. restrs. and SS energy: 20.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1192.948983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.948983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.758237 (E_RNA) where: Base-Base interactions energy: -844.279 where: short stacking energy: -361.757 Base-Backbone interact. energy: -2.808 local terms energy: -408.671753 where: bonds (distance) C4'-P energy: -76.742 bonds (distance) P-C4' energy: -93.264 flat angles C4'-P-C4' energy: -102.612 flat angles P-C4'-P energy: -55.839 tors. eta vs tors. theta energy: -80.215 Dist. restrs. and SS energy: 26.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1216.469215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.469215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.010711 (E_RNA) where: Base-Base interactions energy: -889.287 where: short stacking energy: -356.056 Base-Backbone interact. energy: -2.219 local terms energy: -378.504930 where: bonds (distance) C4'-P energy: -75.338 bonds (distance) P-C4' energy: -77.543 flat angles C4'-P-C4' energy: -78.005 flat angles P-C4'-P energy: -55.364 tors. eta vs tors. theta energy: -92.255 Dist. restrs. and SS energy: 16.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -1041.869784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.869784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.500359 (E_RNA) where: Base-Base interactions energy: -745.862 where: short stacking energy: -296.047 Base-Backbone interact. energy: -1.593 local terms energy: -357.045374 where: bonds (distance) C4'-P energy: -84.750 bonds (distance) P-C4' energy: -78.296 flat angles C4'-P-C4' energy: -69.616 flat angles P-C4'-P energy: -51.551 tors. eta vs tors. theta energy: -72.832 Dist. restrs. and SS energy: 25.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -1095.605784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.605784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.698022 (E_RNA) where: Base-Base interactions energy: -796.773 where: short stacking energy: -317.881 Base-Backbone interact. energy: -0.925 local terms energy: -346.999894 where: bonds (distance) C4'-P energy: -59.685 bonds (distance) P-C4' energy: -78.205 flat angles C4'-P-C4' energy: -79.163 flat angles P-C4'-P energy: -49.865 tors. eta vs tors. theta energy: -80.082 Dist. restrs. and SS energy: 12.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -1089.475397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.475397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.353035 (E_RNA) where: Base-Base interactions energy: -810.029 where: short stacking energy: -319.482 Base-Backbone interact. energy: -0.185 local terms energy: -337.139091 where: bonds (distance) C4'-P energy: -65.739 bonds (distance) P-C4' energy: -81.419 flat angles C4'-P-C4' energy: -74.662 flat angles P-C4'-P energy: -42.215 tors. eta vs tors. theta energy: -73.104 Dist. restrs. and SS energy: 21.128 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1357.656277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.656277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.157143 (E_RNA) where: Base-Base interactions energy: -984.693 where: short stacking energy: -387.273 Base-Backbone interact. energy: -0.002 local terms energy: -425.462174 where: bonds (distance) C4'-P energy: -87.839 bonds (distance) P-C4' energy: -94.610 flat angles C4'-P-C4' energy: -93.162 flat angles P-C4'-P energy: -61.353 tors. eta vs tors. theta energy: -88.498 Dist. restrs. and SS energy: 15.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1451.638909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.638909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.840530 (E_RNA) where: Base-Base interactions energy: -1056.744 where: short stacking energy: -442.516 Base-Backbone interact. energy: -0.920 local terms energy: -450.176303 where: bonds (distance) C4'-P energy: -89.850 bonds (distance) P-C4' energy: -100.405 flat angles C4'-P-C4' energy: -100.433 flat angles P-C4'-P energy: -55.443 tors. eta vs tors. theta energy: -104.044 Dist. restrs. and SS energy: 19.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1273.285412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.285412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.902101 (E_RNA) where: Base-Base interactions energy: -939.203 where: short stacking energy: -379.302 Base-Backbone interact. energy: 0.639 local terms energy: -397.338434 where: bonds (distance) C4'-P energy: -76.695 bonds (distance) P-C4' energy: -81.457 flat angles C4'-P-C4' energy: -94.513 flat angles P-C4'-P energy: -52.637 tors. eta vs tors. theta energy: -92.036 Dist. restrs. and SS energy: 25.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1371.476655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.476655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.961701 (E_RNA) where: Base-Base interactions energy: -986.258 where: short stacking energy: -418.472 Base-Backbone interact. energy: -2.538 local terms energy: -433.165234 where: bonds (distance) C4'-P energy: -86.976 bonds (distance) P-C4' energy: -81.603 flat angles C4'-P-C4' energy: -88.527 flat angles P-C4'-P energy: -65.088 tors. eta vs tors. theta energy: -110.971 Dist. restrs. and SS energy: 13.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1115.609361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.609361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.244300 (E_RNA) where: Base-Base interactions energy: -809.004 where: short stacking energy: -329.841 Base-Backbone interact. energy: -2.195 local terms energy: -374.045558 where: bonds (distance) C4'-P energy: -82.698 bonds (distance) P-C4' energy: -90.429 flat angles C4'-P-C4' energy: -73.558 flat angles P-C4'-P energy: -59.441 tors. eta vs tors. theta energy: -67.919 Dist. restrs. and SS energy: 32.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1262.049828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.049828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.168939 (E_RNA) where: Base-Base interactions energy: -913.232 where: short stacking energy: -370.837 Base-Backbone interact. energy: 0.173 local terms energy: -401.109236 where: bonds (distance) C4'-P energy: -83.877 bonds (distance) P-C4' energy: -85.134 flat angles C4'-P-C4' energy: -89.316 flat angles P-C4'-P energy: -47.727 tors. eta vs tors. theta energy: -95.055 Dist. restrs. and SS energy: 15.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1217.173064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.173064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.988643 (E_RNA) where: Base-Base interactions energy: -883.734 where: short stacking energy: -385.585 Base-Backbone interact. energy: 0.876 local terms energy: -387.130361 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -83.038 flat angles C4'-P-C4' energy: -71.770 flat angles P-C4'-P energy: -51.467 tors. eta vs tors. theta energy: -101.773 Dist. restrs. and SS energy: 16.066 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -1189.569476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.569476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.182841 (E_RNA) where: Base-Base interactions energy: -850.757 where: short stacking energy: -329.102 Base-Backbone interact. energy: 0.811 local terms energy: -393.236799 where: bonds (distance) C4'-P energy: -72.220 bonds (distance) P-C4' energy: -82.691 flat angles C4'-P-C4' energy: -92.560 flat angles P-C4'-P energy: -65.142 tors. eta vs tors. theta energy: -80.624 Dist. restrs. and SS energy: 16.863 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -1082.194123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.194123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.138895 (E_RNA) where: Base-Base interactions energy: -796.072 where: short stacking energy: -321.149 Base-Backbone interact. energy: 4.698 local terms energy: -344.764713 where: bonds (distance) C4'-P energy: -65.221 bonds (distance) P-C4' energy: -85.861 flat angles C4'-P-C4' energy: -74.504 flat angles P-C4'-P energy: -46.596 tors. eta vs tors. theta energy: -72.582 Dist. restrs. and SS energy: 17.195 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -1109.915918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.915918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.773958 (E_RNA) where: Base-Base interactions energy: -829.059 where: short stacking energy: -333.880 Base-Backbone interact. energy: -0.139 local terms energy: -337.575876 where: bonds (distance) C4'-P energy: -65.296 bonds (distance) P-C4' energy: -71.878 flat angles C4'-P-C4' energy: -77.691 flat angles P-C4'-P energy: -53.002 tors. eta vs tors. theta energy: -69.709 Dist. restrs. and SS energy: 20.108 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1505.527453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.527453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.729259 (E_RNA) where: Base-Base interactions energy: -1088.661 where: short stacking energy: -456.628 Base-Backbone interact. energy: -2.082 local terms energy: -468.986101 where: bonds (distance) C4'-P energy: -88.112 bonds (distance) P-C4' energy: -94.814 flat angles C4'-P-C4' energy: -100.469 flat angles P-C4'-P energy: -66.625 tors. eta vs tors. theta energy: -118.966 Dist. restrs. and SS energy: 17.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1334.248255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.248255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.000669 (E_RNA) where: Base-Base interactions energy: -970.658 where: short stacking energy: -400.077 Base-Backbone interact. energy: -0.577 local terms energy: -420.765116 where: bonds (distance) C4'-P energy: -81.507 bonds (distance) P-C4' energy: -92.728 flat angles C4'-P-C4' energy: -99.258 flat angles P-C4'-P energy: -49.297 tors. eta vs tors. theta energy: -97.975 Dist. restrs. and SS energy: 21.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1424.869628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.869628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.064842 (E_RNA) where: Base-Base interactions energy: -1008.538 where: short stacking energy: -399.820 Base-Backbone interact. energy: -2.810 local terms energy: -466.717130 where: bonds (distance) C4'-P energy: -96.589 bonds (distance) P-C4' energy: -99.161 flat angles C4'-P-C4' energy: -97.882 flat angles P-C4'-P energy: -64.686 tors. eta vs tors. theta energy: -108.399 Dist. restrs. and SS energy: 16.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1342.340279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.340279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.861030 (E_RNA) where: Base-Base interactions energy: -979.104 where: short stacking energy: -423.868 Base-Backbone interact. energy: -2.489 local terms energy: -417.268018 where: bonds (distance) C4'-P energy: -81.163 bonds (distance) P-C4' energy: -83.883 flat angles C4'-P-C4' energy: -93.812 flat angles P-C4'-P energy: -59.318 tors. eta vs tors. theta energy: -99.091 Dist. restrs. and SS energy: 19.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1345.738365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.738365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.476946 (E_RNA) where: Base-Base interactions energy: -981.247 where: short stacking energy: -389.143 Base-Backbone interact. energy: -0.245 local terms energy: -414.985598 where: bonds (distance) C4'-P energy: -77.985 bonds (distance) P-C4' energy: -82.198 flat angles C4'-P-C4' energy: -86.785 flat angles P-C4'-P energy: -57.520 tors. eta vs tors. theta energy: -110.498 Dist. restrs. and SS energy: 13.989 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1125.843648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.843648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.674795 (E_RNA) where: Base-Base interactions energy: -835.620 where: short stacking energy: -343.761 Base-Backbone interact. energy: -2.096 local terms energy: -338.958552 where: bonds (distance) C4'-P energy: -56.587 bonds (distance) P-C4' energy: -84.064 flat angles C4'-P-C4' energy: -65.287 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -77.953 Dist. restrs. and SS energy: 14.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1334.628822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.628822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.809022 (E_RNA) where: Base-Base interactions energy: -965.949 where: short stacking energy: -401.222 Base-Backbone interact. energy: -1.089 local terms energy: -412.770956 where: bonds (distance) C4'-P energy: -72.822 bonds (distance) P-C4' energy: -80.153 flat angles C4'-P-C4' energy: -91.962 flat angles P-C4'-P energy: -55.707 tors. eta vs tors. theta energy: -112.127 Dist. restrs. and SS energy: 8.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -1235.149164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.149164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.157653 (E_RNA) where: Base-Base interactions energy: -910.160 where: short stacking energy: -358.031 Base-Backbone interact. energy: -0.991 local terms energy: -370.005889 where: bonds (distance) C4'-P energy: -72.461 bonds (distance) P-C4' energy: -72.855 flat angles C4'-P-C4' energy: -79.107 flat angles P-C4'-P energy: -58.558 tors. eta vs tors. theta energy: -87.025 Dist. restrs. and SS energy: 9.258 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -1203.559887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.559887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.120554 (E_RNA) where: Base-Base interactions energy: -882.137 where: short stacking energy: -361.188 Base-Backbone interact. energy: -1.640 local terms energy: -367.343686 where: bonds (distance) C4'-P energy: -81.478 bonds (distance) P-C4' energy: -82.066 flat angles C4'-P-C4' energy: -77.527 flat angles P-C4'-P energy: -46.436 tors. eta vs tors. theta energy: -79.837 Dist. restrs. and SS energy: 10.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -1081.115892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.115892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.438304 (E_RNA) where: Base-Base interactions energy: -827.203 where: short stacking energy: -321.599 Base-Backbone interact. energy: 1.528 local terms energy: -300.763763 where: bonds (distance) C4'-P energy: -81.081 bonds (distance) P-C4' energy: -60.705 flat angles C4'-P-C4' energy: -62.052 flat angles P-C4'-P energy: -25.254 tors. eta vs tors. theta energy: -71.671 Dist. restrs. and SS energy: 8.572 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1537.666990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.666990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.606365 (E_RNA) where: Base-Base interactions energy: -1113.049 where: short stacking energy: -447.734 Base-Backbone interact. energy: -3.023 local terms energy: -474.534038 where: bonds (distance) C4'-P energy: -90.843 bonds (distance) P-C4' energy: -99.533 flat angles C4'-P-C4' energy: -94.591 flat angles P-C4'-P energy: -64.112 tors. eta vs tors. theta energy: -125.455 Dist. restrs. and SS energy: 16.189 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1462.532908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.532908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.755528 (E_RNA) where: Base-Base interactions energy: -1059.682 where: short stacking energy: -439.710 Base-Backbone interact. energy: -0.623 local terms energy: -458.450196 where: bonds (distance) C4'-P energy: -92.916 bonds (distance) P-C4' energy: -80.357 flat angles C4'-P-C4' energy: -98.795 flat angles P-C4'-P energy: -70.823 tors. eta vs tors. theta energy: -115.559 Dist. restrs. and SS energy: 19.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1315.978057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.978057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.763391 (E_RNA) where: Base-Base interactions energy: -970.080 where: short stacking energy: -393.956 Base-Backbone interact. energy: -3.035 local terms energy: -403.648609 where: bonds (distance) C4'-P energy: -80.754 bonds (distance) P-C4' energy: -83.484 flat angles C4'-P-C4' energy: -90.051 flat angles P-C4'-P energy: -54.622 tors. eta vs tors. theta energy: -94.738 Dist. restrs. and SS energy: 24.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1451.065134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.065134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.541643 (E_RNA) where: Base-Base interactions energy: -1054.003 where: short stacking energy: -414.130 Base-Backbone interact. energy: -2.764 local terms energy: -439.774584 where: bonds (distance) C4'-P energy: -83.971 bonds (distance) P-C4' energy: -96.141 flat angles C4'-P-C4' energy: -89.371 flat angles P-C4'-P energy: -59.719 tors. eta vs tors. theta energy: -110.573 Dist. restrs. and SS energy: 8.727 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1352.182042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.182042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.325947 (E_RNA) where: Base-Base interactions energy: -998.377 where: short stacking energy: -423.655 Base-Backbone interact. energy: 0.604 local terms energy: -401.552866 where: bonds (distance) C4'-P energy: -78.652 bonds (distance) P-C4' energy: -80.948 flat angles C4'-P-C4' energy: -82.917 flat angles P-C4'-P energy: -56.682 tors. eta vs tors. theta energy: -102.354 Dist. restrs. and SS energy: 10.394 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1384.287461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.287461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.412122 (E_RNA) where: Base-Base interactions energy: -1000.248 where: short stacking energy: -418.933 Base-Backbone interact. energy: -1.708 local terms energy: -424.456242 where: bonds (distance) C4'-P energy: -78.113 bonds (distance) P-C4' energy: -82.018 flat angles C4'-P-C4' energy: -84.131 flat angles P-C4'-P energy: -61.451 tors. eta vs tors. theta energy: -118.744 Dist. restrs. and SS energy: 5.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1180.029782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.029782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.802402 (E_RNA) where: Base-Base interactions energy: -859.202 where: short stacking energy: -346.844 Base-Backbone interact. energy: 2.954 local terms energy: -374.553675 where: bonds (distance) C4'-P energy: -77.640 bonds (distance) P-C4' energy: -81.480 flat angles C4'-P-C4' energy: -79.477 flat angles P-C4'-P energy: -49.770 tors. eta vs tors. theta energy: -86.187 Dist. restrs. and SS energy: 14.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -1282.383106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.383106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.707730 (E_RNA) where: Base-Base interactions energy: -927.122 where: short stacking energy: -375.701 Base-Backbone interact. energy: -1.456 local terms energy: -394.128890 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -79.865 flat angles C4'-P-C4' energy: -83.468 flat angles P-C4'-P energy: -50.112 tors. eta vs tors. theta energy: -97.263 Dist. restrs. and SS energy: 3.575 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -1221.353085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.353085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.338441 (E_RNA) where: Base-Base interactions energy: -932.925 where: short stacking energy: -364.684 Base-Backbone interact. energy: 7.121 local terms energy: -337.534203 where: bonds (distance) C4'-P energy: -72.431 bonds (distance) P-C4' energy: -77.091 flat angles C4'-P-C4' energy: -68.638 flat angles P-C4'-P energy: -34.172 tors. eta vs tors. theta energy: -85.202 Dist. restrs. and SS energy: 5.235 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -1086.912746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.912746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.464906 (E_RNA) where: Base-Base interactions energy: -782.511 where: short stacking energy: -325.627 Base-Backbone interact. energy: 0.369 local terms energy: -350.322752 where: bonds (distance) C4'-P energy: -53.594 bonds (distance) P-C4' energy: -85.278 flat angles C4'-P-C4' energy: -89.837 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: -91.060 Dist. restrs. and SS energy: 8.802 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1507.996927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.996927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.808394 (E_RNA) where: Base-Base interactions energy: -1087.516 where: short stacking energy: -462.586 Base-Backbone interact. energy: 0.896 local terms energy: -475.188154 where: bonds (distance) C4'-P energy: -97.974 bonds (distance) P-C4' energy: -83.069 flat angles C4'-P-C4' energy: -100.789 flat angles P-C4'-P energy: -62.456 tors. eta vs tors. theta energy: -130.901 Dist. restrs. and SS energy: 17.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1489.594345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.594345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.976261 (E_RNA) where: Base-Base interactions energy: -1068.107 where: short stacking energy: -439.790 Base-Backbone interact. energy: -1.060 local terms energy: -478.809262 where: bonds (distance) C4'-P energy: -103.420 bonds (distance) P-C4' energy: -92.352 flat angles C4'-P-C4' energy: -88.851 flat angles P-C4'-P energy: -77.718 tors. eta vs tors. theta energy: -116.468 Dist. restrs. and SS energy: 21.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1472.228664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.228664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.024235 (E_RNA) where: Base-Base interactions energy: -1086.477 where: short stacking energy: -450.476 Base-Backbone interact. energy: -1.060 local terms energy: -436.486665 where: bonds (distance) C4'-P energy: -72.713 bonds (distance) P-C4' energy: -92.466 flat angles C4'-P-C4' energy: -98.078 flat angles P-C4'-P energy: -57.890 tors. eta vs tors. theta energy: -115.339 Dist. restrs. and SS energy: 15.046 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1300.553942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.553942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.577940 (E_RNA) where: Base-Base interactions energy: -973.700 where: short stacking energy: -401.827 Base-Backbone interact. energy: -2.003 local terms energy: -387.875062 where: bonds (distance) C4'-P energy: -71.263 bonds (distance) P-C4' energy: -78.572 flat angles C4'-P-C4' energy: -90.172 flat angles P-C4'-P energy: -54.270 tors. eta vs tors. theta energy: -93.598 Dist. restrs. and SS energy: 26.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1388.757015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.757015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.666554 (E_RNA) where: Base-Base interactions energy: -1019.137 where: short stacking energy: -392.637 Base-Backbone interact. energy: -1.477 local terms energy: -410.052745 where: bonds (distance) C4'-P energy: -70.000 bonds (distance) P-C4' energy: -84.121 flat angles C4'-P-C4' energy: -90.687 flat angles P-C4'-P energy: -58.040 tors. eta vs tors. theta energy: -107.205 Dist. restrs. and SS energy: 5.160 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1409.760934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.760934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.538522 (E_RNA) where: Base-Base interactions energy: -1039.301 where: short stacking energy: -425.183 Base-Backbone interact. energy: -1.127 local terms energy: -407.110291 where: bonds (distance) C4'-P energy: -66.503 bonds (distance) P-C4' energy: -75.221 flat angles C4'-P-C4' energy: -99.357 flat angles P-C4'-P energy: -55.012 tors. eta vs tors. theta energy: -111.018 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1424.630485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.630485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.358249 (E_RNA) where: Base-Base interactions energy: -1030.379 where: short stacking energy: -436.071 Base-Backbone interact. energy: -2.953 local terms energy: -430.026256 where: bonds (distance) C4'-P energy: -77.577 bonds (distance) P-C4' energy: -69.911 flat angles C4'-P-C4' energy: -95.325 flat angles P-C4'-P energy: -58.496 tors. eta vs tors. theta energy: -128.717 Dist. restrs. and SS energy: 1.978 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1214.079299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.079299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.280232 (E_RNA) where: Base-Base interactions energy: -881.416 where: short stacking energy: -357.920 Base-Backbone interact. energy: 1.074 local terms energy: -383.938677 where: bonds (distance) C4'-P energy: -73.312 bonds (distance) P-C4' energy: -72.682 flat angles C4'-P-C4' energy: -85.408 flat angles P-C4'-P energy: -60.909 tors. eta vs tors. theta energy: -91.628 Dist. restrs. and SS energy: 13.451 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -1300.021047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.021047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.761100 (E_RNA) where: Base-Base interactions energy: -977.219 where: short stacking energy: -400.593 Base-Backbone interact. energy: 5.409 local terms energy: -366.951618 where: bonds (distance) C4'-P energy: -74.975 bonds (distance) P-C4' energy: -68.370 flat angles C4'-P-C4' energy: -81.090 flat angles P-C4'-P energy: -49.332 tors. eta vs tors. theta energy: -93.184 Dist. restrs. and SS energy: 1.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -1091.135097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.135097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.605616 (E_RNA) where: Base-Base interactions energy: -813.674 where: short stacking energy: -327.688 Base-Backbone interact. energy: -0.782 local terms energy: -339.149282 where: bonds (distance) C4'-P energy: -67.163 bonds (distance) P-C4' energy: -68.249 flat angles C4'-P-C4' energy: -75.245 flat angles P-C4'-P energy: -51.040 tors. eta vs tors. theta energy: -77.452 Dist. restrs. and SS energy: 25.721 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1540.497711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.497711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.167604 (E_RNA) where: Base-Base interactions energy: -1123.976 where: short stacking energy: -444.091 Base-Backbone interact. energy: -2.596 local terms energy: -462.595136 where: bonds (distance) C4'-P energy: -87.596 bonds (distance) P-C4' energy: -92.566 flat angles C4'-P-C4' energy: -97.932 flat angles P-C4'-P energy: -65.042 tors. eta vs tors. theta energy: -119.459 Dist. restrs. and SS energy: 11.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1536.706413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.706413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.250012 (E_RNA) where: Base-Base interactions energy: -1114.981 where: short stacking energy: -456.049 Base-Backbone interact. energy: -3.285 local terms energy: -463.984149 where: bonds (distance) C4'-P energy: -86.682 bonds (distance) P-C4' energy: -90.276 flat angles C4'-P-C4' energy: -105.589 flat angles P-C4'-P energy: -60.366 tors. eta vs tors. theta energy: -121.071 Dist. restrs. and SS energy: 8.794 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1485.658732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.658732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.220139 (E_RNA) where: Base-Base interactions energy: -1078.608 where: short stacking energy: -460.407 Base-Backbone interact. energy: -0.746 local terms energy: -456.866721 where: bonds (distance) C4'-P energy: -78.541 bonds (distance) P-C4' energy: -83.773 flat angles C4'-P-C4' energy: -99.562 flat angles P-C4'-P energy: -67.655 tors. eta vs tors. theta energy: -127.336 Dist. restrs. and SS energy: 13.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1446.522501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.522501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.746606 (E_RNA) where: Base-Base interactions energy: -1053.088 where: short stacking energy: -437.837 Base-Backbone interact. energy: -1.564 local terms energy: -434.094798 where: bonds (distance) C4'-P energy: -82.548 bonds (distance) P-C4' energy: -83.580 flat angles C4'-P-C4' energy: -96.145 flat angles P-C4'-P energy: -55.686 tors. eta vs tors. theta energy: -116.135 Dist. restrs. and SS energy: 5.474 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1294.758493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.758493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.223049 (E_RNA) where: Base-Base interactions energy: -921.981 where: short stacking energy: -383.820 Base-Backbone interact. energy: 2.250 local terms energy: -432.492490 where: bonds (distance) C4'-P energy: -83.921 bonds (distance) P-C4' energy: -78.220 flat angles C4'-P-C4' energy: -95.602 flat angles P-C4'-P energy: -68.838 tors. eta vs tors. theta energy: -105.912 Dist. restrs. and SS energy: 20.715 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1449.153864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.153864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.991316 (E_RNA) where: Base-Base interactions energy: -1040.482 where: short stacking energy: -429.725 Base-Backbone interact. energy: -0.020 local terms energy: -446.489468 where: bonds (distance) C4'-P energy: -80.400 bonds (distance) P-C4' energy: -82.777 flat angles C4'-P-C4' energy: -89.218 flat angles P-C4'-P energy: -65.975 tors. eta vs tors. theta energy: -128.120 Dist. restrs. and SS energy: 1.087 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1379.999910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.999910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.900621 (E_RNA) where: Base-Base interactions energy: -1038.602 where: short stacking energy: -413.903 Base-Backbone interact. energy: 0.301 local terms energy: -380.600398 where: bonds (distance) C4'-P energy: -71.186 bonds (distance) P-C4' energy: -82.125 flat angles C4'-P-C4' energy: -71.914 flat angles P-C4'-P energy: -52.347 tors. eta vs tors. theta energy: -103.028 Dist. restrs. and SS energy: 2.151 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1391.762361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.762361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.315368 (E_RNA) where: Base-Base interactions energy: -1042.100 where: short stacking energy: -408.509 Base-Backbone interact. energy: 3.444 local terms energy: -391.659879 where: bonds (distance) C4'-P energy: -80.251 bonds (distance) P-C4' energy: -70.567 flat angles C4'-P-C4' energy: -75.504 flat angles P-C4'-P energy: -63.355 tors. eta vs tors. theta energy: -101.984 Dist. restrs. and SS energy: 1.803 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -1236.587223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.587223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.661992 (E_RNA) where: Base-Base interactions energy: -897.590 where: short stacking energy: -356.502 Base-Backbone interact. energy: -0.405 local terms energy: -384.667142 where: bonds (distance) C4'-P energy: -73.365 bonds (distance) P-C4' energy: -80.422 flat angles C4'-P-C4' energy: -75.980 flat angles P-C4'-P energy: -63.321 tors. eta vs tors. theta energy: -91.580 Dist. restrs. and SS energy: 9.325 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -1127.709314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.709314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.069230 (E_RNA) where: Base-Base interactions energy: -824.093 where: short stacking energy: -312.546 Base-Backbone interact. energy: 3.147 local terms energy: -352.122327 where: bonds (distance) C4'-P energy: -75.323 bonds (distance) P-C4' energy: -78.905 flat angles C4'-P-C4' energy: -67.825 flat angles P-C4'-P energy: -56.030 tors. eta vs tors. theta energy: -74.038 Dist. restrs. and SS energy: 8.610 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1623.289544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.289544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.711344 (E_RNA) where: Base-Base interactions energy: -1184.380 where: short stacking energy: -486.615 Base-Backbone interact. energy: -1.428 local terms energy: -480.903634 where: bonds (distance) C4'-P energy: -99.373 bonds (distance) P-C4' energy: -93.362 flat angles C4'-P-C4' energy: -106.817 flat angles P-C4'-P energy: -63.004 tors. eta vs tors. theta energy: -118.348 Dist. restrs. and SS energy: 6.672 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1571.136116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.136116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1618.720912 (E_RNA) where: Base-Base interactions energy: -1135.876 where: short stacking energy: -452.904 Base-Backbone interact. energy: -1.369 local terms energy: -481.475582 where: bonds (distance) C4'-P energy: -92.943 bonds (distance) P-C4' energy: -90.782 flat angles C4'-P-C4' energy: -99.554 flat angles P-C4'-P energy: -67.662 tors. eta vs tors. theta energy: -130.535 Dist. restrs. and SS energy: 10.835 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1514.577492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.577492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.402631 (E_RNA) where: Base-Base interactions energy: -1088.940 where: short stacking energy: -469.723 Base-Backbone interact. energy: 5.574 local terms energy: -473.036406 where: bonds (distance) C4'-P energy: -95.608 bonds (distance) P-C4' energy: -81.687 flat angles C4'-P-C4' energy: -98.366 flat angles P-C4'-P energy: -68.219 tors. eta vs tors. theta energy: -129.157 Dist. restrs. and SS energy: 5.075 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1460.626311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.626311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.407563 (E_RNA) where: Base-Base interactions energy: -1060.474 where: short stacking energy: -443.151 Base-Backbone interact. energy: -2.974 local terms energy: -444.959328 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -90.813 flat angles C4'-P-C4' energy: -95.023 flat angles P-C4'-P energy: -62.309 tors. eta vs tors. theta energy: -113.393 Dist. restrs. and SS energy: 11.031 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1505.025091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.025091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.153491 (E_RNA) where: Base-Base interactions energy: -1108.048 where: short stacking energy: -448.780 Base-Backbone interact. energy: -1.916 local terms energy: -433.189279 where: bonds (distance) C4'-P energy: -76.830 bonds (distance) P-C4' energy: -81.669 flat angles C4'-P-C4' energy: -81.913 flat angles P-C4'-P energy: -68.572 tors. eta vs tors. theta energy: -124.206 Dist. restrs. and SS energy: 1.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1353.818515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.818515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.715369 (E_RNA) where: Base-Base interactions energy: -985.365 where: short stacking energy: -399.494 Base-Backbone interact. energy: -1.441 local terms energy: -416.909277 where: bonds (distance) C4'-P energy: -95.118 bonds (distance) P-C4' energy: -85.520 flat angles C4'-P-C4' energy: -89.811 flat angles P-C4'-P energy: -51.605 tors. eta vs tors. theta energy: -94.856 Dist. restrs. and SS energy: 13.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1398.250160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.250160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.303060 (E_RNA) where: Base-Base interactions energy: -1026.818 where: short stacking energy: -406.862 Base-Backbone interact. energy: -0.885 local terms energy: -408.600072 where: bonds (distance) C4'-P energy: -69.157 bonds (distance) P-C4' energy: -74.258 flat angles C4'-P-C4' energy: -89.730 flat angles P-C4'-P energy: -71.721 tors. eta vs tors. theta energy: -103.734 Dist. restrs. and SS energy: 1.303 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -1370.510624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.510624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.330973 (E_RNA) where: Base-Base interactions energy: -1010.429 where: short stacking energy: -419.201 Base-Backbone interact. energy: -1.328 local terms energy: -397.574270 where: bonds (distance) C4'-P energy: -75.758 bonds (distance) P-C4' energy: -86.384 flat angles C4'-P-C4' energy: -70.045 flat angles P-C4'-P energy: -55.291 tors. eta vs tors. theta energy: -110.096 Dist. restrs. and SS energy: 2.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1242.627764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.627764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.940678 (E_RNA) where: Base-Base interactions energy: -897.355 where: short stacking energy: -369.438 Base-Backbone interact. energy: -4.616 local terms energy: -396.969617 where: bonds (distance) C4'-P energy: -71.475 bonds (distance) P-C4' energy: -74.749 flat angles C4'-P-C4' energy: -104.673 flat angles P-C4'-P energy: -57.885 tors. eta vs tors. theta energy: -88.188 Dist. restrs. and SS energy: 19.563 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -1173.412895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.412895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.303923 (E_RNA) where: Base-Base interactions energy: -882.633 where: short stacking energy: -349.146 Base-Backbone interact. energy: -1.607 local terms energy: -334.063943 where: bonds (distance) C4'-P energy: -68.614 bonds (distance) P-C4' energy: -65.480 flat angles C4'-P-C4' energy: -61.988 flat angles P-C4'-P energy: -51.847 tors. eta vs tors. theta energy: -86.134 Dist. restrs. and SS energy: 8.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1620.912799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.912799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.634573 (E_RNA) where: Base-Base interactions energy: -1177.820 where: short stacking energy: -475.263 Base-Backbone interact. energy: -1.035 local terms energy: -485.780268 where: bonds (distance) C4'-P energy: -92.705 bonds (distance) P-C4' energy: -96.975 flat angles C4'-P-C4' energy: -105.831 flat angles P-C4'-P energy: -68.584 tors. eta vs tors. theta energy: -121.685 Dist. restrs. and SS energy: 6.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1555.467292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.467292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.076102 (E_RNA) where: Base-Base interactions energy: -1127.829 where: short stacking energy: -476.240 Base-Backbone interact. energy: 1.251 local terms energy: -474.497536 where: bonds (distance) C4'-P energy: -78.716 bonds (distance) P-C4' energy: -88.853 flat angles C4'-P-C4' energy: -104.987 flat angles P-C4'-P energy: -65.412 tors. eta vs tors. theta energy: -136.529 Dist. restrs. and SS energy: 8.859 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1512.448938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.448938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.641702 (E_RNA) where: Base-Base interactions energy: -1105.293 where: short stacking energy: -458.987 Base-Backbone interact. energy: -1.534 local terms energy: -443.815268 where: bonds (distance) C4'-P energy: -87.107 bonds (distance) P-C4' energy: -94.675 flat angles C4'-P-C4' energy: -92.959 flat angles P-C4'-P energy: -59.621 tors. eta vs tors. theta energy: -109.453 Dist. restrs. and SS energy: 1.443 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1567.435920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.435920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.051154 (E_RNA) where: Base-Base interactions energy: -1151.587 where: short stacking energy: -472.193 Base-Backbone interact. energy: 5.693 local terms energy: -459.157212 where: bonds (distance) C4'-P energy: -87.862 bonds (distance) P-C4' energy: -87.770 flat angles C4'-P-C4' energy: -99.698 flat angles P-C4'-P energy: -56.365 tors. eta vs tors. theta energy: -127.463 Dist. restrs. and SS energy: 0.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1438.981135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.981135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.618737 (E_RNA) where: Base-Base interactions energy: -1041.422 where: short stacking energy: -423.554 Base-Backbone interact. energy: -1.289 local terms energy: -443.906982 where: bonds (distance) C4'-P energy: -80.814 bonds (distance) P-C4' energy: -77.053 flat angles C4'-P-C4' energy: -94.012 flat angles P-C4'-P energy: -70.385 tors. eta vs tors. theta energy: -121.644 Dist. restrs. and SS energy: 10.888 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1488.518987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.518987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.308747 (E_RNA) where: Base-Base interactions energy: -1113.430 where: short stacking energy: -441.688 Base-Backbone interact. energy: -1.384 local terms energy: -411.494573 where: bonds (distance) C4'-P energy: -81.304 bonds (distance) P-C4' energy: -84.700 flat angles C4'-P-C4' energy: -77.448 flat angles P-C4'-P energy: -55.741 tors. eta vs tors. theta energy: -112.302 Dist. restrs. and SS energy: 1.040 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1344.233789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.233789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.183643 (E_RNA) where: Base-Base interactions energy: -1009.047 where: short stacking energy: -402.492 Base-Backbone interact. energy: -1.672 local terms energy: -381.464656 where: bonds (distance) C4'-P energy: -63.245 bonds (distance) P-C4' energy: -67.698 flat angles C4'-P-C4' energy: -85.142 flat angles P-C4'-P energy: -59.246 tors. eta vs tors. theta energy: -106.134 Dist. restrs. and SS energy: 11.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1359.937773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.937773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.572665 (E_RNA) where: Base-Base interactions energy: -1001.231 where: short stacking energy: -396.230 Base-Backbone interact. energy: -0.742 local terms energy: -397.599353 where: bonds (distance) C4'-P energy: -73.592 bonds (distance) P-C4' energy: -69.787 flat angles C4'-P-C4' energy: -93.028 flat angles P-C4'-P energy: -50.102 tors. eta vs tors. theta energy: -111.091 Dist. restrs. and SS energy: 2.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1246.882609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.882609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.963777 (E_RNA) where: Base-Base interactions energy: -950.575 where: short stacking energy: -386.086 Base-Backbone interact. energy: 4.060 local terms energy: -356.448043 where: bonds (distance) C4'-P energy: -64.465 bonds (distance) P-C4' energy: -71.305 flat angles C4'-P-C4' energy: -73.520 flat angles P-C4'-P energy: -48.428 tors. eta vs tors. theta energy: -98.730 Dist. restrs. and SS energy: 19.331 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -1177.012807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.012807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.252827 (E_RNA) where: Base-Base interactions energy: -888.556 where: short stacking energy: -354.810 Base-Backbone interact. energy: -1.364 local terms energy: -333.333137 where: bonds (distance) C4'-P energy: -60.667 bonds (distance) P-C4' energy: -64.829 flat angles C4'-P-C4' energy: -68.931 flat angles P-C4'-P energy: -51.206 tors. eta vs tors. theta energy: -87.700 Dist. restrs. and SS energy: 9.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1603.690396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.690396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.826704 (E_RNA) where: Base-Base interactions energy: -1139.815 where: short stacking energy: -480.098 Base-Backbone interact. energy: -1.173 local terms energy: -503.838605 where: bonds (distance) C4'-P energy: -97.505 bonds (distance) P-C4' energy: -103.281 flat angles C4'-P-C4' energy: -110.808 flat angles P-C4'-P energy: -68.759 tors. eta vs tors. theta energy: -123.486 Dist. restrs. and SS energy: 4.386 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1549.149809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.149809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.942276 (E_RNA) where: Base-Base interactions energy: -1121.966 where: short stacking energy: -450.852 Base-Backbone interact. energy: -1.104 local terms energy: -470.872624 where: bonds (distance) C4'-P energy: -90.560 bonds (distance) P-C4' energy: -88.569 flat angles C4'-P-C4' energy: -93.045 flat angles P-C4'-P energy: -67.833 tors. eta vs tors. theta energy: -130.865 Dist. restrs. and SS energy: 8.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1605.215496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.215496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.014527 (E_RNA) where: Base-Base interactions energy: -1162.644 where: short stacking energy: -481.248 Base-Backbone interact. energy: 0.317 local terms energy: -481.688031 where: bonds (distance) C4'-P energy: -82.900 bonds (distance) P-C4' energy: -96.338 flat angles C4'-P-C4' energy: -105.090 flat angles P-C4'-P energy: -63.583 tors. eta vs tors. theta energy: -133.777 Dist. restrs. and SS energy: 2.049 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1498.744952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1498.744952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.860848 (E_RNA) where: Base-Base interactions energy: -1057.292 where: short stacking energy: -456.490 Base-Backbone interact. energy: -1.574 local terms energy: -477.994544 where: bonds (distance) C4'-P energy: -95.191 bonds (distance) P-C4' energy: -97.974 flat angles C4'-P-C4' energy: -95.502 flat angles P-C4'-P energy: -61.121 tors. eta vs tors. theta energy: -128.206 Dist. restrs. and SS energy: 1.366 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1510.025187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.025187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.477463 (E_RNA) where: Base-Base interactions energy: -1084.749 where: short stacking energy: -448.552 Base-Backbone interact. energy: -2.597 local terms energy: -461.131889 where: bonds (distance) C4'-P energy: -87.982 bonds (distance) P-C4' energy: -84.192 flat angles C4'-P-C4' energy: -107.724 flat angles P-C4'-P energy: -61.290 tors. eta vs tors. theta energy: -119.943 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1381.127182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.127182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.671678 (E_RNA) where: Base-Base interactions energy: -1011.434 where: short stacking energy: -413.315 Base-Backbone interact. energy: 1.723 local terms energy: -415.961052 where: bonds (distance) C4'-P energy: -66.402 bonds (distance) P-C4' energy: -83.612 flat angles C4'-P-C4' energy: -100.557 flat angles P-C4'-P energy: -58.592 tors. eta vs tors. theta energy: -106.798 Dist. restrs. and SS energy: 7.794 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1300.001367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.001367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.586856 (E_RNA) where: Base-Base interactions energy: -927.718 where: short stacking energy: -372.687 Base-Backbone interact. energy: -0.739 local terms energy: -420.130186 where: bonds (distance) C4'-P energy: -72.066 bonds (distance) P-C4' energy: -82.376 flat angles C4'-P-C4' energy: -101.691 flat angles P-C4'-P energy: -64.617 tors. eta vs tors. theta energy: -99.380 Dist. restrs. and SS energy: 11.835 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1385.165826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.165826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.143788 (E_RNA) where: Base-Base interactions energy: -1027.667 where: short stacking energy: -421.576 Base-Backbone interact. energy: -0.506 local terms energy: -394.971203 where: bonds (distance) C4'-P energy: -58.081 bonds (distance) P-C4' energy: -68.485 flat angles C4'-P-C4' energy: -87.714 flat angles P-C4'-P energy: -64.874 tors. eta vs tors. theta energy: -115.818 Dist. restrs. and SS energy: 1.228 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1290.429491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.429491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.591822 (E_RNA) where: Base-Base interactions energy: -949.683 where: short stacking energy: -365.751 Base-Backbone interact. energy: 0.958 local terms energy: -387.866824 where: bonds (distance) C4'-P energy: -76.030 bonds (distance) P-C4' energy: -69.434 flat angles C4'-P-C4' energy: -89.896 flat angles P-C4'-P energy: -55.729 tors. eta vs tors. theta energy: -96.779 Dist. restrs. and SS energy: 9.412 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -1193.689486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.689486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.412464 (E_RNA) where: Base-Base interactions energy: -875.365 where: short stacking energy: -346.936 Base-Backbone interact. energy: 1.709 local terms energy: -365.756933 where: bonds (distance) C4'-P energy: -77.757 bonds (distance) P-C4' energy: -73.153 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -41.756 tors. eta vs tors. theta energy: -90.475 Dist. restrs. and SS energy: 8.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1618.146842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.146842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.405873 (E_RNA) where: Base-Base interactions energy: -1166.948 where: short stacking energy: -483.830 Base-Backbone interact. energy: -3.068 local terms energy: -489.389860 where: bonds (distance) C4'-P energy: -89.293 bonds (distance) P-C4' energy: -94.348 flat angles C4'-P-C4' energy: -96.590 flat angles P-C4'-P energy: -82.938 tors. eta vs tors. theta energy: -126.221 Dist. restrs. and SS energy: 4.509 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1588.561063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.561063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.626254 (E_RNA) where: Base-Base interactions energy: -1150.368 where: short stacking energy: -454.352 Base-Backbone interact. energy: -0.552 local terms energy: -478.707120 where: bonds (distance) C4'-P energy: -90.427 bonds (distance) P-C4' energy: -88.062 flat angles C4'-P-C4' energy: -100.037 flat angles P-C4'-P energy: -72.910 tors. eta vs tors. theta energy: -127.271 Dist. restrs. and SS energy: 4.315 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1594.988684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.988684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.835356 (E_RNA) where: Base-Base interactions energy: -1151.357 where: short stacking energy: -479.089 Base-Backbone interact. energy: -1.213 local terms energy: -480.265518 where: bonds (distance) C4'-P energy: -99.245 bonds (distance) P-C4' energy: -75.795 flat angles C4'-P-C4' energy: -102.940 flat angles P-C4'-P energy: -70.668 tors. eta vs tors. theta energy: -131.618 Dist. restrs. and SS energy: 1.097 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1530.129846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.129846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.901708 (E_RNA) where: Base-Base interactions energy: -1109.434 where: short stacking energy: -466.400 Base-Backbone interact. energy: -1.640 local terms energy: -456.827208 where: bonds (distance) C4'-P energy: -87.969 bonds (distance) P-C4' energy: -90.618 flat angles C4'-P-C4' energy: -99.108 flat angles P-C4'-P energy: -55.191 tors. eta vs tors. theta energy: -123.941 Dist. restrs. and SS energy: 1.022 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1454.502827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.502827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.962185 (E_RNA) where: Base-Base interactions energy: -1065.336 where: short stacking energy: -445.288 Base-Backbone interact. energy: -0.608 local terms energy: -427.018645 where: bonds (distance) C4'-P energy: -80.112 bonds (distance) P-C4' energy: -85.879 flat angles C4'-P-C4' energy: -102.839 flat angles P-C4'-P energy: -47.582 tors. eta vs tors. theta energy: -110.607 Dist. restrs. and SS energy: 1.709 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1398.226342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.226342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.942615 (E_RNA) where: Base-Base interactions energy: -1003.036 where: short stacking energy: -405.203 Base-Backbone interact. energy: -2.843 local terms energy: -440.063025 where: bonds (distance) C4'-P energy: -91.732 bonds (distance) P-C4' energy: -82.382 flat angles C4'-P-C4' energy: -92.978 flat angles P-C4'-P energy: -59.394 tors. eta vs tors. theta energy: -113.577 Dist. restrs. and SS energy: 10.966 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1339.860293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.860293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.188533 (E_RNA) where: Base-Base interactions energy: -984.537 where: short stacking energy: -396.168 Base-Backbone interact. energy: -2.343 local terms energy: -408.308674 where: bonds (distance) C4'-P energy: -65.022 bonds (distance) P-C4' energy: -84.549 flat angles C4'-P-C4' energy: -89.941 flat angles P-C4'-P energy: -60.120 tors. eta vs tors. theta energy: -108.676 Dist. restrs. and SS energy: 18.578 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1400.261104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.261104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.137817 (E_RNA) where: Base-Base interactions energy: -1031.005 where: short stacking energy: -413.156 Base-Backbone interact. energy: -2.589 local terms energy: -405.544659 where: bonds (distance) C4'-P energy: -64.194 bonds (distance) P-C4' energy: -75.523 flat angles C4'-P-C4' energy: -92.115 flat angles P-C4'-P energy: -62.079 tors. eta vs tors. theta energy: -111.634 Dist. restrs. and SS energy: 2.127 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1252.698058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.698058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.842811 (E_RNA) where: Base-Base interactions energy: -927.668 where: short stacking energy: -382.514 Base-Backbone interact. energy: -0.901 local terms energy: -371.274394 where: bonds (distance) C4'-P energy: -62.483 bonds (distance) P-C4' energy: -78.681 flat angles C4'-P-C4' energy: -83.620 flat angles P-C4'-P energy: -52.042 tors. eta vs tors. theta energy: -94.448 Dist. restrs. and SS energy: 10.395 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -1206.503655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.503655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.574000 (E_RNA) where: Base-Base interactions energy: -881.259 where: short stacking energy: -340.323 Base-Backbone interact. energy: -3.363 local terms energy: -368.951387 where: bonds (distance) C4'-P energy: -72.685 bonds (distance) P-C4' energy: -78.127 flat angles C4'-P-C4' energy: -74.842 flat angles P-C4'-P energy: -53.672 tors. eta vs tors. theta energy: -89.626 Dist. restrs. and SS energy: 10.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1602.624444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.624444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.806097 (E_RNA) where: Base-Base interactions energy: -1141.294 where: short stacking energy: -472.613 Base-Backbone interact. energy: -1.589 local terms energy: -501.922649 where: bonds (distance) C4'-P energy: -98.745 bonds (distance) P-C4' energy: -96.402 flat angles C4'-P-C4' energy: -100.597 flat angles P-C4'-P energy: -63.390 tors. eta vs tors. theta energy: -142.790 Dist. restrs. and SS energy: 5.432 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1570.466033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.466033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.661722 (E_RNA) where: Base-Base interactions energy: -1132.151 where: short stacking energy: -450.309 Base-Backbone interact. energy: -1.380 local terms energy: -477.130330 where: bonds (distance) C4'-P energy: -85.692 bonds (distance) P-C4' energy: -86.762 flat angles C4'-P-C4' energy: -101.220 flat angles P-C4'-P energy: -71.880 tors. eta vs tors. theta energy: -131.576 Dist. restrs. and SS energy: 3.446 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1570.415923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.415923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.058097 (E_RNA) where: Base-Base interactions energy: -1141.452 where: short stacking energy: -478.587 Base-Backbone interact. energy: -1.398 local terms energy: -466.207827 where: bonds (distance) C4'-P energy: -91.524 bonds (distance) P-C4' energy: -82.290 flat angles C4'-P-C4' energy: -102.342 flat angles P-C4'-P energy: -64.451 tors. eta vs tors. theta energy: -125.600 Dist. restrs. and SS energy: 1.892 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1527.953298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.953298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.864407 (E_RNA) where: Base-Base interactions energy: -1104.672 where: short stacking energy: -463.867 Base-Backbone interact. energy: -3.274 local terms energy: -457.918670 where: bonds (distance) C4'-P energy: -91.091 bonds (distance) P-C4' energy: -77.891 flat angles C4'-P-C4' energy: -100.235 flat angles P-C4'-P energy: -54.695 tors. eta vs tors. theta energy: -134.006 Dist. restrs. and SS energy: 1.161 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1454.062287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.062287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.435690 (E_RNA) where: Base-Base interactions energy: -1058.155 where: short stacking energy: -445.502 Base-Backbone interact. energy: -0.981 local terms energy: -439.299517 where: bonds (distance) C4'-P energy: -85.698 bonds (distance) P-C4' energy: -85.931 flat angles C4'-P-C4' energy: -93.151 flat angles P-C4'-P energy: -56.253 tors. eta vs tors. theta energy: -118.267 Dist. restrs. and SS energy: 7.623 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1400.160744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.160744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.818142 (E_RNA) where: Base-Base interactions energy: -1016.302 where: short stacking energy: -394.126 Base-Backbone interact. energy: -2.240 local terms energy: -419.276334 where: bonds (distance) C4'-P energy: -83.387 bonds (distance) P-C4' energy: -80.376 flat angles C4'-P-C4' energy: -93.718 flat angles P-C4'-P energy: -57.002 tors. eta vs tors. theta energy: -104.795 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1419.709529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.709529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.623653 (E_RNA) where: Base-Base interactions energy: -1047.687 where: short stacking energy: -439.296 Base-Backbone interact. energy: -1.002 local terms energy: -408.935167 where: bonds (distance) C4'-P energy: -83.938 bonds (distance) P-C4' energy: -64.965 flat angles C4'-P-C4' energy: -85.277 flat angles P-C4'-P energy: -57.723 tors. eta vs tors. theta energy: -117.032 Dist. restrs. and SS energy: 1.164 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1260.997172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.997172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.366202 (E_RNA) where: Base-Base interactions energy: -912.993 where: short stacking energy: -378.876 Base-Backbone interact. energy: 1.332 local terms energy: -400.705336 where: bonds (distance) C4'-P energy: -68.987 bonds (distance) P-C4' energy: -67.446 flat angles C4'-P-C4' energy: -94.885 flat angles P-C4'-P energy: -64.409 tors. eta vs tors. theta energy: -104.978 Dist. restrs. and SS energy: 14.619 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1350.165850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.165850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.870317 (E_RNA) where: Base-Base interactions energy: -987.645 where: short stacking energy: -388.107 Base-Backbone interact. energy: -1.840 local terms energy: -399.385165 where: bonds (distance) C4'-P energy: -78.112 bonds (distance) P-C4' energy: -64.290 flat angles C4'-P-C4' energy: -79.621 flat angles P-C4'-P energy: -62.913 tors. eta vs tors. theta energy: -114.448 Dist. restrs. and SS energy: 1.954 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -1241.122997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.122997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.830105 (E_RNA) where: Base-Base interactions energy: -927.522 where: short stacking energy: -376.971 Base-Backbone interact. energy: -0.182 local terms energy: -363.126768 where: bonds (distance) C4'-P energy: -71.695 bonds (distance) P-C4' energy: -86.164 flat angles C4'-P-C4' energy: -72.468 flat angles P-C4'-P energy: -54.809 tors. eta vs tors. theta energy: -77.991 Dist. restrs. and SS energy: 12.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1617.247267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.247267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.927951 (E_RNA) where: Base-Base interactions energy: -1174.364 where: short stacking energy: -488.856 Base-Backbone interact. energy: -0.576 local terms energy: -481.988073 where: bonds (distance) C4'-P energy: -93.989 bonds (distance) P-C4' energy: -95.903 flat angles C4'-P-C4' energy: -99.743 flat angles P-C4'-P energy: -66.034 tors. eta vs tors. theta energy: -126.320 Dist. restrs. and SS energy: 2.931 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1617.403954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.403954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.840326 (E_RNA) where: Base-Base interactions energy: -1159.456 where: short stacking energy: -514.396 Base-Backbone interact. energy: 2.539 local terms energy: -497.923616 where: bonds (distance) C4'-P energy: -85.025 bonds (distance) P-C4' energy: -91.948 flat angles C4'-P-C4' energy: -104.705 flat angles P-C4'-P energy: -75.601 tors. eta vs tors. theta energy: -140.645 Dist. restrs. and SS energy: 0.686 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1605.728194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.728194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.883533 (E_RNA) where: Base-Base interactions energy: -1155.230 where: short stacking energy: -486.914 Base-Backbone interact. energy: 1.816 local terms energy: -493.469147 where: bonds (distance) C4'-P energy: -94.488 bonds (distance) P-C4' energy: -93.339 flat angles C4'-P-C4' energy: -95.131 flat angles P-C4'-P energy: -69.232 tors. eta vs tors. theta energy: -141.280 Dist. restrs. and SS energy: 4.405 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1600.691377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.691377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.761844 (E_RNA) where: Base-Base interactions energy: -1163.572 where: short stacking energy: -489.827 Base-Backbone interact. energy: -2.631 local terms energy: -472.558661 where: bonds (distance) C4'-P energy: -75.771 bonds (distance) P-C4' energy: -89.314 flat angles C4'-P-C4' energy: -103.022 flat angles P-C4'-P energy: -69.900 tors. eta vs tors. theta energy: -134.551 Dist. restrs. and SS energy: 1.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1461.450164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.450164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.421139 (E_RNA) where: Base-Base interactions energy: -1052.458 where: short stacking energy: -438.015 Base-Backbone interact. energy: 0.152 local terms energy: -457.115126 where: bonds (distance) C4'-P energy: -80.663 bonds (distance) P-C4' energy: -77.892 flat angles C4'-P-C4' energy: -96.505 flat angles P-C4'-P energy: -73.609 tors. eta vs tors. theta energy: -128.445 Dist. restrs. and SS energy: 11.221 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1452.164875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.164875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.330945 (E_RNA) where: Base-Base interactions energy: -1074.522 where: short stacking energy: -457.743 Base-Backbone interact. energy: -0.702 local terms energy: -415.107134 where: bonds (distance) C4'-P energy: -71.491 bonds (distance) P-C4' energy: -77.581 flat angles C4'-P-C4' energy: -81.477 flat angles P-C4'-P energy: -58.498 tors. eta vs tors. theta energy: -126.061 Dist. restrs. and SS energy: 1.416 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1410.938511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.938511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.816491 (E_RNA) where: Base-Base interactions energy: -1035.758 where: short stacking energy: -413.914 Base-Backbone interact. energy: 1.233 local terms energy: -415.290970 where: bonds (distance) C4'-P energy: -89.234 bonds (distance) P-C4' energy: -81.577 flat angles C4'-P-C4' energy: -81.208 flat angles P-C4'-P energy: -59.206 tors. eta vs tors. theta energy: -104.066 Dist. restrs. and SS energy: 2.128 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1383.586994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.586994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.543618 (E_RNA) where: Base-Base interactions energy: -1035.552 where: short stacking energy: -435.347 Base-Backbone interact. energy: -1.926 local terms energy: -384.065949 where: bonds (distance) C4'-P energy: -70.218 bonds (distance) P-C4' energy: -62.529 flat angles C4'-P-C4' energy: -80.664 flat angles P-C4'-P energy: -61.106 tors. eta vs tors. theta energy: -109.549 Dist. restrs. and SS energy: 1.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1336.197230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.197230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.534589 (E_RNA) where: Base-Base interactions energy: -991.744 where: short stacking energy: -408.827 Base-Backbone interact. energy: -0.132 local terms energy: -387.658299 where: bonds (distance) C4'-P energy: -73.553 bonds (distance) P-C4' energy: -70.688 flat angles C4'-P-C4' energy: -86.535 flat angles P-C4'-P energy: -37.410 tors. eta vs tors. theta energy: -119.473 Dist. restrs. and SS energy: 6.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -1244.692763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.692763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.796720 (E_RNA) where: Base-Base interactions energy: -941.098 where: short stacking energy: -383.088 Base-Backbone interact. energy: 0.109 local terms energy: -351.808372 where: bonds (distance) C4'-P energy: -62.193 bonds (distance) P-C4' energy: -66.965 flat angles C4'-P-C4' energy: -68.504 flat angles P-C4'-P energy: -50.329 tors. eta vs tors. theta energy: -103.818 Dist. restrs. and SS energy: 11.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1597.994188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.994188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.673055 (E_RNA) where: Base-Base interactions energy: -1152.566 where: short stacking energy: -495.555 Base-Backbone interact. energy: -1.467 local terms energy: -484.639451 where: bonds (distance) C4'-P energy: -93.279 bonds (distance) P-C4' energy: -86.548 flat angles C4'-P-C4' energy: -106.955 flat angles P-C4'-P energy: -63.915 tors. eta vs tors. theta energy: -133.942 Dist. restrs. and SS energy: 3.929 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1610.100954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.100954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.693222 (E_RNA) where: Base-Base interactions energy: -1165.338 where: short stacking energy: -492.914 Base-Backbone interact. energy: -1.874 local terms energy: -480.480731 where: bonds (distance) C4'-P energy: -94.046 bonds (distance) P-C4' energy: -88.695 flat angles C4'-P-C4' energy: -97.909 flat angles P-C4'-P energy: -69.305 tors. eta vs tors. theta energy: -130.525 Dist. restrs. and SS energy: 0.842 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1593.398741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.398741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.637948 (E_RNA) where: Base-Base interactions energy: -1154.117 where: short stacking energy: -477.013 Base-Backbone interact. energy: -0.712 local terms energy: -479.808159 where: bonds (distance) C4'-P energy: -82.314 bonds (distance) P-C4' energy: -87.200 flat angles C4'-P-C4' energy: -97.485 flat angles P-C4'-P energy: -76.191 tors. eta vs tors. theta energy: -136.618 Dist. restrs. and SS energy: 4.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1587.331844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.331844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.915074 (E_RNA) where: Base-Base interactions energy: -1160.840 where: short stacking energy: -481.786 Base-Backbone interact. energy: -0.741 local terms energy: -463.334590 where: bonds (distance) C4'-P energy: -88.356 bonds (distance) P-C4' energy: -86.811 flat angles C4'-P-C4' energy: -102.908 flat angles P-C4'-P energy: -49.061 tors. eta vs tors. theta energy: -136.199 Dist. restrs. and SS energy: 0.833 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1502.708293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.708293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.121427 (E_RNA) where: Base-Base interactions energy: -1101.798 where: short stacking energy: -461.380 Base-Backbone interact. energy: -1.521 local terms energy: -437.802872 where: bonds (distance) C4'-P energy: -69.008 bonds (distance) P-C4' energy: -90.014 flat angles C4'-P-C4' energy: -93.709 flat angles P-C4'-P energy: -54.157 tors. eta vs tors. theta energy: -130.916 Dist. restrs. and SS energy: 1.663 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1437.101018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.101018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.385382 (E_RNA) where: Base-Base interactions energy: -1060.462 where: short stacking energy: -435.158 Base-Backbone interact. energy: -0.087 local terms energy: -421.836573 where: bonds (distance) C4'-P energy: -76.277 bonds (distance) P-C4' energy: -79.342 flat angles C4'-P-C4' energy: -92.878 flat angles P-C4'-P energy: -56.593 tors. eta vs tors. theta energy: -116.746 Dist. restrs. and SS energy: 8.534 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1378.867094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.867094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.156945 (E_RNA) where: Base-Base interactions energy: -998.706 where: short stacking energy: -407.750 Base-Backbone interact. energy: -2.536 local terms energy: -418.914702 where: bonds (distance) C4'-P energy: -61.830 bonds (distance) P-C4' energy: -97.584 flat angles C4'-P-C4' energy: -90.707 flat angles P-C4'-P energy: -62.740 tors. eta vs tors. theta energy: -106.054 Dist. restrs. and SS energy: 4.540 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1386.685592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.685592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.374556 (E_RNA) where: Base-Base interactions energy: -1011.108 where: short stacking energy: -420.043 Base-Backbone interact. energy: 0.321 local terms energy: -419.588360 where: bonds (distance) C4'-P energy: -72.022 bonds (distance) P-C4' energy: -82.273 flat angles C4'-P-C4' energy: -84.866 flat angles P-C4'-P energy: -56.783 tors. eta vs tors. theta energy: -123.644 Dist. restrs. and SS energy: 6.939 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1377.470678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.470678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.181743 (E_RNA) where: Base-Base interactions energy: -1008.579 where: short stacking energy: -403.803 Base-Backbone interact. energy: -2.115 local terms energy: -410.487702 where: bonds (distance) C4'-P energy: -74.741 bonds (distance) P-C4' energy: -81.971 flat angles C4'-P-C4' energy: -89.659 flat angles P-C4'-P energy: -55.366 tors. eta vs tors. theta energy: -108.750 Dist. restrs. and SS energy: 6.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -1259.056019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.056019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.939504 (E_RNA) where: Base-Base interactions energy: -935.550 where: short stacking energy: -376.746 Base-Backbone interact. energy: 0.098 local terms energy: -371.487046 where: bonds (distance) C4'-P energy: -54.738 bonds (distance) P-C4' energy: -65.331 flat angles C4'-P-C4' energy: -93.058 flat angles P-C4'-P energy: -63.413 tors. eta vs tors. theta energy: -94.947 Dist. restrs. and SS energy: 11.133 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1654.730071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.730071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.968164 (E_RNA) where: Base-Base interactions energy: -1185.464 where: short stacking energy: -500.615 Base-Backbone interact. energy: 0.590 local terms energy: -511.093704 where: bonds (distance) C4'-P energy: -91.848 bonds (distance) P-C4' energy: -94.473 flat angles C4'-P-C4' energy: -111.582 flat angles P-C4'-P energy: -71.696 tors. eta vs tors. theta energy: -141.495 Dist. restrs. and SS energy: 4.488 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1610.115465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.115465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.821863 (E_RNA) where: Base-Base interactions energy: -1178.584 where: short stacking energy: -496.087 Base-Backbone interact. energy: -2.245 local terms energy: -468.992772 where: bonds (distance) C4'-P energy: -72.020 bonds (distance) P-C4' energy: -93.548 flat angles C4'-P-C4' energy: -99.519 flat angles P-C4'-P energy: -67.329 tors. eta vs tors. theta energy: -136.577 Dist. restrs. and SS energy: 2.956 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1596.755930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.755930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.863786 (E_RNA) where: Base-Base interactions energy: -1155.799 where: short stacking energy: -496.061 Base-Backbone interact. energy: -1.110 local terms energy: -477.954632 where: bonds (distance) C4'-P energy: -93.648 bonds (distance) P-C4' energy: -90.619 flat angles C4'-P-C4' energy: -96.770 flat angles P-C4'-P energy: -64.982 tors. eta vs tors. theta energy: -131.936 Dist. restrs. and SS energy: 1.358 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1556.426095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.426095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.886092 (E_RNA) where: Base-Base interactions energy: -1120.534 where: short stacking energy: -472.109 Base-Backbone interact. energy: -2.244 local terms energy: -472.108261 where: bonds (distance) C4'-P energy: -80.501 bonds (distance) P-C4' energy: -92.201 flat angles C4'-P-C4' energy: -91.478 flat angles P-C4'-P energy: -66.662 tors. eta vs tors. theta energy: -141.267 Dist. restrs. and SS energy: 1.710 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1533.937630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.937630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.604796 (E_RNA) where: Base-Base interactions energy: -1122.708 where: short stacking energy: -471.663 Base-Backbone interact. energy: -0.811 local terms energy: -449.086363 where: bonds (distance) C4'-P energy: -71.179 bonds (distance) P-C4' energy: -97.749 flat angles C4'-P-C4' energy: -95.963 flat angles P-C4'-P energy: -59.347 tors. eta vs tors. theta energy: -124.848 Dist. restrs. and SS energy: 1.917 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1434.920552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.920552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.801885 (E_RNA) where: Base-Base interactions energy: -1054.383 where: short stacking energy: -439.024 Base-Backbone interact. energy: -2.763 local terms energy: -422.655394 where: bonds (distance) C4'-P energy: -68.000 bonds (distance) P-C4' energy: -82.209 flat angles C4'-P-C4' energy: -94.970 flat angles P-C4'-P energy: -63.172 tors. eta vs tors. theta energy: -114.303 Dist. restrs. and SS energy: 8.131 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1421.944874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.944874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.927023 (E_RNA) where: Base-Base interactions energy: -1048.894 where: short stacking energy: -414.885 Base-Backbone interact. energy: -1.502 local terms energy: -409.531112 where: bonds (distance) C4'-P energy: -77.768 bonds (distance) P-C4' energy: -74.354 flat angles C4'-P-C4' energy: -91.471 flat angles P-C4'-P energy: -52.139 tors. eta vs tors. theta energy: -113.799 Dist. restrs. and SS energy: 1.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1351.172508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.172508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.369556 (E_RNA) where: Base-Base interactions energy: -1006.865 where: short stacking energy: -397.545 Base-Backbone interact. energy: -0.402 local terms energy: -385.102430 where: bonds (distance) C4'-P energy: -65.779 bonds (distance) P-C4' energy: -86.960 flat angles C4'-P-C4' energy: -77.446 flat angles P-C4'-P energy: -57.359 tors. eta vs tors. theta energy: -97.558 Dist. restrs. and SS energy: 4.447 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1314.763189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.763189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.870393 (E_RNA) where: Base-Base interactions energy: -961.468 where: short stacking energy: -379.096 Base-Backbone interact. energy: 5.819 local terms energy: -400.221512 where: bonds (distance) C4'-P energy: -66.157 bonds (distance) P-C4' energy: -78.092 flat angles C4'-P-C4' energy: -92.731 flat angles P-C4'-P energy: -54.109 tors. eta vs tors. theta energy: -109.133 Dist. restrs. and SS energy: 4.357 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -1238.443612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.443612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.940378 (E_RNA) where: Base-Base interactions energy: -934.083 where: short stacking energy: -361.197 Base-Backbone interact. energy: -2.423 local terms energy: -349.435009 where: bonds (distance) C4'-P energy: -57.105 bonds (distance) P-C4' energy: -78.147 flat angles C4'-P-C4' energy: -88.788 flat angles P-C4'-P energy: -34.669 tors. eta vs tors. theta energy: -90.725 Dist. restrs. and SS energy: 10.747 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1626.671934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.671934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.654885 (E_RNA) where: Base-Base interactions energy: -1200.475 where: short stacking energy: -503.416 Base-Backbone interact. energy: 0.765 local terms energy: -471.944266 where: bonds (distance) C4'-P energy: -96.467 bonds (distance) P-C4' energy: -82.709 flat angles C4'-P-C4' energy: -98.898 flat angles P-C4'-P energy: -61.406 tors. eta vs tors. theta energy: -132.464 Dist. restrs. and SS energy: 8.233 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1608.773450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.773450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.071554 (E_RNA) where: Base-Base interactions energy: -1153.435 where: short stacking energy: -486.551 Base-Backbone interact. energy: -1.734 local terms energy: -491.902812 where: bonds (distance) C4'-P energy: -84.520 bonds (distance) P-C4' energy: -94.660 flat angles C4'-P-C4' energy: -99.025 flat angles P-C4'-P energy: -79.613 tors. eta vs tors. theta energy: -134.086 Dist. restrs. and SS energy: 1.548 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1598.141350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.141350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.713907 (E_RNA) where: Base-Base interactions energy: -1156.796 where: short stacking energy: -501.640 Base-Backbone interact. energy: 2.762 local terms energy: -481.680443 where: bonds (distance) C4'-P energy: -97.370 bonds (distance) P-C4' energy: -92.280 flat angles C4'-P-C4' energy: -93.566 flat angles P-C4'-P energy: -61.305 tors. eta vs tors. theta energy: -137.160 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1562.386022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.386022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.601134 (E_RNA) where: Base-Base interactions energy: -1126.708 where: short stacking energy: -484.801 Base-Backbone interact. energy: 1.121 local terms energy: -475.014936 where: bonds (distance) C4'-P energy: -94.042 bonds (distance) P-C4' energy: -75.901 flat angles C4'-P-C4' energy: -95.715 flat angles P-C4'-P energy: -72.443 tors. eta vs tors. theta energy: -136.913 Dist. restrs. and SS energy: 1.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1519.374178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.374178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.291784 (E_RNA) where: Base-Base interactions energy: -1099.196 where: short stacking energy: -448.231 Base-Backbone interact. energy: 5.959 local terms energy: -464.054631 where: bonds (distance) C4'-P energy: -83.330 bonds (distance) P-C4' energy: -99.012 flat angles C4'-P-C4' energy: -94.635 flat angles P-C4'-P energy: -57.202 tors. eta vs tors. theta energy: -129.876 Dist. restrs. and SS energy: 1.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1405.754415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.754415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.478348 (E_RNA) where: Base-Base interactions energy: -1050.344 where: short stacking energy: -436.994 Base-Backbone interact. energy: -1.208 local terms energy: -400.926575 where: bonds (distance) C4'-P energy: -84.933 bonds (distance) P-C4' energy: -62.610 flat angles C4'-P-C4' energy: -82.762 flat angles P-C4'-P energy: -56.274 tors. eta vs tors. theta energy: -114.347 Dist. restrs. and SS energy: 9.974 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1442.074146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.074146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.154420 (E_RNA) where: Base-Base interactions energy: -1051.509 where: short stacking energy: -427.325 Base-Backbone interact. energy: 0.045 local terms energy: -429.691062 where: bonds (distance) C4'-P energy: -79.918 bonds (distance) P-C4' energy: -83.487 flat angles C4'-P-C4' energy: -96.038 flat angles P-C4'-P energy: -50.321 tors. eta vs tors. theta energy: -119.927 Dist. restrs. and SS energy: 2.330 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1419.745753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.745753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.950148 (E_RNA) where: Base-Base interactions energy: -1059.430 where: short stacking energy: -439.527 Base-Backbone interact. energy: -0.116 local terms energy: -398.403822 where: bonds (distance) C4'-P energy: -61.966 bonds (distance) P-C4' energy: -75.166 flat angles C4'-P-C4' energy: -95.890 flat angles P-C4'-P energy: -55.837 tors. eta vs tors. theta energy: -109.545 Dist. restrs. and SS energy: 1.454 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -1371.471465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.471465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.988575 (E_RNA) where: Base-Base interactions energy: -996.557 where: short stacking energy: -412.394 Base-Backbone interact. energy: -0.565 local terms energy: -412.866728 where: bonds (distance) C4'-P energy: -73.769 bonds (distance) P-C4' energy: -71.392 flat angles C4'-P-C4' energy: -90.141 flat angles P-C4'-P energy: -63.978 tors. eta vs tors. theta energy: -113.587 Dist. restrs. and SS energy: 1.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -1240.996210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.996210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.952739 (E_RNA) where: Base-Base interactions energy: -931.297 where: short stacking energy: -374.410 Base-Backbone interact. energy: 1.842 local terms energy: -357.496856 where: bonds (distance) C4'-P energy: -56.832 bonds (distance) P-C4' energy: -65.623 flat angles C4'-P-C4' energy: -82.845 flat angles P-C4'-P energy: -51.690 tors. eta vs tors. theta energy: -100.506 Dist. restrs. and SS energy: 9.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1608.877864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.877864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.839435 (E_RNA) where: Base-Base interactions energy: -1164.736 where: short stacking energy: -491.110 Base-Backbone interact. energy: -1.017 local terms energy: -487.086666 where: bonds (distance) C4'-P energy: -75.353 bonds (distance) P-C4' energy: -100.066 flat angles C4'-P-C4' energy: -100.612 flat angles P-C4'-P energy: -75.014 tors. eta vs tors. theta energy: -136.042 Dist. restrs. and SS energy: 7.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1618.659655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.659655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.687587 (E_RNA) where: Base-Base interactions energy: -1153.930 where: short stacking energy: -493.050 Base-Backbone interact. energy: -1.605 local terms energy: -501.152964 where: bonds (distance) C4'-P energy: -87.676 bonds (distance) P-C4' energy: -98.835 flat angles C4'-P-C4' energy: -109.060 flat angles P-C4'-P energy: -70.763 tors. eta vs tors. theta energy: -134.819 Dist. restrs. and SS energy: 1.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1573.482857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.482857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.288776 (E_RNA) where: Base-Base interactions energy: -1138.876 where: short stacking energy: -465.691 Base-Backbone interact. energy: 0.044 local terms energy: -473.456721 where: bonds (distance) C4'-P energy: -79.043 bonds (distance) P-C4' energy: -91.255 flat angles C4'-P-C4' energy: -95.340 flat angles P-C4'-P energy: -75.752 tors. eta vs tors. theta energy: -132.067 Dist. restrs. and SS energy: 2.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1568.148863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.148863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.840975 (E_RNA) where: Base-Base interactions energy: -1106.101 where: short stacking energy: -477.711 Base-Backbone interact. energy: -1.605 local terms energy: -498.135038 where: bonds (distance) C4'-P energy: -86.502 bonds (distance) P-C4' energy: -97.457 flat angles C4'-P-C4' energy: -101.733 flat angles P-C4'-P energy: -69.669 tors. eta vs tors. theta energy: -142.774 Dist. restrs. and SS energy: 0.942 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1536.563429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.563429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.376262 (E_RNA) where: Base-Base interactions energy: -1119.451 where: short stacking energy: -443.820 Base-Backbone interact. energy: -1.752 local terms energy: -453.172975 where: bonds (distance) C4'-P energy: -79.445 bonds (distance) P-C4' energy: -75.083 flat angles C4'-P-C4' energy: -94.527 flat angles P-C4'-P energy: -67.915 tors. eta vs tors. theta energy: -136.203 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1483.903341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.903341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.983424 (E_RNA) where: Base-Base interactions energy: -1077.339 where: short stacking energy: -440.827 Base-Backbone interact. energy: -1.253 local terms energy: -444.390972 where: bonds (distance) C4'-P energy: -75.639 bonds (distance) P-C4' energy: -80.264 flat angles C4'-P-C4' energy: -98.935 flat angles P-C4'-P energy: -72.634 tors. eta vs tors. theta energy: -116.919 Dist. restrs. and SS energy: 2.330 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1382.667285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.667285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.892171 (E_RNA) where: Base-Base interactions energy: -1004.420 where: short stacking energy: -414.917 Base-Backbone interact. energy: 2.867 local terms energy: -426.339278 where: bonds (distance) C4'-P energy: -94.205 bonds (distance) P-C4' energy: -82.826 flat angles C4'-P-C4' energy: -90.494 flat angles P-C4'-P energy: -51.720 tors. eta vs tors. theta energy: -107.094 Dist. restrs. and SS energy: 8.475 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1405.461528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.461528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.532736 (E_RNA) where: Base-Base interactions energy: -1018.532 where: short stacking energy: -411.173 Base-Backbone interact. energy: -2.467 local terms energy: -422.533698 where: bonds (distance) C4'-P energy: -80.337 bonds (distance) P-C4' energy: -68.023 flat angles C4'-P-C4' energy: -98.112 flat angles P-C4'-P energy: -57.058 tors. eta vs tors. theta energy: -119.003 Dist. restrs. and SS energy: 1.321 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1327.801156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.801156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.302406 (E_RNA) where: Base-Base interactions energy: -974.997 where: short stacking energy: -401.593 Base-Backbone interact. energy: -1.271 local terms energy: -390.033738 where: bonds (distance) C4'-P energy: -72.968 bonds (distance) P-C4' energy: -78.338 flat angles C4'-P-C4' energy: -90.939 flat angles P-C4'-P energy: -57.726 tors. eta vs tors. theta energy: -90.062 Dist. restrs. and SS energy: 1.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -1263.146810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.146810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.950522 (E_RNA) where: Base-Base interactions energy: -924.074 where: short stacking energy: -384.472 Base-Backbone interact. energy: 1.165 local terms energy: -386.041488 where: bonds (distance) C4'-P energy: -75.143 bonds (distance) P-C4' energy: -77.303 flat angles C4'-P-C4' energy: -82.551 flat angles P-C4'-P energy: -52.826 tors. eta vs tors. theta energy: -98.218 Dist. restrs. and SS energy: 9.054 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1655.054798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.054798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.802278 (E_RNA) where: Base-Base interactions energy: -1224.403 where: short stacking energy: -486.827 Base-Backbone interact. energy: -0.602 local terms energy: -475.797755 where: bonds (distance) C4'-P energy: -90.033 bonds (distance) P-C4' energy: -92.960 flat angles C4'-P-C4' energy: -95.897 flat angles P-C4'-P energy: -68.353 tors. eta vs tors. theta energy: -128.555 Dist. restrs. and SS energy: 8.997 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1601.339323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.339323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.036666 (E_RNA) where: Base-Base interactions energy: -1154.955 where: short stacking energy: -470.566 Base-Backbone interact. energy: -0.504 local terms energy: -483.578241 where: bonds (distance) C4'-P energy: -90.727 bonds (distance) P-C4' energy: -86.222 flat angles C4'-P-C4' energy: -107.901 flat angles P-C4'-P energy: -68.134 tors. eta vs tors. theta energy: -130.594 Dist. restrs. and SS energy: 0.947 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1621.452708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.452708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.072726 (E_RNA) where: Base-Base interactions energy: -1171.992 where: short stacking energy: -525.052 Base-Backbone interact. energy: -1.130 local terms energy: -486.950505 where: bonds (distance) C4'-P energy: -87.860 bonds (distance) P-C4' energy: -75.758 flat angles C4'-P-C4' energy: -97.891 flat angles P-C4'-P energy: -65.251 tors. eta vs tors. theta energy: -160.189 Dist. restrs. and SS energy: 1.870 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1565.976031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.976031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.315571 (E_RNA) where: Base-Base interactions energy: -1124.177 where: short stacking energy: -479.995 Base-Backbone interact. energy: -3.853 local terms energy: -476.285636 where: bonds (distance) C4'-P energy: -75.796 bonds (distance) P-C4' energy: -96.287 flat angles C4'-P-C4' energy: -100.107 flat angles P-C4'-P energy: -69.220 tors. eta vs tors. theta energy: -134.876 Dist. restrs. and SS energy: 1.590 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1551.424202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.424202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.253250 (E_RNA) where: Base-Base interactions energy: -1117.223 where: short stacking energy: -465.234 Base-Backbone interact. energy: -1.748 local terms energy: -470.282164 where: bonds (distance) C4'-P energy: -84.416 bonds (distance) P-C4' energy: -87.935 flat angles C4'-P-C4' energy: -94.745 flat angles P-C4'-P energy: -67.497 tors. eta vs tors. theta energy: -135.689 Dist. restrs. and SS energy: 1.079 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1527.380224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.380224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.888080 (E_RNA) where: Base-Base interactions energy: -1130.665 where: short stacking energy: -454.802 Base-Backbone interact. energy: -2.268 local terms energy: -432.954700 where: bonds (distance) C4'-P energy: -68.951 bonds (distance) P-C4' energy: -77.821 flat angles C4'-P-C4' energy: -99.364 flat angles P-C4'-P energy: -56.243 tors. eta vs tors. theta energy: -130.575 Dist. restrs. and SS energy: 1.758 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1433.897336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.897336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.433920 (E_RNA) where: Base-Base interactions energy: -1041.524 where: short stacking energy: -438.428 Base-Backbone interact. energy: 0.662 local terms energy: -431.572622 where: bonds (distance) C4'-P energy: -76.513 bonds (distance) P-C4' energy: -82.968 flat angles C4'-P-C4' energy: -95.050 flat angles P-C4'-P energy: -56.495 tors. eta vs tors. theta energy: -120.546 Dist. restrs. and SS energy: 1.787 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1346.022203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.022203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.590397 (E_RNA) where: Base-Base interactions energy: -983.101 where: short stacking energy: -412.899 Base-Backbone interact. energy: -0.807 local terms energy: -410.681971 where: bonds (distance) C4'-P energy: -66.871 bonds (distance) P-C4' energy: -75.400 flat angles C4'-P-C4' energy: -95.638 flat angles P-C4'-P energy: -69.272 tors. eta vs tors. theta energy: -103.501 Dist. restrs. and SS energy: 11.818 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1353.034033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.034033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.390626 (E_RNA) where: Base-Base interactions energy: -989.705 where: short stacking energy: -384.643 Base-Backbone interact. energy: 4.870 local terms energy: -406.555909 where: bonds (distance) C4'-P energy: -87.044 bonds (distance) P-C4' energy: -71.108 flat angles C4'-P-C4' energy: -92.839 flat angles P-C4'-P energy: -54.010 tors. eta vs tors. theta energy: -101.554 Dist. restrs. and SS energy: 1.607 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -1272.660227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.660227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.165540 (E_RNA) where: Base-Base interactions energy: -920.799 where: short stacking energy: -385.570 Base-Backbone interact. energy: -2.869 local terms energy: -392.497803 where: bonds (distance) C4'-P energy: -73.393 bonds (distance) P-C4' energy: -77.915 flat angles C4'-P-C4' energy: -80.240 flat angles P-C4'-P energy: -51.861 tors. eta vs tors. theta energy: -109.089 Dist. restrs. and SS energy: 6.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1638.654150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.654150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.317549 (E_RNA) where: Base-Base interactions energy: -1203.834 where: short stacking energy: -477.188 Base-Backbone interact. energy: -1.888 local terms energy: -477.595131 where: bonds (distance) C4'-P energy: -87.424 bonds (distance) P-C4' energy: -102.934 flat angles C4'-P-C4' energy: -97.895 flat angles P-C4'-P energy: -60.241 tors. eta vs tors. theta energy: -129.101 Dist. restrs. and SS energy: 7.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1621.058476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.058476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.022399 (E_RNA) where: Base-Base interactions energy: -1185.943 where: short stacking energy: -497.247 Base-Backbone interact. energy: 0.823 local terms energy: -473.901721 where: bonds (distance) C4'-P energy: -90.414 bonds (distance) P-C4' energy: -72.598 flat angles C4'-P-C4' energy: -109.074 flat angles P-C4'-P energy: -75.691 tors. eta vs tors. theta energy: -126.125 Dist. restrs. and SS energy: 1.214 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1617.426947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.426947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.083590 (E_RNA) where: Base-Base interactions energy: -1173.553 where: short stacking energy: -502.236 Base-Backbone interact. energy: -1.801 local terms energy: -479.729888 where: bonds (distance) C4'-P energy: -79.717 bonds (distance) P-C4' energy: -90.293 flat angles C4'-P-C4' energy: -102.167 flat angles P-C4'-P energy: -65.876 tors. eta vs tors. theta energy: -141.677 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1553.786039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.786039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.184342 (E_RNA) where: Base-Base interactions energy: -1115.185 where: short stacking energy: -450.147 Base-Backbone interact. energy: -0.356 local terms energy: -476.643337 where: bonds (distance) C4'-P energy: -89.210 bonds (distance) P-C4' energy: -95.801 flat angles C4'-P-C4' energy: -100.076 flat angles P-C4'-P energy: -62.151 tors. eta vs tors. theta energy: -129.405 Dist. restrs. and SS energy: 1.648 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1493.516889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.516889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.677333 (E_RNA) where: Base-Base interactions energy: -1100.091 where: short stacking energy: -463.700 Base-Backbone interact. energy: -1.562 local terms energy: -431.023517 where: bonds (distance) C4'-P energy: -73.320 bonds (distance) P-C4' energy: -80.055 flat angles C4'-P-C4' energy: -86.390 flat angles P-C4'-P energy: -60.336 tors. eta vs tors. theta energy: -130.922 Dist. restrs. and SS energy: 2.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1493.151575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.151575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.192377 (E_RNA) where: Base-Base interactions energy: -1087.954 where: short stacking energy: -450.190 Base-Backbone interact. energy: -1.740 local terms energy: -441.498121 where: bonds (distance) C4'-P energy: -75.700 bonds (distance) P-C4' energy: -86.100 flat angles C4'-P-C4' energy: -91.790 flat angles P-C4'-P energy: -57.584 tors. eta vs tors. theta energy: -130.324 Dist. restrs. and SS energy: 1.291 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1429.836415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.836415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.378091 (E_RNA) where: Base-Base interactions energy: -1038.412 where: short stacking energy: -419.737 Base-Backbone interact. energy: 5.656 local terms energy: -435.621650 where: bonds (distance) C4'-P energy: -70.502 bonds (distance) P-C4' energy: -89.579 flat angles C4'-P-C4' energy: -92.807 flat angles P-C4'-P energy: -64.513 tors. eta vs tors. theta energy: -118.220 Dist. restrs. and SS energy: 1.792 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1363.328576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.328576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.257778 (E_RNA) where: Base-Base interactions energy: -988.626 where: short stacking energy: -401.445 Base-Backbone interact. energy: 1.582 local terms energy: -415.213665 where: bonds (distance) C4'-P energy: -67.894 bonds (distance) P-C4' energy: -83.776 flat angles C4'-P-C4' energy: -92.319 flat angles P-C4'-P energy: -56.854 tors. eta vs tors. theta energy: -114.371 Dist. restrs. and SS energy: 2.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1334.628869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.628869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.548026 (E_RNA) where: Base-Base interactions energy: -970.439 where: short stacking energy: -383.170 Base-Backbone interact. energy: -1.326 local terms energy: -410.782986 where: bonds (distance) C4'-P energy: -83.440 bonds (distance) P-C4' energy: -82.473 flat angles C4'-P-C4' energy: -71.338 flat angles P-C4'-P energy: -59.790 tors. eta vs tors. theta energy: -113.742 Dist. restrs. and SS energy: 11.169 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -1239.834224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.834224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.593160 (E_RNA) where: Base-Base interactions energy: -924.341 where: short stacking energy: -377.264 Base-Backbone interact. energy: -4.357 local terms energy: -352.895387 where: bonds (distance) C4'-P energy: -73.046 bonds (distance) P-C4' energy: -73.902 flat angles C4'-P-C4' energy: -57.789 flat angles P-C4'-P energy: -53.474 tors. eta vs tors. theta energy: -94.684 Dist. restrs. and SS energy: 5.009 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1633.923361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.923361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.435620 (E_RNA) where: Base-Base interactions energy: -1184.533 where: short stacking energy: -496.181 Base-Backbone interact. energy: -1.936 local terms energy: -484.967088 where: bonds (distance) C4'-P energy: -85.970 bonds (distance) P-C4' energy: -95.375 flat angles C4'-P-C4' energy: -99.586 flat angles P-C4'-P energy: -72.477 tors. eta vs tors. theta energy: -131.558 Dist. restrs. and SS energy: 0.762 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1602.855306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.855306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.331156 (E_RNA) where: Base-Base interactions energy: -1168.375 where: short stacking energy: -485.750 Base-Backbone interact. energy: -1.865 local terms energy: -478.090566 where: bonds (distance) C4'-P energy: -92.292 bonds (distance) P-C4' energy: -85.122 flat angles C4'-P-C4' energy: -104.916 flat angles P-C4'-P energy: -66.476 tors. eta vs tors. theta energy: -129.284 Dist. restrs. and SS energy: 8.726 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1597.485684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.485684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.149678 (E_RNA) where: Base-Base interactions energy: -1162.820 where: short stacking energy: -477.553 Base-Backbone interact. energy: -1.562 local terms energy: -470.767027 where: bonds (distance) C4'-P energy: -84.325 bonds (distance) P-C4' energy: -81.850 flat angles C4'-P-C4' energy: -100.443 flat angles P-C4'-P energy: -66.954 tors. eta vs tors. theta energy: -137.195 Dist. restrs. and SS energy: 0.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1575.809608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.809608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.528657 (E_RNA) where: Base-Base interactions energy: -1126.752 where: short stacking energy: -475.733 Base-Backbone interact. energy: -0.129 local terms energy: -486.647661 where: bonds (distance) C4'-P energy: -82.238 bonds (distance) P-C4' energy: -94.565 flat angles C4'-P-C4' energy: -100.565 flat angles P-C4'-P energy: -70.272 tors. eta vs tors. theta energy: -139.007 Dist. restrs. and SS energy: 0.969 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1479.967956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.967956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.583724 (E_RNA) where: Base-Base interactions energy: -1092.569 where: short stacking energy: -459.694 Base-Backbone interact. energy: -1.496 local terms energy: -425.519253 where: bonds (distance) C4'-P energy: -81.580 bonds (distance) P-C4' energy: -70.302 flat angles C4'-P-C4' energy: -99.142 flat angles P-C4'-P energy: -56.114 tors. eta vs tors. theta energy: -118.382 Dist. restrs. and SS energy: 2.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1471.123027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.123027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.204119 (E_RNA) where: Base-Base interactions energy: -1080.724 where: short stacking energy: -437.146 Base-Backbone interact. energy: -0.785 local terms energy: -427.694520 where: bonds (distance) C4'-P energy: -79.862 bonds (distance) P-C4' energy: -71.307 flat angles C4'-P-C4' energy: -96.074 flat angles P-C4'-P energy: -65.839 tors. eta vs tors. theta energy: -114.613 Dist. restrs. and SS energy: 1.331 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1432.088722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.088722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.310604 (E_RNA) where: Base-Base interactions energy: -1026.234 where: short stacking energy: -403.714 Base-Backbone interact. energy: 2.467 local terms energy: -446.543668 where: bonds (distance) C4'-P energy: -82.903 bonds (distance) P-C4' energy: -89.612 flat angles C4'-P-C4' energy: -90.745 flat angles P-C4'-P energy: -61.525 tors. eta vs tors. theta energy: -121.759 Dist. restrs. and SS energy: 1.472 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1342.578675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.578675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.338653 (E_RNA) where: Base-Base interactions energy: -988.189 where: short stacking energy: -401.901 Base-Backbone interact. energy: 3.261 local terms energy: -397.411292 where: bonds (distance) C4'-P energy: -60.593 bonds (distance) P-C4' energy: -79.418 flat angles C4'-P-C4' energy: -100.927 flat angles P-C4'-P energy: -52.523 tors. eta vs tors. theta energy: -103.950 Dist. restrs. and SS energy: 3.010 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1266.522334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.522334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.965060 (E_RNA) where: Base-Base interactions energy: -917.823 where: short stacking energy: -365.964 Base-Backbone interact. energy: -2.513 local terms energy: -391.628242 where: bonds (distance) C4'-P energy: -84.344 bonds (distance) P-C4' energy: -81.945 flat angles C4'-P-C4' energy: -82.961 flat angles P-C4'-P energy: -43.662 tors. eta vs tors. theta energy: -98.716 Dist. restrs. and SS energy: 8.693 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -1247.793847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.793847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.536655 (E_RNA) where: Base-Base interactions energy: -933.125 where: short stacking energy: -382.482 Base-Backbone interact. energy: -0.814 local terms energy: -356.597955 where: bonds (distance) C4'-P energy: -52.875 bonds (distance) P-C4' energy: -75.662 flat angles C4'-P-C4' energy: -82.808 flat angles P-C4'-P energy: -40.511 tors. eta vs tors. theta energy: -104.741 Dist. restrs. and SS energy: 5.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1648.411756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.411756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.939606 (E_RNA) where: Base-Base interactions energy: -1174.553 where: short stacking energy: -485.196 Base-Backbone interact. energy: -1.643 local terms energy: -509.742931 where: bonds (distance) C4'-P energy: -88.723 bonds (distance) P-C4' energy: -100.139 flat angles C4'-P-C4' energy: -108.565 flat angles P-C4'-P energy: -81.302 tors. eta vs tors. theta energy: -131.015 Dist. restrs. and SS energy: 0.778 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1601.678108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.678108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.035023 (E_RNA) where: Base-Base interactions energy: -1178.528 where: short stacking energy: -483.063 Base-Backbone interact. energy: -0.109 local terms energy: -468.398042 where: bonds (distance) C4'-P energy: -88.443 bonds (distance) P-C4' energy: -77.454 flat angles C4'-P-C4' energy: -108.104 flat angles P-C4'-P energy: -70.202 tors. eta vs tors. theta energy: -124.195 Dist. restrs. and SS energy: 8.607 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1613.473300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.473300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.018602 (E_RNA) where: Base-Base interactions energy: -1186.360 where: short stacking energy: -485.750 Base-Backbone interact. energy: -0.142 local terms energy: -465.516654 where: bonds (distance) C4'-P energy: -81.300 bonds (distance) P-C4' energy: -90.307 flat angles C4'-P-C4' energy: -97.152 flat angles P-C4'-P energy: -62.494 tors. eta vs tors. theta energy: -134.264 Dist. restrs. and SS energy: 1.795 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1569.992425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.992425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.778273 (E_RNA) where: Base-Base interactions energy: -1116.116 where: short stacking energy: -475.009 Base-Backbone interact. energy: -0.637 local terms energy: -491.025003 where: bonds (distance) C4'-P energy: -95.140 bonds (distance) P-C4' energy: -84.734 flat angles C4'-P-C4' energy: -94.668 flat angles P-C4'-P energy: -78.998 tors. eta vs tors. theta energy: -137.486 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1494.335695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.335695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.364098 (E_RNA) where: Base-Base interactions energy: -1073.329 where: short stacking energy: -443.030 Base-Backbone interact. energy: -1.392 local terms energy: -458.643361 where: bonds (distance) C4'-P energy: -80.526 bonds (distance) P-C4' energy: -77.498 flat angles C4'-P-C4' energy: -105.230 flat angles P-C4'-P energy: -71.785 tors. eta vs tors. theta energy: -123.605 Dist. restrs. and SS energy: 2.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1435.924236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.924236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.692631 (E_RNA) where: Base-Base interactions energy: -1041.777 where: short stacking energy: -416.606 Base-Backbone interact. energy: -1.389 local terms energy: -430.526847 where: bonds (distance) C4'-P energy: -79.480 bonds (distance) P-C4' energy: -84.507 flat angles C4'-P-C4' energy: -91.914 flat angles P-C4'-P energy: -59.575 tors. eta vs tors. theta energy: -115.051 Dist. restrs. and SS energy: 1.018 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1416.061228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.061228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.073987 (E_RNA) where: Base-Base interactions energy: -1042.705 where: short stacking energy: -419.249 Base-Backbone interact. energy: 0.228 local terms energy: -411.597376 where: bonds (distance) C4'-P energy: -76.100 bonds (distance) P-C4' energy: -72.586 flat angles C4'-P-C4' energy: -93.369 flat angles P-C4'-P energy: -59.642 tors. eta vs tors. theta energy: -109.901 Dist. restrs. and SS energy: 1.263 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1386.568973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.568973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.719951 (E_RNA) where: Base-Base interactions energy: -1026.163 where: short stacking energy: -423.165 Base-Backbone interact. energy: -2.470 local terms energy: -396.086955 where: bonds (distance) C4'-P energy: -64.031 bonds (distance) P-C4' energy: -76.450 flat angles C4'-P-C4' energy: -79.223 flat angles P-C4'-P energy: -61.741 tors. eta vs tors. theta energy: -114.642 Dist. restrs. and SS energy: 1.401 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1297.877042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.877042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.545505 (E_RNA) where: Base-Base interactions energy: -953.310 where: short stacking energy: -400.519 Base-Backbone interact. energy: 2.785 local terms energy: -393.021327 where: bonds (distance) C4'-P energy: -65.195 bonds (distance) P-C4' energy: -81.930 flat angles C4'-P-C4' energy: -98.907 flat angles P-C4'-P energy: -43.661 tors. eta vs tors. theta energy: -103.328 Dist. restrs. and SS energy: 8.918 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -1236.911951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.911951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.572743 (E_RNA) where: Base-Base interactions energy: -926.338 where: short stacking energy: -395.685 Base-Backbone interact. energy: -0.138 local terms energy: -353.096044 where: bonds (distance) C4'-P energy: -70.214 bonds (distance) P-C4' energy: -75.277 flat angles C4'-P-C4' energy: -76.280 flat angles P-C4'-P energy: -39.214 tors. eta vs tors. theta energy: -92.112 Dist. restrs. and SS energy: 5.911 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1661.707860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.707860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1698.757276 (E_RNA) where: Base-Base interactions energy: -1217.993 where: short stacking energy: -501.461 Base-Backbone interact. energy: -2.298 local terms energy: -478.466302 where: bonds (distance) C4'-P energy: -94.007 bonds (distance) P-C4' energy: -85.764 flat angles C4'-P-C4' energy: -101.161 flat angles P-C4'-P energy: -68.469 tors. eta vs tors. theta energy: -129.065 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1601.057191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.057191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.933907 (E_RNA) where: Base-Base interactions energy: -1155.225 where: short stacking energy: -471.804 Base-Backbone interact. energy: -0.423 local terms energy: -489.285908 where: bonds (distance) C4'-P energy: -99.539 bonds (distance) P-C4' energy: -93.137 flat angles C4'-P-C4' energy: -108.653 flat angles P-C4'-P energy: -61.673 tors. eta vs tors. theta energy: -126.284 Dist. restrs. and SS energy: 7.127 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1600.801097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.801097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.944511 (E_RNA) where: Base-Base interactions energy: -1152.311 where: short stacking energy: -476.389 Base-Backbone interact. energy: -2.390 local terms energy: -484.243796 where: bonds (distance) C4'-P energy: -89.520 bonds (distance) P-C4' energy: -97.755 flat angles C4'-P-C4' energy: -94.392 flat angles P-C4'-P energy: -71.422 tors. eta vs tors. theta energy: -131.156 Dist. restrs. and SS energy: 1.393 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1570.838029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.838029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.814214 (E_RNA) where: Base-Base interactions energy: -1162.376 where: short stacking energy: -502.071 Base-Backbone interact. energy: -0.017 local terms energy: -446.420371 where: bonds (distance) C4'-P energy: -75.260 bonds (distance) P-C4' energy: -76.723 flat angles C4'-P-C4' energy: -94.616 flat angles P-C4'-P energy: -58.798 tors. eta vs tors. theta energy: -141.024 Dist. restrs. and SS energy: 1.226 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1503.016246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.016246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.419426 (E_RNA) where: Base-Base interactions energy: -1097.234 where: short stacking energy: -476.967 Base-Backbone interact. energy: -2.356 local terms energy: -442.829048 where: bonds (distance) C4'-P energy: -84.817 bonds (distance) P-C4' energy: -70.623 flat angles C4'-P-C4' energy: -97.259 flat angles P-C4'-P energy: -55.967 tors. eta vs tors. theta energy: -134.163 Dist. restrs. and SS energy: 2.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1479.273266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.273266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.013484 (E_RNA) where: Base-Base interactions energy: -1077.569 where: short stacking energy: -454.159 Base-Backbone interact. energy: -0.465 local terms energy: -439.979970 where: bonds (distance) C4'-P energy: -73.193 bonds (distance) P-C4' energy: -93.995 flat angles C4'-P-C4' energy: -96.272 flat angles P-C4'-P energy: -47.474 tors. eta vs tors. theta energy: -129.046 Dist. restrs. and SS energy: 1.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1429.557256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.557256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.313540 (E_RNA) where: Base-Base interactions energy: -1030.658 where: short stacking energy: -420.518 Base-Backbone interact. energy: 1.916 local terms energy: -439.571800 where: bonds (distance) C4'-P energy: -71.865 bonds (distance) P-C4' energy: -81.137 flat angles C4'-P-C4' energy: -98.423 flat angles P-C4'-P energy: -67.596 tors. eta vs tors. theta energy: -120.551 Dist. restrs. and SS energy: 2.006 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1397.215935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.215935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.927848 (E_RNA) where: Base-Base interactions energy: -1009.323 where: short stacking energy: -399.405 Base-Backbone interact. energy: -2.686 local terms energy: -422.918114 where: bonds (distance) C4'-P energy: -81.006 bonds (distance) P-C4' energy: -82.445 flat angles C4'-P-C4' energy: -95.038 flat angles P-C4'-P energy: -56.064 tors. eta vs tors. theta energy: -108.364 Dist. restrs. and SS energy: 0.962 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1285.397081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.397081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.470927 (E_RNA) where: Base-Base interactions energy: -952.397 where: short stacking energy: -418.496 Base-Backbone interact. energy: 1.968 local terms energy: -385.041823 where: bonds (distance) C4'-P energy: -70.244 bonds (distance) P-C4' energy: -76.339 flat angles C4'-P-C4' energy: -85.217 flat angles P-C4'-P energy: -57.056 tors. eta vs tors. theta energy: -96.186 Dist. restrs. and SS energy: 13.324 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -1264.977611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.977611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.656195 (E_RNA) where: Base-Base interactions energy: -932.565 where: short stacking energy: -374.186 Base-Backbone interact. energy: -1.532 local terms energy: -372.558515 where: bonds (distance) C4'-P energy: -66.609 bonds (distance) P-C4' energy: -70.215 flat angles C4'-P-C4' energy: -77.103 flat angles P-C4'-P energy: -53.247 tors. eta vs tors. theta energy: -105.384 Dist. restrs. and SS energy: 4.929 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1650.380046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.380046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.412990 (E_RNA) where: Base-Base interactions energy: -1199.433 where: short stacking energy: -481.638 Base-Backbone interact. energy: -1.589 local terms energy: -487.390847 where: bonds (distance) C4'-P energy: -98.418 bonds (distance) P-C4' energy: -92.061 flat angles C4'-P-C4' energy: -105.810 flat angles P-C4'-P energy: -67.114 tors. eta vs tors. theta energy: -123.989 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1632.060446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.060446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.869352 (E_RNA) where: Base-Base interactions energy: -1202.693 where: short stacking energy: -489.668 Base-Backbone interact. energy: -1.923 local terms energy: -476.253926 where: bonds (distance) C4'-P energy: -75.897 bonds (distance) P-C4' energy: -98.070 flat angles C4'-P-C4' energy: -110.748 flat angles P-C4'-P energy: -57.484 tors. eta vs tors. theta energy: -134.054 Dist. restrs. and SS energy: 12.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1616.893538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.893538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.753933 (E_RNA) where: Base-Base interactions energy: -1181.467 where: short stacking energy: -504.426 Base-Backbone interact. energy: -0.589 local terms energy: -473.697576 where: bonds (distance) C4'-P energy: -72.969 bonds (distance) P-C4' energy: -85.296 flat angles C4'-P-C4' energy: -108.364 flat angles P-C4'-P energy: -66.615 tors. eta vs tors. theta energy: -140.453 Dist. restrs. and SS energy: 2.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1568.393477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.393477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.112569 (E_RNA) where: Base-Base interactions energy: -1126.647 where: short stacking energy: -492.060 Base-Backbone interact. energy: -2.571 local terms energy: -476.894292 where: bonds (distance) C4'-P energy: -76.729 bonds (distance) P-C4' energy: -88.177 flat angles C4'-P-C4' energy: -99.910 flat angles P-C4'-P energy: -72.420 tors. eta vs tors. theta energy: -139.658 Dist. restrs. and SS energy: 0.969 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1488.948246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.948246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.851429 (E_RNA) where: Base-Base interactions energy: -1077.317 where: short stacking energy: -466.387 Base-Backbone interact. energy: -0.604 local terms energy: -449.930136 where: bonds (distance) C4'-P energy: -72.115 bonds (distance) P-C4' energy: -86.170 flat angles C4'-P-C4' energy: -97.939 flat angles P-C4'-P energy: -66.918 tors. eta vs tors. theta energy: -126.788 Dist. restrs. and SS energy: 2.153 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1481.438172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.438172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.407213 (E_RNA) where: Base-Base interactions energy: -1078.776 where: short stacking energy: -455.831 Base-Backbone interact. energy: -1.912 local terms energy: -438.718879 where: bonds (distance) C4'-P energy: -82.288 bonds (distance) P-C4' energy: -83.403 flat angles C4'-P-C4' energy: -94.659 flat angles P-C4'-P energy: -61.948 tors. eta vs tors. theta energy: -116.421 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1443.943298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.943298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.046954 (E_RNA) where: Base-Base interactions energy: -1069.609 where: short stacking energy: -431.230 Base-Backbone interact. energy: -1.122 local terms energy: -412.316631 where: bonds (distance) C4'-P energy: -78.893 bonds (distance) P-C4' energy: -57.219 flat angles C4'-P-C4' energy: -86.083 flat angles P-C4'-P energy: -56.088 tors. eta vs tors. theta energy: -134.034 Dist. restrs. and SS energy: 2.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1385.597640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.597640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.029315 (E_RNA) where: Base-Base interactions energy: -1003.709 where: short stacking energy: -435.042 Base-Backbone interact. energy: -1.477 local terms energy: -421.842729 where: bonds (distance) C4'-P energy: -86.168 bonds (distance) P-C4' energy: -64.684 flat angles C4'-P-C4' energy: -87.203 flat angles P-C4'-P energy: -65.078 tors. eta vs tors. theta energy: -118.710 Dist. restrs. and SS energy: 4.682 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1324.183827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.183827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.257672 (E_RNA) where: Base-Base interactions energy: -982.859 where: short stacking energy: -431.020 Base-Backbone interact. energy: 1.016 local terms energy: -393.414555 where: bonds (distance) C4'-P energy: -60.124 bonds (distance) P-C4' energy: -79.034 flat angles C4'-P-C4' energy: -86.963 flat angles P-C4'-P energy: -46.795 tors. eta vs tors. theta energy: -120.498 Dist. restrs. and SS energy: 14.324 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -1259.066366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.066366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.686658 (E_RNA) where: Base-Base interactions energy: -916.798 where: short stacking energy: -378.411 Base-Backbone interact. energy: -1.612 local terms energy: -383.276209 where: bonds (distance) C4'-P energy: -67.293 bonds (distance) P-C4' energy: -80.592 flat angles C4'-P-C4' energy: -83.297 flat angles P-C4'-P energy: -42.615 tors. eta vs tors. theta energy: -109.479 Dist. restrs. and SS energy: 5.870 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1675.545810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.545810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.112197 (E_RNA) where: Base-Base interactions energy: -1208.213 where: short stacking energy: -494.585 Base-Backbone interact. energy: -1.889 local terms energy: -503.010321 where: bonds (distance) C4'-P energy: -90.517 bonds (distance) P-C4' energy: -97.779 flat angles C4'-P-C4' energy: -111.595 flat angles P-C4'-P energy: -67.554 tors. eta vs tors. theta energy: -135.565 Dist. restrs. and SS energy: 0.816 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1623.518527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.518527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.928145 (E_RNA) where: Base-Base interactions energy: -1189.740 where: short stacking energy: -480.533 Base-Backbone interact. energy: -5.224 local terms energy: -474.963715 where: bonds (distance) C4'-P energy: -82.963 bonds (distance) P-C4' energy: -92.721 flat angles C4'-P-C4' energy: -101.123 flat angles P-C4'-P energy: -68.154 tors. eta vs tors. theta energy: -130.003 Dist. restrs. and SS energy: 9.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1612.899473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.899473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.262181 (E_RNA) where: Base-Base interactions energy: -1174.633 where: short stacking energy: -497.707 Base-Backbone interact. energy: -0.767 local terms energy: -475.862556 where: bonds (distance) C4'-P energy: -85.349 bonds (distance) P-C4' energy: -89.158 flat angles C4'-P-C4' energy: -96.124 flat angles P-C4'-P energy: -67.196 tors. eta vs tors. theta energy: -138.036 Dist. restrs. and SS energy: 1.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1559.056516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.056516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.538599 (E_RNA) where: Base-Base interactions energy: -1133.203 where: short stacking energy: -454.837 Base-Backbone interact. energy: -2.319 local terms energy: -462.017137 where: bonds (distance) C4'-P energy: -89.766 bonds (distance) P-C4' energy: -82.035 flat angles C4'-P-C4' energy: -94.778 flat angles P-C4'-P energy: -62.522 tors. eta vs tors. theta energy: -132.915 Dist. restrs. and SS energy: 1.732 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1480.101712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.101712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.897493 (E_RNA) where: Base-Base interactions energy: -1081.727 where: short stacking energy: -456.138 Base-Backbone interact. energy: -1.399 local terms energy: -435.770735 where: bonds (distance) C4'-P energy: -82.220 bonds (distance) P-C4' energy: -71.752 flat angles C4'-P-C4' energy: -94.447 flat angles P-C4'-P energy: -56.720 tors. eta vs tors. theta energy: -130.632 Dist. restrs. and SS energy: 2.046 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1428.663074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.663074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.004576 (E_RNA) where: Base-Base interactions energy: -1015.695 where: short stacking energy: -427.990 Base-Backbone interact. energy: 2.688 local terms energy: -453.998058 where: bonds (distance) C4'-P energy: -87.195 bonds (distance) P-C4' energy: -86.331 flat angles C4'-P-C4' energy: -96.490 flat angles P-C4'-P energy: -62.721 tors. eta vs tors. theta energy: -121.262 Dist. restrs. and SS energy: 1.592 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1468.182063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.182063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.268979 (E_RNA) where: Base-Base interactions energy: -1077.426 where: short stacking energy: -441.627 Base-Backbone interact. energy: 5.831 local terms energy: -434.673680 where: bonds (distance) C4'-P energy: -69.241 bonds (distance) P-C4' energy: -82.665 flat angles C4'-P-C4' energy: -92.641 flat angles P-C4'-P energy: -61.712 tors. eta vs tors. theta energy: -128.414 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1386.978911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.978911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.051717 (E_RNA) where: Base-Base interactions energy: -1014.802 where: short stacking energy: -405.174 Base-Backbone interact. energy: -1.969 local terms energy: -411.280773 where: bonds (distance) C4'-P energy: -65.992 bonds (distance) P-C4' energy: -85.216 flat angles C4'-P-C4' energy: -102.898 flat angles P-C4'-P energy: -60.628 tors. eta vs tors. theta energy: -96.547 Dist. restrs. and SS energy: 4.323 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1264.796959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.796959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.662656 (E_RNA) where: Base-Base interactions energy: -927.454 where: short stacking energy: -355.384 Base-Backbone interact. energy: 1.194 local terms energy: -386.402889 where: bonds (distance) C4'-P energy: -71.591 bonds (distance) P-C4' energy: -80.070 flat angles C4'-P-C4' energy: -81.110 flat angles P-C4'-P energy: -59.337 tors. eta vs tors. theta energy: -94.295 Dist. restrs. and SS energy: 11.116 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -1237.795081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.795081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.822800 (E_RNA) where: Base-Base interactions energy: -888.827 where: short stacking energy: -368.668 Base-Backbone interact. energy: 0.171 local terms energy: -389.166687 where: bonds (distance) C4'-P energy: -67.558 bonds (distance) P-C4' energy: -72.664 flat angles C4'-P-C4' energy: -99.229 flat angles P-C4'-P energy: -54.776 tors. eta vs tors. theta energy: -94.939 Dist. restrs. and SS energy: 3.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1673.498853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.498853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.016103 (E_RNA) where: Base-Base interactions energy: -1224.622 where: short stacking energy: -499.367 Base-Backbone interact. energy: -1.198 local terms energy: -486.196421 where: bonds (distance) C4'-P energy: -84.424 bonds (distance) P-C4' energy: -96.958 flat angles C4'-P-C4' energy: -106.243 flat angles P-C4'-P energy: -60.058 tors. eta vs tors. theta energy: -138.513 Dist. restrs. and SS energy: 1.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1660.489411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.489411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1698.072111 (E_RNA) where: Base-Base interactions energy: -1192.652 where: short stacking energy: -507.399 Base-Backbone interact. energy: -1.015 local terms energy: -504.405043 where: bonds (distance) C4'-P energy: -92.100 bonds (distance) P-C4' energy: -88.935 flat angles C4'-P-C4' energy: -102.980 flat angles P-C4'-P energy: -72.952 tors. eta vs tors. theta energy: -147.439 Dist. restrs. and SS energy: 0.833 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1558.814925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.814925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.537378 (E_RNA) where: Base-Base interactions energy: -1139.827 where: short stacking energy: -464.264 Base-Backbone interact. energy: -0.282 local terms energy: -465.428252 where: bonds (distance) C4'-P energy: -92.557 bonds (distance) P-C4' energy: -87.309 flat angles C4'-P-C4' energy: -100.793 flat angles P-C4'-P energy: -58.521 tors. eta vs tors. theta energy: -126.248 Dist. restrs. and SS energy: 9.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1603.756510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.756510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.150833 (E_RNA) where: Base-Base interactions energy: -1159.093 where: short stacking energy: -496.100 Base-Backbone interact. energy: -0.554 local terms energy: -481.503994 where: bonds (distance) C4'-P energy: -86.208 bonds (distance) P-C4' energy: -74.700 flat angles C4'-P-C4' energy: -107.111 flat angles P-C4'-P energy: -75.483 tors. eta vs tors. theta energy: -138.002 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1502.925746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.925746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.090230 (E_RNA) where: Base-Base interactions energy: -1103.568 where: short stacking energy: -447.244 Base-Backbone interact. energy: -1.408 local terms energy: -436.113878 where: bonds (distance) C4'-P energy: -84.706 bonds (distance) P-C4' energy: -76.863 flat angles C4'-P-C4' energy: -95.801 flat angles P-C4'-P energy: -50.696 tors. eta vs tors. theta energy: -128.048 Dist. restrs. and SS energy: 1.414 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1478.842627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.842627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.056114 (E_RNA) where: Base-Base interactions energy: -1093.432 where: short stacking energy: -460.101 Base-Backbone interact. energy: 2.700 local terms energy: -426.324113 where: bonds (distance) C4'-P energy: -74.246 bonds (distance) P-C4' energy: -72.277 flat angles C4'-P-C4' energy: -86.188 flat angles P-C4'-P energy: -62.683 tors. eta vs tors. theta energy: -130.930 Dist. restrs. and SS energy: 1.463 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1420.313302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.313302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.994633 (E_RNA) where: Base-Base interactions energy: -1030.546 where: short stacking energy: -419.833 Base-Backbone interact. energy: 1.589 local terms energy: -433.037972 where: bonds (distance) C4'-P energy: -73.280 bonds (distance) P-C4' energy: -87.399 flat angles C4'-P-C4' energy: -90.862 flat angles P-C4'-P energy: -58.431 tors. eta vs tors. theta energy: -123.067 Dist. restrs. and SS energy: 4.931 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1387.139660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.139660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.230504 (E_RNA) where: Base-Base interactions energy: -1019.755 where: short stacking energy: -386.496 Base-Backbone interact. energy: -2.354 local terms energy: -402.122104 where: bonds (distance) C4'-P energy: -65.852 bonds (distance) P-C4' energy: -82.489 flat angles C4'-P-C4' energy: -89.491 flat angles P-C4'-P energy: -51.188 tors. eta vs tors. theta energy: -113.102 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1270.196570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.196570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.484192 (E_RNA) where: Base-Base interactions energy: -923.757 where: short stacking energy: -362.512 Base-Backbone interact. energy: 0.941 local terms energy: -394.667464 where: bonds (distance) C4'-P energy: -78.955 bonds (distance) P-C4' energy: -80.280 flat angles C4'-P-C4' energy: -88.337 flat angles P-C4'-P energy: -44.975 tors. eta vs tors. theta energy: -102.119 Dist. restrs. and SS energy: 10.538 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -1281.921684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.921684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.365268 (E_RNA) where: Base-Base interactions energy: -946.552 where: short stacking energy: -397.780 Base-Backbone interact. energy: -0.141 local terms energy: -386.672667 where: bonds (distance) C4'-P energy: -76.540 bonds (distance) P-C4' energy: -66.330 flat angles C4'-P-C4' energy: -93.074 flat angles P-C4'-P energy: -47.417 tors. eta vs tors. theta energy: -103.311 Dist. restrs. and SS energy: 14.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1678.551821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1678.551821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.365231 (E_RNA) where: Base-Base interactions energy: -1214.409 where: short stacking energy: -531.062 Base-Backbone interact. energy: -1.494 local terms energy: -500.462327 where: bonds (distance) C4'-P energy: -94.366 bonds (distance) P-C4' energy: -86.239 flat angles C4'-P-C4' energy: -110.908 flat angles P-C4'-P energy: -54.890 tors. eta vs tors. theta energy: -154.059 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1647.752814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.752814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.967759 (E_RNA) where: Base-Base interactions energy: -1194.769 where: short stacking energy: -492.549 Base-Backbone interact. energy: -0.999 local terms energy: -489.199862 where: bonds (distance) C4'-P energy: -87.772 bonds (distance) P-C4' energy: -97.253 flat angles C4'-P-C4' energy: -107.446 flat angles P-C4'-P energy: -67.017 tors. eta vs tors. theta energy: -129.712 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1618.077458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.077458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.974732 (E_RNA) where: Base-Base interactions energy: -1171.405 where: short stacking energy: -485.901 Base-Backbone interact. energy: -1.590 local terms energy: -482.979253 where: bonds (distance) C4'-P energy: -81.828 bonds (distance) P-C4' energy: -96.315 flat angles C4'-P-C4' energy: -99.107 flat angles P-C4'-P energy: -61.749 tors. eta vs tors. theta energy: -143.980 Dist. restrs. and SS energy: 1.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1551.577270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.577270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.218139 (E_RNA) where: Base-Base interactions energy: -1135.313 where: short stacking energy: -475.190 Base-Backbone interact. energy: -2.255 local terms energy: -457.649622 where: bonds (distance) C4'-P energy: -91.335 bonds (distance) P-C4' energy: -79.108 flat angles C4'-P-C4' energy: -94.797 flat angles P-C4'-P energy: -63.684 tors. eta vs tors. theta energy: -128.726 Dist. restrs. and SS energy: 6.891 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1529.047539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.047539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.664463 (E_RNA) where: Base-Base interactions energy: -1107.099 where: short stacking energy: -457.925 Base-Backbone interact. energy: 3.537 local terms energy: -463.102661 where: bonds (distance) C4'-P energy: -83.936 bonds (distance) P-C4' energy: -85.420 flat angles C4'-P-C4' energy: -98.491 flat angles P-C4'-P energy: -64.193 tors. eta vs tors. theta energy: -131.063 Dist. restrs. and SS energy: 0.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1482.906236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.906236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.623410 (E_RNA) where: Base-Base interactions energy: -1088.528 where: short stacking energy: -441.228 Base-Backbone interact. energy: 2.895 local terms energy: -434.991003 where: bonds (distance) C4'-P energy: -75.928 bonds (distance) P-C4' energy: -80.769 flat angles C4'-P-C4' energy: -97.719 flat angles P-C4'-P energy: -62.557 tors. eta vs tors. theta energy: -118.018 Dist. restrs. and SS energy: 0.967 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1451.313682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.313682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.253283 (E_RNA) where: Base-Base interactions energy: -1073.150 where: short stacking energy: -444.775 Base-Backbone interact. energy: -2.707 local terms energy: -413.396084 where: bonds (distance) C4'-P energy: -84.830 bonds (distance) P-C4' energy: -75.853 flat angles C4'-P-C4' energy: -90.098 flat angles P-C4'-P energy: -44.222 tors. eta vs tors. theta energy: -118.393 Dist. restrs. and SS energy: 1.190 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1371.821410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.821410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.331782 (E_RNA) where: Base-Base interactions energy: -1006.523 where: short stacking energy: -416.869 Base-Backbone interact. energy: 0.067 local terms energy: -407.875859 where: bonds (distance) C4'-P energy: -68.210 bonds (distance) P-C4' energy: -70.322 flat angles C4'-P-C4' energy: -87.912 flat angles P-C4'-P energy: -59.010 tors. eta vs tors. theta energy: -122.422 Dist. restrs. and SS energy: 5.760 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1313.517294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.517294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.526624 (E_RNA) where: Base-Base interactions energy: -955.043 where: short stacking energy: -394.928 Base-Backbone interact. energy: 2.680 local terms energy: -409.163015 where: bonds (distance) C4'-P energy: -73.828 bonds (distance) P-C4' energy: -74.965 flat angles C4'-P-C4' energy: -99.188 flat angles P-C4'-P energy: -57.575 tors. eta vs tors. theta energy: -103.608 Dist. restrs. and SS energy: 11.259 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -1245.800742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.800742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.030000 (E_RNA) where: Base-Base interactions energy: -937.166 where: short stacking energy: -391.147 Base-Backbone interact. energy: -0.795 local terms energy: -360.069364 where: bonds (distance) C4'-P energy: -75.428 bonds (distance) P-C4' energy: -62.512 flat angles C4'-P-C4' energy: -75.126 flat angles P-C4'-P energy: -45.373 tors. eta vs tors. theta energy: -101.631 Dist. restrs. and SS energy: 15.479 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1695.433113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.433113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.268713 (E_RNA) where: Base-Base interactions energy: -1211.412 where: short stacking energy: -521.351 Base-Backbone interact. energy: -1.718 local terms energy: -520.138925 where: bonds (distance) C4'-P energy: -88.113 bonds (distance) P-C4' energy: -97.443 flat angles C4'-P-C4' energy: -115.148 flat angles P-C4'-P energy: -67.867 tors. eta vs tors. theta energy: -151.569 Dist. restrs. and SS energy: 1.086 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1630.478184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.478184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.846847 (E_RNA) where: Base-Base interactions energy: -1193.680 where: short stacking energy: -487.216 Base-Backbone interact. energy: 1.001 local terms energy: -475.167936 where: bonds (distance) C4'-P energy: -85.971 bonds (distance) P-C4' energy: -90.407 flat angles C4'-P-C4' energy: -107.566 flat angles P-C4'-P energy: -61.355 tors. eta vs tors. theta energy: -129.868 Dist. restrs. and SS energy: 0.619 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1596.681264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.681264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.057108 (E_RNA) where: Base-Base interactions energy: -1160.836 where: short stacking energy: -476.635 Base-Backbone interact. energy: -1.890 local terms energy: -472.331077 where: bonds (distance) C4'-P energy: -81.094 bonds (distance) P-C4' energy: -90.619 flat angles C4'-P-C4' energy: -100.056 flat angles P-C4'-P energy: -61.231 tors. eta vs tors. theta energy: -139.331 Dist. restrs. and SS energy: 1.626 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1570.269310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.269310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.710831 (E_RNA) where: Base-Base interactions energy: -1152.768 where: short stacking energy: -469.466 Base-Backbone interact. energy: 0.716 local terms energy: -455.658884 where: bonds (distance) C4'-P energy: -82.110 bonds (distance) P-C4' energy: -77.664 flat angles C4'-P-C4' energy: -109.367 flat angles P-C4'-P energy: -55.986 tors. eta vs tors. theta energy: -130.531 Dist. restrs. and SS energy: 0.692 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1508.811569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.811569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.149399 (E_RNA) where: Base-Base interactions energy: -1084.730 where: short stacking energy: -457.867 Base-Backbone interact. energy: 0.031 local terms energy: -469.450813 where: bonds (distance) C4'-P energy: -89.768 bonds (distance) P-C4' energy: -84.684 flat angles C4'-P-C4' energy: -98.810 flat angles P-C4'-P energy: -63.621 tors. eta vs tors. theta energy: -132.568 Dist. restrs. and SS energy: 8.588 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1468.794773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.794773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.079434 (E_RNA) where: Base-Base interactions energy: -1081.513 where: short stacking energy: -432.917 Base-Backbone interact. energy: 2.239 local terms energy: -426.805842 where: bonds (distance) C4'-P energy: -65.667 bonds (distance) P-C4' energy: -75.434 flat angles C4'-P-C4' energy: -99.598 flat angles P-C4'-P energy: -63.264 tors. eta vs tors. theta energy: -122.843 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1471.160623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.160623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.244106 (E_RNA) where: Base-Base interactions energy: -1069.328 where: short stacking energy: -452.831 Base-Backbone interact. energy: -2.280 local terms energy: -437.636155 where: bonds (distance) C4'-P energy: -66.341 bonds (distance) P-C4' energy: -83.557 flat angles C4'-P-C4' energy: -92.484 flat angles P-C4'-P energy: -60.557 tors. eta vs tors. theta energy: -134.696 Dist. restrs. and SS energy: 1.333 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1369.797420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.797420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.916751 (E_RNA) where: Base-Base interactions energy: -988.038 where: short stacking energy: -417.410 Base-Backbone interact. energy: -0.513 local terms energy: -423.365468 where: bonds (distance) C4'-P energy: -71.969 bonds (distance) P-C4' energy: -87.253 flat angles C4'-P-C4' energy: -94.652 flat angles P-C4'-P energy: -57.514 tors. eta vs tors. theta energy: -111.977 Dist. restrs. and SS energy: 5.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1307.616948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.616948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.736244 (E_RNA) where: Base-Base interactions energy: -952.204 where: short stacking energy: -395.978 Base-Backbone interact. energy: -2.050 local terms energy: -411.482089 where: bonds (distance) C4'-P energy: -67.006 bonds (distance) P-C4' energy: -73.031 flat angles C4'-P-C4' energy: -90.504 flat angles P-C4'-P energy: -64.872 tors. eta vs tors. theta energy: -116.069 Dist. restrs. and SS energy: 21.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -1275.083608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.083608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.844188 (E_RNA) where: Base-Base interactions energy: -942.691 where: short stacking energy: -372.643 Base-Backbone interact. energy: 0.358 local terms energy: -373.510352 where: bonds (distance) C4'-P energy: -77.035 bonds (distance) P-C4' energy: -83.298 flat angles C4'-P-C4' energy: -82.212 flat angles P-C4'-P energy: -36.744 tors. eta vs tors. theta energy: -94.222 Dist. restrs. and SS energy: 4.011 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1668.730037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.730037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.168415 (E_RNA) where: Base-Base interactions energy: -1211.124 where: short stacking energy: -503.852 Base-Backbone interact. energy: -0.539 local terms energy: -494.505391 where: bonds (distance) C4'-P energy: -89.740 bonds (distance) P-C4' energy: -90.354 flat angles C4'-P-C4' energy: -107.781 flat angles P-C4'-P energy: -69.606 tors. eta vs tors. theta energy: -137.024 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1617.637920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.637920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.365860 (E_RNA) where: Base-Base interactions energy: -1152.421 where: short stacking energy: -473.451 Base-Backbone interact. energy: -1.605 local terms energy: -501.339909 where: bonds (distance) C4'-P energy: -90.547 bonds (distance) P-C4' energy: -88.508 flat angles C4'-P-C4' energy: -106.327 flat angles P-C4'-P energy: -79.713 tors. eta vs tors. theta energy: -136.245 Dist. restrs. and SS energy: 0.978 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1615.893955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.893955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.816918 (E_RNA) where: Base-Base interactions energy: -1160.971 where: short stacking energy: -477.664 Base-Backbone interact. energy: -1.610 local terms energy: -491.235990 where: bonds (distance) C4'-P energy: -82.254 bonds (distance) P-C4' energy: -95.669 flat angles C4'-P-C4' energy: -103.767 flat angles P-C4'-P energy: -67.986 tors. eta vs tors. theta energy: -141.561 Dist. restrs. and SS energy: 1.173 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1607.967739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.967739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.356832 (E_RNA) where: Base-Base interactions energy: -1156.483 where: short stacking energy: -477.364 Base-Backbone interact. energy: 1.460 local terms energy: -491.333414 where: bonds (distance) C4'-P energy: -88.980 bonds (distance) P-C4' energy: -93.801 flat angles C4'-P-C4' energy: -99.656 flat angles P-C4'-P energy: -67.739 tors. eta vs tors. theta energy: -141.158 Dist. restrs. and SS energy: 1.639 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1508.722013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.722013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.879265 (E_RNA) where: Base-Base interactions energy: -1098.817 where: short stacking energy: -451.600 Base-Backbone interact. energy: -0.471 local terms energy: -447.591513 where: bonds (distance) C4'-P energy: -84.417 bonds (distance) P-C4' energy: -79.292 flat angles C4'-P-C4' energy: -101.988 flat angles P-C4'-P energy: -58.074 tors. eta vs tors. theta energy: -123.821 Dist. restrs. and SS energy: 1.407 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1482.669788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.669788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.172211 (E_RNA) where: Base-Base interactions energy: -1088.446 where: short stacking energy: -452.067 Base-Backbone interact. energy: -0.635 local terms energy: -439.091873 where: bonds (distance) C4'-P energy: -61.848 bonds (distance) P-C4' energy: -98.816 flat angles C4'-P-C4' energy: -89.690 flat angles P-C4'-P energy: -60.836 tors. eta vs tors. theta energy: -127.902 Dist. restrs. and SS energy: 8.752 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1390.700410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.700410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.025779 (E_RNA) where: Base-Base interactions energy: -1000.515 where: short stacking energy: -426.246 Base-Backbone interact. energy: -1.582 local terms energy: -429.928907 where: bonds (distance) C4'-P energy: -68.900 bonds (distance) P-C4' energy: -77.875 flat angles C4'-P-C4' energy: -103.774 flat angles P-C4'-P energy: -57.294 tors. eta vs tors. theta energy: -122.086 Dist. restrs. and SS energy: 4.575 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1412.648856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.648856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.708681 (E_RNA) where: Base-Base interactions energy: -1028.100 where: short stacking energy: -404.990 Base-Backbone interact. energy: -1.356 local terms energy: -421.252669 where: bonds (distance) C4'-P energy: -82.513 bonds (distance) P-C4' energy: -78.525 flat angles C4'-P-C4' energy: -87.075 flat angles P-C4'-P energy: -59.540 tors. eta vs tors. theta energy: -113.601 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1329.162172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.162172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.819928 (E_RNA) where: Base-Base interactions energy: -1003.766 where: short stacking energy: -399.377 Base-Backbone interact. energy: 0.869 local terms energy: -364.922513 where: bonds (distance) C4'-P energy: -60.062 bonds (distance) P-C4' energy: -62.336 flat angles C4'-P-C4' energy: -90.721 flat angles P-C4'-P energy: -46.006 tors. eta vs tors. theta energy: -105.797 Dist. restrs. and SS energy: 1.908 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -1242.486712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.486712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.649126 (E_RNA) where: Base-Base interactions energy: -908.546 where: short stacking energy: -364.390 Base-Backbone interact. energy: 2.680 local terms energy: -384.783209 where: bonds (distance) C4'-P energy: -64.629 bonds (distance) P-C4' energy: -82.649 flat angles C4'-P-C4' energy: -75.656 flat angles P-C4'-P energy: -50.741 tors. eta vs tors. theta energy: -111.108 Dist. restrs. and SS energy: 11.412 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1678.635200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1678.635200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.446780 (E_RNA) where: Base-Base interactions energy: -1227.202 where: short stacking energy: -531.041 Base-Backbone interact. energy: 1.531 local terms energy: -490.776399 where: bonds (distance) C4'-P energy: -88.645 bonds (distance) P-C4' energy: -102.695 flat angles C4'-P-C4' energy: -95.042 flat angles P-C4'-P energy: -64.993 tors. eta vs tors. theta energy: -139.401 Dist. restrs. and SS energy: 1.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1606.842972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.842972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.661817 (E_RNA) where: Base-Base interactions energy: -1167.530 where: short stacking energy: -490.298 Base-Backbone interact. energy: -2.264 local terms energy: -474.867560 where: bonds (distance) C4'-P energy: -81.590 bonds (distance) P-C4' energy: -86.614 flat angles C4'-P-C4' energy: -111.393 flat angles P-C4'-P energy: -65.872 tors. eta vs tors. theta energy: -129.399 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1642.241470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.241470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.520212 (E_RNA) where: Base-Base interactions energy: -1199.243 where: short stacking energy: -498.472 Base-Backbone interact. energy: 0.680 local terms energy: -481.957303 where: bonds (distance) C4'-P energy: -95.337 bonds (distance) P-C4' energy: -90.404 flat angles C4'-P-C4' energy: -89.467 flat angles P-C4'-P energy: -66.529 tors. eta vs tors. theta energy: -140.221 Dist. restrs. and SS energy: 1.529 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1570.433708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.433708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.024098 (E_RNA) where: Base-Base interactions energy: -1129.250 where: short stacking energy: -466.658 Base-Backbone interact. energy: -0.934 local terms energy: -477.840071 where: bonds (distance) C4'-P energy: -81.275 bonds (distance) P-C4' energy: -99.752 flat angles C4'-P-C4' energy: -94.762 flat angles P-C4'-P energy: -61.935 tors. eta vs tors. theta energy: -140.116 Dist. restrs. and SS energy: 0.840 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1529.192054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.192054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.259219 (E_RNA) where: Base-Base interactions energy: -1098.682 where: short stacking energy: -443.564 Base-Backbone interact. energy: -1.288 local terms energy: -467.289290 where: bonds (distance) C4'-P energy: -78.624 bonds (distance) P-C4' energy: -85.009 flat angles C4'-P-C4' energy: -99.851 flat angles P-C4'-P energy: -68.092 tors. eta vs tors. theta energy: -135.714 Dist. restrs. and SS energy: 1.317 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1446.627079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.627079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.231990 (E_RNA) where: Base-Base interactions energy: -1057.017 where: short stacking energy: -455.926 Base-Backbone interact. energy: -2.149 local terms energy: -433.065597 where: bonds (distance) C4'-P energy: -68.795 bonds (distance) P-C4' energy: -81.879 flat angles C4'-P-C4' energy: -93.951 flat angles P-C4'-P energy: -68.717 tors. eta vs tors. theta energy: -119.723 Dist. restrs. and SS energy: 8.855 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1416.222979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.222979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.750735 (E_RNA) where: Base-Base interactions energy: -1015.908 where: short stacking energy: -407.601 Base-Backbone interact. energy: -0.927 local terms energy: -437.915669 where: bonds (distance) C4'-P energy: -80.479 bonds (distance) P-C4' energy: -81.108 flat angles C4'-P-C4' energy: -97.571 flat angles P-C4'-P energy: -53.501 tors. eta vs tors. theta energy: -125.257 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1418.045856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.045856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.309993 (E_RNA) where: Base-Base interactions energy: -1053.056 where: short stacking energy: -419.448 Base-Backbone interact. energy: -2.111 local terms energy: -401.142544 where: bonds (distance) C4'-P energy: -66.278 bonds (distance) P-C4' energy: -75.859 flat angles C4'-P-C4' energy: -85.309 flat angles P-C4'-P energy: -55.975 tors. eta vs tors. theta energy: -117.722 Dist. restrs. and SS energy: 1.514 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1415.006537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.006537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.848331 (E_RNA) where: Base-Base interactions energy: -1032.204 where: short stacking energy: -413.411 Base-Backbone interact. energy: -2.893 local terms energy: -418.751088 where: bonds (distance) C4'-P energy: -77.574 bonds (distance) P-C4' energy: -67.216 flat angles C4'-P-C4' energy: -93.344 flat angles P-C4'-P energy: -66.220 tors. eta vs tors. theta energy: -114.396 Dist. restrs. and SS energy: 2.092 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1213.453519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.453519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.022999 (E_RNA) where: Base-Base interactions energy: -913.344 where: short stacking energy: -370.405 Base-Backbone interact. energy: 2.453 local terms energy: -346.131269 where: bonds (distance) C4'-P energy: -51.432 bonds (distance) P-C4' energy: -76.850 flat angles C4'-P-C4' energy: -79.836 flat angles P-C4'-P energy: -41.479 tors. eta vs tors. theta energy: -96.535 Dist. restrs. and SS energy: 6.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1666.039044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.039044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.384549 (E_RNA) where: Base-Base interactions energy: -1193.976 where: short stacking energy: -507.291 Base-Backbone interact. energy: -1.123 local terms energy: -508.285912 where: bonds (distance) C4'-P energy: -90.058 bonds (distance) P-C4' energy: -97.784 flat angles C4'-P-C4' energy: -100.761 flat angles P-C4'-P energy: -72.055 tors. eta vs tors. theta energy: -147.628 Dist. restrs. and SS energy: 0.596 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1605.571572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.571572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.800905 (E_RNA) where: Base-Base interactions energy: -1151.824 where: short stacking energy: -474.821 Base-Backbone interact. energy: -6.525 local terms energy: -485.452657 where: bonds (distance) C4'-P energy: -99.192 bonds (distance) P-C4' energy: -83.094 flat angles C4'-P-C4' energy: -101.215 flat angles P-C4'-P energy: -72.661 tors. eta vs tors. theta energy: -129.290 Dist. restrs. and SS energy: 1.479 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1599.852707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.852707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.653766 (E_RNA) where: Base-Base interactions energy: -1145.765 where: short stacking energy: -467.645 Base-Backbone interact. energy: 0.043 local terms energy: -491.930968 where: bonds (distance) C4'-P energy: -85.721 bonds (distance) P-C4' energy: -96.472 flat angles C4'-P-C4' energy: -100.316 flat angles P-C4'-P energy: -78.863 tors. eta vs tors. theta energy: -130.558 Dist. restrs. and SS energy: 1.051 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1594.873162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.873162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.454730 (E_RNA) where: Base-Base interactions energy: -1177.152 where: short stacking energy: -503.007 Base-Backbone interact. energy: -0.961 local terms energy: -455.341799 where: bonds (distance) C4'-P energy: -63.373 bonds (distance) P-C4' energy: -93.759 flat angles C4'-P-C4' energy: -100.739 flat angles P-C4'-P energy: -60.725 tors. eta vs tors. theta energy: -136.745 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1524.180198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.180198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.751937 (E_RNA) where: Base-Base interactions energy: -1116.453 where: short stacking energy: -460.236 Base-Backbone interact. energy: -0.735 local terms energy: -444.564484 where: bonds (distance) C4'-P energy: -67.766 bonds (distance) P-C4' energy: -82.384 flat angles C4'-P-C4' energy: -100.375 flat angles P-C4'-P energy: -64.487 tors. eta vs tors. theta energy: -129.552 Dist. restrs. and SS energy: 0.822 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1422.955233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.955233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.839051 (E_RNA) where: Base-Base interactions energy: -1083.022 where: short stacking energy: -430.189 Base-Backbone interact. energy: 3.378 local terms energy: -391.194942 where: bonds (distance) C4'-P energy: -75.383 bonds (distance) P-C4' energy: -80.068 flat angles C4'-P-C4' energy: -81.976 flat angles P-C4'-P energy: -50.667 tors. eta vs tors. theta energy: -103.101 Dist. restrs. and SS energy: 11.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1417.377993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.377993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.848174 (E_RNA) where: Base-Base interactions energy: -1035.731 where: short stacking energy: -421.145 Base-Backbone interact. energy: -1.103 local terms energy: -419.014341 where: bonds (distance) C4'-P energy: -71.616 bonds (distance) P-C4' energy: -85.326 flat angles C4'-P-C4' energy: -95.632 flat angles P-C4'-P energy: -47.244 tors. eta vs tors. theta energy: -119.196 Dist. restrs. and SS energy: 1.720 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1406.940211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.940211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.905452 (E_RNA) where: Base-Base interactions energy: -1022.595 where: short stacking energy: -426.595 Base-Backbone interact. energy: 0.467 local terms energy: -423.776626 where: bonds (distance) C4'-P energy: -66.703 bonds (distance) P-C4' energy: -89.098 flat angles C4'-P-C4' energy: -85.460 flat angles P-C4'-P energy: -66.239 tors. eta vs tors. theta energy: -116.277 Dist. restrs. and SS energy: 2.215 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1387.269659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.269659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.069141 (E_RNA) where: Base-Base interactions energy: -1022.120 where: short stacking energy: -386.872 Base-Backbone interact. energy: -2.290 local terms energy: -400.659452 where: bonds (distance) C4'-P energy: -66.568 bonds (distance) P-C4' energy: -85.237 flat angles C4'-P-C4' energy: -90.213 flat angles P-C4'-P energy: -59.600 tors. eta vs tors. theta energy: -99.041 Dist. restrs. and SS energy: 1.049 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1230.389809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.389809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.784098 (E_RNA) where: Base-Base interactions energy: -943.759 where: short stacking energy: -382.290 Base-Backbone interact. energy: -1.864 local terms energy: -339.161180 where: bonds (distance) C4'-P energy: -74.565 bonds (distance) P-C4' energy: -57.777 flat angles C4'-P-C4' energy: -84.911 flat angles P-C4'-P energy: -35.925 tors. eta vs tors. theta energy: -85.983 Dist. restrs. and SS energy: 17.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1687.280442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.280442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.612815 (E_RNA) where: Base-Base interactions energy: -1206.477 where: short stacking energy: -521.259 Base-Backbone interact. energy: -2.846 local terms energy: -516.289751 where: bonds (distance) C4'-P energy: -99.258 bonds (distance) P-C4' energy: -90.318 flat angles C4'-P-C4' energy: -107.099 flat angles P-C4'-P energy: -76.311 tors. eta vs tors. theta energy: -143.303 Dist. restrs. and SS energy: 1.582 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1635.879037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.879037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.879512 (E_RNA) where: Base-Base interactions energy: -1187.814 where: short stacking energy: -499.854 Base-Backbone interact. energy: -1.786 local terms energy: -484.279260 where: bonds (distance) C4'-P energy: -90.821 bonds (distance) P-C4' energy: -77.899 flat angles C4'-P-C4' energy: -103.007 flat angles P-C4'-P energy: -70.207 tors. eta vs tors. theta energy: -142.345 Dist. restrs. and SS energy: 1.250 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1629.523739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.523739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.123943 (E_RNA) where: Base-Base interactions energy: -1186.052 where: short stacking energy: -498.859 Base-Backbone interact. energy: -0.149 local terms energy: -480.922497 where: bonds (distance) C4'-P energy: -93.506 bonds (distance) P-C4' energy: -80.025 flat angles C4'-P-C4' energy: -100.269 flat angles P-C4'-P energy: -69.526 tors. eta vs tors. theta energy: -137.596 Dist. restrs. and SS energy: 0.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1579.779636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.779636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.433104 (E_RNA) where: Base-Base interactions energy: -1141.418 where: short stacking energy: -468.600 Base-Backbone interact. energy: -0.765 local terms energy: -475.250348 where: bonds (distance) C4'-P energy: -93.084 bonds (distance) P-C4' energy: -81.969 flat angles C4'-P-C4' energy: -91.805 flat angles P-C4'-P energy: -73.161 tors. eta vs tors. theta energy: -135.231 Dist. restrs. and SS energy: 0.903 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1513.251291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1513.251291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.706979 (E_RNA) where: Base-Base interactions energy: -1098.824 where: short stacking energy: -455.437 Base-Backbone interact. energy: -0.432 local terms energy: -451.450735 where: bonds (distance) C4'-P energy: -76.712 bonds (distance) P-C4' energy: -84.656 flat angles C4'-P-C4' energy: -95.391 flat angles P-C4'-P energy: -60.058 tors. eta vs tors. theta energy: -134.633 Dist. restrs. and SS energy: 0.706 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1478.824006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.824006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.536017 (E_RNA) where: Base-Base interactions energy: -1069.876 where: short stacking energy: -412.404 Base-Backbone interact. energy: -1.842 local terms energy: -455.818788 where: bonds (distance) C4'-P energy: -71.155 bonds (distance) P-C4' energy: -92.093 flat angles C4'-P-C4' energy: -96.737 flat angles P-C4'-P energy: -74.412 tors. eta vs tors. theta energy: -121.421 Dist. restrs. and SS energy: 11.962 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1435.659422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.659422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.207469 (E_RNA) where: Base-Base interactions energy: -1041.002 where: short stacking energy: -422.318 Base-Backbone interact. energy: 0.119 local terms energy: -435.324459 where: bonds (distance) C4'-P energy: -83.884 bonds (distance) P-C4' energy: -84.347 flat angles C4'-P-C4' energy: -88.090 flat angles P-C4'-P energy: -52.140 tors. eta vs tors. theta energy: -126.863 Dist. restrs. and SS energy: 3.798 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1427.544064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.544064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.496563 (E_RNA) where: Base-Base interactions energy: -1028.580 where: short stacking energy: -433.700 Base-Backbone interact. energy: 0.666 local terms energy: -437.582525 where: bonds (distance) C4'-P energy: -74.525 bonds (distance) P-C4' energy: -87.404 flat angles C4'-P-C4' energy: -90.865 flat angles P-C4'-P energy: -71.665 tors. eta vs tors. theta energy: -113.125 Dist. restrs. and SS energy: 1.202 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1364.784031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.784031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.553806 (E_RNA) where: Base-Base interactions energy: -1016.041 where: short stacking energy: -404.070 Base-Backbone interact. energy: -1.564 local terms energy: -385.948534 where: bonds (distance) C4'-P energy: -69.819 bonds (distance) P-C4' energy: -63.000 flat angles C4'-P-C4' energy: -83.536 flat angles P-C4'-P energy: -51.828 tors. eta vs tors. theta energy: -117.765 Dist. restrs. and SS energy: 2.020 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -1267.061864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.061864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.407336 (E_RNA) where: Base-Base interactions energy: -942.929 where: short stacking energy: -382.157 Base-Backbone interact. energy: -1.833 local terms energy: -370.645622 where: bonds (distance) C4'-P energy: -57.375 bonds (distance) P-C4' energy: -84.406 flat angles C4'-P-C4' energy: -87.349 flat angles P-C4'-P energy: -42.332 tors. eta vs tors. theta energy: -99.185 Dist. restrs. and SS energy: 11.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1648.518050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.518050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.400433 (E_RNA) where: Base-Base interactions energy: -1194.476 where: short stacking energy: -503.277 Base-Backbone interact. energy: -1.233 local terms energy: -490.691287 where: bonds (distance) C4'-P energy: -89.311 bonds (distance) P-C4' energy: -88.998 flat angles C4'-P-C4' energy: -93.491 flat angles P-C4'-P energy: -74.907 tors. eta vs tors. theta energy: -143.985 Dist. restrs. and SS energy: 1.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1636.224089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.224089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.626028 (E_RNA) where: Base-Base interactions energy: -1195.240 where: short stacking energy: -490.561 Base-Backbone interact. energy: 0.964 local terms energy: -479.349977 where: bonds (distance) C4'-P energy: -90.088 bonds (distance) P-C4' energy: -83.698 flat angles C4'-P-C4' energy: -100.492 flat angles P-C4'-P energy: -69.295 tors. eta vs tors. theta energy: -135.776 Dist. restrs. and SS energy: 0.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1603.077287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.077287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.874102 (E_RNA) where: Base-Base interactions energy: -1158.445 where: short stacking energy: -480.922 Base-Backbone interact. energy: -2.135 local terms energy: -480.294339 where: bonds (distance) C4'-P energy: -86.415 bonds (distance) P-C4' energy: -89.845 flat angles C4'-P-C4' energy: -103.217 flat angles P-C4'-P energy: -69.846 tors. eta vs tors. theta energy: -130.972 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1543.086829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.086829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.516984 (E_RNA) where: Base-Base interactions energy: -1126.042 where: short stacking energy: -463.480 Base-Backbone interact. energy: -3.349 local terms energy: -452.126182 where: bonds (distance) C4'-P energy: -76.397 bonds (distance) P-C4' energy: -79.232 flat angles C4'-P-C4' energy: -104.758 flat angles P-C4'-P energy: -62.385 tors. eta vs tors. theta energy: -129.355 Dist. restrs. and SS energy: 1.680 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1488.666035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.666035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.354116 (E_RNA) where: Base-Base interactions energy: -1071.805 where: short stacking energy: -443.847 Base-Backbone interact. energy: -2.072 local terms energy: -452.476724 where: bonds (distance) C4'-P energy: -80.186 bonds (distance) P-C4' energy: -80.486 flat angles C4'-P-C4' energy: -91.892 flat angles P-C4'-P energy: -74.045 tors. eta vs tors. theta energy: -125.869 Dist. restrs. and SS energy: 0.938 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1453.999015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.999015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.055865 (E_RNA) where: Base-Base interactions energy: -1073.672 where: short stacking energy: -433.619 Base-Backbone interact. energy: -3.714 local terms energy: -423.669180 where: bonds (distance) C4'-P energy: -87.881 bonds (distance) P-C4' energy: -81.096 flat angles C4'-P-C4' energy: -87.996 flat angles P-C4'-P energy: -46.519 tors. eta vs tors. theta energy: -120.176 Dist. restrs. and SS energy: 10.307 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1441.053651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.053651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.733535 (E_RNA) where: Base-Base interactions energy: -1059.615 where: short stacking energy: -426.328 Base-Backbone interact. energy: -2.089 local terms energy: -417.029291 where: bonds (distance) C4'-P energy: -79.159 bonds (distance) P-C4' energy: -81.023 flat angles C4'-P-C4' energy: -99.879 flat angles P-C4'-P energy: -39.867 tors. eta vs tors. theta energy: -117.101 Dist. restrs. and SS energy: 0.930 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1390.510303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.510303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.792335 (E_RNA) where: Base-Base interactions energy: -1003.311 where: short stacking energy: -410.423 Base-Backbone interact. energy: 0.293 local terms energy: -425.773923 where: bonds (distance) C4'-P energy: -68.304 bonds (distance) P-C4' energy: -86.430 flat angles C4'-P-C4' energy: -103.305 flat angles P-C4'-P energy: -48.753 tors. eta vs tors. theta energy: -118.982 Dist. restrs. and SS energy: 1.532 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1353.044506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.044506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.853862 (E_RNA) where: Base-Base interactions energy: -1003.408 where: short stacking energy: -399.567 Base-Backbone interact. energy: -2.206 local terms energy: -386.239791 where: bonds (distance) C4'-P energy: -72.179 bonds (distance) P-C4' energy: -62.317 flat angles C4'-P-C4' energy: -87.410 flat angles P-C4'-P energy: -57.973 tors. eta vs tors. theta energy: -106.361 Dist. restrs. and SS energy: 2.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1221.441514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.441514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.872330 (E_RNA) where: Base-Base interactions energy: -909.259 where: short stacking energy: -368.004 Base-Backbone interact. energy: 0.948 local terms energy: -362.561454 where: bonds (distance) C4'-P energy: -58.087 bonds (distance) P-C4' energy: -87.501 flat angles C4'-P-C4' energy: -74.805 flat angles P-C4'-P energy: -42.432 tors. eta vs tors. theta energy: -99.737 Dist. restrs. and SS energy: 12.681 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1661.439859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.439859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.224490 (E_RNA) where: Base-Base interactions energy: -1185.649 where: short stacking energy: -513.432 Base-Backbone interact. energy: -1.442 local terms energy: -512.133243 where: bonds (distance) C4'-P energy: -98.275 bonds (distance) P-C4' energy: -99.576 flat angles C4'-P-C4' energy: -102.104 flat angles P-C4'-P energy: -71.463 tors. eta vs tors. theta energy: -140.716 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1651.686639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.686639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.996072 (E_RNA) where: Base-Base interactions energy: -1180.614 where: short stacking energy: -510.155 Base-Backbone interact. energy: 0.049 local terms energy: -509.431170 where: bonds (distance) C4'-P energy: -90.858 bonds (distance) P-C4' energy: -100.054 flat angles C4'-P-C4' energy: -106.590 flat angles P-C4'-P energy: -66.963 tors. eta vs tors. theta energy: -144.967 Dist. restrs. and SS energy: 1.559 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1633.763595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.763595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.426335 (E_RNA) where: Base-Base interactions energy: -1199.109 where: short stacking energy: -506.579 Base-Backbone interact. energy: -0.877 local terms energy: -471.440396 where: bonds (distance) C4'-P energy: -86.085 bonds (distance) P-C4' energy: -73.922 flat angles C4'-P-C4' energy: -100.998 flat angles P-C4'-P energy: -68.620 tors. eta vs tors. theta energy: -141.816 Dist. restrs. and SS energy: 0.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1572.636337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.636337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.394834 (E_RNA) where: Base-Base interactions energy: -1173.050 where: short stacking energy: -483.437 Base-Backbone interact. energy: -0.842 local terms energy: -436.503675 where: bonds (distance) C4'-P energy: -73.824 bonds (distance) P-C4' energy: -79.383 flat angles C4'-P-C4' energy: -93.416 flat angles P-C4'-P energy: -62.015 tors. eta vs tors. theta energy: -127.866 Dist. restrs. and SS energy: 1.008 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1502.535242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.535242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.985129 (E_RNA) where: Base-Base interactions energy: -1110.477 where: short stacking energy: -450.660 Base-Backbone interact. energy: -2.406 local terms energy: -427.102109 where: bonds (distance) C4'-P energy: -74.703 bonds (distance) P-C4' energy: -73.892 flat angles C4'-P-C4' energy: -93.929 flat angles P-C4'-P energy: -54.039 tors. eta vs tors. theta energy: -130.540 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1433.643846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.643846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.590500 (E_RNA) where: Base-Base interactions energy: -1051.228 where: short stacking energy: -439.206 Base-Backbone interact. energy: -1.715 local terms energy: -429.646971 where: bonds (distance) C4'-P energy: -72.661 bonds (distance) P-C4' energy: -84.207 flat angles C4'-P-C4' energy: -89.553 flat angles P-C4'-P energy: -66.881 tors. eta vs tors. theta energy: -116.345 Dist. restrs. and SS energy: 12.197 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1447.674625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.674625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.955602 (E_RNA) where: Base-Base interactions energy: -1048.421 where: short stacking energy: -440.706 Base-Backbone interact. energy: -1.076 local terms energy: -436.458628 where: bonds (distance) C4'-P energy: -72.619 bonds (distance) P-C4' energy: -91.585 flat angles C4'-P-C4' energy: -86.903 flat angles P-C4'-P energy: -50.849 tors. eta vs tors. theta energy: -134.503 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1428.646319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.646319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.097724 (E_RNA) where: Base-Base interactions energy: -1042.586 where: short stacking energy: -457.010 Base-Backbone interact. energy: 0.170 local terms energy: -424.681667 where: bonds (distance) C4'-P energy: -76.446 bonds (distance) P-C4' energy: -67.644 flat angles C4'-P-C4' energy: -101.968 flat angles P-C4'-P energy: -50.348 tors. eta vs tors. theta energy: -128.275 Dist. restrs. and SS energy: 1.701 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1370.079172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.079172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.512132 (E_RNA) where: Base-Base interactions energy: -1002.174 where: short stacking energy: -391.275 Base-Backbone interact. energy: -1.969 local terms energy: -404.369250 where: bonds (distance) C4'-P energy: -66.127 bonds (distance) P-C4' energy: -74.899 flat angles C4'-P-C4' energy: -92.470 flat angles P-C4'-P energy: -61.299 tors. eta vs tors. theta energy: -109.575 Dist. restrs. and SS energy: 1.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1251.099680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.099680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.025294 (E_RNA) where: Base-Base interactions energy: -950.136 where: short stacking energy: -399.624 Base-Backbone interact. energy: 0.634 local terms energy: -351.523949 where: bonds (distance) C4'-P energy: -42.466 bonds (distance) P-C4' energy: -66.608 flat angles C4'-P-C4' energy: -91.332 flat angles P-C4'-P energy: -50.806 tors. eta vs tors. theta energy: -100.312 Dist. restrs. and SS energy: 13.176 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1693.312148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.312148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.686354 (E_RNA) where: Base-Base interactions energy: -1210.241 where: short stacking energy: -525.976 Base-Backbone interact. energy: -0.798 local terms energy: -519.646550 where: bonds (distance) C4'-P energy: -87.398 bonds (distance) P-C4' energy: -92.502 flat angles C4'-P-C4' energy: -116.747 flat angles P-C4'-P energy: -69.371 tors. eta vs tors. theta energy: -153.629 Dist. restrs. and SS energy: 0.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1652.887298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.887298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.186025 (E_RNA) where: Base-Base interactions energy: -1208.147 where: short stacking energy: -517.965 Base-Backbone interact. energy: -1.433 local terms energy: -481.605937 where: bonds (distance) C4'-P energy: -99.348 bonds (distance) P-C4' energy: -88.968 flat angles C4'-P-C4' energy: -97.995 flat angles P-C4'-P energy: -59.198 tors. eta vs tors. theta energy: -136.096 Dist. restrs. and SS energy: 1.549 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1639.694354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.694354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.083792 (E_RNA) where: Base-Base interactions energy: -1182.533 where: short stacking energy: -484.124 Base-Backbone interact. energy: -2.149 local terms energy: -493.402141 where: bonds (distance) C4'-P energy: -90.824 bonds (distance) P-C4' energy: -88.444 flat angles C4'-P-C4' energy: -107.667 flat angles P-C4'-P energy: -64.773 tors. eta vs tors. theta energy: -141.695 Dist. restrs. and SS energy: 1.639 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1571.501992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.501992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.238013 (E_RNA) where: Base-Base interactions energy: -1144.243 where: short stacking energy: -473.236 Base-Backbone interact. energy: -2.791 local terms energy: -462.204095 where: bonds (distance) C4'-P energy: -83.008 bonds (distance) P-C4' energy: -86.706 flat angles C4'-P-C4' energy: -100.712 flat angles P-C4'-P energy: -64.695 tors. eta vs tors. theta energy: -127.082 Dist. restrs. and SS energy: 0.986 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1509.951969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.951969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.814163 (E_RNA) where: Base-Base interactions energy: -1089.540 where: short stacking energy: -445.129 Base-Backbone interact. energy: -2.410 local terms energy: -455.863870 where: bonds (distance) C4'-P energy: -55.305 bonds (distance) P-C4' energy: -93.602 flat angles C4'-P-C4' energy: -107.217 flat angles P-C4'-P energy: -74.697 tors. eta vs tors. theta energy: -125.044 Dist. restrs. and SS energy: 1.112 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1448.927043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.927043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.390424 (E_RNA) where: Base-Base interactions energy: -1047.563 where: short stacking energy: -427.200 Base-Backbone interact. energy: -0.481 local terms energy: -448.346500 where: bonds (distance) C4'-P energy: -93.711 bonds (distance) P-C4' energy: -72.377 flat angles C4'-P-C4' energy: -98.050 flat angles P-C4'-P energy: -50.988 tors. eta vs tors. theta energy: -133.220 Dist. restrs. and SS energy: 10.713 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1437.549906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.549906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.720097 (E_RNA) where: Base-Base interactions energy: -1050.892 where: short stacking energy: -441.588 Base-Backbone interact. energy: 1.810 local terms energy: -426.639002 where: bonds (distance) C4'-P energy: -71.432 bonds (distance) P-C4' energy: -78.824 flat angles C4'-P-C4' energy: -95.837 flat angles P-C4'-P energy: -62.736 tors. eta vs tors. theta energy: -117.810 Dist. restrs. and SS energy: 1.420 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1385.237134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.237134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.201766 (E_RNA) where: Base-Base interactions energy: -1029.752 where: short stacking energy: -422.845 Base-Backbone interact. energy: -1.162 local terms energy: -392.288112 where: bonds (distance) C4'-P energy: -86.059 bonds (distance) P-C4' energy: -72.136 flat angles C4'-P-C4' energy: -88.941 flat angles P-C4'-P energy: -45.698 tors. eta vs tors. theta energy: -99.454 Dist. restrs. and SS energy: 1.215 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1346.494531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.494531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.413727 (E_RNA) where: Base-Base interactions energy: -1004.053 where: short stacking energy: -400.754 Base-Backbone interact. energy: 0.005 local terms energy: -380.365780 where: bonds (distance) C4'-P energy: -73.772 bonds (distance) P-C4' energy: -65.775 flat angles C4'-P-C4' energy: -78.984 flat angles P-C4'-P energy: -60.442 tors. eta vs tors. theta energy: -101.392 Dist. restrs. and SS energy: 1.169 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1261.005874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.005874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.071409 (E_RNA) where: Base-Base interactions energy: -925.952 where: short stacking energy: -385.181 Base-Backbone interact. energy: -1.424 local terms energy: -383.695742 where: bonds (distance) C4'-P energy: -73.649 bonds (distance) P-C4' energy: -74.193 flat angles C4'-P-C4' energy: -81.684 flat angles P-C4'-P energy: -53.468 tors. eta vs tors. theta energy: -100.703 Dist. restrs. and SS energy: 13.316 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1682.681141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.681141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.282664 (E_RNA) where: Base-Base interactions energy: -1193.071 where: short stacking energy: -501.913 Base-Backbone interact. energy: -2.173 local terms energy: -526.038446 where: bonds (distance) C4'-P energy: -98.151 bonds (distance) P-C4' energy: -88.171 flat angles C4'-P-C4' energy: -107.532 flat angles P-C4'-P energy: -81.376 tors. eta vs tors. theta energy: -150.809 Dist. restrs. and SS energy: 1.852 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1697.730131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.730131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.189220 (E_RNA) where: Base-Base interactions energy: -1222.734 where: short stacking energy: -522.784 Base-Backbone interact. energy: -0.465 local terms energy: -511.990834 where: bonds (distance) C4'-P energy: -93.440 bonds (distance) P-C4' energy: -93.335 flat angles C4'-P-C4' energy: -110.294 flat angles P-C4'-P energy: -74.398 tors. eta vs tors. theta energy: -140.524 Dist. restrs. and SS energy: 0.709 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1637.518507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.518507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.151854 (E_RNA) where: Base-Base interactions energy: -1195.903 where: short stacking energy: -501.877 Base-Backbone interact. energy: 0.357 local terms energy: -479.605744 where: bonds (distance) C4'-P energy: -85.353 bonds (distance) P-C4' energy: -88.451 flat angles C4'-P-C4' energy: -104.664 flat angles P-C4'-P energy: -59.676 tors. eta vs tors. theta energy: -141.462 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1564.963263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.963263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.021203 (E_RNA) where: Base-Base interactions energy: -1135.524 where: short stacking energy: -451.036 Base-Backbone interact. energy: -0.990 local terms energy: -466.507132 where: bonds (distance) C4'-P energy: -86.736 bonds (distance) P-C4' energy: -80.577 flat angles C4'-P-C4' energy: -99.368 flat angles P-C4'-P energy: -66.939 tors. eta vs tors. theta energy: -132.888 Dist. restrs. and SS energy: 1.308 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1494.633208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.633208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.937097 (E_RNA) where: Base-Base interactions energy: -1099.511 where: short stacking energy: -459.502 Base-Backbone interact. energy: 1.682 local terms energy: -435.107671 where: bonds (distance) C4'-P energy: -69.613 bonds (distance) P-C4' energy: -76.154 flat angles C4'-P-C4' energy: -88.033 flat angles P-C4'-P energy: -67.715 tors. eta vs tors. theta energy: -133.593 Dist. restrs. and SS energy: 1.554 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1446.425332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.425332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.290326 (E_RNA) where: Base-Base interactions energy: -1042.254 where: short stacking energy: -437.964 Base-Backbone interact. energy: -0.952 local terms energy: -448.084375 where: bonds (distance) C4'-P energy: -93.929 bonds (distance) P-C4' energy: -73.184 flat angles C4'-P-C4' energy: -96.896 flat angles P-C4'-P energy: -62.867 tors. eta vs tors. theta energy: -121.208 Dist. restrs. and SS energy: 8.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1466.492908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.492908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.059849 (E_RNA) where: Base-Base interactions energy: -1071.734 where: short stacking energy: -442.983 Base-Backbone interact. energy: -3.013 local terms energy: -429.313325 where: bonds (distance) C4'-P energy: -67.827 bonds (distance) P-C4' energy: -93.049 flat angles C4'-P-C4' energy: -94.184 flat angles P-C4'-P energy: -52.505 tors. eta vs tors. theta energy: -121.749 Dist. restrs. and SS energy: 0.817 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1398.962908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.962908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.330289 (E_RNA) where: Base-Base interactions energy: -1012.692 where: short stacking energy: -408.865 Base-Backbone interact. energy: -1.691 local terms energy: -422.947821 where: bonds (distance) C4'-P energy: -70.387 bonds (distance) P-C4' energy: -87.151 flat angles C4'-P-C4' energy: -94.544 flat angles P-C4'-P energy: -52.745 tors. eta vs tors. theta energy: -118.120 Dist. restrs. and SS energy: 1.617 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1364.773454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.773454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.349844 (E_RNA) where: Base-Base interactions energy: -989.357 where: short stacking energy: -397.146 Base-Backbone interact. energy: -1.364 local terms energy: -413.628243 where: bonds (distance) C4'-P energy: -80.024 bonds (distance) P-C4' energy: -77.072 flat angles C4'-P-C4' energy: -86.954 flat angles P-C4'-P energy: -61.027 tors. eta vs tors. theta energy: -108.552 Dist. restrs. and SS energy: 2.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1286.397361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.397361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.619641 (E_RNA) where: Base-Base interactions energy: -950.557 where: short stacking energy: -388.588 Base-Backbone interact. energy: -0.378 local terms energy: -384.685180 where: bonds (distance) C4'-P energy: -71.321 bonds (distance) P-C4' energy: -73.506 flat angles C4'-P-C4' energy: -81.365 flat angles P-C4'-P energy: -48.472 tors. eta vs tors. theta energy: -110.022 Dist. restrs. and SS energy: 12.472 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1681.785714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.785714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.797233 (E_RNA) where: Base-Base interactions energy: -1200.662 where: short stacking energy: -501.365 Base-Backbone interact. energy: 0.047 local terms energy: -520.181731 where: bonds (distance) C4'-P energy: -94.852 bonds (distance) P-C4' energy: -92.015 flat angles C4'-P-C4' energy: -115.455 flat angles P-C4'-P energy: -74.217 tors. eta vs tors. theta energy: -143.643 Dist. restrs. and SS energy: 2.262 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1656.499136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.499136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.325569 (E_RNA) where: Base-Base interactions energy: -1207.235 where: short stacking energy: -498.157 Base-Backbone interact. energy: -3.280 local terms energy: -483.810896 where: bonds (distance) C4'-P energy: -86.525 bonds (distance) P-C4' energy: -84.778 flat angles C4'-P-C4' energy: -102.839 flat angles P-C4'-P energy: -73.562 tors. eta vs tors. theta energy: -136.107 Dist. restrs. and SS energy: 1.076 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1610.602513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.602513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.799225 (E_RNA) where: Base-Base interactions energy: -1180.258 where: short stacking energy: -492.334 Base-Backbone interact. energy: -2.027 local terms energy: -467.514414 where: bonds (distance) C4'-P energy: -75.182 bonds (distance) P-C4' energy: -89.054 flat angles C4'-P-C4' energy: -101.785 flat angles P-C4'-P energy: -67.404 tors. eta vs tors. theta energy: -134.091 Dist. restrs. and SS energy: 2.447 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1531.366134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.366134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.411640 (E_RNA) where: Base-Base interactions energy: -1084.085 where: short stacking energy: -446.050 Base-Backbone interact. energy: 1.188 local terms energy: -486.515143 where: bonds (distance) C4'-P energy: -84.724 bonds (distance) P-C4' energy: -99.280 flat angles C4'-P-C4' energy: -104.909 flat angles P-C4'-P energy: -69.412 tors. eta vs tors. theta energy: -128.191 Dist. restrs. and SS energy: 1.296 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1522.827520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.827520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.534789 (E_RNA) where: Base-Base interactions energy: -1098.429 where: short stacking energy: -438.567 Base-Backbone interact. energy: 0.809 local terms energy: -463.914494 where: bonds (distance) C4'-P energy: -88.926 bonds (distance) P-C4' energy: -88.678 flat angles C4'-P-C4' energy: -105.646 flat angles P-C4'-P energy: -52.125 tors. eta vs tors. theta energy: -128.539 Dist. restrs. and SS energy: 1.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1472.985303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.985303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.845928 (E_RNA) where: Base-Base interactions energy: -1078.809 where: short stacking energy: -450.859 Base-Backbone interact. energy: -0.556 local terms energy: -445.480396 where: bonds (distance) C4'-P energy: -85.824 bonds (distance) P-C4' energy: -83.303 flat angles C4'-P-C4' energy: -86.021 flat angles P-C4'-P energy: -64.961 tors. eta vs tors. theta energy: -125.372 Dist. restrs. and SS energy: 15.111 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1423.095962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.095962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.325571 (E_RNA) where: Base-Base interactions energy: -1045.742 where: short stacking energy: -441.180 Base-Backbone interact. energy: -1.105 local terms energy: -414.477871 where: bonds (distance) C4'-P energy: -63.222 bonds (distance) P-C4' energy: -84.617 flat angles C4'-P-C4' energy: -89.492 flat angles P-C4'-P energy: -57.683 tors. eta vs tors. theta energy: -119.463 Dist. restrs. and SS energy: 1.480 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1389.561769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.561769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.588249 (E_RNA) where: Base-Base interactions energy: -1020.679 where: short stacking energy: -408.657 Base-Backbone interact. energy: -0.941 local terms energy: -405.967922 where: bonds (distance) C4'-P energy: -87.573 bonds (distance) P-C4' energy: -73.583 flat angles C4'-P-C4' energy: -80.043 flat angles P-C4'-P energy: -55.965 tors. eta vs tors. theta energy: -108.804 Dist. restrs. and SS energy: 1.276 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1343.881686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.881686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.793569 (E_RNA) where: Base-Base interactions energy: -983.277 where: short stacking energy: -403.420 Base-Backbone interact. energy: 0.577 local terms energy: -399.093894 where: bonds (distance) C4'-P energy: -67.625 bonds (distance) P-C4' energy: -77.032 flat angles C4'-P-C4' energy: -87.847 flat angles P-C4'-P energy: -60.711 tors. eta vs tors. theta energy: -105.878 Dist. restrs. and SS energy: 1.162 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1285.446855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.446855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.334152 (E_RNA) where: Base-Base interactions energy: -924.659 where: short stacking energy: -383.353 Base-Backbone interact. energy: -0.702 local terms energy: -408.973417 where: bonds (distance) C4'-P energy: -76.647 bonds (distance) P-C4' energy: -80.180 flat angles C4'-P-C4' energy: -91.334 flat angles P-C4'-P energy: -56.863 tors. eta vs tors. theta energy: -103.950 Dist. restrs. and SS energy: 12.137 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1705.633378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.633378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.030158 (E_RNA) where: Base-Base interactions energy: -1232.017 where: short stacking energy: -515.678 Base-Backbone interact. energy: -1.142 local terms energy: -509.871216 where: bonds (distance) C4'-P energy: -94.195 bonds (distance) P-C4' energy: -88.285 flat angles C4'-P-C4' energy: -116.184 flat angles P-C4'-P energy: -65.648 tors. eta vs tors. theta energy: -145.559 Dist. restrs. and SS energy: 0.647 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1649.906358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.906358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.570073 (E_RNA) where: Base-Base interactions energy: -1199.558 where: short stacking energy: -505.442 Base-Backbone interact. energy: -0.113 local terms energy: -487.899470 where: bonds (distance) C4'-P energy: -80.365 bonds (distance) P-C4' energy: -96.302 flat angles C4'-P-C4' energy: -104.239 flat angles P-C4'-P energy: -66.883 tors. eta vs tors. theta energy: -140.111 Dist. restrs. and SS energy: 0.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1628.428678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.428678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.353106 (E_RNA) where: Base-Base interactions energy: -1174.417 where: short stacking energy: -486.034 Base-Backbone interact. energy: -3.218 local terms energy: -488.717602 where: bonds (distance) C4'-P energy: -90.493 bonds (distance) P-C4' energy: -86.534 flat angles C4'-P-C4' energy: -101.174 flat angles P-C4'-P energy: -70.438 tors. eta vs tors. theta energy: -140.079 Dist. restrs. and SS energy: 1.174 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1557.622917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.622917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.514636 (E_RNA) where: Base-Base interactions energy: -1137.563 where: short stacking energy: -485.133 Base-Backbone interact. energy: -0.491 local terms energy: -457.460830 where: bonds (distance) C4'-P energy: -73.152 bonds (distance) P-C4' energy: -87.255 flat angles C4'-P-C4' energy: -99.495 flat angles P-C4'-P energy: -62.057 tors. eta vs tors. theta energy: -135.501 Dist. restrs. and SS energy: 1.142 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1489.272996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.272996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.488724 (E_RNA) where: Base-Base interactions energy: -1088.331 where: short stacking energy: -451.153 Base-Backbone interact. energy: 1.303 local terms energy: -440.461228 where: bonds (distance) C4'-P energy: -75.106 bonds (distance) P-C4' energy: -73.848 flat angles C4'-P-C4' energy: -96.134 flat angles P-C4'-P energy: -71.348 tors. eta vs tors. theta energy: -124.025 Dist. restrs. and SS energy: 1.466 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1454.201226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.201226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.291716 (E_RNA) where: Base-Base interactions energy: -1062.929 where: short stacking energy: -435.747 Base-Backbone interact. energy: -0.859 local terms energy: -443.503970 where: bonds (distance) C4'-P energy: -73.761 bonds (distance) P-C4' energy: -82.603 flat angles C4'-P-C4' energy: -96.799 flat angles P-C4'-P energy: -68.637 tors. eta vs tors. theta energy: -121.704 Dist. restrs. and SS energy: 16.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1423.094408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.094408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.394668 (E_RNA) where: Base-Base interactions energy: -1018.421 where: short stacking energy: -421.549 Base-Backbone interact. energy: 1.706 local terms energy: -445.679134 where: bonds (distance) C4'-P energy: -85.449 bonds (distance) P-C4' energy: -85.938 flat angles C4'-P-C4' energy: -92.901 flat angles P-C4'-P energy: -61.205 tors. eta vs tors. theta energy: -120.187 Dist. restrs. and SS energy: 2.550 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1409.098748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.098748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.279629 (E_RNA) where: Base-Base interactions energy: -1031.247 where: short stacking energy: -430.639 Base-Backbone interact. energy: -1.671 local terms energy: -414.362200 where: bonds (distance) C4'-P energy: -65.309 bonds (distance) P-C4' energy: -90.979 flat angles C4'-P-C4' energy: -93.372 flat angles P-C4'-P energy: -52.650 tors. eta vs tors. theta energy: -112.052 Dist. restrs. and SS energy: 1.431 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1380.880606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.880606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.498701 (E_RNA) where: Base-Base interactions energy: -1023.591 where: short stacking energy: -416.589 Base-Backbone interact. energy: 1.377 local terms energy: -397.284204 where: bonds (distance) C4'-P energy: -70.577 bonds (distance) P-C4' energy: -70.229 flat angles C4'-P-C4' energy: -92.518 flat angles P-C4'-P energy: -51.306 tors. eta vs tors. theta energy: -112.654 Dist. restrs. and SS energy: 1.868 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1264.473265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.473265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.016442 (E_RNA) where: Base-Base interactions energy: -932.278 where: short stacking energy: -378.403 Base-Backbone interact. energy: -3.107 local terms energy: -373.631198 where: bonds (distance) C4'-P energy: -53.188 bonds (distance) P-C4' energy: -66.579 flat angles C4'-P-C4' energy: -83.234 flat angles P-C4'-P energy: -69.553 tors. eta vs tors. theta energy: -101.077 Dist. restrs. and SS energy: 7.793 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1724.885676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.885676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.628918 (E_RNA) where: Base-Base interactions energy: -1222.684 where: short stacking energy: -521.174 Base-Backbone interact. energy: -2.330 local terms energy: -537.615091 where: bonds (distance) C4'-P energy: -89.340 bonds (distance) P-C4' energy: -106.961 flat angles C4'-P-C4' energy: -116.675 flat angles P-C4'-P energy: -79.172 tors. eta vs tors. theta energy: -145.466 Dist. restrs. and SS energy: 0.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1666.953727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.953727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.293356 (E_RNA) where: Base-Base interactions energy: -1215.356 where: short stacking energy: -514.779 Base-Backbone interact. energy: -1.375 local terms energy: -487.561582 where: bonds (distance) C4'-P energy: -82.027 bonds (distance) P-C4' energy: -88.608 flat angles C4'-P-C4' energy: -97.735 flat angles P-C4'-P energy: -73.182 tors. eta vs tors. theta energy: -146.010 Dist. restrs. and SS energy: 0.590 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1652.897667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.897667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.762680 (E_RNA) where: Base-Base interactions energy: -1213.756 where: short stacking energy: -498.275 Base-Backbone interact. energy: -1.913 local terms energy: -475.093779 where: bonds (distance) C4'-P energy: -88.230 bonds (distance) P-C4' energy: -82.069 flat angles C4'-P-C4' energy: -99.293 flat angles P-C4'-P energy: -64.709 tors. eta vs tors. theta energy: -140.793 Dist. restrs. and SS energy: 1.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1527.863733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.863733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.891290 (E_RNA) where: Base-Base interactions energy: -1102.401 where: short stacking energy: -472.063 Base-Backbone interact. energy: 0.906 local terms energy: -464.396943 where: bonds (distance) C4'-P energy: -78.550 bonds (distance) P-C4' energy: -95.287 flat angles C4'-P-C4' energy: -89.555 flat angles P-C4'-P energy: -76.609 tors. eta vs tors. theta energy: -124.397 Dist. restrs. and SS energy: 1.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1533.762753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.762753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.119837 (E_RNA) where: Base-Base interactions energy: -1117.213 where: short stacking energy: -475.478 Base-Backbone interact. energy: -1.578 local terms energy: -452.329813 where: bonds (distance) C4'-P energy: -87.300 bonds (distance) P-C4' energy: -80.992 flat angles C4'-P-C4' energy: -92.030 flat angles P-C4'-P energy: -54.805 tors. eta vs tors. theta energy: -137.203 Dist. restrs. and SS energy: 0.607 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1421.842896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.842896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.848326 (E_RNA) where: Base-Base interactions energy: -1028.487 where: short stacking energy: -427.885 Base-Backbone interact. energy: -1.088 local terms energy: -438.272939 where: bonds (distance) C4'-P energy: -87.998 bonds (distance) P-C4' energy: -78.470 flat angles C4'-P-C4' energy: -91.787 flat angles P-C4'-P energy: -60.337 tors. eta vs tors. theta energy: -119.681 Dist. restrs. and SS energy: 9.255 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1434.653587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.653587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.376102 (E_RNA) where: Base-Base interactions energy: -1035.325 where: short stacking energy: -430.580 Base-Backbone interact. energy: -2.997 local terms energy: -435.054377 where: bonds (distance) C4'-P energy: -72.322 bonds (distance) P-C4' energy: -78.383 flat angles C4'-P-C4' energy: -95.769 flat angles P-C4'-P energy: -59.560 tors. eta vs tors. theta energy: -129.020 Dist. restrs. and SS energy: 1.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1400.524309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.524309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.083338 (E_RNA) where: Base-Base interactions energy: -1027.582 where: short stacking energy: -426.601 Base-Backbone interact. energy: 1.240 local terms energy: -411.740733 where: bonds (distance) C4'-P energy: -71.404 bonds (distance) P-C4' energy: -70.423 flat angles C4'-P-C4' energy: -96.002 flat angles P-C4'-P energy: -56.952 tors. eta vs tors. theta energy: -116.960 Dist. restrs. and SS energy: 0.809 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1352.848983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.848983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.697248 (E_RNA) where: Base-Base interactions energy: -1007.696 where: short stacking energy: -402.304 Base-Backbone interact. energy: 4.396 local terms energy: -387.398026 where: bonds (distance) C4'-P energy: -69.915 bonds (distance) P-C4' energy: -70.320 flat angles C4'-P-C4' energy: -80.917 flat angles P-C4'-P energy: -50.471 tors. eta vs tors. theta energy: -115.776 Dist. restrs. and SS energy: 1.098 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1297.917893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.917893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.808528 (E_RNA) where: Base-Base interactions energy: -951.496 where: short stacking energy: -369.706 Base-Backbone interact. energy: 3.931 local terms energy: -390.243132 where: bonds (distance) C4'-P energy: -73.328 bonds (distance) P-C4' energy: -82.297 flat angles C4'-P-C4' energy: -75.997 flat angles P-C4'-P energy: -58.853 tors. eta vs tors. theta energy: -99.768 Dist. restrs. and SS energy: 3.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1722.552232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1722.552232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.996438 (E_RNA) where: Base-Base interactions energy: -1264.623 where: short stacking energy: -525.813 Base-Backbone interact. energy: -2.654 local terms energy: -492.719226 where: bonds (distance) C4'-P energy: -92.223 bonds (distance) P-C4' energy: -87.304 flat angles C4'-P-C4' energy: -103.168 flat angles P-C4'-P energy: -63.242 tors. eta vs tors. theta energy: -146.783 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1675.513877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.513877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.529265 (E_RNA) where: Base-Base interactions energy: -1205.026 where: short stacking energy: -509.533 Base-Backbone interact. energy: -0.804 local terms energy: -507.700138 where: bonds (distance) C4'-P energy: -88.052 bonds (distance) P-C4' energy: -88.985 flat angles C4'-P-C4' energy: -107.815 flat angles P-C4'-P energy: -75.104 tors. eta vs tors. theta energy: -147.744 Dist. restrs. and SS energy: 1.265 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1639.964608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.964608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.707626 (E_RNA) where: Base-Base interactions energy: -1203.399 where: short stacking energy: -501.545 Base-Backbone interact. energy: -1.289 local terms energy: -473.019246 where: bonds (distance) C4'-P energy: -81.992 bonds (distance) P-C4' energy: -88.010 flat angles C4'-P-C4' energy: -100.952 flat angles P-C4'-P energy: -61.245 tors. eta vs tors. theta energy: -140.820 Dist. restrs. and SS energy: 0.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1568.439397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.439397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.098745 (E_RNA) where: Base-Base interactions energy: -1123.740 where: short stacking energy: -470.714 Base-Backbone interact. energy: -1.269 local terms energy: -482.090231 where: bonds (distance) C4'-P energy: -88.753 bonds (distance) P-C4' energy: -88.129 flat angles C4'-P-C4' energy: -100.259 flat angles P-C4'-P energy: -67.845 tors. eta vs tors. theta energy: -137.105 Dist. restrs. and SS energy: 1.909 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1503.303816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.303816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.043728 (E_RNA) where: Base-Base interactions energy: -1102.846 where: short stacking energy: -457.214 Base-Backbone interact. energy: 1.227 local terms energy: -439.424613 where: bonds (distance) C4'-P energy: -84.858 bonds (distance) P-C4' energy: -76.220 flat angles C4'-P-C4' energy: -95.219 flat angles P-C4'-P energy: -61.784 tors. eta vs tors. theta energy: -121.344 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1496.519956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.519956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1534.639083 (E_RNA) where: Base-Base interactions energy: -1074.035 where: short stacking energy: -452.787 Base-Backbone interact. energy: -1.027 local terms energy: -459.577200 where: bonds (distance) C4'-P energy: -94.490 bonds (distance) P-C4' energy: -78.989 flat angles C4'-P-C4' energy: -103.266 flat angles P-C4'-P energy: -66.088 tors. eta vs tors. theta energy: -116.744 Dist. restrs. and SS energy: 1.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1381.218597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.218597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.532432 (E_RNA) where: Base-Base interactions energy: -1005.604 where: short stacking energy: -403.860 Base-Backbone interact. energy: -3.359 local terms energy: -416.569182 where: bonds (distance) C4'-P energy: -74.566 bonds (distance) P-C4' energy: -79.718 flat angles C4'-P-C4' energy: -89.651 flat angles P-C4'-P energy: -60.816 tors. eta vs tors. theta energy: -111.819 Dist. restrs. and SS energy: 7.564 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1400.633921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.633921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.936691 (E_RNA) where: Base-Base interactions energy: -1008.432 where: short stacking energy: -418.419 Base-Backbone interact. energy: 6.451 local terms energy: -436.955720 where: bonds (distance) C4'-P energy: -78.314 bonds (distance) P-C4' energy: -80.866 flat angles C4'-P-C4' energy: -87.956 flat angles P-C4'-P energy: -69.190 tors. eta vs tors. theta energy: -120.630 Dist. restrs. and SS energy: 1.553 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1369.044758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.044758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.856357 (E_RNA) where: Base-Base interactions energy: -1013.568 where: short stacking energy: -419.241 Base-Backbone interact. energy: -1.066 local terms energy: -393.222775 where: bonds (distance) C4'-P energy: -74.290 bonds (distance) P-C4' energy: -53.298 flat angles C4'-P-C4' energy: -83.176 flat angles P-C4'-P energy: -61.757 tors. eta vs tors. theta energy: -120.701 Dist. restrs. and SS energy: 2.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1266.765471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.765471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.058438 (E_RNA) where: Base-Base interactions energy: -942.988 where: short stacking energy: -381.740 Base-Backbone interact. energy: -0.673 local terms energy: -366.397017 where: bonds (distance) C4'-P energy: -60.312 bonds (distance) P-C4' energy: -75.335 flat angles C4'-P-C4' energy: -81.359 flat angles P-C4'-P energy: -49.694 tors. eta vs tors. theta energy: -99.696 Dist. restrs. and SS energy: 6.543 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1732.601767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.601767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.788724 (E_RNA) where: Base-Base interactions energy: -1269.435 where: short stacking energy: -515.137 Base-Backbone interact. energy: -2.701 local terms energy: -497.653291 where: bonds (distance) C4'-P energy: -98.045 bonds (distance) P-C4' energy: -87.577 flat angles C4'-P-C4' energy: -96.503 flat angles P-C4'-P energy: -71.943 tors. eta vs tors. theta energy: -143.586 Dist. restrs. and SS energy: 0.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1667.824916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1667.824916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.278020 (E_RNA) where: Base-Base interactions energy: -1203.730 where: short stacking energy: -492.278 Base-Backbone interact. energy: -1.273 local terms energy: -501.274949 where: bonds (distance) C4'-P energy: -98.520 bonds (distance) P-C4' energy: -88.544 flat angles C4'-P-C4' energy: -105.801 flat angles P-C4'-P energy: -73.119 tors. eta vs tors. theta energy: -135.291 Dist. restrs. and SS energy: 1.703 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1643.356881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.356881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.360003 (E_RNA) where: Base-Base interactions energy: -1183.815 where: short stacking energy: -480.558 Base-Backbone interact. energy: -4.135 local terms energy: -493.410481 where: bonds (distance) C4'-P energy: -79.759 bonds (distance) P-C4' energy: -92.581 flat angles C4'-P-C4' energy: -109.765 flat angles P-C4'-P energy: -69.276 tors. eta vs tors. theta energy: -142.030 Dist. restrs. and SS energy: 1.253 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1569.817665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.817665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.000595 (E_RNA) where: Base-Base interactions energy: -1127.439 where: short stacking energy: -477.433 Base-Backbone interact. energy: -2.130 local terms energy: -478.431859 where: bonds (distance) C4'-P energy: -87.167 bonds (distance) P-C4' energy: -88.064 flat angles C4'-P-C4' energy: -104.655 flat angles P-C4'-P energy: -58.402 tors. eta vs tors. theta energy: -140.144 Dist. restrs. and SS energy: 1.433 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1524.289423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.289423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.134716 (E_RNA) where: Base-Base interactions energy: -1107.624 where: short stacking energy: -471.083 Base-Backbone interact. energy: 2.167 local terms energy: -457.677809 where: bonds (distance) C4'-P energy: -81.736 bonds (distance) P-C4' energy: -83.630 flat angles C4'-P-C4' energy: -96.123 flat angles P-C4'-P energy: -62.649 tors. eta vs tors. theta energy: -133.540 Dist. restrs. and SS energy: 2.095 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1476.282711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.282711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.014537 (E_RNA) where: Base-Base interactions energy: -1074.856 where: short stacking energy: -436.264 Base-Backbone interact. energy: -0.861 local terms energy: -438.297654 where: bonds (distance) C4'-P energy: -67.308 bonds (distance) P-C4' energy: -80.983 flat angles C4'-P-C4' energy: -104.670 flat angles P-C4'-P energy: -70.014 tors. eta vs tors. theta energy: -115.324 Dist. restrs. and SS energy: 0.982 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1414.506798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.506798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.131858 (E_RNA) where: Base-Base interactions energy: -1041.738 where: short stacking energy: -433.196 Base-Backbone interact. energy: 1.442 local terms energy: -413.835840 where: bonds (distance) C4'-P energy: -69.661 bonds (distance) P-C4' energy: -71.628 flat angles C4'-P-C4' energy: -93.521 flat angles P-C4'-P energy: -59.888 tors. eta vs tors. theta energy: -119.138 Dist. restrs. and SS energy: 2.875 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1365.642134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.642134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.793177 (E_RNA) where: Base-Base interactions energy: -989.373 where: short stacking energy: -402.513 Base-Backbone interact. energy: -2.301 local terms energy: -417.119700 where: bonds (distance) C4'-P energy: -69.127 bonds (distance) P-C4' energy: -73.107 flat angles C4'-P-C4' energy: -93.603 flat angles P-C4'-P energy: -69.820 tors. eta vs tors. theta energy: -111.463 Dist. restrs. and SS energy: 6.401 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1353.842750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.842750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.584063 (E_RNA) where: Base-Base interactions energy: -1002.101 where: short stacking energy: -385.056 Base-Backbone interact. energy: 2.514 local terms energy: -391.996998 where: bonds (distance) C4'-P energy: -60.721 bonds (distance) P-C4' energy: -69.563 flat angles C4'-P-C4' energy: -93.214 flat angles P-C4'-P energy: -64.495 tors. eta vs tors. theta energy: -104.004 Dist. restrs. and SS energy: 0.991 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1264.773965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.773965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.855934 (E_RNA) where: Base-Base interactions energy: -971.039 where: short stacking energy: -383.574 Base-Backbone interact. energy: -2.043 local terms energy: -333.774478 where: bonds (distance) C4'-P energy: -54.359 bonds (distance) P-C4' energy: -61.167 flat angles C4'-P-C4' energy: -70.053 flat angles P-C4'-P energy: -45.250 tors. eta vs tors. theta energy: -102.945 Dist. restrs. and SS energy: 5.332 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1732.674174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.674174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.992884 (E_RNA) where: Base-Base interactions energy: -1261.211 where: short stacking energy: -513.971 Base-Backbone interact. energy: -1.464 local terms energy: -507.317943 where: bonds (distance) C4'-P energy: -93.811 bonds (distance) P-C4' energy: -99.903 flat angles C4'-P-C4' energy: -100.736 flat angles P-C4'-P energy: -61.589 tors. eta vs tors. theta energy: -151.279 Dist. restrs. and SS energy: 0.569 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1651.168694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.168694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.689549 (E_RNA) where: Base-Base interactions energy: -1210.951 where: short stacking energy: -479.572 Base-Backbone interact. energy: -1.860 local terms energy: -475.878095 where: bonds (distance) C4'-P energy: -87.019 bonds (distance) P-C4' energy: -95.724 flat angles C4'-P-C4' energy: -103.946 flat angles P-C4'-P energy: -57.517 tors. eta vs tors. theta energy: -131.673 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1634.014404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.014404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.722535 (E_RNA) where: Base-Base interactions energy: -1188.215 where: short stacking energy: -489.954 Base-Backbone interact. energy: -2.365 local terms energy: -481.142764 where: bonds (distance) C4'-P energy: -87.784 bonds (distance) P-C4' energy: -89.524 flat angles C4'-P-C4' energy: -99.486 flat angles P-C4'-P energy: -66.754 tors. eta vs tors. theta energy: -137.595 Dist. restrs. and SS energy: 0.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1563.046199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.046199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.176587 (E_RNA) where: Base-Base interactions energy: -1107.820 where: short stacking energy: -479.512 Base-Backbone interact. energy: -0.870 local terms energy: -492.486856 where: bonds (distance) C4'-P energy: -89.480 bonds (distance) P-C4' energy: -93.765 flat angles C4'-P-C4' energy: -104.252 flat angles P-C4'-P energy: -64.723 tors. eta vs tors. theta energy: -140.267 Dist. restrs. and SS energy: 1.380 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1519.694250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.694250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.463357 (E_RNA) where: Base-Base interactions energy: -1083.991 where: short stacking energy: -454.589 Base-Backbone interact. energy: -1.394 local terms energy: -472.078474 where: bonds (distance) C4'-P energy: -88.348 bonds (distance) P-C4' energy: -94.673 flat angles C4'-P-C4' energy: -95.725 flat angles P-C4'-P energy: -69.193 tors. eta vs tors. theta energy: -124.140 Dist. restrs. and SS energy: 1.019 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1463.296014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.296014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.159633 (E_RNA) where: Base-Base interactions energy: -1072.715 where: short stacking energy: -451.281 Base-Backbone interact. energy: -3.149 local terms energy: -425.295722 where: bonds (distance) C4'-P energy: -72.770 bonds (distance) P-C4' energy: -74.294 flat angles C4'-P-C4' energy: -101.027 flat angles P-C4'-P energy: -55.050 tors. eta vs tors. theta energy: -122.154 Dist. restrs. and SS energy: 1.114 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1410.727810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.727810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.727686 (E_RNA) where: Base-Base interactions energy: -1024.010 where: short stacking energy: -428.966 Base-Backbone interact. energy: -1.567 local terms energy: -423.150340 where: bonds (distance) C4'-P energy: -76.975 bonds (distance) P-C4' energy: -75.207 flat angles C4'-P-C4' energy: -94.110 flat angles P-C4'-P energy: -57.497 tors. eta vs tors. theta energy: -119.361 Dist. restrs. and SS energy: 1.250 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1402.470405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.470405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.827099 (E_RNA) where: Base-Base interactions energy: -1025.059 where: short stacking energy: -425.301 Base-Backbone interact. energy: -1.223 local terms energy: -415.544626 where: bonds (distance) C4'-P energy: -68.130 bonds (distance) P-C4' energy: -81.366 flat angles C4'-P-C4' energy: -86.330 flat angles P-C4'-P energy: -56.317 tors. eta vs tors. theta energy: -123.400 Dist. restrs. and SS energy: 2.607 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1368.254433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.254433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.118957 (E_RNA) where: Base-Base interactions energy: -989.531 where: short stacking energy: -397.157 Base-Backbone interact. energy: 2.732 local terms energy: -426.320216 where: bonds (distance) C4'-P energy: -86.906 bonds (distance) P-C4' energy: -83.119 flat angles C4'-P-C4' energy: -81.243 flat angles P-C4'-P energy: -65.878 tors. eta vs tors. theta energy: -109.174 Dist. restrs. and SS energy: 8.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1309.588091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.588091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.621342 (E_RNA) where: Base-Base interactions energy: -977.150 where: short stacking energy: -392.046 Base-Backbone interact. energy: -0.728 local terms energy: -369.744158 where: bonds (distance) C4'-P energy: -60.161 bonds (distance) P-C4' energy: -69.503 flat angles C4'-P-C4' energy: -82.896 flat angles P-C4'-P energy: -62.067 tors. eta vs tors. theta energy: -95.118 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1730.869936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1730.869936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.365749 (E_RNA) where: Base-Base interactions energy: -1266.312 where: short stacking energy: -522.367 Base-Backbone interact. energy: -1.791 local terms energy: -500.262339 where: bonds (distance) C4'-P energy: -82.301 bonds (distance) P-C4' energy: -95.865 flat angles C4'-P-C4' energy: -101.399 flat angles P-C4'-P energy: -71.655 tors. eta vs tors. theta energy: -149.042 Dist. restrs. and SS energy: 0.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1658.953839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.953839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.131253 (E_RNA) where: Base-Base interactions energy: -1196.087 where: short stacking energy: -505.943 Base-Backbone interact. energy: -2.314 local terms energy: -497.730120 where: bonds (distance) C4'-P energy: -94.314 bonds (distance) P-C4' energy: -93.184 flat angles C4'-P-C4' energy: -109.532 flat angles P-C4'-P energy: -62.738 tors. eta vs tors. theta energy: -137.962 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1650.976259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.976259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.502711 (E_RNA) where: Base-Base interactions energy: -1189.239 where: short stacking energy: -486.368 Base-Backbone interact. energy: -2.468 local terms energy: -496.795961 where: bonds (distance) C4'-P energy: -84.729 bonds (distance) P-C4' energy: -95.224 flat angles C4'-P-C4' energy: -103.057 flat angles P-C4'-P energy: -67.514 tors. eta vs tors. theta energy: -146.272 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1572.988237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.988237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.170004 (E_RNA) where: Base-Base interactions energy: -1127.420 where: short stacking energy: -495.139 Base-Backbone interact. energy: -0.731 local terms energy: -483.019553 where: bonds (distance) C4'-P energy: -88.178 bonds (distance) P-C4' energy: -89.409 flat angles C4'-P-C4' energy: -99.095 flat angles P-C4'-P energy: -62.413 tors. eta vs tors. theta energy: -143.924 Dist. restrs. and SS energy: 1.432 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1516.000702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.000702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.664873 (E_RNA) where: Base-Base interactions energy: -1094.401 where: short stacking energy: -467.818 Base-Backbone interact. energy: -2.501 local terms energy: -457.763322 where: bonds (distance) C4'-P energy: -77.831 bonds (distance) P-C4' energy: -90.422 flat angles C4'-P-C4' energy: -92.422 flat angles P-C4'-P energy: -62.764 tors. eta vs tors. theta energy: -134.325 Dist. restrs. and SS energy: 1.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1443.447142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.447142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.646184 (E_RNA) where: Base-Base interactions energy: -1030.142 where: short stacking energy: -430.094 Base-Backbone interact. energy: -1.200 local terms energy: -450.303952 where: bonds (distance) C4'-P energy: -72.931 bonds (distance) P-C4' energy: -85.015 flat angles C4'-P-C4' energy: -109.837 flat angles P-C4'-P energy: -63.644 tors. eta vs tors. theta energy: -118.877 Dist. restrs. and SS energy: 1.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1418.680663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.680663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.200408 (E_RNA) where: Base-Base interactions energy: -1038.007 where: short stacking energy: -425.955 Base-Backbone interact. energy: -1.551 local terms energy: -417.641692 where: bonds (distance) C4'-P energy: -62.929 bonds (distance) P-C4' energy: -86.943 flat angles C4'-P-C4' energy: -90.531 flat angles P-C4'-P energy: -63.147 tors. eta vs tors. theta energy: -114.091 Dist. restrs. and SS energy: 1.770 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1393.707003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.707003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.967422 (E_RNA) where: Base-Base interactions energy: -1025.505 where: short stacking energy: -422.951 Base-Backbone interact. energy: 0.832 local terms energy: -407.294013 where: bonds (distance) C4'-P energy: -64.618 bonds (distance) P-C4' energy: -82.086 flat angles C4'-P-C4' energy: -92.335 flat angles P-C4'-P energy: -50.075 tors. eta vs tors. theta energy: -118.180 Dist. restrs. and SS energy: 1.510 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1332.475538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.475538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.939680 (E_RNA) where: Base-Base interactions energy: -993.316 where: short stacking energy: -404.018 Base-Backbone interact. energy: 2.194 local terms energy: -385.817811 where: bonds (distance) C4'-P energy: -88.080 bonds (distance) P-C4' energy: -75.531 flat angles C4'-P-C4' energy: -79.175 flat angles P-C4'-P energy: -29.381 tors. eta vs tors. theta energy: -113.651 Dist. restrs. and SS energy: 7.714 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1291.211682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.211682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.605998 (E_RNA) where: Base-Base interactions energy: -964.832 where: short stacking energy: -378.022 Base-Backbone interact. energy: -2.186 local terms energy: -367.588216 where: bonds (distance) C4'-P energy: -72.494 bonds (distance) P-C4' energy: -85.925 flat angles C4'-P-C4' energy: -77.564 flat angles P-C4'-P energy: -40.511 tors. eta vs tors. theta energy: -91.094 Dist. restrs. and SS energy: 6.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1733.905853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.905853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1771.333199 (E_RNA) where: Base-Base interactions energy: -1244.661 where: short stacking energy: -520.165 Base-Backbone interact. energy: -3.091 local terms energy: -523.581873 where: bonds (distance) C4'-P energy: -99.638 bonds (distance) P-C4' energy: -89.754 flat angles C4'-P-C4' energy: -107.631 flat angles P-C4'-P energy: -80.860 tors. eta vs tors. theta energy: -145.699 Dist. restrs. and SS energy: 0.677 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1658.836598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.836598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.615300 (E_RNA) where: Base-Base interactions energy: -1203.712 where: short stacking energy: -502.670 Base-Backbone interact. energy: -1.294 local terms energy: -492.609403 where: bonds (distance) C4'-P energy: -84.579 bonds (distance) P-C4' energy: -93.676 flat angles C4'-P-C4' energy: -108.057 flat angles P-C4'-P energy: -66.374 tors. eta vs tors. theta energy: -139.925 Dist. restrs. and SS energy: 2.029 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1611.854300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1611.854300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.086758 (E_RNA) where: Base-Base interactions energy: -1174.161 where: short stacking energy: -480.339 Base-Backbone interact. energy: -2.214 local terms energy: -472.711333 where: bonds (distance) C4'-P energy: -78.528 bonds (distance) P-C4' energy: -83.949 flat angles C4'-P-C4' energy: -98.940 flat angles P-C4'-P energy: -75.170 tors. eta vs tors. theta energy: -136.124 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1561.042625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.042625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.008499 (E_RNA) where: Base-Base interactions energy: -1104.258 where: short stacking energy: -479.298 Base-Backbone interact. energy: -0.603 local terms energy: -494.148144 where: bonds (distance) C4'-P energy: -85.972 bonds (distance) P-C4' energy: -85.677 flat angles C4'-P-C4' energy: -105.660 flat angles P-C4'-P energy: -78.183 tors. eta vs tors. theta energy: -138.656 Dist. restrs. and SS energy: 1.216 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1496.495397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.495397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1534.873182 (E_RNA) where: Base-Base interactions energy: -1077.938 where: short stacking energy: -436.294 Base-Backbone interact. energy: -2.810 local terms energy: -454.124833 where: bonds (distance) C4'-P energy: -83.910 bonds (distance) P-C4' energy: -82.653 flat angles C4'-P-C4' energy: -98.647 flat angles P-C4'-P energy: -70.747 tors. eta vs tors. theta energy: -118.168 Dist. restrs. and SS energy: 1.628 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1433.992859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.992859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.519047 (E_RNA) where: Base-Base interactions energy: -1035.359 where: short stacking energy: -426.511 Base-Backbone interact. energy: 1.652 local terms energy: -437.812081 where: bonds (distance) C4'-P energy: -86.258 bonds (distance) P-C4' energy: -91.127 flat angles C4'-P-C4' energy: -83.403 flat angles P-C4'-P energy: -65.236 tors. eta vs tors. theta energy: -111.788 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1441.403494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.403494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.293086 (E_RNA) where: Base-Base interactions energy: -1058.784 where: short stacking energy: -422.524 Base-Backbone interact. energy: 2.033 local terms energy: -422.541890 where: bonds (distance) C4'-P energy: -74.424 bonds (distance) P-C4' energy: -81.975 flat angles C4'-P-C4' energy: -91.428 flat angles P-C4'-P energy: -58.011 tors. eta vs tors. theta energy: -116.703 Dist. restrs. and SS energy: 1.140 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1425.503090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.503090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.159829 (E_RNA) where: Base-Base interactions energy: -1024.722 where: short stacking energy: -412.708 Base-Backbone interact. energy: 0.324 local terms energy: -439.761518 where: bonds (distance) C4'-P energy: -81.711 bonds (distance) P-C4' energy: -87.096 flat angles C4'-P-C4' energy: -88.148 flat angles P-C4'-P energy: -62.709 tors. eta vs tors. theta energy: -120.097 Dist. restrs. and SS energy: 1.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1386.988870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.988870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.901841 (E_RNA) where: Base-Base interactions energy: -1034.004 where: short stacking energy: -418.537 Base-Backbone interact. energy: 0.744 local terms energy: -391.641257 where: bonds (distance) C4'-P energy: -68.655 bonds (distance) P-C4' energy: -69.398 flat angles C4'-P-C4' energy: -84.857 flat angles P-C4'-P energy: -47.489 tors. eta vs tors. theta energy: -121.242 Dist. restrs. and SS energy: 1.163 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1316.009478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.009478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.507594 (E_RNA) where: Base-Base interactions energy: -971.735 where: short stacking energy: -384.382 Base-Backbone interact. energy: 0.486 local terms energy: -383.258550 where: bonds (distance) C4'-P energy: -78.291 bonds (distance) P-C4' energy: -52.887 flat angles C4'-P-C4' energy: -85.527 flat angles P-C4'-P energy: -59.752 tors. eta vs tors. theta energy: -106.801 Dist. restrs. and SS energy: 1.748 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1721.790099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.790099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.034854 (E_RNA) where: Base-Base interactions energy: -1260.767 where: short stacking energy: -529.729 Base-Backbone interact. energy: -1.418 local terms energy: -496.849890 where: bonds (distance) C4'-P energy: -88.459 bonds (distance) P-C4' energy: -92.046 flat angles C4'-P-C4' energy: -99.562 flat angles P-C4'-P energy: -59.598 tors. eta vs tors. theta energy: -157.185 Dist. restrs. and SS energy: 0.495 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1676.761813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.761813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.330240 (E_RNA) where: Base-Base interactions energy: -1219.074 where: short stacking energy: -519.437 Base-Backbone interact. energy: -1.344 local terms energy: -493.912028 where: bonds (distance) C4'-P energy: -85.556 bonds (distance) P-C4' energy: -96.631 flat angles C4'-P-C4' energy: -100.913 flat angles P-C4'-P energy: -58.239 tors. eta vs tors. theta energy: -152.574 Dist. restrs. and SS energy: 0.818 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1633.549814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.549814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.678264 (E_RNA) where: Base-Base interactions energy: -1173.295 where: short stacking energy: -493.437 Base-Backbone interact. energy: -2.064 local terms energy: -496.319027 where: bonds (distance) C4'-P energy: -91.351 bonds (distance) P-C4' energy: -90.061 flat angles C4'-P-C4' energy: -97.481 flat angles P-C4'-P energy: -73.851 tors. eta vs tors. theta energy: -143.576 Dist. restrs. and SS energy: 1.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1542.355786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.355786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.681860 (E_RNA) where: Base-Base interactions energy: -1133.689 where: short stacking energy: -497.123 Base-Backbone interact. energy: 0.940 local terms energy: -447.932602 where: bonds (distance) C4'-P energy: -69.181 bonds (distance) P-C4' energy: -78.603 flat angles C4'-P-C4' energy: -92.258 flat angles P-C4'-P energy: -67.176 tors. eta vs tors. theta energy: -140.715 Dist. restrs. and SS energy: 1.576 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1480.199280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.199280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.026718 (E_RNA) where: Base-Base interactions energy: -1075.320 where: short stacking energy: -418.279 Base-Backbone interact. energy: -1.716 local terms energy: -441.991166 where: bonds (distance) C4'-P energy: -67.246 bonds (distance) P-C4' energy: -84.883 flat angles C4'-P-C4' energy: -102.199 flat angles P-C4'-P energy: -68.280 tors. eta vs tors. theta energy: -119.382 Dist. restrs. and SS energy: 2.077 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1470.071245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.071245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.462156 (E_RNA) where: Base-Base interactions energy: -1062.261 where: short stacking energy: -447.174 Base-Backbone interact. energy: -2.325 local terms energy: -443.876637 where: bonds (distance) C4'-P energy: -78.095 bonds (distance) P-C4' energy: -89.568 flat angles C4'-P-C4' energy: -95.412 flat angles P-C4'-P energy: -52.379 tors. eta vs tors. theta energy: -128.423 Dist. restrs. and SS energy: 1.641 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1430.426104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.426104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.386033 (E_RNA) where: Base-Base interactions energy: -1065.243 where: short stacking energy: -420.805 Base-Backbone interact. energy: -2.675 local terms energy: -400.467593 where: bonds (distance) C4'-P energy: -73.170 bonds (distance) P-C4' energy: -81.229 flat angles C4'-P-C4' energy: -80.067 flat angles P-C4'-P energy: -60.162 tors. eta vs tors. theta energy: -105.840 Dist. restrs. and SS energy: 1.210 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1410.719495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.719495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.548906 (E_RNA) where: Base-Base interactions energy: -1043.376 where: short stacking energy: -437.380 Base-Backbone interact. energy: -1.082 local terms energy: -404.090706 where: bonds (distance) C4'-P energy: -70.873 bonds (distance) P-C4' energy: -69.924 flat angles C4'-P-C4' energy: -92.713 flat angles P-C4'-P energy: -57.135 tors. eta vs tors. theta energy: -113.447 Dist. restrs. and SS energy: 1.079 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1370.217111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.217111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.397510 (E_RNA) where: Base-Base interactions energy: -1008.335 where: short stacking energy: -407.620 Base-Backbone interact. energy: -1.750 local terms energy: -398.313283 where: bonds (distance) C4'-P energy: -76.866 bonds (distance) P-C4' energy: -66.326 flat angles C4'-P-C4' energy: -95.527 flat angles P-C4'-P energy: -54.261 tors. eta vs tors. theta energy: -105.333 Dist. restrs. and SS energy: 1.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1314.386868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.386868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.670423 (E_RNA) where: Base-Base interactions energy: -973.625 where: short stacking energy: -389.126 Base-Backbone interact. energy: -0.553 local terms energy: -379.491769 where: bonds (distance) C4'-P energy: -65.568 bonds (distance) P-C4' energy: -78.345 flat angles C4'-P-C4' energy: -86.855 flat angles P-C4'-P energy: -43.420 tors. eta vs tors. theta energy: -105.304 Dist. restrs. and SS energy: 2.534 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1731.942118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.942118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.370660 (E_RNA) where: Base-Base interactions energy: -1264.931 where: short stacking energy: -539.964 Base-Backbone interact. energy: -1.137 local terms energy: -503.303158 where: bonds (distance) C4'-P energy: -93.792 bonds (distance) P-C4' energy: -92.654 flat angles C4'-P-C4' energy: -103.509 flat angles P-C4'-P energy: -60.871 tors. eta vs tors. theta energy: -152.477 Dist. restrs. and SS energy: 0.679 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1672.081973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.081973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.577504 (E_RNA) where: Base-Base interactions energy: -1181.073 where: short stacking energy: -500.406 Base-Backbone interact. energy: 0.856 local terms energy: -530.359742 where: bonds (distance) C4'-P energy: -100.625 bonds (distance) P-C4' energy: -101.025 flat angles C4'-P-C4' energy: -111.567 flat angles P-C4'-P energy: -74.354 tors. eta vs tors. theta energy: -142.789 Dist. restrs. and SS energy: 1.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1596.911743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.911743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.763469 (E_RNA) where: Base-Base interactions energy: -1154.281 where: short stacking energy: -478.164 Base-Backbone interact. energy: -1.682 local terms energy: -478.800694 where: bonds (distance) C4'-P energy: -88.699 bonds (distance) P-C4' energy: -93.778 flat angles C4'-P-C4' energy: -102.171 flat angles P-C4'-P energy: -58.853 tors. eta vs tors. theta energy: -135.300 Dist. restrs. and SS energy: 1.102 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1561.763283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.763283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.024236 (E_RNA) where: Base-Base interactions energy: -1121.184 where: short stacking energy: -468.184 Base-Backbone interact. energy: 0.703 local terms energy: -479.543218 where: bonds (distance) C4'-P energy: -88.822 bonds (distance) P-C4' energy: -75.749 flat angles C4'-P-C4' energy: -99.781 flat angles P-C4'-P energy: -81.514 tors. eta vs tors. theta energy: -133.677 Dist. restrs. and SS energy: 1.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1481.764445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.764445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.623746 (E_RNA) where: Base-Base interactions energy: -1098.806 where: short stacking energy: -442.230 Base-Backbone interact. energy: -2.067 local terms energy: -418.750396 where: bonds (distance) C4'-P energy: -63.530 bonds (distance) P-C4' energy: -80.097 flat angles C4'-P-C4' energy: -98.134 flat angles P-C4'-P energy: -52.705 tors. eta vs tors. theta energy: -124.285 Dist. restrs. and SS energy: 1.109 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1448.038395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.038395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.311493 (E_RNA) where: Base-Base interactions energy: -1045.449 where: short stacking energy: -431.801 Base-Backbone interact. energy: -0.870 local terms energy: -439.992742 where: bonds (distance) C4'-P energy: -75.516 bonds (distance) P-C4' energy: -86.644 flat angles C4'-P-C4' energy: -95.539 flat angles P-C4'-P energy: -60.814 tors. eta vs tors. theta energy: -121.479 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1457.365941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.365941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1495.272653 (E_RNA) where: Base-Base interactions energy: -1073.898 where: short stacking energy: -441.301 Base-Backbone interact. energy: -1.436 local terms energy: -419.938262 where: bonds (distance) C4'-P energy: -74.750 bonds (distance) P-C4' energy: -72.841 flat angles C4'-P-C4' energy: -96.677 flat angles P-C4'-P energy: -51.446 tors. eta vs tors. theta energy: -124.225 Dist. restrs. and SS energy: 1.157 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1361.266506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.266506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.953891 (E_RNA) where: Base-Base interactions energy: -996.223 where: short stacking energy: -408.985 Base-Backbone interact. energy: 1.006 local terms energy: -404.737429 where: bonds (distance) C4'-P energy: -71.773 bonds (distance) P-C4' energy: -79.367 flat angles C4'-P-C4' energy: -85.512 flat angles P-C4'-P energy: -46.276 tors. eta vs tors. theta energy: -121.810 Dist. restrs. and SS energy: 1.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1401.088516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.088516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.358134 (E_RNA) where: Base-Base interactions energy: -1033.207 where: short stacking energy: -419.266 Base-Backbone interact. energy: -0.308 local terms energy: -405.843207 where: bonds (distance) C4'-P energy: -62.847 bonds (distance) P-C4' energy: -84.147 flat angles C4'-P-C4' energy: -94.274 flat angles P-C4'-P energy: -44.070 tors. eta vs tors. theta energy: -120.506 Dist. restrs. and SS energy: 1.520 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -1329.356611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.356611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.241186 (E_RNA) where: Base-Base interactions energy: -982.031 where: short stacking energy: -404.121 Base-Backbone interact. energy: 0.718 local terms energy: -385.928008 where: bonds (distance) C4'-P energy: -67.846 bonds (distance) P-C4' energy: -91.456 flat angles C4'-P-C4' energy: -69.376 flat angles P-C4'-P energy: -53.160 tors. eta vs tors. theta energy: -104.090 Dist. restrs. and SS energy: 1.135 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1683.724799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.724799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.252878 (E_RNA) where: Base-Base interactions energy: -1249.839 where: short stacking energy: -519.173 Base-Backbone interact. energy: 0.499 local terms energy: -471.913226 where: bonds (distance) C4'-P energy: -85.250 bonds (distance) P-C4' energy: -83.694 flat angles C4'-P-C4' energy: -94.690 flat angles P-C4'-P energy: -65.758 tors. eta vs tors. theta energy: -142.522 Dist. restrs. and SS energy: 0.778 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1706.313116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.313116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.697439 (E_RNA) where: Base-Base interactions energy: -1245.319 where: short stacking energy: -523.020 Base-Backbone interact. energy: -3.901 local terms energy: -494.477799 where: bonds (distance) C4'-P energy: -95.929 bonds (distance) P-C4' energy: -80.698 flat angles C4'-P-C4' energy: -106.744 flat angles P-C4'-P energy: -66.714 tors. eta vs tors. theta energy: -144.393 Dist. restrs. and SS energy: 0.634 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1563.381258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.381258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.010665 (E_RNA) where: Base-Base interactions energy: -1124.550 where: short stacking energy: -472.198 Base-Backbone interact. energy: -1.480 local terms energy: -474.980595 where: bonds (distance) C4'-P energy: -83.214 bonds (distance) P-C4' energy: -87.067 flat angles C4'-P-C4' energy: -107.158 flat angles P-C4'-P energy: -66.252 tors. eta vs tors. theta energy: -131.291 Dist. restrs. and SS energy: 0.879 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1523.265251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.265251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.073420 (E_RNA) where: Base-Base interactions energy: -1088.751 where: short stacking energy: -445.774 Base-Backbone interact. energy: -0.436 local terms energy: -472.886589 where: bonds (distance) C4'-P energy: -86.549 bonds (distance) P-C4' energy: -91.680 flat angles C4'-P-C4' energy: -107.397 flat angles P-C4'-P energy: -64.468 tors. eta vs tors. theta energy: -122.792 Dist. restrs. and SS energy: 2.058 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1504.554496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.554496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.539874 (E_RNA) where: Base-Base interactions energy: -1077.890 where: short stacking energy: -433.264 Base-Backbone interact. energy: -3.725 local terms energy: -460.924273 where: bonds (distance) C4'-P energy: -85.148 bonds (distance) P-C4' energy: -83.276 flat angles C4'-P-C4' energy: -98.052 flat angles P-C4'-P energy: -69.869 tors. eta vs tors. theta energy: -124.578 Dist. restrs. and SS energy: 1.235 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1429.732965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.732965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.439664 (E_RNA) where: Base-Base interactions energy: -1032.668 where: short stacking energy: -410.587 Base-Backbone interact. energy: -0.946 local terms energy: -433.825729 where: bonds (distance) C4'-P energy: -78.806 bonds (distance) P-C4' energy: -87.977 flat angles C4'-P-C4' energy: -93.064 flat angles P-C4'-P energy: -58.120 tors. eta vs tors. theta energy: -115.858 Dist. restrs. and SS energy: 0.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1392.581898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.581898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.998510 (E_RNA) where: Base-Base interactions energy: -1022.837 where: short stacking energy: -405.645 Base-Backbone interact. energy: -1.569 local terms energy: -406.592508 where: bonds (distance) C4'-P energy: -67.315 bonds (distance) P-C4' energy: -85.280 flat angles C4'-P-C4' energy: -89.018 flat angles P-C4'-P energy: -59.588 tors. eta vs tors. theta energy: -105.392 Dist. restrs. and SS energy: 1.667 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1375.504173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.504173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.044727 (E_RNA) where: Base-Base interactions energy: -1009.755 where: short stacking energy: -395.523 Base-Backbone interact. energy: 2.468 local terms energy: -406.757956 where: bonds (distance) C4'-P energy: -76.889 bonds (distance) P-C4' energy: -64.108 flat angles C4'-P-C4' energy: -95.360 flat angles P-C4'-P energy: -57.820 tors. eta vs tors. theta energy: -112.581 Dist. restrs. and SS energy: 1.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1357.508912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.508912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.484236 (E_RNA) where: Base-Base interactions energy: -977.501 where: short stacking energy: -376.549 Base-Backbone interact. energy: -0.681 local terms energy: -418.302214 where: bonds (distance) C4'-P energy: -82.780 bonds (distance) P-C4' energy: -74.093 flat angles C4'-P-C4' energy: -87.995 flat angles P-C4'-P energy: -61.699 tors. eta vs tors. theta energy: -111.735 Dist. restrs. and SS energy: 2.225 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1333.028115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.028115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.480564 (E_RNA) where: Base-Base interactions energy: -982.865 where: short stacking energy: -396.581 Base-Backbone interact. energy: -2.056 local terms energy: -388.559601 where: bonds (distance) C4'-P energy: -62.268 bonds (distance) P-C4' energy: -74.490 flat angles C4'-P-C4' energy: -88.953 flat angles P-C4'-P energy: -58.209 tors. eta vs tors. theta energy: -104.640 Dist. restrs. and SS energy: 3.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1715.986196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.986196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.007002 (E_RNA) where: Base-Base interactions energy: -1249.234 where: short stacking energy: -537.907 Base-Backbone interact. energy: -0.901 local terms energy: -503.871419 where: bonds (distance) C4'-P energy: -81.460 bonds (distance) P-C4' energy: -90.909 flat angles C4'-P-C4' energy: -105.603 flat angles P-C4'-P energy: -75.995 tors. eta vs tors. theta energy: -149.904 Dist. restrs. and SS energy: 1.271 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1702.614860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.614860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.704609 (E_RNA) where: Base-Base interactions energy: -1244.447 where: short stacking energy: -524.753 Base-Backbone interact. energy: -2.535 local terms energy: -492.722348 where: bonds (distance) C4'-P energy: -86.256 bonds (distance) P-C4' energy: -91.288 flat angles C4'-P-C4' energy: -107.095 flat angles P-C4'-P energy: -70.228 tors. eta vs tors. theta energy: -137.854 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1577.301567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.301567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.122386 (E_RNA) where: Base-Base interactions energy: -1154.087 where: short stacking energy: -486.211 Base-Backbone interact. energy: -0.392 local terms energy: -460.643976 where: bonds (distance) C4'-P energy: -88.402 bonds (distance) P-C4' energy: -84.052 flat angles C4'-P-C4' energy: -95.554 flat angles P-C4'-P energy: -62.108 tors. eta vs tors. theta energy: -130.529 Dist. restrs. and SS energy: 1.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1557.550860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.550860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.287226 (E_RNA) where: Base-Base interactions energy: -1138.159 where: short stacking energy: -483.092 Base-Backbone interact. energy: -1.641 local terms energy: -455.487185 where: bonds (distance) C4'-P energy: -87.076 bonds (distance) P-C4' energy: -75.964 flat angles C4'-P-C4' energy: -106.458 flat angles P-C4'-P energy: -59.765 tors. eta vs tors. theta energy: -126.224 Dist. restrs. and SS energy: 0.986 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1505.207382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.207382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.276900 (E_RNA) where: Base-Base interactions energy: -1099.136 where: short stacking energy: -464.199 Base-Backbone interact. energy: -1.233 local terms energy: -442.908229 where: bonds (distance) C4'-P energy: -72.340 bonds (distance) P-C4' energy: -73.496 flat angles C4'-P-C4' energy: -97.266 flat angles P-C4'-P energy: -59.506 tors. eta vs tors. theta energy: -140.300 Dist. restrs. and SS energy: 1.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1497.549187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.549187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.022929 (E_RNA) where: Base-Base interactions energy: -1096.128 where: short stacking energy: -461.114 Base-Backbone interact. energy: -0.591 local terms energy: -438.303765 where: bonds (distance) C4'-P energy: -77.951 bonds (distance) P-C4' energy: -65.498 flat angles C4'-P-C4' energy: -97.231 flat angles P-C4'-P energy: -66.668 tors. eta vs tors. theta energy: -130.956 Dist. restrs. and SS energy: 0.724 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1437.374666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.374666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.290888 (E_RNA) where: Base-Base interactions energy: -1045.716 where: short stacking energy: -420.374 Base-Backbone interact. energy: -1.097 local terms energy: -428.478317 where: bonds (distance) C4'-P energy: -62.056 bonds (distance) P-C4' energy: -97.198 flat angles C4'-P-C4' energy: -93.567 flat angles P-C4'-P energy: -61.469 tors. eta vs tors. theta energy: -114.189 Dist. restrs. and SS energy: 1.166 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1399.039138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.039138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.408728 (E_RNA) where: Base-Base interactions energy: -1018.224 where: short stacking energy: -419.299 Base-Backbone interact. energy: 2.600 local terms energy: -421.784212 where: bonds (distance) C4'-P energy: -81.288 bonds (distance) P-C4' energy: -78.893 flat angles C4'-P-C4' energy: -88.919 flat angles P-C4'-P energy: -53.977 tors. eta vs tors. theta energy: -118.707 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1387.410687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.410687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.011047 (E_RNA) where: Base-Base interactions energy: -1008.985 where: short stacking energy: -412.523 Base-Backbone interact. energy: -0.896 local terms energy: -416.130119 where: bonds (distance) C4'-P energy: -80.645 bonds (distance) P-C4' energy: -72.448 flat angles C4'-P-C4' energy: -85.385 flat angles P-C4'-P energy: -67.154 tors. eta vs tors. theta energy: -110.498 Dist. restrs. and SS energy: 1.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -1286.970944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.970944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.894592 (E_RNA) where: Base-Base interactions energy: -946.998 where: short stacking energy: -360.901 Base-Backbone interact. energy: -2.719 local terms energy: -375.177024 where: bonds (distance) C4'-P energy: -81.604 bonds (distance) P-C4' energy: -80.375 flat angles C4'-P-C4' energy: -86.811 flat angles P-C4'-P energy: -29.291 tors. eta vs tors. theta energy: -97.096 Dist. restrs. and SS energy: 1.174 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1693.619809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.619809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.023067 (E_RNA) where: Base-Base interactions energy: -1211.758 where: short stacking energy: -510.309 Base-Backbone interact. energy: -0.778 local terms energy: -518.486855 where: bonds (distance) C4'-P energy: -95.015 bonds (distance) P-C4' energy: -90.807 flat angles C4'-P-C4' energy: -110.676 flat angles P-C4'-P energy: -68.703 tors. eta vs tors. theta energy: -153.285 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1697.224954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.224954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.525699 (E_RNA) where: Base-Base interactions energy: -1263.981 where: short stacking energy: -512.604 Base-Backbone interact. energy: -2.866 local terms energy: -468.679312 where: bonds (distance) C4'-P energy: -80.329 bonds (distance) P-C4' energy: -85.295 flat angles C4'-P-C4' energy: -99.846 flat angles P-C4'-P energy: -56.455 tors. eta vs tors. theta energy: -146.755 Dist. restrs. and SS energy: 1.551 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1606.371295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.371295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.969098 (E_RNA) where: Base-Base interactions energy: -1168.157 where: short stacking energy: -495.103 Base-Backbone interact. energy: 0.009 local terms energy: -475.821679 where: bonds (distance) C4'-P energy: -86.327 bonds (distance) P-C4' energy: -85.278 flat angles C4'-P-C4' energy: -98.957 flat angles P-C4'-P energy: -64.706 tors. eta vs tors. theta energy: -140.553 Dist. restrs. and SS energy: 0.848 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1558.549645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.549645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.248152 (E_RNA) where: Base-Base interactions energy: -1134.211 where: short stacking energy: -476.330 Base-Backbone interact. energy: -0.342 local terms energy: -461.695135 where: bonds (distance) C4'-P energy: -86.473 bonds (distance) P-C4' energy: -85.706 flat angles C4'-P-C4' energy: -92.405 flat angles P-C4'-P energy: -67.842 tors. eta vs tors. theta energy: -129.268 Dist. restrs. and SS energy: 0.949 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1520.018168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.018168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.018103 (E_RNA) where: Base-Base interactions energy: -1100.566 where: short stacking energy: -469.471 Base-Backbone interact. energy: -3.235 local terms energy: -454.216530 where: bonds (distance) C4'-P energy: -84.090 bonds (distance) P-C4' energy: -66.653 flat angles C4'-P-C4' energy: -101.995 flat angles P-C4'-P energy: -70.731 tors. eta vs tors. theta energy: -130.748 Dist. restrs. and SS energy: 1.250 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1490.936061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.936061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.927684 (E_RNA) where: Base-Base interactions energy: -1084.196 where: short stacking energy: -443.350 Base-Backbone interact. energy: -0.847 local terms energy: -443.885092 where: bonds (distance) C4'-P energy: -84.319 bonds (distance) P-C4' energy: -82.769 flat angles C4'-P-C4' energy: -91.218 flat angles P-C4'-P energy: -63.938 tors. eta vs tors. theta energy: -121.642 Dist. restrs. and SS energy: 1.242 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1450.848936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.848936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.697237 (E_RNA) where: Base-Base interactions energy: -1071.678 where: short stacking energy: -435.358 Base-Backbone interact. energy: -1.364 local terms energy: -415.655002 where: bonds (distance) C4'-P energy: -75.572 bonds (distance) P-C4' energy: -83.594 flat angles C4'-P-C4' energy: -85.390 flat angles P-C4'-P energy: -53.678 tors. eta vs tors. theta energy: -117.422 Dist. restrs. and SS energy: 1.098 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1378.558515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.558515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.903447 (E_RNA) where: Base-Base interactions energy: -1036.206 where: short stacking energy: -439.146 Base-Backbone interact. energy: 2.644 local terms energy: -383.342004 where: bonds (distance) C4'-P energy: -58.210 bonds (distance) P-C4' energy: -69.064 flat angles C4'-P-C4' energy: -82.405 flat angles P-C4'-P energy: -58.565 tors. eta vs tors. theta energy: -115.098 Dist. restrs. and SS energy: 1.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1357.230910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.230910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.774507 (E_RNA) where: Base-Base interactions energy: -964.495 where: short stacking energy: -386.064 Base-Backbone interact. energy: -1.997 local terms energy: -429.282008 where: bonds (distance) C4'-P energy: -81.276 bonds (distance) P-C4' energy: -83.313 flat angles C4'-P-C4' energy: -100.045 flat angles P-C4'-P energy: -50.605 tors. eta vs tors. theta energy: -114.042 Dist. restrs. and SS energy: 1.794 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1289.770748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.770748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.738457 (E_RNA) where: Base-Base interactions energy: -951.954 where: short stacking energy: -395.957 Base-Backbone interact. energy: -1.753 local terms energy: -377.032259 where: bonds (distance) C4'-P energy: -68.974 bonds (distance) P-C4' energy: -71.593 flat angles C4'-P-C4' energy: -77.224 flat angles P-C4'-P energy: -40.242 tors. eta vs tors. theta energy: -119.000 Dist. restrs. and SS energy: 4.218 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1700.695399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.695399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.170635 (E_RNA) where: Base-Base interactions energy: -1231.639 where: short stacking energy: -527.864 Base-Backbone interact. energy: -1.239 local terms energy: -505.292708 where: bonds (distance) C4'-P energy: -87.100 bonds (distance) P-C4' energy: -102.475 flat angles C4'-P-C4' energy: -106.271 flat angles P-C4'-P energy: -67.352 tors. eta vs tors. theta energy: -142.095 Dist. restrs. and SS energy: 0.725 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1710.260374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.260374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.634360 (E_RNA) where: Base-Base interactions energy: -1248.563 where: short stacking energy: -528.639 Base-Backbone interact. energy: -1.285 local terms energy: -497.786535 where: bonds (distance) C4'-P energy: -79.898 bonds (distance) P-C4' energy: -90.297 flat angles C4'-P-C4' energy: -106.468 flat angles P-C4'-P energy: -75.410 tors. eta vs tors. theta energy: -145.714 Dist. restrs. and SS energy: 0.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1602.074752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.074752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.873621 (E_RNA) where: Base-Base interactions energy: -1143.883 where: short stacking energy: -488.392 Base-Backbone interact. energy: 0.481 local terms energy: -496.471357 where: bonds (distance) C4'-P energy: -97.760 bonds (distance) P-C4' energy: -86.379 flat angles C4'-P-C4' energy: -106.703 flat angles P-C4'-P energy: -69.097 tors. eta vs tors. theta energy: -136.532 Dist. restrs. and SS energy: 1.049 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1561.749746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.749746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.660274 (E_RNA) where: Base-Base interactions energy: -1133.667 where: short stacking energy: -473.965 Base-Backbone interact. energy: -2.175 local terms energy: -464.818159 where: bonds (distance) C4'-P energy: -62.953 bonds (distance) P-C4' energy: -79.386 flat angles C4'-P-C4' energy: -101.408 flat angles P-C4'-P energy: -80.650 tors. eta vs tors. theta energy: -140.422 Dist. restrs. and SS energy: 2.161 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1575.090680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.090680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.744445 (E_RNA) where: Base-Base interactions energy: -1146.746 where: short stacking energy: -485.368 Base-Backbone interact. energy: 0.304 local terms energy: -468.302514 where: bonds (distance) C4'-P energy: -83.685 bonds (distance) P-C4' energy: -76.938 flat angles C4'-P-C4' energy: -100.229 flat angles P-C4'-P energy: -64.021 tors. eta vs tors. theta energy: -143.430 Dist. restrs. and SS energy: 2.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1505.688606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.688606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.415393 (E_RNA) where: Base-Base interactions energy: -1131.151 where: short stacking energy: -463.604 Base-Backbone interact. energy: 2.826 local terms energy: -415.089788 where: bonds (distance) C4'-P energy: -55.432 bonds (distance) P-C4' energy: -78.933 flat angles C4'-P-C4' energy: -99.289 flat angles P-C4'-P energy: -56.963 tors. eta vs tors. theta energy: -124.473 Dist. restrs. and SS energy: 0.977 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1438.611788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.611788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.043782 (E_RNA) where: Base-Base interactions energy: -1042.148 where: short stacking energy: -439.857 Base-Backbone interact. energy: -1.364 local terms energy: -433.532046 where: bonds (distance) C4'-P energy: -70.087 bonds (distance) P-C4' energy: -81.630 flat angles C4'-P-C4' energy: -95.431 flat angles P-C4'-P energy: -62.903 tors. eta vs tors. theta energy: -123.481 Dist. restrs. and SS energy: 1.682 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1404.924301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.924301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.130412 (E_RNA) where: Base-Base interactions energy: -1030.511 where: short stacking energy: -424.523 Base-Backbone interact. energy: 1.819 local terms energy: -414.438275 where: bonds (distance) C4'-P energy: -74.113 bonds (distance) P-C4' energy: -74.193 flat angles C4'-P-C4' energy: -95.973 flat angles P-C4'-P energy: -51.462 tors. eta vs tors. theta energy: -118.697 Dist. restrs. and SS energy: 1.456 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1335.559209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.559209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.202799 (E_RNA) where: Base-Base interactions energy: -968.432 where: short stacking energy: -379.480 Base-Backbone interact. energy: 1.090 local terms energy: -406.861072 where: bonds (distance) C4'-P energy: -82.922 bonds (distance) P-C4' energy: -80.778 flat angles C4'-P-C4' energy: -81.895 flat angles P-C4'-P energy: -47.067 tors. eta vs tors. theta energy: -114.199 Dist. restrs. and SS energy: 1.894 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1329.667857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.667857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.528306 (E_RNA) where: Base-Base interactions energy: -972.010 where: short stacking energy: -384.062 Base-Backbone interact. energy: -3.151 local terms energy: -393.366457 where: bonds (distance) C4'-P energy: -75.289 bonds (distance) P-C4' energy: -67.002 flat angles C4'-P-C4' energy: -87.601 flat angles P-C4'-P energy: -61.608 tors. eta vs tors. theta energy: -101.866 Dist. restrs. and SS energy: 2.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1714.296098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.296098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.429220 (E_RNA) where: Base-Base interactions energy: -1247.123 where: short stacking energy: -534.174 Base-Backbone interact. energy: -1.302 local terms energy: -503.004498 where: bonds (distance) C4'-P energy: -98.001 bonds (distance) P-C4' energy: -77.832 flat angles C4'-P-C4' energy: -106.301 flat angles P-C4'-P energy: -68.094 tors. eta vs tors. theta energy: -152.776 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1735.548183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.548183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.973646 (E_RNA) where: Base-Base interactions energy: -1265.541 where: short stacking energy: -523.564 Base-Backbone interact. energy: -1.452 local terms energy: -505.980019 where: bonds (distance) C4'-P energy: -82.983 bonds (distance) P-C4' energy: -95.967 flat angles C4'-P-C4' energy: -101.719 flat angles P-C4'-P energy: -74.271 tors. eta vs tors. theta energy: -151.041 Dist. restrs. and SS energy: 0.675 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1571.977370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.977370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.926991 (E_RNA) where: Base-Base interactions energy: -1122.036 where: short stacking energy: -491.105 Base-Backbone interact. energy: -1.981 local terms energy: -485.910103 where: bonds (distance) C4'-P energy: -79.205 bonds (distance) P-C4' energy: -97.682 flat angles C4'-P-C4' energy: -95.432 flat angles P-C4'-P energy: -78.710 tors. eta vs tors. theta energy: -134.881 Dist. restrs. and SS energy: 1.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1618.482031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.482031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.235696 (E_RNA) where: Base-Base interactions energy: -1126.725 where: short stacking energy: -492.320 Base-Backbone interact. energy: -1.675 local terms energy: -527.836005 where: bonds (distance) C4'-P energy: -99.628 bonds (distance) P-C4' energy: -94.304 flat angles C4'-P-C4' energy: -105.923 flat angles P-C4'-P energy: -76.600 tors. eta vs tors. theta energy: -151.382 Dist. restrs. and SS energy: 1.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1542.207945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.207945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.287759 (E_RNA) where: Base-Base interactions energy: -1111.071 where: short stacking energy: -462.181 Base-Backbone interact. energy: -1.044 local terms energy: -468.172911 where: bonds (distance) C4'-P energy: -84.264 bonds (distance) P-C4' energy: -78.116 flat angles C4'-P-C4' energy: -108.215 flat angles P-C4'-P energy: -65.585 tors. eta vs tors. theta energy: -131.993 Dist. restrs. and SS energy: 1.330 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1478.569810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.569810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.492159 (E_RNA) where: Base-Base interactions energy: -1063.884 where: short stacking energy: -446.166 Base-Backbone interact. energy: -0.203 local terms energy: -452.405504 where: bonds (distance) C4'-P energy: -77.594 bonds (distance) P-C4' energy: -83.089 flat angles C4'-P-C4' energy: -105.012 flat angles P-C4'-P energy: -63.068 tors. eta vs tors. theta energy: -123.643 Dist. restrs. and SS energy: 1.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1418.699526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.699526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.279638 (E_RNA) where: Base-Base interactions energy: -1034.396 where: short stacking energy: -434.829 Base-Backbone interact. energy: -0.236 local terms energy: -421.648427 where: bonds (distance) C4'-P energy: -70.997 bonds (distance) P-C4' energy: -83.003 flat angles C4'-P-C4' energy: -89.449 flat angles P-C4'-P energy: -59.096 tors. eta vs tors. theta energy: -119.104 Dist. restrs. and SS energy: 0.830 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1415.600035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.600035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.695956 (E_RNA) where: Base-Base interactions energy: -1029.492 where: short stacking energy: -432.198 Base-Backbone interact. energy: -2.704 local terms energy: -421.500325 where: bonds (distance) C4'-P energy: -68.960 bonds (distance) P-C4' energy: -78.941 flat angles C4'-P-C4' energy: -88.000 flat angles P-C4'-P energy: -63.399 tors. eta vs tors. theta energy: -122.201 Dist. restrs. and SS energy: 1.346 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1384.437110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.437110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.662869 (E_RNA) where: Base-Base interactions energy: -1012.757 where: short stacking energy: -414.468 Base-Backbone interact. energy: -1.741 local terms energy: -408.164951 where: bonds (distance) C4'-P energy: -69.937 bonds (distance) P-C4' energy: -77.823 flat angles C4'-P-C4' energy: -99.985 flat angles P-C4'-P energy: -52.855 tors. eta vs tors. theta energy: -107.565 Dist. restrs. and SS energy: 1.476 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1299.985504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.985504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.911853 (E_RNA) where: Base-Base interactions energy: -964.614 where: short stacking energy: -388.172 Base-Backbone interact. energy: 1.984 local terms energy: -378.281759 where: bonds (distance) C4'-P energy: -54.429 bonds (distance) P-C4' energy: -82.199 flat angles C4'-P-C4' energy: -86.604 flat angles P-C4'-P energy: -46.833 tors. eta vs tors. theta energy: -108.218 Dist. restrs. and SS energy: 4.176 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1709.329765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.329765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.957775 (E_RNA) where: Base-Base interactions energy: -1245.991 where: short stacking energy: -513.291 Base-Backbone interact. energy: -0.554 local terms energy: -500.412542 where: bonds (distance) C4'-P energy: -91.744 bonds (distance) P-C4' energy: -92.611 flat angles C4'-P-C4' energy: -107.139 flat angles P-C4'-P energy: -67.776 tors. eta vs tors. theta energy: -141.143 Dist. restrs. and SS energy: 0.878 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1713.706371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.706371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.380721 (E_RNA) where: Base-Base interactions energy: -1272.301 where: short stacking energy: -532.306 Base-Backbone interact. energy: -0.430 local terms energy: -478.650223 where: bonds (distance) C4'-P energy: -79.051 bonds (distance) P-C4' energy: -89.383 flat angles C4'-P-C4' energy: -104.711 flat angles P-C4'-P energy: -58.541 tors. eta vs tors. theta energy: -146.964 Dist. restrs. and SS energy: 0.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1577.370752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.370752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.144984 (E_RNA) where: Base-Base interactions energy: -1126.646 where: short stacking energy: -469.246 Base-Backbone interact. energy: -0.961 local terms energy: -487.538047 where: bonds (distance) C4'-P energy: -88.374 bonds (distance) P-C4' energy: -94.603 flat angles C4'-P-C4' energy: -108.494 flat angles P-C4'-P energy: -64.123 tors. eta vs tors. theta energy: -131.944 Dist. restrs. and SS energy: 1.024 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1586.731235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.731235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.900999 (E_RNA) where: Base-Base interactions energy: -1130.244 where: short stacking energy: -475.068 Base-Backbone interact. energy: 0.698 local terms energy: -496.355336 where: bonds (distance) C4'-P energy: -91.798 bonds (distance) P-C4' energy: -88.098 flat angles C4'-P-C4' energy: -100.647 flat angles P-C4'-P energy: -76.249 tors. eta vs tors. theta energy: -139.563 Dist. restrs. and SS energy: 2.420 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1534.810908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.810908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.072004 (E_RNA) where: Base-Base interactions energy: -1121.199 where: short stacking energy: -483.034 Base-Backbone interact. energy: -2.009 local terms energy: -449.864686 where: bonds (distance) C4'-P energy: -74.617 bonds (distance) P-C4' energy: -71.683 flat angles C4'-P-C4' energy: -100.174 flat angles P-C4'-P energy: -64.492 tors. eta vs tors. theta energy: -138.898 Dist. restrs. and SS energy: 1.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1475.410577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.410577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.687664 (E_RNA) where: Base-Base interactions energy: -1061.733 where: short stacking energy: -431.398 Base-Backbone interact. energy: -1.559 local terms energy: -450.394869 where: bonds (distance) C4'-P energy: -86.254 bonds (distance) P-C4' energy: -91.606 flat angles C4'-P-C4' energy: -93.228 flat angles P-C4'-P energy: -62.112 tors. eta vs tors. theta energy: -117.194 Dist. restrs. and SS energy: 1.527 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1441.759730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.759730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.348814 (E_RNA) where: Base-Base interactions energy: -1050.126 where: short stacking energy: -435.743 Base-Backbone interact. energy: -2.021 local terms energy: -428.202201 where: bonds (distance) C4'-P energy: -84.109 bonds (distance) P-C4' energy: -81.740 flat angles C4'-P-C4' energy: -81.428 flat angles P-C4'-P energy: -58.011 tors. eta vs tors. theta energy: -122.914 Dist. restrs. and SS energy: 1.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1392.103271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.103271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.940996 (E_RNA) where: Base-Base interactions energy: -1021.219 where: short stacking energy: -420.334 Base-Backbone interact. energy: -3.948 local terms energy: -405.774632 where: bonds (distance) C4'-P energy: -67.633 bonds (distance) P-C4' energy: -58.740 flat angles C4'-P-C4' energy: -91.430 flat angles P-C4'-P energy: -66.264 tors. eta vs tors. theta energy: -121.708 Dist. restrs. and SS energy: 2.088 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1347.815045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.815045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.472605 (E_RNA) where: Base-Base interactions energy: -1012.605 where: short stacking energy: -413.028 Base-Backbone interact. energy: 3.670 local terms energy: -377.537475 where: bonds (distance) C4'-P energy: -64.121 bonds (distance) P-C4' energy: -69.923 flat angles C4'-P-C4' energy: -79.097 flat angles P-C4'-P energy: -49.049 tors. eta vs tors. theta energy: -115.347 Dist. restrs. and SS energy: 1.908 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1304.127210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.127210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.308681 (E_RNA) where: Base-Base interactions energy: -959.705 where: short stacking energy: -376.310 Base-Backbone interact. energy: -1.376 local terms energy: -383.228179 where: bonds (distance) C4'-P energy: -54.500 bonds (distance) P-C4' energy: -83.922 flat angles C4'-P-C4' energy: -87.972 flat angles P-C4'-P energy: -46.705 tors. eta vs tors. theta energy: -110.129 Dist. restrs. and SS energy: 3.431 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1732.027502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.027502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.139677 (E_RNA) where: Base-Base interactions energy: -1240.995 where: short stacking energy: -539.462 Base-Backbone interact. energy: -0.965 local terms energy: -528.178938 where: bonds (distance) C4'-P energy: -95.074 bonds (distance) P-C4' energy: -98.499 flat angles C4'-P-C4' energy: -112.794 flat angles P-C4'-P energy: -75.871 tors. eta vs tors. theta energy: -145.940 Dist. restrs. and SS energy: 1.362 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1724.743205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.743205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.227338 (E_RNA) where: Base-Base interactions energy: -1252.689 where: short stacking energy: -514.752 Base-Backbone interact. energy: -1.480 local terms energy: -508.058003 where: bonds (distance) C4'-P energy: -98.684 bonds (distance) P-C4' energy: -99.808 flat angles C4'-P-C4' energy: -105.275 flat angles P-C4'-P energy: -62.920 tors. eta vs tors. theta energy: -141.370 Dist. restrs. and SS energy: 0.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1573.093744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.093744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.640592 (E_RNA) where: Base-Base interactions energy: -1137.828 where: short stacking energy: -490.940 Base-Backbone interact. energy: 0.523 local terms energy: -473.335449 where: bonds (distance) C4'-P energy: -81.257 bonds (distance) P-C4' energy: -75.522 flat angles C4'-P-C4' energy: -101.063 flat angles P-C4'-P energy: -73.234 tors. eta vs tors. theta energy: -142.259 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1546.947074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.947074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.570608 (E_RNA) where: Base-Base interactions energy: -1133.470 where: short stacking energy: -463.940 Base-Backbone interact. energy: -2.931 local terms energy: -448.169825 where: bonds (distance) C4'-P energy: -79.686 bonds (distance) P-C4' energy: -83.122 flat angles C4'-P-C4' energy: -96.373 flat angles P-C4'-P energy: -59.772 tors. eta vs tors. theta energy: -129.217 Dist. restrs. and SS energy: 0.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1558.911413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.911413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.523388 (E_RNA) where: Base-Base interactions energy: -1136.038 where: short stacking energy: -483.821 Base-Backbone interact. energy: -0.735 local terms energy: -459.751199 where: bonds (distance) C4'-P energy: -79.021 bonds (distance) P-C4' energy: -81.114 flat angles C4'-P-C4' energy: -95.850 flat angles P-C4'-P energy: -61.521 tors. eta vs tors. theta energy: -142.246 Dist. restrs. and SS energy: 0.862 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1453.254990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.254990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.057565 (E_RNA) where: Base-Base interactions energy: -1065.385 where: short stacking energy: -447.064 Base-Backbone interact. energy: -0.906 local terms energy: -424.766304 where: bonds (distance) C4'-P energy: -76.311 bonds (distance) P-C4' energy: -71.985 flat angles C4'-P-C4' energy: -93.902 flat angles P-C4'-P energy: -60.345 tors. eta vs tors. theta energy: -122.222 Dist. restrs. and SS energy: 1.053 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1424.777637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.777637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.201883 (E_RNA) where: Base-Base interactions energy: -1049.576 where: short stacking energy: -423.443 Base-Backbone interact. energy: 2.077 local terms energy: -414.702415 where: bonds (distance) C4'-P energy: -88.049 bonds (distance) P-C4' energy: -70.768 flat angles C4'-P-C4' energy: -81.567 flat angles P-C4'-P energy: -65.709 tors. eta vs tors. theta energy: -108.610 Dist. restrs. and SS energy: 0.674 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1457.452436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.452436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1495.952438 (E_RNA) where: Base-Base interactions energy: -1055.201 where: short stacking energy: -443.647 Base-Backbone interact. energy: -1.921 local terms energy: -438.829957 where: bonds (distance) C4'-P energy: -85.788 bonds (distance) P-C4' energy: -68.513 flat angles C4'-P-C4' energy: -99.425 flat angles P-C4'-P energy: -58.487 tors. eta vs tors. theta energy: -126.618 Dist. restrs. and SS energy: 1.750 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1322.001906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.001906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.226442 (E_RNA) where: Base-Base interactions energy: -977.604 where: short stacking energy: -398.137 Base-Backbone interact. energy: -1.291 local terms energy: -382.331593 where: bonds (distance) C4'-P energy: -73.278 bonds (distance) P-C4' energy: -73.917 flat angles C4'-P-C4' energy: -86.239 flat angles P-C4'-P energy: -47.020 tors. eta vs tors. theta energy: -101.877 Dist. restrs. and SS energy: 2.475 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1314.901641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.901641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.075365 (E_RNA) where: Base-Base interactions energy: -962.577 where: short stacking energy: -397.571 Base-Backbone interact. energy: -1.147 local terms energy: -391.351444 where: bonds (distance) C4'-P energy: -67.503 bonds (distance) P-C4' energy: -71.476 flat angles C4'-P-C4' energy: -99.543 flat angles P-C4'-P energy: -50.012 tors. eta vs tors. theta energy: -102.817 Dist. restrs. and SS energy: 3.424 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1755.466513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1755.466513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.741560 (E_RNA) where: Base-Base interactions energy: -1289.577 where: short stacking energy: -528.780 Base-Backbone interact. energy: -1.946 local terms energy: -501.219315 where: bonds (distance) C4'-P energy: -92.427 bonds (distance) P-C4' energy: -89.025 flat angles C4'-P-C4' energy: -105.290 flat angles P-C4'-P energy: -68.908 tors. eta vs tors. theta energy: -145.569 Dist. restrs. and SS energy: 0.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1700.892297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.892297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.958762 (E_RNA) where: Base-Base interactions energy: -1232.174 where: short stacking energy: -504.590 Base-Backbone interact. energy: -2.493 local terms energy: -504.291388 where: bonds (distance) C4'-P energy: -94.509 bonds (distance) P-C4' energy: -103.022 flat angles C4'-P-C4' energy: -98.132 flat angles P-C4'-P energy: -62.973 tors. eta vs tors. theta energy: -145.656 Dist. restrs. and SS energy: 1.316 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1584.126450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.126450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1621.943571 (E_RNA) where: Base-Base interactions energy: -1133.243 where: short stacking energy: -473.654 Base-Backbone interact. energy: -1.055 local terms energy: -487.646009 where: bonds (distance) C4'-P energy: -94.913 bonds (distance) P-C4' energy: -95.506 flat angles C4'-P-C4' energy: -98.930 flat angles P-C4'-P energy: -64.368 tors. eta vs tors. theta energy: -133.929 Dist. restrs. and SS energy: 1.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1596.526562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.526562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.912358 (E_RNA) where: Base-Base interactions energy: -1164.709 where: short stacking energy: -486.442 Base-Backbone interact. energy: -0.519 local terms energy: -468.684662 where: bonds (distance) C4'-P energy: -86.581 bonds (distance) P-C4' energy: -88.007 flat angles C4'-P-C4' energy: -98.211 flat angles P-C4'-P energy: -61.989 tors. eta vs tors. theta energy: -133.896 Dist. restrs. and SS energy: 0.636 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1496.938512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.938512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1534.513063 (E_RNA) where: Base-Base interactions energy: -1070.755 where: short stacking energy: -437.768 Base-Backbone interact. energy: -1.929 local terms energy: -461.828618 where: bonds (distance) C4'-P energy: -92.829 bonds (distance) P-C4' energy: -89.364 flat angles C4'-P-C4' energy: -100.744 flat angles P-C4'-P energy: -54.300 tors. eta vs tors. theta energy: -124.591 Dist. restrs. and SS energy: 0.825 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1450.939894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.939894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.840233 (E_RNA) where: Base-Base interactions energy: -1061.722 where: short stacking energy: -448.558 Base-Backbone interact. energy: -2.011 local terms energy: -426.106660 where: bonds (distance) C4'-P energy: -77.814 bonds (distance) P-C4' energy: -82.083 flat angles C4'-P-C4' energy: -87.578 flat angles P-C4'-P energy: -63.451 tors. eta vs tors. theta energy: -115.180 Dist. restrs. and SS energy: 2.150 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1409.815942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.815942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.433290 (E_RNA) where: Base-Base interactions energy: -1025.417 where: short stacking energy: -423.118 Base-Backbone interact. energy: -0.199 local terms energy: -422.817463 where: bonds (distance) C4'-P energy: -80.563 bonds (distance) P-C4' energy: -71.792 flat angles C4'-P-C4' energy: -81.700 flat angles P-C4'-P energy: -63.936 tors. eta vs tors. theta energy: -124.827 Dist. restrs. and SS energy: 1.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1405.848052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.848052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.608368 (E_RNA) where: Base-Base interactions energy: -1036.679 where: short stacking energy: -408.071 Base-Backbone interact. energy: 5.167 local terms energy: -412.096923 where: bonds (distance) C4'-P energy: -72.902 bonds (distance) P-C4' energy: -72.563 flat angles C4'-P-C4' energy: -89.418 flat angles P-C4'-P energy: -57.622 tors. eta vs tors. theta energy: -119.592 Dist. restrs. and SS energy: 1.010 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1370.134160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.134160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.203597 (E_RNA) where: Base-Base interactions energy: -1023.791 where: short stacking energy: -400.157 Base-Backbone interact. energy: 2.446 local terms energy: -386.858849 where: bonds (distance) C4'-P energy: -62.756 bonds (distance) P-C4' energy: -83.604 flat angles C4'-P-C4' energy: -75.741 flat angles P-C4'-P energy: -56.190 tors. eta vs tors. theta energy: -108.568 Dist. restrs. and SS energy: 1.319 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1339.840626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.840626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.263130 (E_RNA) where: Base-Base interactions energy: -1004.858 where: short stacking energy: -409.211 Base-Backbone interact. energy: -0.684 local terms energy: -373.720967 where: bonds (distance) C4'-P energy: -71.196 bonds (distance) P-C4' energy: -61.826 flat angles C4'-P-C4' energy: -82.134 flat angles P-C4'-P energy: -53.894 tors. eta vs tors. theta energy: -104.670 Dist. restrs. and SS energy: 2.673 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1720.170521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.170521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.905762 (E_RNA) where: Base-Base interactions energy: -1238.283 where: short stacking energy: -531.638 Base-Backbone interact. energy: -1.266 local terms energy: -518.356053 where: bonds (distance) C4'-P energy: -96.744 bonds (distance) P-C4' energy: -90.067 flat angles C4'-P-C4' energy: -109.104 flat angles P-C4'-P energy: -76.942 tors. eta vs tors. theta energy: -145.499 Dist. restrs. and SS energy: 0.985 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1696.027974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.027974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.205468 (E_RNA) where: Base-Base interactions energy: -1222.976 where: short stacking energy: -513.669 Base-Backbone interact. energy: -0.835 local terms energy: -510.394478 where: bonds (distance) C4'-P energy: -90.786 bonds (distance) P-C4' energy: -97.090 flat angles C4'-P-C4' energy: -108.709 flat angles P-C4'-P energy: -62.316 tors. eta vs tors. theta energy: -151.495 Dist. restrs. and SS energy: 1.427 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1589.937714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.937714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.919065 (E_RNA) where: Base-Base interactions energy: -1132.795 where: short stacking energy: -486.836 Base-Backbone interact. energy: -0.512 local terms energy: -494.612171 where: bonds (distance) C4'-P energy: -91.043 bonds (distance) P-C4' energy: -88.555 flat angles C4'-P-C4' energy: -101.764 flat angles P-C4'-P energy: -69.560 tors. eta vs tors. theta energy: -143.689 Dist. restrs. and SS energy: 1.231 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1567.699017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.699017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.492519 (E_RNA) where: Base-Base interactions energy: -1128.031 where: short stacking energy: -488.135 Base-Backbone interact. energy: -0.384 local terms energy: -477.077639 where: bonds (distance) C4'-P energy: -74.493 bonds (distance) P-C4' energy: -89.968 flat angles C4'-P-C4' energy: -101.587 flat angles P-C4'-P energy: -69.102 tors. eta vs tors. theta energy: -141.927 Dist. restrs. and SS energy: 1.044 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1518.721489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.721489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.111568 (E_RNA) where: Base-Base interactions energy: -1099.718 where: short stacking energy: -459.863 Base-Backbone interact. energy: -1.722 local terms energy: -456.672210 where: bonds (distance) C4'-P energy: -65.431 bonds (distance) P-C4' energy: -91.000 flat angles C4'-P-C4' energy: -100.714 flat angles P-C4'-P energy: -68.364 tors. eta vs tors. theta energy: -131.163 Dist. restrs. and SS energy: 2.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1466.424794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.424794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.683641 (E_RNA) where: Base-Base interactions energy: -1076.529 where: short stacking energy: -442.707 Base-Backbone interact. energy: -1.387 local terms energy: -427.766951 where: bonds (distance) C4'-P energy: -86.039 bonds (distance) P-C4' energy: -68.094 flat angles C4'-P-C4' energy: -96.726 flat angles P-C4'-P energy: -57.018 tors. eta vs tors. theta energy: -119.890 Dist. restrs. and SS energy: 2.509 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1404.498473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.498473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.866723 (E_RNA) where: Base-Base interactions energy: -1020.119 where: short stacking energy: -413.069 Base-Backbone interact. energy: -0.953 local terms energy: -421.795215 where: bonds (distance) C4'-P energy: -72.980 bonds (distance) P-C4' energy: -87.293 flat angles C4'-P-C4' energy: -93.451 flat angles P-C4'-P energy: -57.049 tors. eta vs tors. theta energy: -111.022 Dist. restrs. and SS energy: 1.618 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1446.081893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.081893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.218549 (E_RNA) where: Base-Base interactions energy: -1060.554 where: short stacking energy: -439.951 Base-Backbone interact. energy: 2.733 local terms energy: -426.397058 where: bonds (distance) C4'-P energy: -74.802 bonds (distance) P-C4' energy: -59.954 flat angles C4'-P-C4' energy: -99.826 flat angles P-C4'-P energy: -68.520 tors. eta vs tors. theta energy: -123.295 Dist. restrs. and SS energy: 1.387 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1377.381420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.381420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.417461 (E_RNA) where: Base-Base interactions energy: -1027.708 where: short stacking energy: -420.078 Base-Backbone interact. energy: 5.311 local terms energy: -394.020537 where: bonds (distance) C4'-P energy: -61.311 bonds (distance) P-C4' energy: -78.799 flat angles C4'-P-C4' energy: -82.632 flat angles P-C4'-P energy: -52.748 tors. eta vs tors. theta energy: -118.530 Dist. restrs. and SS energy: 2.286 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1306.306503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.306503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.577284 (E_RNA) where: Base-Base interactions energy: -992.886 where: short stacking energy: -398.020 Base-Backbone interact. energy: -1.148 local terms energy: -350.543165 where: bonds (distance) C4'-P energy: -73.414 bonds (distance) P-C4' energy: -73.170 flat angles C4'-P-C4' energy: -70.173 flat angles P-C4'-P energy: -32.317 tors. eta vs tors. theta energy: -101.470 Dist. restrs. and SS energy: 1.521 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1733.584325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.584325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1771.260406 (E_RNA) where: Base-Base interactions energy: -1263.462 where: short stacking energy: -523.356 Base-Backbone interact. energy: -3.611 local terms energy: -504.187168 where: bonds (distance) C4'-P energy: -99.486 bonds (distance) P-C4' energy: -80.140 flat angles C4'-P-C4' energy: -102.290 flat angles P-C4'-P energy: -71.943 tors. eta vs tors. theta energy: -150.328 Dist. restrs. and SS energy: 0.926 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1708.129670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.129670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.095376 (E_RNA) where: Base-Base interactions energy: -1247.021 where: short stacking energy: -522.217 Base-Backbone interact. energy: -1.536 local terms energy: -497.538427 where: bonds (distance) C4'-P energy: -92.851 bonds (distance) P-C4' energy: -86.154 flat angles C4'-P-C4' energy: -101.998 flat angles P-C4'-P energy: -73.424 tors. eta vs tors. theta energy: -143.112 Dist. restrs. and SS energy: 1.216 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1588.602169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.602169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.364526 (E_RNA) where: Base-Base interactions energy: -1162.817 where: short stacking energy: -504.360 Base-Backbone interact. energy: -1.560 local terms energy: -461.988015 where: bonds (distance) C4'-P energy: -84.142 bonds (distance) P-C4' energy: -77.255 flat angles C4'-P-C4' energy: -100.012 flat angles P-C4'-P energy: -54.964 tors. eta vs tors. theta energy: -145.615 Dist. restrs. and SS energy: 1.012 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1576.818968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.818968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.494349 (E_RNA) where: Base-Base interactions energy: -1121.404 where: short stacking energy: -483.033 Base-Backbone interact. energy: -0.746 local terms energy: -492.343900 where: bonds (distance) C4'-P energy: -82.453 bonds (distance) P-C4' energy: -96.247 flat angles C4'-P-C4' energy: -93.238 flat angles P-C4'-P energy: -71.496 tors. eta vs tors. theta energy: -148.909 Dist. restrs. and SS energy: 0.925 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1486.745785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.745785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.714650 (E_RNA) where: Base-Base interactions energy: -1077.972 where: short stacking energy: -457.886 Base-Backbone interact. energy: 1.627 local terms energy: -448.369436 where: bonds (distance) C4'-P energy: -80.890 bonds (distance) P-C4' energy: -76.597 flat angles C4'-P-C4' energy: -91.256 flat angles P-C4'-P energy: -69.149 tors. eta vs tors. theta energy: -130.479 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1467.771841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.771841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.386254 (E_RNA) where: Base-Base interactions energy: -1049.217 where: short stacking energy: -435.090 Base-Backbone interact. energy: -1.131 local terms energy: -455.038378 where: bonds (distance) C4'-P energy: -84.173 bonds (distance) P-C4' energy: -83.687 flat angles C4'-P-C4' energy: -102.199 flat angles P-C4'-P energy: -59.034 tors. eta vs tors. theta energy: -125.945 Dist. restrs. and SS energy: 0.864 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1427.258750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.258750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.395762 (E_RNA) where: Base-Base interactions energy: -1063.650 where: short stacking energy: -426.807 Base-Backbone interact. energy: -1.485 local terms energy: -400.261497 where: bonds (distance) C4'-P energy: -65.945 bonds (distance) P-C4' energy: -74.529 flat angles C4'-P-C4' energy: -76.633 flat angles P-C4'-P energy: -68.471 tors. eta vs tors. theta energy: -114.685 Dist. restrs. and SS energy: 1.387 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1400.470789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.470789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.596790 (E_RNA) where: Base-Base interactions energy: -1035.208 where: short stacking energy: -427.385 Base-Backbone interact. energy: -1.546 local terms energy: -401.842771 where: bonds (distance) C4'-P energy: -68.372 bonds (distance) P-C4' energy: -69.862 flat angles C4'-P-C4' energy: -95.487 flat angles P-C4'-P energy: -50.331 tors. eta vs tors. theta energy: -117.790 Dist. restrs. and SS energy: 1.376 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1365.637965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.637965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.219925 (E_RNA) where: Base-Base interactions energy: -1014.928 where: short stacking energy: -440.927 Base-Backbone interact. energy: 1.888 local terms energy: -391.180812 where: bonds (distance) C4'-P energy: -73.017 bonds (distance) P-C4' energy: -64.780 flat angles C4'-P-C4' energy: -88.062 flat angles P-C4'-P energy: -53.263 tors. eta vs tors. theta energy: -112.059 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1291.210682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.210682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.563038 (E_RNA) where: Base-Base interactions energy: -941.754 where: short stacking energy: -377.696 Base-Backbone interact. energy: 0.639 local terms energy: -389.448180 where: bonds (distance) C4'-P energy: -63.670 bonds (distance) P-C4' energy: -76.373 flat angles C4'-P-C4' energy: -84.143 flat angles P-C4'-P energy: -56.489 tors. eta vs tors. theta energy: -108.773 Dist. restrs. and SS energy: 2.602 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1735.241749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.241749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.584629 (E_RNA) where: Base-Base interactions energy: -1277.333 where: short stacking energy: -510.268 Base-Backbone interact. energy: 1.702 local terms energy: -496.954200 where: bonds (distance) C4'-P energy: -90.122 bonds (distance) P-C4' energy: -92.995 flat angles C4'-P-C4' energy: -109.999 flat angles P-C4'-P energy: -62.068 tors. eta vs tors. theta energy: -141.770 Dist. restrs. and SS energy: 0.593 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1705.547807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.547807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.304953 (E_RNA) where: Base-Base interactions energy: -1237.969 where: short stacking energy: -509.197 Base-Backbone interact. energy: -2.397 local terms energy: -502.938762 where: bonds (distance) C4'-P energy: -84.825 bonds (distance) P-C4' energy: -101.146 flat angles C4'-P-C4' energy: -100.615 flat angles P-C4'-P energy: -73.404 tors. eta vs tors. theta energy: -142.950 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1602.621082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.621082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.194455 (E_RNA) where: Base-Base interactions energy: -1145.036 where: short stacking energy: -484.593 Base-Backbone interact. energy: 0.388 local terms energy: -495.546269 where: bonds (distance) C4'-P energy: -84.748 bonds (distance) P-C4' energy: -91.039 flat angles C4'-P-C4' energy: -97.764 flat angles P-C4'-P energy: -79.113 tors. eta vs tors. theta energy: -142.882 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1596.682046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.682046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.667143 (E_RNA) where: Base-Base interactions energy: -1158.091 where: short stacking energy: -497.253 Base-Backbone interact. energy: -0.555 local terms energy: -477.021256 where: bonds (distance) C4'-P energy: -81.857 bonds (distance) P-C4' energy: -79.503 flat angles C4'-P-C4' energy: -99.649 flat angles P-C4'-P energy: -70.374 tors. eta vs tors. theta energy: -145.639 Dist. restrs. and SS energy: 2.235 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1500.212019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.212019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1538.430664 (E_RNA) where: Base-Base interactions energy: -1076.184 where: short stacking energy: -444.602 Base-Backbone interact. energy: -0.424 local terms energy: -461.823106 where: bonds (distance) C4'-P energy: -84.338 bonds (distance) P-C4' energy: -83.802 flat angles C4'-P-C4' energy: -103.093 flat angles P-C4'-P energy: -57.863 tors. eta vs tors. theta energy: -132.727 Dist. restrs. and SS energy: 1.469 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1445.112114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.112114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.465164 (E_RNA) where: Base-Base interactions energy: -1046.805 where: short stacking energy: -437.906 Base-Backbone interact. energy: -1.363 local terms energy: -435.297111 where: bonds (distance) C4'-P energy: -85.590 bonds (distance) P-C4' energy: -76.794 flat angles C4'-P-C4' energy: -99.291 flat angles P-C4'-P energy: -55.071 tors. eta vs tors. theta energy: -118.551 Dist. restrs. and SS energy: 1.603 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1425.720555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.720555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.548285 (E_RNA) where: Base-Base interactions energy: -1048.450 where: short stacking energy: -432.104 Base-Backbone interact. energy: -0.202 local terms energy: -414.895886 where: bonds (distance) C4'-P energy: -77.399 bonds (distance) P-C4' energy: -74.794 flat angles C4'-P-C4' energy: -94.162 flat angles P-C4'-P energy: -56.843 tors. eta vs tors. theta energy: -111.697 Dist. restrs. and SS energy: 1.078 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1371.323610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.323610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.031828 (E_RNA) where: Base-Base interactions energy: -997.985 where: short stacking energy: -411.033 Base-Backbone interact. energy: -0.323 local terms energy: -411.724604 where: bonds (distance) C4'-P energy: -82.238 bonds (distance) P-C4' energy: -84.976 flat angles C4'-P-C4' energy: -79.737 flat angles P-C4'-P energy: -56.973 tors. eta vs tors. theta energy: -107.800 Dist. restrs. and SS energy: 1.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1369.490206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.490206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.579165 (E_RNA) where: Base-Base interactions energy: -988.466 where: short stacking energy: -415.435 Base-Backbone interact. energy: -0.929 local terms energy: -418.184822 where: bonds (distance) C4'-P energy: -62.499 bonds (distance) P-C4' energy: -94.988 flat angles C4'-P-C4' energy: -90.031 flat angles P-C4'-P energy: -54.626 tors. eta vs tors. theta energy: -116.040 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1297.302359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.302359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.514576 (E_RNA) where: Base-Base interactions energy: -944.767 where: short stacking energy: -372.073 Base-Backbone interact. energy: -2.854 local terms energy: -387.893874 where: bonds (distance) C4'-P energy: -71.431 bonds (distance) P-C4' energy: -68.279 flat angles C4'-P-C4' energy: -81.534 flat angles P-C4'-P energy: -60.694 tors. eta vs tors. theta energy: -105.956 Dist. restrs. and SS energy: 1.462 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1725.822323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1725.822323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.437162 (E_RNA) where: Base-Base interactions energy: -1239.486 where: short stacking energy: -520.069 Base-Backbone interact. energy: -1.885 local terms energy: -522.066565 where: bonds (distance) C4'-P energy: -89.190 bonds (distance) P-C4' energy: -92.979 flat angles C4'-P-C4' energy: -112.746 flat angles P-C4'-P energy: -75.941 tors. eta vs tors. theta energy: -151.211 Dist. restrs. and SS energy: 0.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1700.123595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.123595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.099735 (E_RNA) where: Base-Base interactions energy: -1237.012 where: short stacking energy: -504.664 Base-Backbone interact. energy: -3.759 local terms energy: -497.329194 where: bonds (distance) C4'-P energy: -91.496 bonds (distance) P-C4' energy: -95.335 flat angles C4'-P-C4' energy: -106.540 flat angles P-C4'-P energy: -64.258 tors. eta vs tors. theta energy: -139.700 Dist. restrs. and SS energy: 1.226 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1601.329593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.329593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.477458 (E_RNA) where: Base-Base interactions energy: -1151.017 where: short stacking energy: -487.128 Base-Backbone interact. energy: -1.219 local terms energy: -487.242057 where: bonds (distance) C4'-P energy: -90.270 bonds (distance) P-C4' energy: -94.269 flat angles C4'-P-C4' energy: -99.849 flat angles P-C4'-P energy: -62.346 tors. eta vs tors. theta energy: -140.508 Dist. restrs. and SS energy: 1.398 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1556.038481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.038481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.323292 (E_RNA) where: Base-Base interactions energy: -1114.868 where: short stacking energy: -453.768 Base-Backbone interact. energy: 0.176 local terms energy: -478.631071 where: bonds (distance) C4'-P energy: -86.723 bonds (distance) P-C4' energy: -100.085 flat angles C4'-P-C4' energy: -103.679 flat angles P-C4'-P energy: -54.180 tors. eta vs tors. theta energy: -133.964 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1530.061824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.061824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.240054 (E_RNA) where: Base-Base interactions energy: -1090.893 where: short stacking energy: -457.159 Base-Backbone interact. energy: -0.724 local terms energy: -476.622571 where: bonds (distance) C4'-P energy: -82.097 bonds (distance) P-C4' energy: -84.969 flat angles C4'-P-C4' energy: -103.366 flat angles P-C4'-P energy: -67.580 tors. eta vs tors. theta energy: -138.611 Dist. restrs. and SS energy: 1.428 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1481.263609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.263609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.725690 (E_RNA) where: Base-Base interactions energy: -1098.315 where: short stacking energy: -431.233 Base-Backbone interact. energy: -2.101 local terms energy: -420.309123 where: bonds (distance) C4'-P energy: -70.454 bonds (distance) P-C4' energy: -93.869 flat angles C4'-P-C4' energy: -76.862 flat angles P-C4'-P energy: -72.111 tors. eta vs tors. theta energy: -107.012 Dist. restrs. and SS energy: 2.712 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1425.367927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.367927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.493009 (E_RNA) where: Base-Base interactions energy: -1053.677 where: short stacking energy: -416.274 Base-Backbone interact. energy: -2.546 local terms energy: -407.269821 where: bonds (distance) C4'-P energy: -66.455 bonds (distance) P-C4' energy: -77.803 flat angles C4'-P-C4' energy: -86.855 flat angles P-C4'-P energy: -53.057 tors. eta vs tors. theta energy: -123.100 Dist. restrs. and SS energy: 1.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1435.823121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.823121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.575553 (E_RNA) where: Base-Base interactions energy: -1045.666 where: short stacking energy: -442.882 Base-Backbone interact. energy: -1.823 local terms energy: -427.086784 where: bonds (distance) C4'-P energy: -69.713 bonds (distance) P-C4' energy: -83.706 flat angles C4'-P-C4' energy: -98.443 flat angles P-C4'-P energy: -51.436 tors. eta vs tors. theta energy: -123.789 Dist. restrs. and SS energy: 2.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1374.840437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.840437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.050844 (E_RNA) where: Base-Base interactions energy: -1003.452 where: short stacking energy: -412.898 Base-Backbone interact. energy: -1.895 local terms energy: -408.703913 where: bonds (distance) C4'-P energy: -70.818 bonds (distance) P-C4' energy: -73.423 flat angles C4'-P-C4' energy: -92.407 flat angles P-C4'-P energy: -67.860 tors. eta vs tors. theta energy: -104.195 Dist. restrs. and SS energy: 2.460 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1285.259495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.259495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.064074 (E_RNA) where: Base-Base interactions energy: -947.836 where: short stacking energy: -389.206 Base-Backbone interact. energy: -0.224 local terms energy: -376.003847 where: bonds (distance) C4'-P energy: -71.867 bonds (distance) P-C4' energy: -73.312 flat angles C4'-P-C4' energy: -74.926 flat angles P-C4'-P energy: -52.165 tors. eta vs tors. theta energy: -103.734 Dist. restrs. and SS energy: 2.055 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1728.221341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.221341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.655211 (E_RNA) where: Base-Base interactions energy: -1243.521 where: short stacking energy: -523.408 Base-Backbone interact. energy: -0.990 local terms energy: -521.143804 where: bonds (distance) C4'-P energy: -100.568 bonds (distance) P-C4' energy: -91.607 flat angles C4'-P-C4' energy: -109.905 flat angles P-C4'-P energy: -72.044 tors. eta vs tors. theta energy: -147.021 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1707.958835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.958835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1745.775894 (E_RNA) where: Base-Base interactions energy: -1261.884 where: short stacking energy: -512.873 Base-Backbone interact. energy: -0.670 local terms energy: -483.222078 where: bonds (distance) C4'-P energy: -88.390 bonds (distance) P-C4' energy: -72.404 flat angles C4'-P-C4' energy: -101.620 flat angles P-C4'-P energy: -71.807 tors. eta vs tors. theta energy: -149.001 Dist. restrs. and SS energy: 1.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1616.923842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.923842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.620885 (E_RNA) where: Base-Base interactions energy: -1150.015 where: short stacking energy: -487.655 Base-Backbone interact. energy: -1.324 local terms energy: -503.282320 where: bonds (distance) C4'-P energy: -94.498 bonds (distance) P-C4' energy: -91.401 flat angles C4'-P-C4' energy: -110.471 flat angles P-C4'-P energy: -76.632 tors. eta vs tors. theta energy: -130.281 Dist. restrs. and SS energy: 0.947 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1561.690637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.690637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.819347 (E_RNA) where: Base-Base interactions energy: -1114.204 where: short stacking energy: -457.568 Base-Backbone interact. energy: -1.458 local terms energy: -485.157841 where: bonds (distance) C4'-P energy: -97.424 bonds (distance) P-C4' energy: -80.365 flat angles C4'-P-C4' energy: -100.656 flat angles P-C4'-P energy: -77.769 tors. eta vs tors. theta energy: -128.944 Dist. restrs. and SS energy: 2.379 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1529.796805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.796805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.078055 (E_RNA) where: Base-Base interactions energy: -1096.328 where: short stacking energy: -452.944 Base-Backbone interact. energy: -1.688 local terms energy: -470.061912 where: bonds (distance) C4'-P energy: -88.742 bonds (distance) P-C4' energy: -92.961 flat angles C4'-P-C4' energy: -92.216 flat angles P-C4'-P energy: -65.864 tors. eta vs tors. theta energy: -130.278 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1491.583199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.583199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.331231 (E_RNA) where: Base-Base interactions energy: -1094.979 where: short stacking energy: -434.579 Base-Backbone interact. energy: -4.173 local terms energy: -430.179865 where: bonds (distance) C4'-P energy: -76.944 bonds (distance) P-C4' energy: -91.408 flat angles C4'-P-C4' energy: -77.836 flat angles P-C4'-P energy: -72.085 tors. eta vs tors. theta energy: -111.907 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1415.726112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.726112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.156191 (E_RNA) where: Base-Base interactions energy: -1021.082 where: short stacking energy: -417.381 Base-Backbone interact. energy: -0.560 local terms energy: -432.513912 where: bonds (distance) C4'-P energy: -71.853 bonds (distance) P-C4' energy: -80.244 flat angles C4'-P-C4' energy: -99.316 flat angles P-C4'-P energy: -64.921 tors. eta vs tors. theta energy: -116.180 Dist. restrs. and SS energy: 1.680 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1415.484052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.484052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.750046 (E_RNA) where: Base-Base interactions energy: -1030.490 where: short stacking energy: -420.789 Base-Backbone interact. energy: -0.797 local terms energy: -422.462930 where: bonds (distance) C4'-P energy: -79.549 bonds (distance) P-C4' energy: -83.854 flat angles C4'-P-C4' energy: -86.445 flat angles P-C4'-P energy: -50.546 tors. eta vs tors. theta energy: -122.069 Dist. restrs. and SS energy: 1.516 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1345.657982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.657982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.477892 (E_RNA) where: Base-Base interactions energy: -960.206 where: short stacking energy: -379.759 Base-Backbone interact. energy: -1.793 local terms energy: -422.479551 where: bonds (distance) C4'-P energy: -85.041 bonds (distance) P-C4' energy: -79.597 flat angles C4'-P-C4' energy: -91.757 flat angles P-C4'-P energy: -55.568 tors. eta vs tors. theta energy: -110.517 Dist. restrs. and SS energy: 2.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1294.823472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.823472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.660008 (E_RNA) where: Base-Base interactions energy: -957.705 where: short stacking energy: -377.389 Base-Backbone interact. energy: 0.306 local terms energy: -377.261258 where: bonds (distance) C4'-P energy: -82.645 bonds (distance) P-C4' energy: -64.665 flat angles C4'-P-C4' energy: -83.399 flat angles P-C4'-P energy: -40.511 tors. eta vs tors. theta energy: -106.041 Dist. restrs. and SS energy: 3.087 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1713.999721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.999721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.335468 (E_RNA) where: Base-Base interactions energy: -1236.040 where: short stacking energy: -508.819 Base-Backbone interact. energy: -0.513 local terms energy: -514.782346 where: bonds (distance) C4'-P energy: -90.340 bonds (distance) P-C4' energy: -98.016 flat angles C4'-P-C4' energy: -110.542 flat angles P-C4'-P energy: -66.270 tors. eta vs tors. theta energy: -149.615 Dist. restrs. and SS energy: 0.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1726.400811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.400811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.116534 (E_RNA) where: Base-Base interactions energy: -1257.124 where: short stacking energy: -533.477 Base-Backbone interact. energy: -0.382 local terms energy: -506.609854 where: bonds (distance) C4'-P energy: -77.644 bonds (distance) P-C4' energy: -101.778 flat angles C4'-P-C4' energy: -104.060 flat angles P-C4'-P energy: -76.073 tors. eta vs tors. theta energy: -147.055 Dist. restrs. and SS energy: 0.966 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1614.853171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.853171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.595888 (E_RNA) where: Base-Base interactions energy: -1152.501 where: short stacking energy: -493.120 Base-Backbone interact. energy: -1.836 local terms energy: -499.258637 where: bonds (distance) C4'-P energy: -90.383 bonds (distance) P-C4' energy: -85.843 flat angles C4'-P-C4' energy: -112.312 flat angles P-C4'-P energy: -71.007 tors. eta vs tors. theta energy: -139.713 Dist. restrs. and SS energy: 1.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1582.204594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.204594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.671083 (E_RNA) where: Base-Base interactions energy: -1139.247 where: short stacking energy: -475.022 Base-Backbone interact. energy: -1.626 local terms energy: -479.797534 where: bonds (distance) C4'-P energy: -83.552 bonds (distance) P-C4' energy: -83.432 flat angles C4'-P-C4' energy: -108.883 flat angles P-C4'-P energy: -60.422 tors. eta vs tors. theta energy: -143.509 Dist. restrs. and SS energy: 1.716 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1491.047141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.047141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.568797 (E_RNA) where: Base-Base interactions energy: -1072.279 where: short stacking energy: -434.464 Base-Backbone interact. energy: -2.979 local terms energy: -453.310743 where: bonds (distance) C4'-P energy: -80.875 bonds (distance) P-C4' energy: -91.352 flat angles C4'-P-C4' energy: -95.342 flat angles P-C4'-P energy: -70.595 tors. eta vs tors. theta energy: -115.147 Dist. restrs. and SS energy: 0.772 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1497.657378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.657378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.615509 (E_RNA) where: Base-Base interactions energy: -1095.549 where: short stacking energy: -439.036 Base-Backbone interact. energy: -1.531 local terms energy: -438.535398 where: bonds (distance) C4'-P energy: -73.927 bonds (distance) P-C4' energy: -89.197 flat angles C4'-P-C4' energy: -91.342 flat angles P-C4'-P energy: -68.992 tors. eta vs tors. theta energy: -115.078 Dist. restrs. and SS energy: 1.208 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1474.546378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.546378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.685729 (E_RNA) where: Base-Base interactions energy: -1087.119 where: short stacking energy: -454.477 Base-Backbone interact. energy: -2.161 local terms energy: -425.405370 where: bonds (distance) C4'-P energy: -74.419 bonds (distance) P-C4' energy: -76.894 flat angles C4'-P-C4' energy: -89.016 flat angles P-C4'-P energy: -65.456 tors. eta vs tors. theta energy: -119.620 Dist. restrs. and SS energy: 3.389 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1410.980875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.980875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.786972 (E_RNA) where: Base-Base interactions energy: -1030.295 where: short stacking energy: -420.929 Base-Backbone interact. energy: -1.822 local terms energy: -417.670196 where: bonds (distance) C4'-P energy: -86.003 bonds (distance) P-C4' energy: -82.950 flat angles C4'-P-C4' energy: -82.083 flat angles P-C4'-P energy: -53.136 tors. eta vs tors. theta energy: -113.498 Dist. restrs. and SS energy: 2.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1358.935448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.935448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.329102 (E_RNA) where: Base-Base interactions energy: -983.538 where: short stacking energy: -402.388 Base-Backbone interact. energy: 0.017 local terms energy: -413.808478 where: bonds (distance) C4'-P energy: -79.516 bonds (distance) P-C4' energy: -79.567 flat angles C4'-P-C4' energy: -82.131 flat angles P-C4'-P energy: -58.344 tors. eta vs tors. theta energy: -114.252 Dist. restrs. and SS energy: 1.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1316.748930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.748930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.200804 (E_RNA) where: Base-Base interactions energy: -957.322 where: short stacking energy: -396.692 Base-Backbone interact. energy: -1.122 local terms energy: -397.756746 where: bonds (distance) C4'-P energy: -81.569 bonds (distance) P-C4' energy: -74.331 flat angles C4'-P-C4' energy: -88.443 flat angles P-C4'-P energy: -47.329 tors. eta vs tors. theta energy: -106.085 Dist. restrs. and SS energy: 2.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1769.590027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1769.590027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.042285 (E_RNA) where: Base-Base interactions energy: -1294.365 where: short stacking energy: -530.881 Base-Backbone interact. energy: -0.909 local terms energy: -511.768261 where: bonds (distance) C4'-P energy: -87.463 bonds (distance) P-C4' energy: -101.660 flat angles C4'-P-C4' energy: -103.785 flat angles P-C4'-P energy: -68.825 tors. eta vs tors. theta energy: -150.035 Dist. restrs. and SS energy: 0.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1692.857276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.857276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.648702 (E_RNA) where: Base-Base interactions energy: -1216.764 where: short stacking energy: -505.978 Base-Backbone interact. energy: -3.296 local terms energy: -510.588317 where: bonds (distance) C4'-P energy: -88.760 bonds (distance) P-C4' energy: -108.124 flat angles C4'-P-C4' energy: -103.695 flat angles P-C4'-P energy: -73.122 tors. eta vs tors. theta energy: -136.887 Dist. restrs. and SS energy: 1.041 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1599.590512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.590512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.050070 (E_RNA) where: Base-Base interactions energy: -1149.461 where: short stacking energy: -492.543 Base-Backbone interact. energy: -1.151 local terms energy: -486.437844 where: bonds (distance) C4'-P energy: -82.090 bonds (distance) P-C4' energy: -95.090 flat angles C4'-P-C4' energy: -105.421 flat angles P-C4'-P energy: -65.058 tors. eta vs tors. theta energy: -138.779 Dist. restrs. and SS energy: 0.710 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1587.405787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.405787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.052533 (E_RNA) where: Base-Base interactions energy: -1135.965 where: short stacking energy: -466.458 Base-Backbone interact. energy: -2.713 local terms energy: -486.374863 where: bonds (distance) C4'-P energy: -89.769 bonds (distance) P-C4' energy: -80.944 flat angles C4'-P-C4' energy: -105.168 flat angles P-C4'-P energy: -73.124 tors. eta vs tors. theta energy: -137.369 Dist. restrs. and SS energy: 0.897 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1540.994815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.994815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.312654 (E_RNA) where: Base-Base interactions energy: -1111.685 where: short stacking energy: -460.872 Base-Backbone interact. energy: -1.702 local terms energy: -465.925492 where: bonds (distance) C4'-P energy: -87.899 bonds (distance) P-C4' energy: -87.032 flat angles C4'-P-C4' energy: -89.062 flat angles P-C4'-P energy: -72.454 tors. eta vs tors. theta energy: -129.478 Dist. restrs. and SS energy: 1.568 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1471.675447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.675447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.546713 (E_RNA) where: Base-Base interactions energy: -1064.992 where: short stacking energy: -436.060 Base-Backbone interact. energy: -1.269 local terms energy: -443.285466 where: bonds (distance) C4'-P energy: -74.451 bonds (distance) P-C4' energy: -91.002 flat angles C4'-P-C4' energy: -92.949 flat angles P-C4'-P energy: -61.116 tors. eta vs tors. theta energy: -123.768 Dist. restrs. and SS energy: 1.121 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1428.474513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.474513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.048368 (E_RNA) where: Base-Base interactions energy: -1057.596 where: short stacking energy: -407.000 Base-Backbone interact. energy: -1.265 local terms energy: -407.186900 where: bonds (distance) C4'-P energy: -63.268 bonds (distance) P-C4' energy: -70.829 flat angles C4'-P-C4' energy: -88.753 flat angles P-C4'-P energy: -65.361 tors. eta vs tors. theta energy: -118.976 Dist. restrs. and SS energy: 0.824 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1391.155866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.155866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.848346 (E_RNA) where: Base-Base interactions energy: -1015.390 where: short stacking energy: -419.205 Base-Backbone interact. energy: -3.129 local terms energy: -416.329160 where: bonds (distance) C4'-P energy: -82.107 bonds (distance) P-C4' energy: -76.981 flat angles C4'-P-C4' energy: -90.883 flat angles P-C4'-P energy: -47.848 tors. eta vs tors. theta energy: -118.511 Dist. restrs. and SS energy: 6.942 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1308.487443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.487443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.534260 (E_RNA) where: Base-Base interactions energy: -967.456 where: short stacking energy: -405.437 Base-Backbone interact. energy: 2.225 local terms energy: -386.303962 where: bonds (distance) C4'-P energy: -83.711 bonds (distance) P-C4' energy: -53.506 flat angles C4'-P-C4' energy: -78.685 flat angles P-C4'-P energy: -52.268 tors. eta vs tors. theta energy: -118.134 Dist. restrs. and SS energy: 6.297 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1324.425350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.425350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.013591 (E_RNA) where: Base-Base interactions energy: -963.645 where: short stacking energy: -385.112 Base-Backbone interact. energy: -0.719 local terms energy: -398.649689 where: bonds (distance) C4'-P energy: -73.412 bonds (distance) P-C4' energy: -72.768 flat angles C4'-P-C4' energy: -85.735 flat angles P-C4'-P energy: -58.936 tors. eta vs tors. theta energy: -107.799 Dist. restrs. and SS energy: 1.838 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1759.590179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1759.590179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1798.162857 (E_RNA) where: Base-Base interactions energy: -1277.128 where: short stacking energy: -528.106 Base-Backbone interact. energy: 1.568 local terms energy: -522.603108 where: bonds (distance) C4'-P energy: -90.815 bonds (distance) P-C4' energy: -99.447 flat angles C4'-P-C4' energy: -112.339 flat angles P-C4'-P energy: -71.115 tors. eta vs tors. theta energy: -148.888 Dist. restrs. and SS energy: 1.823 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1689.448018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.448018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.975432 (E_RNA) where: Base-Base interactions energy: -1221.338 where: short stacking energy: -516.176 Base-Backbone interact. energy: 0.238 local terms energy: -505.875589 where: bonds (distance) C4'-P energy: -85.962 bonds (distance) P-C4' energy: -93.982 flat angles C4'-P-C4' energy: -105.588 flat angles P-C4'-P energy: -70.422 tors. eta vs tors. theta energy: -149.922 Dist. restrs. and SS energy: 0.777 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1578.250582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.250582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.139497 (E_RNA) where: Base-Base interactions energy: -1132.308 where: short stacking energy: -474.629 Base-Backbone interact. energy: -2.445 local terms energy: -481.386651 where: bonds (distance) C4'-P energy: -87.311 bonds (distance) P-C4' energy: -83.258 flat angles C4'-P-C4' energy: -101.430 flat angles P-C4'-P energy: -70.723 tors. eta vs tors. theta energy: -138.666 Dist. restrs. and SS energy: 1.139 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1547.407930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.407930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.157795 (E_RNA) where: Base-Base interactions energy: -1128.260 where: short stacking energy: -446.772 Base-Backbone interact. energy: -2.452 local terms energy: -454.445672 where: bonds (distance) C4'-P energy: -71.719 bonds (distance) P-C4' energy: -87.636 flat angles C4'-P-C4' energy: -96.682 flat angles P-C4'-P energy: -69.898 tors. eta vs tors. theta energy: -128.510 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1557.094297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.094297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.090970 (E_RNA) where: Base-Base interactions energy: -1110.936 where: short stacking energy: -462.078 Base-Backbone interact. energy: 3.521 local terms energy: -487.676121 where: bonds (distance) C4'-P energy: -83.784 bonds (distance) P-C4' energy: -89.002 flat angles C4'-P-C4' energy: -107.151 flat angles P-C4'-P energy: -67.171 tors. eta vs tors. theta energy: -140.568 Dist. restrs. and SS energy: 1.247 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1490.869465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.869465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.363581 (E_RNA) where: Base-Base interactions energy: -1115.827 where: short stacking energy: -460.455 Base-Backbone interact. energy: -2.262 local terms energy: -411.274141 where: bonds (distance) C4'-P energy: -77.278 bonds (distance) P-C4' energy: -71.915 flat angles C4'-P-C4' energy: -88.894 flat angles P-C4'-P energy: -44.833 tors. eta vs tors. theta energy: -128.354 Dist. restrs. and SS energy: 1.744 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1428.390655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.390655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.170542 (E_RNA) where: Base-Base interactions energy: -1035.516 where: short stacking energy: -405.012 Base-Backbone interact. energy: -1.269 local terms energy: -429.385267 where: bonds (distance) C4'-P energy: -88.362 bonds (distance) P-C4' energy: -81.351 flat angles C4'-P-C4' energy: -95.341 flat angles P-C4'-P energy: -50.668 tors. eta vs tors. theta energy: -113.663 Dist. restrs. and SS energy: 1.030 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1418.165516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.165516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.025315 (E_RNA) where: Base-Base interactions energy: -1027.541 where: short stacking energy: -444.973 Base-Backbone interact. energy: -2.932 local terms energy: -426.551737 where: bonds (distance) C4'-P energy: -69.264 bonds (distance) P-C4' energy: -83.777 flat angles C4'-P-C4' energy: -89.699 flat angles P-C4'-P energy: -53.026 tors. eta vs tors. theta energy: -130.787 Dist. restrs. and SS energy: 2.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1406.029759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.029759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.457950 (E_RNA) where: Base-Base interactions energy: -1027.518 where: short stacking energy: -439.555 Base-Backbone interact. energy: 1.742 local terms energy: -418.682175 where: bonds (distance) C4'-P energy: -79.862 bonds (distance) P-C4' energy: -81.653 flat angles C4'-P-C4' energy: -86.741 flat angles P-C4'-P energy: -51.072 tors. eta vs tors. theta energy: -119.354 Dist. restrs. and SS energy: 1.678 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1339.491432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.491432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.749012 (E_RNA) where: Base-Base interactions energy: -986.957 where: short stacking energy: -375.840 Base-Backbone interact. energy: 4.292 local terms energy: -396.083354 where: bonds (distance) C4'-P energy: -75.891 bonds (distance) P-C4' energy: -76.151 flat angles C4'-P-C4' energy: -76.077 flat angles P-C4'-P energy: -59.143 tors. eta vs tors. theta energy: -108.821 Dist. restrs. and SS energy: 2.508 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1751.309928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.309928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1788.841118 (E_RNA) where: Base-Base interactions energy: -1275.749 where: short stacking energy: -541.538 Base-Backbone interact. energy: -1.917 local terms energy: -511.175278 where: bonds (distance) C4'-P energy: -92.606 bonds (distance) P-C4' energy: -103.968 flat angles C4'-P-C4' energy: -110.021 flat angles P-C4'-P energy: -60.557 tors. eta vs tors. theta energy: -144.024 Dist. restrs. and SS energy: 0.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1738.474404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.474404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.089906 (E_RNA) where: Base-Base interactions energy: -1283.719 where: short stacking energy: -530.118 Base-Backbone interact. energy: -1.525 local terms energy: -490.846188 where: bonds (distance) C4'-P energy: -76.847 bonds (distance) P-C4' energy: -94.208 flat angles C4'-P-C4' energy: -101.896 flat angles P-C4'-P energy: -63.673 tors. eta vs tors. theta energy: -154.223 Dist. restrs. and SS energy: 0.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1609.891398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.891398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.849896 (E_RNA) where: Base-Base interactions energy: -1137.840 where: short stacking energy: -469.787 Base-Backbone interact. energy: -2.737 local terms energy: -507.272608 where: bonds (distance) C4'-P energy: -99.512 bonds (distance) P-C4' energy: -97.208 flat angles C4'-P-C4' energy: -106.655 flat angles P-C4'-P energy: -61.942 tors. eta vs tors. theta energy: -141.956 Dist. restrs. and SS energy: 1.208 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1579.209966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.209966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.440814 (E_RNA) where: Base-Base interactions energy: -1155.991 where: short stacking energy: -476.632 Base-Backbone interact. energy: 1.221 local terms energy: -462.670880 where: bonds (distance) C4'-P energy: -81.483 bonds (distance) P-C4' energy: -85.529 flat angles C4'-P-C4' energy: -90.438 flat angles P-C4'-P energy: -69.675 tors. eta vs tors. theta energy: -135.546 Dist. restrs. and SS energy: 1.481 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1542.082107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.082107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.489058 (E_RNA) where: Base-Base interactions energy: -1139.503 where: short stacking energy: -466.662 Base-Backbone interact. energy: -3.706 local terms energy: -436.279820 where: bonds (distance) C4'-P energy: -88.363 bonds (distance) P-C4' energy: -74.152 flat angles C4'-P-C4' energy: -91.951 flat angles P-C4'-P energy: -53.087 tors. eta vs tors. theta energy: -128.726 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1494.561039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.561039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.486635 (E_RNA) where: Base-Base interactions energy: -1087.206 where: short stacking energy: -461.856 Base-Backbone interact. energy: -2.131 local terms energy: -444.150382 where: bonds (distance) C4'-P energy: -67.386 bonds (distance) P-C4' energy: -84.219 flat angles C4'-P-C4' energy: -99.913 flat angles P-C4'-P energy: -68.654 tors. eta vs tors. theta energy: -123.978 Dist. restrs. and SS energy: 2.176 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1470.868876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.868876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.472196 (E_RNA) where: Base-Base interactions energy: -1081.223 where: short stacking energy: -442.520 Base-Backbone interact. energy: -0.085 local terms energy: -428.164185 where: bonds (distance) C4'-P energy: -76.635 bonds (distance) P-C4' energy: -81.951 flat angles C4'-P-C4' energy: -90.346 flat angles P-C4'-P energy: -56.420 tors. eta vs tors. theta energy: -122.813 Dist. restrs. and SS energy: 1.853 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1392.512315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.512315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.917760 (E_RNA) where: Base-Base interactions energy: -1007.393 where: short stacking energy: -417.724 Base-Backbone interact. energy: -3.325 local terms energy: -421.199608 where: bonds (distance) C4'-P energy: -76.006 bonds (distance) P-C4' energy: -87.966 flat angles C4'-P-C4' energy: -95.644 flat angles P-C4'-P energy: -53.418 tors. eta vs tors. theta energy: -108.166 Dist. restrs. and SS energy: 2.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1383.363949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.363949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.524942 (E_RNA) where: Base-Base interactions energy: -1035.212 where: short stacking energy: -410.335 Base-Backbone interact. energy: 0.554 local terms energy: -386.867398 where: bonds (distance) C4'-P energy: -52.322 bonds (distance) P-C4' energy: -80.173 flat angles C4'-P-C4' energy: -86.779 flat angles P-C4'-P energy: -51.562 tors. eta vs tors. theta energy: -116.031 Dist. restrs. and SS energy: 1.411 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1308.622832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.622832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.246069 (E_RNA) where: Base-Base interactions energy: -986.312 where: short stacking energy: -384.723 Base-Backbone interact. energy: 0.528 local terms energy: -361.461467 where: bonds (distance) C4'-P energy: -74.772 bonds (distance) P-C4' energy: -63.909 flat angles C4'-P-C4' energy: -74.423 flat angles P-C4'-P energy: -38.928 tors. eta vs tors. theta energy: -109.429 Dist. restrs. and SS energy: 1.873 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1742.172560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1742.172560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.302221 (E_RNA) where: Base-Base interactions energy: -1255.328 where: short stacking energy: -518.734 Base-Backbone interact. energy: -2.891 local terms energy: -522.083604 where: bonds (distance) C4'-P energy: -105.801 bonds (distance) P-C4' energy: -89.283 flat angles C4'-P-C4' energy: -111.534 flat angles P-C4'-P energy: -68.400 tors. eta vs tors. theta energy: -147.067 Dist. restrs. and SS energy: 1.380 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1727.203277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.203277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.898911 (E_RNA) where: Base-Base interactions energy: -1246.732 where: short stacking energy: -507.861 Base-Backbone interact. energy: 1.596 local terms energy: -519.762854 where: bonds (distance) C4'-P energy: -89.553 bonds (distance) P-C4' energy: -107.784 flat angles C4'-P-C4' energy: -106.057 flat angles P-C4'-P energy: -67.067 tors. eta vs tors. theta energy: -149.302 Dist. restrs. and SS energy: 0.946 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1618.504733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.504733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.511774 (E_RNA) where: Base-Base interactions energy: -1176.979 where: short stacking energy: -507.977 Base-Backbone interact. energy: -1.769 local terms energy: -477.764243 where: bonds (distance) C4'-P energy: -92.403 bonds (distance) P-C4' energy: -76.663 flat angles C4'-P-C4' energy: -102.841 flat angles P-C4'-P energy: -59.951 tors. eta vs tors. theta energy: -145.906 Dist. restrs. and SS energy: 1.257 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1549.840558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.840558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.940092 (E_RNA) where: Base-Base interactions energy: -1096.968 where: short stacking energy: -476.260 Base-Backbone interact. energy: -0.474 local terms energy: -490.498785 where: bonds (distance) C4'-P energy: -89.280 bonds (distance) P-C4' energy: -87.712 flat angles C4'-P-C4' energy: -106.333 flat angles P-C4'-P energy: -68.312 tors. eta vs tors. theta energy: -138.861 Dist. restrs. and SS energy: 1.350 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1537.794732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.794732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.506180 (E_RNA) where: Base-Base interactions energy: -1108.683 where: short stacking energy: -473.938 Base-Backbone interact. energy: 3.915 local terms energy: -471.738237 where: bonds (distance) C4'-P energy: -79.455 bonds (distance) P-C4' energy: -86.418 flat angles C4'-P-C4' energy: -97.582 flat angles P-C4'-P energy: -67.595 tors. eta vs tors. theta energy: -140.688 Dist. restrs. and SS energy: 1.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1475.334043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.334043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.261331 (E_RNA) where: Base-Base interactions energy: -1082.316 where: short stacking energy: -443.756 Base-Backbone interact. energy: 0.114 local terms energy: -431.059469 where: bonds (distance) C4'-P energy: -77.691 bonds (distance) P-C4' energy: -89.595 flat angles C4'-P-C4' energy: -89.226 flat angles P-C4'-P energy: -58.464 tors. eta vs tors. theta energy: -116.084 Dist. restrs. and SS energy: 1.177 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1483.004042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.004042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.222842 (E_RNA) where: Base-Base interactions energy: -1100.906 where: short stacking energy: -452.206 Base-Backbone interact. energy: 3.677 local terms energy: -423.993903 where: bonds (distance) C4'-P energy: -73.169 bonds (distance) P-C4' energy: -51.724 flat angles C4'-P-C4' energy: -105.802 flat angles P-C4'-P energy: -64.934 tors. eta vs tors. theta energy: -128.364 Dist. restrs. and SS energy: 1.469 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1397.424120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.424120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.006559 (E_RNA) where: Base-Base interactions energy: -1031.879 where: short stacking energy: -410.736 Base-Backbone interact. energy: 0.059 local terms energy: -403.187141 where: bonds (distance) C4'-P energy: -64.560 bonds (distance) P-C4' energy: -86.179 flat angles C4'-P-C4' energy: -97.840 flat angles P-C4'-P energy: -50.418 tors. eta vs tors. theta energy: -104.191 Dist. restrs. and SS energy: 0.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1365.865327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.865327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.622833 (E_RNA) where: Base-Base interactions energy: -990.715 where: short stacking energy: -388.180 Base-Backbone interact. energy: -4.731 local terms energy: -409.177252 where: bonds (distance) C4'-P energy: -84.632 bonds (distance) P-C4' energy: -74.385 flat angles C4'-P-C4' energy: -78.587 flat angles P-C4'-P energy: -55.581 tors. eta vs tors. theta energy: -115.993 Dist. restrs. and SS energy: 2.008 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1297.699581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.699581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.598632 (E_RNA) where: Base-Base interactions energy: -923.276 where: short stacking energy: -376.894 Base-Backbone interact. energy: -0.093 local terms energy: -415.229572 where: bonds (distance) C4'-P energy: -81.345 bonds (distance) P-C4' energy: -85.006 flat angles C4'-P-C4' energy: -96.833 flat angles P-C4'-P energy: -47.732 tors. eta vs tors. theta energy: -104.314 Dist. restrs. and SS energy: 4.149 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1739.718383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.718383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.327654 (E_RNA) where: Base-Base interactions energy: -1265.247 where: short stacking energy: -532.947 Base-Backbone interact. energy: -1.324 local terms energy: -510.756622 where: bonds (distance) C4'-P energy: -89.662 bonds (distance) P-C4' energy: -93.694 flat angles C4'-P-C4' energy: -108.364 flat angles P-C4'-P energy: -71.343 tors. eta vs tors. theta energy: -147.694 Dist. restrs. and SS energy: 0.859 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1718.123641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.123641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.779099 (E_RNA) where: Base-Base interactions energy: -1267.796 where: short stacking energy: -514.931 Base-Backbone interact. energy: -0.645 local terms energy: -487.338295 where: bonds (distance) C4'-P energy: -85.702 bonds (distance) P-C4' energy: -78.966 flat angles C4'-P-C4' energy: -108.155 flat angles P-C4'-P energy: -68.800 tors. eta vs tors. theta energy: -145.715 Dist. restrs. and SS energy: 0.905 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1624.346544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.346544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.852868 (E_RNA) where: Base-Base interactions energy: -1142.283 where: short stacking energy: -502.565 Base-Backbone interact. energy: -1.903 local terms energy: -518.666920 where: bonds (distance) C4'-P energy: -92.415 bonds (distance) P-C4' energy: -95.945 flat angles C4'-P-C4' energy: -107.539 flat angles P-C4'-P energy: -67.442 tors. eta vs tors. theta energy: -155.326 Dist. restrs. and SS energy: 1.756 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1529.047204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.047204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.192229 (E_RNA) where: Base-Base interactions energy: -1097.669 where: short stacking energy: -475.313 Base-Backbone interact. energy: 0.554 local terms energy: -470.077127 where: bonds (distance) C4'-P energy: -79.846 bonds (distance) P-C4' energy: -80.565 flat angles C4'-P-C4' energy: -110.035 flat angles P-C4'-P energy: -67.950 tors. eta vs tors. theta energy: -131.681 Dist. restrs. and SS energy: 1.395 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1487.218724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1487.218724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.515760 (E_RNA) where: Base-Base interactions energy: -1067.957 where: short stacking energy: -439.898 Base-Backbone interact. energy: 3.774 local terms energy: -460.332823 where: bonds (distance) C4'-P energy: -77.965 bonds (distance) P-C4' energy: -93.011 flat angles C4'-P-C4' energy: -104.366 flat angles P-C4'-P energy: -64.878 tors. eta vs tors. theta energy: -120.113 Dist. restrs. and SS energy: 0.547 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1476.543357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.543357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.363368 (E_RNA) where: Base-Base interactions energy: -1072.966 where: short stacking energy: -462.649 Base-Backbone interact. energy: -0.479 local terms energy: -440.918795 where: bonds (distance) C4'-P energy: -87.653 bonds (distance) P-C4' energy: -65.308 flat angles C4'-P-C4' energy: -96.560 flat angles P-C4'-P energy: -71.546 tors. eta vs tors. theta energy: -119.852 Dist. restrs. and SS energy: 1.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1445.046296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.046296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.702285 (E_RNA) where: Base-Base interactions energy: -1037.729 where: short stacking energy: -428.151 Base-Backbone interact. energy: 0.261 local terms energy: -447.233916 where: bonds (distance) C4'-P energy: -85.928 bonds (distance) P-C4' energy: -84.612 flat angles C4'-P-C4' energy: -94.125 flat angles P-C4'-P energy: -59.251 tors. eta vs tors. theta energy: -123.318 Dist. restrs. and SS energy: 2.906 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1385.000333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.000333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.499180 (E_RNA) where: Base-Base interactions energy: -1030.558 where: short stacking energy: -410.692 Base-Backbone interact. energy: -1.492 local terms energy: -391.448509 where: bonds (distance) C4'-P energy: -58.735 bonds (distance) P-C4' energy: -80.203 flat angles C4'-P-C4' energy: -85.575 flat angles P-C4'-P energy: -59.179 tors. eta vs tors. theta energy: -107.757 Dist. restrs. and SS energy: 1.749 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1354.897982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.897982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.331698 (E_RNA) where: Base-Base interactions energy: -1009.303 where: short stacking energy: -423.165 Base-Backbone interact. energy: -1.465 local terms energy: -383.563408 where: bonds (distance) C4'-P energy: -58.395 bonds (distance) P-C4' energy: -72.514 flat angles C4'-P-C4' energy: -88.259 flat angles P-C4'-P energy: -52.606 tors. eta vs tors. theta energy: -111.790 Dist. restrs. and SS energy: 2.684 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1275.754520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.754520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.265197 (E_RNA) where: Base-Base interactions energy: -981.062 where: short stacking energy: -390.843 Base-Backbone interact. energy: 0.428 local terms energy: -334.631848 where: bonds (distance) C4'-P energy: -55.905 bonds (distance) P-C4' energy: -69.590 flat angles C4'-P-C4' energy: -74.996 flat angles P-C4'-P energy: -39.491 tors. eta vs tors. theta energy: -94.650 Dist. restrs. and SS energy: 2.761 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1732.180957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.180957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.831446 (E_RNA) where: Base-Base interactions energy: -1258.247 where: short stacking energy: -519.329 Base-Backbone interact. energy: -2.796 local terms energy: -508.788891 where: bonds (distance) C4'-P energy: -88.481 bonds (distance) P-C4' energy: -99.262 flat angles C4'-P-C4' energy: -108.780 flat angles P-C4'-P energy: -62.684 tors. eta vs tors. theta energy: -149.581 Dist. restrs. and SS energy: 0.900 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1733.810013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.810013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.957186 (E_RNA) where: Base-Base interactions energy: -1257.286 where: short stacking energy: -520.642 Base-Backbone interact. energy: -1.726 local terms energy: -511.944561 where: bonds (distance) C4'-P energy: -87.728 bonds (distance) P-C4' energy: -96.482 flat angles C4'-P-C4' energy: -99.797 flat angles P-C4'-P energy: -74.414 tors. eta vs tors. theta energy: -153.524 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1617.841937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.841937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.570119 (E_RNA) where: Base-Base interactions energy: -1154.496 where: short stacking energy: -497.870 Base-Backbone interact. energy: -1.498 local terms energy: -499.576324 where: bonds (distance) C4'-P energy: -91.887 bonds (distance) P-C4' energy: -93.076 flat angles C4'-P-C4' energy: -103.116 flat angles P-C4'-P energy: -62.177 tors. eta vs tors. theta energy: -149.321 Dist. restrs. and SS energy: 0.978 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1502.269570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.269570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.036235 (E_RNA) where: Base-Base interactions energy: -1073.041 where: short stacking energy: -435.860 Base-Backbone interact. energy: -2.347 local terms energy: -464.648032 where: bonds (distance) C4'-P energy: -80.692 bonds (distance) P-C4' energy: -98.066 flat angles C4'-P-C4' energy: -101.243 flat angles P-C4'-P energy: -66.558 tors. eta vs tors. theta energy: -118.089 Dist. restrs. and SS energy: 1.017 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1535.075248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.075248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.569349 (E_RNA) where: Base-Base interactions energy: -1110.752 where: short stacking energy: -451.888 Base-Backbone interact. energy: -1.738 local terms energy: -461.078975 where: bonds (distance) C4'-P energy: -84.128 bonds (distance) P-C4' energy: -88.035 flat angles C4'-P-C4' energy: -99.547 flat angles P-C4'-P energy: -57.709 tors. eta vs tors. theta energy: -131.660 Dist. restrs. and SS energy: 1.744 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1468.789847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.789847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.299187 (E_RNA) where: Base-Base interactions energy: -1064.689 where: short stacking energy: -433.859 Base-Backbone interact. energy: 0.625 local terms energy: -443.235477 where: bonds (distance) C4'-P energy: -93.863 bonds (distance) P-C4' energy: -64.122 flat angles C4'-P-C4' energy: -98.958 flat angles P-C4'-P energy: -58.490 tors. eta vs tors. theta energy: -127.803 Dist. restrs. and SS energy: 1.759 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1434.202100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.202100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.826535 (E_RNA) where: Base-Base interactions energy: -1056.354 where: short stacking energy: -444.799 Base-Backbone interact. energy: -1.962 local terms energy: -413.510254 where: bonds (distance) C4'-P energy: -82.034 bonds (distance) P-C4' energy: -73.641 flat angles C4'-P-C4' energy: -89.163 flat angles P-C4'-P energy: -44.036 tors. eta vs tors. theta energy: -124.635 Dist. restrs. and SS energy: 0.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1392.087304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.087304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.781877 (E_RNA) where: Base-Base interactions energy: -1024.714 where: short stacking energy: -392.439 Base-Backbone interact. energy: -0.345 local terms energy: -404.722598 where: bonds (distance) C4'-P energy: -73.869 bonds (distance) P-C4' energy: -76.752 flat angles C4'-P-C4' energy: -85.792 flat angles P-C4'-P energy: -57.849 tors. eta vs tors. theta energy: -110.461 Dist. restrs. and SS energy: 0.945 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1379.378511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.378511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.999683 (E_RNA) where: Base-Base interactions energy: -1011.680 where: short stacking energy: -397.119 Base-Backbone interact. energy: -1.539 local terms energy: -407.779755 where: bonds (distance) C4'-P energy: -76.952 bonds (distance) P-C4' energy: -71.627 flat angles C4'-P-C4' energy: -99.818 flat angles P-C4'-P energy: -42.954 tors. eta vs tors. theta energy: -116.430 Dist. restrs. and SS energy: 4.871 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1309.446486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.446486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.296530 (E_RNA) where: Base-Base interactions energy: -966.178 where: short stacking energy: -384.061 Base-Backbone interact. energy: 1.563 local terms energy: -383.681019 where: bonds (distance) C4'-P energy: -51.685 bonds (distance) P-C4' energy: -79.973 flat angles C4'-P-C4' energy: -91.626 flat angles P-C4'-P energy: -54.490 tors. eta vs tors. theta energy: -105.908 Dist. restrs. and SS energy: 2.100 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1718.060582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.060582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1756.291342 (E_RNA) where: Base-Base interactions energy: -1254.649 where: short stacking energy: -516.111 Base-Backbone interact. energy: -1.622 local terms energy: -500.019459 where: bonds (distance) C4'-P energy: -95.466 bonds (distance) P-C4' energy: -90.596 flat angles C4'-P-C4' energy: -113.686 flat angles P-C4'-P energy: -61.025 tors. eta vs tors. theta energy: -139.246 Dist. restrs. and SS energy: 1.481 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1750.004543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1750.004543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.941754 (E_RNA) where: Base-Base interactions energy: -1270.273 where: short stacking energy: -525.953 Base-Backbone interact. energy: 0.288 local terms energy: -517.957168 where: bonds (distance) C4'-P energy: -90.993 bonds (distance) P-C4' energy: -98.253 flat angles C4'-P-C4' energy: -108.602 flat angles P-C4'-P energy: -72.405 tors. eta vs tors. theta energy: -147.705 Dist. restrs. and SS energy: 1.187 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1603.723979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.723979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.261476 (E_RNA) where: Base-Base interactions energy: -1162.583 where: short stacking energy: -492.533 Base-Backbone interact. energy: -0.758 local terms energy: -477.921214 where: bonds (distance) C4'-P energy: -79.293 bonds (distance) P-C4' energy: -96.398 flat angles C4'-P-C4' energy: -96.734 flat angles P-C4'-P energy: -62.278 tors. eta vs tors. theta energy: -143.218 Dist. restrs. and SS energy: 0.787 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1533.202663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.202663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.952996 (E_RNA) where: Base-Base interactions energy: -1105.360 where: short stacking energy: -458.052 Base-Backbone interact. energy: -1.489 local terms energy: -464.104301 where: bonds (distance) C4'-P energy: -81.161 bonds (distance) P-C4' energy: -93.267 flat angles C4'-P-C4' energy: -98.373 flat angles P-C4'-P energy: -68.964 tors. eta vs tors. theta energy: -122.340 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1529.111992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.111992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.499413 (E_RNA) where: Base-Base interactions energy: -1118.530 where: short stacking energy: -476.001 Base-Backbone interact. energy: -0.656 local terms energy: -448.313361 where: bonds (distance) C4'-P energy: -77.619 bonds (distance) P-C4' energy: -82.123 flat angles C4'-P-C4' energy: -96.452 flat angles P-C4'-P energy: -60.139 tors. eta vs tors. theta energy: -131.980 Dist. restrs. and SS energy: 1.637 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1464.242343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.242343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.204276 (E_RNA) where: Base-Base interactions energy: -1065.228 where: short stacking energy: -438.823 Base-Backbone interact. energy: -0.051 local terms energy: -438.925372 where: bonds (distance) C4'-P energy: -80.596 bonds (distance) P-C4' energy: -84.052 flat angles C4'-P-C4' energy: -94.472 flat angles P-C4'-P energy: -55.586 tors. eta vs tors. theta energy: -124.218 Dist. restrs. and SS energy: 3.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1439.748443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.748443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.564631 (E_RNA) where: Base-Base interactions energy: -1061.370 where: short stacking energy: -444.621 Base-Backbone interact. energy: -0.040 local terms energy: -417.154731 where: bonds (distance) C4'-P energy: -73.509 bonds (distance) P-C4' energy: -78.954 flat angles C4'-P-C4' energy: -94.312 flat angles P-C4'-P energy: -48.200 tors. eta vs tors. theta energy: -122.180 Dist. restrs. and SS energy: 2.066 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1403.790993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.790993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.700383 (E_RNA) where: Base-Base interactions energy: -1023.169 where: short stacking energy: -421.789 Base-Backbone interact. energy: 1.675 local terms energy: -420.206095 where: bonds (distance) C4'-P energy: -76.080 bonds (distance) P-C4' energy: -68.804 flat angles C4'-P-C4' energy: -91.373 flat angles P-C4'-P energy: -69.956 tors. eta vs tors. theta energy: -113.994 Dist. restrs. and SS energy: 1.159 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1334.268078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.268078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.464193 (E_RNA) where: Base-Base interactions energy: -964.118 where: short stacking energy: -374.317 Base-Backbone interact. energy: -1.218 local terms energy: -410.128398 where: bonds (distance) C4'-P energy: -72.945 bonds (distance) P-C4' energy: -93.716 flat angles C4'-P-C4' energy: -87.457 flat angles P-C4'-P energy: -54.305 tors. eta vs tors. theta energy: -101.705 Dist. restrs. and SS energy: 4.446 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1339.959283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.959283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.751475 (E_RNA) where: Base-Base interactions energy: -991.433 where: short stacking energy: -392.615 Base-Backbone interact. energy: 3.528 local terms energy: -390.846776 where: bonds (distance) C4'-P energy: -67.086 bonds (distance) P-C4' energy: -84.519 flat angles C4'-P-C4' energy: -83.310 flat angles P-C4'-P energy: -50.993 tors. eta vs tors. theta energy: -104.940 Dist. restrs. and SS energy: 2.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1743.164636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1743.164636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.879436 (E_RNA) where: Base-Base interactions energy: -1268.752 where: short stacking energy: -537.407 Base-Backbone interact. energy: -3.564 local terms energy: -508.563804 where: bonds (distance) C4'-P energy: -93.566 bonds (distance) P-C4' energy: -88.811 flat angles C4'-P-C4' energy: -105.314 flat angles P-C4'-P energy: -72.845 tors. eta vs tors. theta energy: -148.028 Dist. restrs. and SS energy: 0.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1715.513557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.513557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.146170 (E_RNA) where: Base-Base interactions energy: -1257.851 where: short stacking energy: -511.935 Base-Backbone interact. energy: -2.697 local terms energy: -492.598027 where: bonds (distance) C4'-P energy: -79.014 bonds (distance) P-C4' energy: -91.188 flat angles C4'-P-C4' energy: -106.962 flat angles P-C4'-P energy: -65.598 tors. eta vs tors. theta energy: -149.837 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1591.137842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.137842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.406989 (E_RNA) where: Base-Base interactions energy: -1157.057 where: short stacking energy: -481.729 Base-Backbone interact. energy: -1.697 local terms energy: -469.652647 where: bonds (distance) C4'-P energy: -80.811 bonds (distance) P-C4' energy: -84.358 flat angles C4'-P-C4' energy: -102.503 flat angles P-C4'-P energy: -67.165 tors. eta vs tors. theta energy: -134.815 Dist. restrs. and SS energy: 0.519 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1564.656911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.656911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.236194 (E_RNA) where: Base-Base interactions energy: -1122.122 where: short stacking energy: -457.356 Base-Backbone interact. energy: -3.174 local terms energy: -476.939998 where: bonds (distance) C4'-P energy: -83.408 bonds (distance) P-C4' energy: -81.232 flat angles C4'-P-C4' energy: -110.183 flat angles P-C4'-P energy: -75.229 tors. eta vs tors. theta energy: -126.888 Dist. restrs. and SS energy: 0.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1507.024868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.024868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.606769 (E_RNA) where: Base-Base interactions energy: -1085.385 where: short stacking energy: -448.690 Base-Backbone interact. energy: 0.283 local terms energy: -459.505503 where: bonds (distance) C4'-P energy: -85.820 bonds (distance) P-C4' energy: -93.329 flat angles C4'-P-C4' energy: -91.547 flat angles P-C4'-P energy: -59.900 tors. eta vs tors. theta energy: -128.909 Dist. restrs. and SS energy: 0.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1495.252271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1495.252271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.691494 (E_RNA) where: Base-Base interactions energy: -1087.720 where: short stacking energy: -450.013 Base-Backbone interact. energy: -0.976 local terms energy: -444.995748 where: bonds (distance) C4'-P energy: -96.419 bonds (distance) P-C4' energy: -69.672 flat angles C4'-P-C4' energy: -96.613 flat angles P-C4'-P energy: -56.852 tors. eta vs tors. theta energy: -125.440 Dist. restrs. and SS energy: 1.689 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1436.242357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.242357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.216889 (E_RNA) where: Base-Base interactions energy: -1052.907 where: short stacking energy: -436.116 Base-Backbone interact. energy: -2.332 local terms energy: -419.978495 where: bonds (distance) C4'-P energy: -80.775 bonds (distance) P-C4' energy: -72.973 flat angles C4'-P-C4' energy: -95.880 flat angles P-C4'-P energy: -57.302 tors. eta vs tors. theta energy: -113.049 Dist. restrs. and SS energy: 2.225 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1373.641680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.641680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.894119 (E_RNA) where: Base-Base interactions energy: -1002.777 where: short stacking energy: -421.886 Base-Backbone interact. energy: 1.490 local terms energy: -414.607658 where: bonds (distance) C4'-P energy: -64.548 bonds (distance) P-C4' energy: -76.416 flat angles C4'-P-C4' energy: -94.729 flat angles P-C4'-P energy: -59.089 tors. eta vs tors. theta energy: -119.825 Dist. restrs. and SS energy: 5.502 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1351.776220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.776220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.058333 (E_RNA) where: Base-Base interactions energy: -990.600 where: short stacking energy: -398.858 Base-Backbone interact. energy: 0.053 local terms energy: -405.510876 where: bonds (distance) C4'-P energy: -63.425 bonds (distance) P-C4' energy: -79.443 flat angles C4'-P-C4' energy: -83.915 flat angles P-C4'-P energy: -60.454 tors. eta vs tors. theta energy: -118.274 Dist. restrs. and SS energy: 7.532 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1304.539078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.539078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.636054 (E_RNA) where: Base-Base interactions energy: -977.125 where: short stacking energy: -401.944 Base-Backbone interact. energy: 2.129 local terms energy: -367.640441 where: bonds (distance) C4'-P energy: -76.995 bonds (distance) P-C4' energy: -47.450 flat angles C4'-P-C4' energy: -81.874 flat angles P-C4'-P energy: -46.088 tors. eta vs tors. theta energy: -115.233 Dist. restrs. and SS energy: 1.347 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1746.970903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.970903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.778773 (E_RNA) where: Base-Base interactions energy: -1269.387 where: short stacking energy: -534.222 Base-Backbone interact. energy: -2.241 local terms energy: -513.150232 where: bonds (distance) C4'-P energy: -84.605 bonds (distance) P-C4' energy: -95.649 flat angles C4'-P-C4' energy: -114.900 flat angles P-C4'-P energy: -68.378 tors. eta vs tors. theta energy: -149.618 Dist. restrs. and SS energy: 1.058 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1687.924459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.924459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.348061 (E_RNA) where: Base-Base interactions energy: -1227.587 where: short stacking energy: -516.218 Base-Backbone interact. energy: -1.232 local terms energy: -496.529407 where: bonds (distance) C4'-P energy: -86.105 bonds (distance) P-C4' energy: -91.405 flat angles C4'-P-C4' energy: -104.313 flat angles P-C4'-P energy: -65.851 tors. eta vs tors. theta energy: -148.856 Dist. restrs. and SS energy: 0.674 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1577.655828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.655828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.537814 (E_RNA) where: Base-Base interactions energy: -1135.750 where: short stacking energy: -484.655 Base-Backbone interact. energy: -1.271 local terms energy: -478.516952 where: bonds (distance) C4'-P energy: -87.663 bonds (distance) P-C4' energy: -82.298 flat angles C4'-P-C4' energy: -99.981 flat angles P-C4'-P energy: -75.564 tors. eta vs tors. theta energy: -133.011 Dist. restrs. and SS energy: 1.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1562.396609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.396609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.406999 (E_RNA) where: Base-Base interactions energy: -1147.549 where: short stacking energy: -469.798 Base-Backbone interact. energy: -1.230 local terms energy: -451.627776 where: bonds (distance) C4'-P energy: -87.216 bonds (distance) P-C4' energy: -82.821 flat angles C4'-P-C4' energy: -94.973 flat angles P-C4'-P energy: -57.654 tors. eta vs tors. theta energy: -128.964 Dist. restrs. and SS energy: 1.260 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1525.459217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.459217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.385594 (E_RNA) where: Base-Base interactions energy: -1065.874 where: short stacking energy: -452.759 Base-Backbone interact. energy: -1.642 local terms energy: -495.869130 where: bonds (distance) C4'-P energy: -95.101 bonds (distance) P-C4' energy: -102.288 flat angles C4'-P-C4' energy: -97.840 flat angles P-C4'-P energy: -67.260 tors. eta vs tors. theta energy: -133.381 Dist. restrs. and SS energy: 1.176 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1481.866169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.866169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.193368 (E_RNA) where: Base-Base interactions energy: -1083.904 where: short stacking energy: -444.837 Base-Backbone interact. energy: -0.766 local terms energy: -435.524037 where: bonds (distance) C4'-P energy: -76.107 bonds (distance) P-C4' energy: -77.260 flat angles C4'-P-C4' energy: -100.399 flat angles P-C4'-P energy: -62.318 tors. eta vs tors. theta energy: -119.440 Dist. restrs. and SS energy: 1.577 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1499.474268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.474268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.493977 (E_RNA) where: Base-Base interactions energy: -1095.607 where: short stacking energy: -448.425 Base-Backbone interact. energy: -2.435 local terms energy: -439.451899 where: bonds (distance) C4'-P energy: -82.304 bonds (distance) P-C4' energy: -70.417 flat angles C4'-P-C4' energy: -92.295 flat angles P-C4'-P energy: -65.242 tors. eta vs tors. theta energy: -129.195 Dist. restrs. and SS energy: 1.270 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1371.401638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.401638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.250959 (E_RNA) where: Base-Base interactions energy: -1017.162 where: short stacking energy: -396.285 Base-Backbone interact. energy: 0.677 local terms energy: -394.765458 where: bonds (distance) C4'-P energy: -73.899 bonds (distance) P-C4' energy: -70.339 flat angles C4'-P-C4' energy: -82.320 flat angles P-C4'-P energy: -55.243 tors. eta vs tors. theta energy: -112.965 Dist. restrs. and SS energy: 3.099 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1368.493097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.493097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.803559 (E_RNA) where: Base-Base interactions energy: -1036.905 where: short stacking energy: -400.367 Base-Backbone interact. energy: -0.240 local terms energy: -372.657892 where: bonds (distance) C4'-P energy: -59.308 bonds (distance) P-C4' energy: -62.859 flat angles C4'-P-C4' energy: -77.039 flat angles P-C4'-P energy: -56.388 tors. eta vs tors. theta energy: -117.065 Dist. restrs. and SS energy: 4.560 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1297.288059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.288059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.492929 (E_RNA) where: Base-Base interactions energy: -959.336 where: short stacking energy: -396.231 Base-Backbone interact. energy: 0.050 local terms energy: -377.206684 where: bonds (distance) C4'-P energy: -69.855 bonds (distance) P-C4' energy: -70.346 flat angles C4'-P-C4' energy: -81.326 flat angles P-C4'-P energy: -53.147 tors. eta vs tors. theta energy: -102.533 Dist. restrs. and SS energy: 2.455 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1753.591949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1753.591949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1790.785789 (E_RNA) where: Base-Base interactions energy: -1287.309 where: short stacking energy: -541.606 Base-Backbone interact. energy: -1.516 local terms energy: -501.961137 where: bonds (distance) C4'-P energy: -88.040 bonds (distance) P-C4' energy: -95.807 flat angles C4'-P-C4' energy: -103.985 flat angles P-C4'-P energy: -66.673 tors. eta vs tors. theta energy: -147.456 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1708.563262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.563262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.230488 (E_RNA) where: Base-Base interactions energy: -1238.201 where: short stacking energy: -524.662 Base-Backbone interact. energy: -0.391 local terms energy: -507.639010 where: bonds (distance) C4'-P energy: -87.807 bonds (distance) P-C4' energy: -88.522 flat angles C4'-P-C4' energy: -102.783 flat angles P-C4'-P energy: -72.036 tors. eta vs tors. theta energy: -156.491 Dist. restrs. and SS energy: 0.917 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1596.701066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.701066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.531710 (E_RNA) where: Base-Base interactions energy: -1124.023 where: short stacking energy: -487.131 Base-Backbone interact. energy: 0.195 local terms energy: -510.704052 where: bonds (distance) C4'-P energy: -96.225 bonds (distance) P-C4' energy: -90.627 flat angles C4'-P-C4' energy: -102.368 flat angles P-C4'-P energy: -83.275 tors. eta vs tors. theta energy: -138.209 Dist. restrs. and SS energy: 1.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1552.924207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.924207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.433568 (E_RNA) where: Base-Base interactions energy: -1138.055 where: short stacking energy: -484.616 Base-Backbone interact. energy: -0.161 local terms energy: -453.218199 where: bonds (distance) C4'-P energy: -79.824 bonds (distance) P-C4' energy: -70.501 flat angles C4'-P-C4' energy: -104.243 flat angles P-C4'-P energy: -62.593 tors. eta vs tors. theta energy: -136.057 Dist. restrs. and SS energy: 1.759 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1512.122944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.122944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.480666 (E_RNA) where: Base-Base interactions energy: -1079.997 where: short stacking energy: -430.140 Base-Backbone interact. energy: -0.336 local terms energy: -469.147605 where: bonds (distance) C4'-P energy: -87.855 bonds (distance) P-C4' energy: -94.275 flat angles C4'-P-C4' energy: -96.242 flat angles P-C4'-P energy: -60.161 tors. eta vs tors. theta energy: -130.614 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1465.904517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.904517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.706646 (E_RNA) where: Base-Base interactions energy: -1055.218 where: short stacking energy: -440.930 Base-Backbone interact. energy: -1.263 local terms energy: -448.226235 where: bonds (distance) C4'-P energy: -92.380 bonds (distance) P-C4' energy: -76.181 flat angles C4'-P-C4' energy: -98.234 flat angles P-C4'-P energy: -60.616 tors. eta vs tors. theta energy: -120.815 Dist. restrs. and SS energy: 2.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1432.916352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.916352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.654175 (E_RNA) where: Base-Base interactions energy: -1049.408 where: short stacking energy: -441.658 Base-Backbone interact. energy: -0.362 local terms energy: -420.884012 where: bonds (distance) C4'-P energy: -75.597 bonds (distance) P-C4' energy: -81.682 flat angles C4'-P-C4' energy: -79.681 flat angles P-C4'-P energy: -60.498 tors. eta vs tors. theta energy: -123.427 Dist. restrs. and SS energy: 0.988 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1418.523370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.523370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.189568 (E_RNA) where: Base-Base interactions energy: -1039.791 where: short stacking energy: -417.049 Base-Backbone interact. energy: 0.045 local terms energy: -417.443345 where: bonds (distance) C4'-P energy: -71.849 bonds (distance) P-C4' energy: -80.839 flat angles C4'-P-C4' energy: -83.323 flat angles P-C4'-P energy: -61.826 tors. eta vs tors. theta energy: -119.606 Dist. restrs. and SS energy: 1.916 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1324.019193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.019193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.446534 (E_RNA) where: Base-Base interactions energy: -968.979 where: short stacking energy: -400.921 Base-Backbone interact. energy: 3.966 local terms energy: -407.432914 where: bonds (distance) C4'-P energy: -75.577 bonds (distance) P-C4' energy: -86.271 flat angles C4'-P-C4' energy: -85.841 flat angles P-C4'-P energy: -58.032 tors. eta vs tors. theta energy: -101.712 Dist. restrs. and SS energy: 11.677 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1330.161437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.161437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.906535 (E_RNA) where: Base-Base interactions energy: -989.581 where: short stacking energy: -407.793 Base-Backbone interact. energy: -1.008 local terms energy: -378.317777 where: bonds (distance) C4'-P energy: -60.458 bonds (distance) P-C4' energy: -72.957 flat angles C4'-P-C4' energy: -75.445 flat angles P-C4'-P energy: -55.064 tors. eta vs tors. theta energy: -114.394 Dist. restrs. and SS energy: 1.995 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1745.336826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.336826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.424073 (E_RNA) where: Base-Base interactions energy: -1275.304 where: short stacking energy: -537.696 Base-Backbone interact. energy: -3.148 local terms energy: -504.971498 where: bonds (distance) C4'-P energy: -89.726 bonds (distance) P-C4' energy: -81.910 flat angles C4'-P-C4' energy: -108.878 flat angles P-C4'-P energy: -80.537 tors. eta vs tors. theta energy: -143.921 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1704.917354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.917354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.293537 (E_RNA) where: Base-Base interactions energy: -1253.276 where: short stacking energy: -507.100 Base-Backbone interact. energy: -2.387 local terms energy: -487.630892 where: bonds (distance) C4'-P energy: -91.636 bonds (distance) P-C4' energy: -80.660 flat angles C4'-P-C4' energy: -108.227 flat angles P-C4'-P energy: -67.393 tors. eta vs tors. theta energy: -139.714 Dist. restrs. and SS energy: 1.626 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1621.681531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.681531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.266122 (E_RNA) where: Base-Base interactions energy: -1163.142 where: short stacking energy: -491.798 Base-Backbone interact. energy: -1.925 local terms energy: -494.199424 where: bonds (distance) C4'-P energy: -89.115 bonds (distance) P-C4' energy: -98.291 flat angles C4'-P-C4' energy: -97.373 flat angles P-C4'-P energy: -68.398 tors. eta vs tors. theta energy: -141.022 Dist. restrs. and SS energy: 0.835 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1555.296397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.296397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.823482 (E_RNA) where: Base-Base interactions energy: -1131.564 where: short stacking energy: -459.006 Base-Backbone interact. energy: 1.111 local terms energy: -463.370654 where: bonds (distance) C4'-P energy: -93.571 bonds (distance) P-C4' energy: -75.294 flat angles C4'-P-C4' energy: -91.452 flat angles P-C4'-P energy: -69.861 tors. eta vs tors. theta energy: -133.193 Dist. restrs. and SS energy: 1.777 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1489.209422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.209422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.655640 (E_RNA) where: Base-Base interactions energy: -1080.726 where: short stacking energy: -450.836 Base-Backbone interact. energy: 4.810 local terms energy: -451.739834 where: bonds (distance) C4'-P energy: -84.989 bonds (distance) P-C4' energy: -78.229 flat angles C4'-P-C4' energy: -93.025 flat angles P-C4'-P energy: -69.579 tors. eta vs tors. theta energy: -125.918 Dist. restrs. and SS energy: 1.696 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1479.361582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.361582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.115488 (E_RNA) where: Base-Base interactions energy: -1063.553 where: short stacking energy: -433.824 Base-Backbone interact. energy: 0.227 local terms energy: -454.789102 where: bonds (distance) C4'-P energy: -89.684 bonds (distance) P-C4' energy: -91.901 flat angles C4'-P-C4' energy: -88.419 flat angles P-C4'-P energy: -67.809 tors. eta vs tors. theta energy: -116.976 Dist. restrs. and SS energy: 2.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1428.532169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.532169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.200114 (E_RNA) where: Base-Base interactions energy: -1035.563 where: short stacking energy: -433.093 Base-Backbone interact. energy: -1.690 local terms energy: -430.947709 where: bonds (distance) C4'-P energy: -86.929 bonds (distance) P-C4' energy: -76.813 flat angles C4'-P-C4' energy: -85.263 flat angles P-C4'-P energy: -56.513 tors. eta vs tors. theta energy: -125.430 Dist. restrs. and SS energy: 2.918 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1395.296152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.296152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.962853 (E_RNA) where: Base-Base interactions energy: -1019.113 where: short stacking energy: -440.624 Base-Backbone interact. energy: -2.456 local terms energy: -412.393680 where: bonds (distance) C4'-P energy: -68.895 bonds (distance) P-C4' energy: -77.255 flat angles C4'-P-C4' energy: -91.921 flat angles P-C4'-P energy: -49.240 tors. eta vs tors. theta energy: -125.082 Dist. restrs. and SS energy: 1.917 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1390.026276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.026276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.436413 (E_RNA) where: Base-Base interactions energy: -1024.401 where: short stacking energy: -405.359 Base-Backbone interact. energy: -2.361 local terms energy: -401.674215 where: bonds (distance) C4'-P energy: -68.945 bonds (distance) P-C4' energy: -72.623 flat angles C4'-P-C4' energy: -85.743 flat angles P-C4'-P energy: -54.996 tors. eta vs tors. theta energy: -119.367 Dist. restrs. and SS energy: 1.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1353.110031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.110031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.978691 (E_RNA) where: Base-Base interactions energy: -993.417 where: short stacking energy: -408.626 Base-Backbone interact. energy: -0.392 local terms energy: -399.169436 where: bonds (distance) C4'-P energy: -56.487 bonds (distance) P-C4' energy: -83.765 flat angles C4'-P-C4' energy: -91.190 flat angles P-C4'-P energy: -45.050 tors. eta vs tors. theta energy: -122.678 Dist. restrs. and SS energy: 3.119 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1765.130535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1765.130535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1802.380417 (E_RNA) where: Base-Base interactions energy: -1284.649 where: short stacking energy: -535.755 Base-Backbone interact. energy: -1.754 local terms energy: -515.977178 where: bonds (distance) C4'-P energy: -97.278 bonds (distance) P-C4' energy: -88.618 flat angles C4'-P-C4' energy: -109.360 flat angles P-C4'-P energy: -70.389 tors. eta vs tors. theta energy: -150.331 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1705.609030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.609030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.382629 (E_RNA) where: Base-Base interactions energy: -1234.449 where: short stacking energy: -502.717 Base-Backbone interact. energy: -2.636 local terms energy: -506.297841 where: bonds (distance) C4'-P energy: -90.297 bonds (distance) P-C4' energy: -89.362 flat angles C4'-P-C4' energy: -110.955 flat angles P-C4'-P energy: -66.333 tors. eta vs tors. theta energy: -149.351 Dist. restrs. and SS energy: 1.024 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1645.183277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.183277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.142114 (E_RNA) where: Base-Base interactions energy: -1196.135 where: short stacking energy: -501.619 Base-Backbone interact. energy: 1.312 local terms energy: -489.318871 where: bonds (distance) C4'-P energy: -90.381 bonds (distance) P-C4' energy: -79.634 flat angles C4'-P-C4' energy: -94.688 flat angles P-C4'-P energy: -77.536 tors. eta vs tors. theta energy: -147.079 Dist. restrs. and SS energy: 2.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1556.938909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.938909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.485629 (E_RNA) where: Base-Base interactions energy: -1139.526 where: short stacking energy: -472.941 Base-Backbone interact. energy: -0.311 local terms energy: -455.648044 where: bonds (distance) C4'-P energy: -62.304 bonds (distance) P-C4' energy: -89.686 flat angles C4'-P-C4' energy: -103.885 flat angles P-C4'-P energy: -66.002 tors. eta vs tors. theta energy: -133.771 Dist. restrs. and SS energy: 1.797 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1500.954741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.954741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.239107 (E_RNA) where: Base-Base interactions energy: -1087.001 where: short stacking energy: -450.554 Base-Backbone interact. energy: -1.959 local terms energy: -450.279114 where: bonds (distance) C4'-P energy: -90.683 bonds (distance) P-C4' energy: -71.369 flat angles C4'-P-C4' energy: -95.528 flat angles P-C4'-P energy: -68.054 tors. eta vs tors. theta energy: -124.645 Dist. restrs. and SS energy: 1.534 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1476.582501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.582501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.653286 (E_RNA) where: Base-Base interactions energy: -1077.979 where: short stacking energy: -452.875 Base-Backbone interact. energy: -1.000 local terms energy: -435.674385 where: bonds (distance) C4'-P energy: -74.056 bonds (distance) P-C4' energy: -76.825 flat angles C4'-P-C4' energy: -99.407 flat angles P-C4'-P energy: -60.783 tors. eta vs tors. theta energy: -124.603 Dist. restrs. and SS energy: 1.321 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1431.307357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.307357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.723643 (E_RNA) where: Base-Base interactions energy: -1035.738 where: short stacking energy: -405.284 Base-Backbone interact. energy: -1.335 local terms energy: -432.650983 where: bonds (distance) C4'-P energy: -84.043 bonds (distance) P-C4' energy: -80.592 flat angles C4'-P-C4' energy: -93.786 flat angles P-C4'-P energy: -61.803 tors. eta vs tors. theta energy: -112.427 Dist. restrs. and SS energy: 1.666 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1435.446278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.446278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.489850 (E_RNA) where: Base-Base interactions energy: -1061.727 where: short stacking energy: -441.984 Base-Backbone interact. energy: -0.576 local terms energy: -411.186891 where: bonds (distance) C4'-P energy: -77.064 bonds (distance) P-C4' energy: -74.290 flat angles C4'-P-C4' energy: -89.143 flat angles P-C4'-P energy: -46.089 tors. eta vs tors. theta energy: -124.601 Dist. restrs. and SS energy: 1.294 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1378.656122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.656122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.249121 (E_RNA) where: Base-Base interactions energy: -1003.607 where: short stacking energy: -407.726 Base-Backbone interact. energy: 2.444 local terms energy: -416.085780 where: bonds (distance) C4'-P energy: -59.567 bonds (distance) P-C4' energy: -85.591 flat angles C4'-P-C4' energy: -93.987 flat angles P-C4'-P energy: -72.077 tors. eta vs tors. theta energy: -104.864 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1343.456534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.456534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.118564 (E_RNA) where: Base-Base interactions energy: -993.935 where: short stacking energy: -416.449 Base-Backbone interact. energy: -1.381 local terms energy: -386.802000 where: bonds (distance) C4'-P energy: -68.409 bonds (distance) P-C4' energy: -77.167 flat angles C4'-P-C4' energy: -76.819 flat angles P-C4'-P energy: -54.315 tors. eta vs tors. theta energy: -110.092 Dist. restrs. and SS energy: 1.912 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1751.284745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.284745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1789.041365 (E_RNA) where: Base-Base interactions energy: -1274.851 where: short stacking energy: -546.670 Base-Backbone interact. energy: -1.860 local terms energy: -512.330531 where: bonds (distance) C4'-P energy: -94.515 bonds (distance) P-C4' energy: -98.855 flat angles C4'-P-C4' energy: -105.558 flat angles P-C4'-P energy: -65.119 tors. eta vs tors. theta energy: -148.284 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1731.240037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.240037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.183832 (E_RNA) where: Base-Base interactions energy: -1261.888 where: short stacking energy: -522.521 Base-Backbone interact. energy: 2.015 local terms energy: -509.310931 where: bonds (distance) C4'-P energy: -89.348 bonds (distance) P-C4' energy: -87.891 flat angles C4'-P-C4' energy: -107.861 flat angles P-C4'-P energy: -75.042 tors. eta vs tors. theta energy: -149.169 Dist. restrs. and SS energy: 1.194 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1627.616073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.616073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.892969 (E_RNA) where: Base-Base interactions energy: -1191.153 where: short stacking energy: -501.318 Base-Backbone interact. energy: -1.577 local terms energy: -473.163410 where: bonds (distance) C4'-P energy: -69.757 bonds (distance) P-C4' energy: -83.929 flat angles C4'-P-C4' energy: -104.519 flat angles P-C4'-P energy: -73.586 tors. eta vs tors. theta energy: -141.373 Dist. restrs. and SS energy: 1.527 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1567.634210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.634210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.955237 (E_RNA) where: Base-Base interactions energy: -1144.725 where: short stacking energy: -472.550 Base-Backbone interact. energy: -1.652 local terms energy: -459.577453 where: bonds (distance) C4'-P energy: -88.717 bonds (distance) P-C4' energy: -89.841 flat angles C4'-P-C4' energy: -94.258 flat angles P-C4'-P energy: -52.842 tors. eta vs tors. theta energy: -133.920 Dist. restrs. and SS energy: 1.571 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1530.359604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.359604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.271885 (E_RNA) where: Base-Base interactions energy: -1099.611 where: short stacking energy: -468.330 Base-Backbone interact. energy: -1.731 local terms energy: -466.929611 where: bonds (distance) C4'-P energy: -85.757 bonds (distance) P-C4' energy: -74.337 flat angles C4'-P-C4' energy: -96.307 flat angles P-C4'-P energy: -74.487 tors. eta vs tors. theta energy: -136.042 Dist. restrs. and SS energy: 1.162 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1449.421162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.421162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.927782 (E_RNA) where: Base-Base interactions energy: -1029.392 where: short stacking energy: -454.575 Base-Backbone interact. energy: 3.566 local terms energy: -462.101821 where: bonds (distance) C4'-P energy: -78.876 bonds (distance) P-C4' energy: -81.435 flat angles C4'-P-C4' energy: -101.542 flat angles P-C4'-P energy: -72.252 tors. eta vs tors. theta energy: -127.997 Dist. restrs. and SS energy: 1.757 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1455.162649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.162649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.891915 (E_RNA) where: Base-Base interactions energy: -1049.472 where: short stacking energy: -437.187 Base-Backbone interact. energy: -0.649 local terms energy: -443.771014 where: bonds (distance) C4'-P energy: -71.571 bonds (distance) P-C4' energy: -83.273 flat angles C4'-P-C4' energy: -94.922 flat angles P-C4'-P energy: -65.771 tors. eta vs tors. theta energy: -128.234 Dist. restrs. and SS energy: 1.979 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1421.200650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.200650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.276585 (E_RNA) where: Base-Base interactions energy: -1056.307 where: short stacking energy: -426.786 Base-Backbone interact. energy: 0.398 local terms energy: -404.367546 where: bonds (distance) C4'-P energy: -65.007 bonds (distance) P-C4' energy: -77.232 flat angles C4'-P-C4' energy: -96.651 flat angles P-C4'-P energy: -55.326 tors. eta vs tors. theta energy: -110.151 Dist. restrs. and SS energy: 2.326 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1366.091073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.091073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.216634 (E_RNA) where: Base-Base interactions energy: -995.154 where: short stacking energy: -402.086 Base-Backbone interact. energy: -1.704 local terms energy: -407.358720 where: bonds (distance) C4'-P energy: -75.089 bonds (distance) P-C4' energy: -80.233 flat angles C4'-P-C4' energy: -80.253 flat angles P-C4'-P energy: -50.222 tors. eta vs tors. theta energy: -121.561 Dist. restrs. and SS energy: 1.376 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1359.561588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.561588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.029880 (E_RNA) where: Base-Base interactions energy: -1016.684 where: short stacking energy: -401.269 Base-Backbone interact. energy: 0.446 local terms energy: -381.792644 where: bonds (distance) C4'-P energy: -70.575 bonds (distance) P-C4' energy: -69.437 flat angles C4'-P-C4' energy: -68.797 flat angles P-C4'-P energy: -52.754 tors. eta vs tors. theta energy: -120.229 Dist. restrs. and SS energy: 1.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1728.980713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.980713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.966465 (E_RNA) where: Base-Base interactions energy: -1263.548 where: short stacking energy: -540.909 Base-Backbone interact. energy: -2.128 local terms energy: -501.290851 where: bonds (distance) C4'-P energy: -87.389 bonds (distance) P-C4' energy: -85.217 flat angles C4'-P-C4' energy: -109.957 flat angles P-C4'-P energy: -72.020 tors. eta vs tors. theta energy: -146.709 Dist. restrs. and SS energy: 1.236 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1703.538974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.538974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.854449 (E_RNA) where: Base-Base interactions energy: -1263.997 where: short stacking energy: -523.652 Base-Backbone interact. energy: -0.452 local terms energy: -476.405207 where: bonds (distance) C4'-P energy: -77.196 bonds (distance) P-C4' energy: -82.073 flat angles C4'-P-C4' energy: -104.746 flat angles P-C4'-P energy: -65.161 tors. eta vs tors. theta energy: -147.229 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1599.210181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.210181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.430480 (E_RNA) where: Base-Base interactions energy: -1166.690 where: short stacking energy: -497.373 Base-Backbone interact. energy: -1.189 local terms energy: -469.551525 where: bonds (distance) C4'-P energy: -80.718 bonds (distance) P-C4' energy: -89.281 flat angles C4'-P-C4' energy: -91.014 flat angles P-C4'-P energy: -66.055 tors. eta vs tors. theta energy: -142.483 Dist. restrs. and SS energy: 1.470 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1545.907953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.907953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.977768 (E_RNA) where: Base-Base interactions energy: -1122.175 where: short stacking energy: -489.989 Base-Backbone interact. energy: -0.154 local terms energy: -461.649039 where: bonds (distance) C4'-P energy: -70.999 bonds (distance) P-C4' energy: -89.100 flat angles C4'-P-C4' energy: -102.376 flat angles P-C4'-P energy: -65.154 tors. eta vs tors. theta energy: -134.020 Dist. restrs. and SS energy: 1.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1541.732984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.732984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.295830 (E_RNA) where: Base-Base interactions energy: -1115.002 where: short stacking energy: -462.919 Base-Backbone interact. energy: -1.594 local terms energy: -463.699864 where: bonds (distance) C4'-P energy: -77.509 bonds (distance) P-C4' energy: -91.285 flat angles C4'-P-C4' energy: -100.589 flat angles P-C4'-P energy: -63.954 tors. eta vs tors. theta energy: -130.362 Dist. restrs. and SS energy: 1.813 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1501.581624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.581624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.930775 (E_RNA) where: Base-Base interactions energy: -1097.474 where: short stacking energy: -475.289 Base-Backbone interact. energy: -2.830 local terms energy: -439.626744 where: bonds (distance) C4'-P energy: -66.562 bonds (distance) P-C4' energy: -79.491 flat angles C4'-P-C4' energy: -98.373 flat angles P-C4'-P energy: -62.658 tors. eta vs tors. theta energy: -132.543 Dist. restrs. and SS energy: 1.599 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1397.299666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.299666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.990625 (E_RNA) where: Base-Base interactions energy: -1034.465 where: short stacking energy: -411.326 Base-Backbone interact. energy: -0.885 local terms energy: -400.639883 where: bonds (distance) C4'-P energy: -59.938 bonds (distance) P-C4' energy: -84.492 flat angles C4'-P-C4' energy: -81.451 flat angles P-C4'-P energy: -62.490 tors. eta vs tors. theta energy: -112.269 Dist. restrs. and SS energy: 1.941 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1412.430023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.430023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.725292 (E_RNA) where: Base-Base interactions energy: -1043.671 where: short stacking energy: -425.727 Base-Backbone interact. energy: 1.457 local terms energy: -409.511133 where: bonds (distance) C4'-P energy: -67.328 bonds (distance) P-C4' energy: -68.974 flat angles C4'-P-C4' energy: -91.151 flat angles P-C4'-P energy: -67.900 tors. eta vs tors. theta energy: -114.159 Dist. restrs. and SS energy: 2.545 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1405.917815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.917815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.707291 (E_RNA) where: Base-Base interactions energy: -1052.424 where: short stacking energy: -420.681 Base-Backbone interact. energy: 0.656 local terms energy: -391.939624 where: bonds (distance) C4'-P energy: -59.095 bonds (distance) P-C4' energy: -78.962 flat angles C4'-P-C4' energy: -75.351 flat angles P-C4'-P energy: -62.428 tors. eta vs tors. theta energy: -116.103 Dist. restrs. and SS energy: 1.039 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1347.721409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.721409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.200508 (E_RNA) where: Base-Base interactions energy: -1005.091 where: short stacking energy: -415.352 Base-Backbone interact. energy: 3.735 local terms energy: -384.844888 where: bonds (distance) C4'-P energy: -67.348 bonds (distance) P-C4' energy: -68.399 flat angles C4'-P-C4' energy: -88.161 flat angles P-C4'-P energy: -50.181 tors. eta vs tors. theta energy: -110.756 Dist. restrs. and SS energy: 1.729 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1735.855057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.855057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1773.554507 (E_RNA) where: Base-Base interactions energy: -1238.685 where: short stacking energy: -529.658 Base-Backbone interact. energy: -2.081 local terms energy: -532.788592 where: bonds (distance) C4'-P energy: -101.804 bonds (distance) P-C4' energy: -102.687 flat angles C4'-P-C4' energy: -108.351 flat angles P-C4'-P energy: -73.368 tors. eta vs tors. theta energy: -146.579 Dist. restrs. and SS energy: 0.949 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1661.803481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.803481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.869244 (E_RNA) where: Base-Base interactions energy: -1222.955 where: short stacking energy: -493.299 Base-Backbone interact. energy: -1.091 local terms energy: -475.823370 where: bonds (distance) C4'-P energy: -86.011 bonds (distance) P-C4' energy: -92.174 flat angles C4'-P-C4' energy: -95.463 flat angles P-C4'-P energy: -61.198 tors. eta vs tors. theta energy: -140.977 Dist. restrs. and SS energy: 1.316 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1637.329029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.329029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.109115 (E_RNA) where: Base-Base interactions energy: -1188.242 where: short stacking energy: -489.689 Base-Backbone interact. energy: -2.795 local terms energy: -484.072255 where: bonds (distance) C4'-P energy: -91.770 bonds (distance) P-C4' energy: -85.302 flat angles C4'-P-C4' energy: -99.051 flat angles P-C4'-P energy: -71.062 tors. eta vs tors. theta energy: -136.886 Dist. restrs. and SS energy: 1.030 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1539.233712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.233712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.824291 (E_RNA) where: Base-Base interactions energy: -1109.895 where: short stacking energy: -461.917 Base-Backbone interact. energy: -0.390 local terms energy: -467.538982 where: bonds (distance) C4'-P energy: -83.429 bonds (distance) P-C4' energy: -79.753 flat angles C4'-P-C4' energy: -98.377 flat angles P-C4'-P energy: -70.348 tors. eta vs tors. theta energy: -135.632 Dist. restrs. and SS energy: 1.841 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1561.999121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.999121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.855323 (E_RNA) where: Base-Base interactions energy: -1145.873 where: short stacking energy: -485.669 Base-Backbone interact. energy: -1.529 local terms energy: -452.453745 where: bonds (distance) C4'-P energy: -85.467 bonds (distance) P-C4' energy: -73.639 flat angles C4'-P-C4' energy: -95.206 flat angles P-C4'-P energy: -61.997 tors. eta vs tors. theta energy: -136.144 Dist. restrs. and SS energy: 1.106 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1484.396200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.396200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.082258 (E_RNA) where: Base-Base interactions energy: -1075.184 where: short stacking energy: -445.472 Base-Backbone interact. energy: -2.730 local terms energy: -444.168662 where: bonds (distance) C4'-P energy: -80.449 bonds (distance) P-C4' energy: -72.557 flat angles C4'-P-C4' energy: -93.099 flat angles P-C4'-P energy: -67.308 tors. eta vs tors. theta energy: -130.756 Dist. restrs. and SS energy: 0.936 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1426.737428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.737428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.135570 (E_RNA) where: Base-Base interactions energy: -1029.809 where: short stacking energy: -414.011 Base-Backbone interact. energy: -2.114 local terms energy: -433.211714 where: bonds (distance) C4'-P energy: -87.986 bonds (distance) P-C4' energy: -74.480 flat angles C4'-P-C4' energy: -100.709 flat angles P-C4'-P energy: -64.117 tors. eta vs tors. theta energy: -105.919 Dist. restrs. and SS energy: 1.648 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1411.003367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.003367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.702300 (E_RNA) where: Base-Base interactions energy: -1046.747 where: short stacking energy: -417.452 Base-Backbone interact. energy: 2.011 local terms energy: -405.966899 where: bonds (distance) C4'-P energy: -65.263 bonds (distance) P-C4' energy: -76.283 flat angles C4'-P-C4' energy: -80.427 flat angles P-C4'-P energy: -62.626 tors. eta vs tors. theta energy: -121.367 Dist. restrs. and SS energy: 2.949 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1357.862069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.862069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.040308 (E_RNA) where: Base-Base interactions energy: -990.806 where: short stacking energy: -401.575 Base-Backbone interact. energy: 1.699 local terms energy: -408.932642 where: bonds (distance) C4'-P energy: -70.979 bonds (distance) P-C4' energy: -88.042 flat angles C4'-P-C4' energy: -82.778 flat angles P-C4'-P energy: -55.576 tors. eta vs tors. theta energy: -111.558 Dist. restrs. and SS energy: 3.428 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1323.084533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.084533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.036354 (E_RNA) where: Base-Base interactions energy: -973.662 where: short stacking energy: -394.263 Base-Backbone interact. energy: -0.261 local terms energy: -387.113159 where: bonds (distance) C4'-P energy: -70.253 bonds (distance) P-C4' energy: -70.771 flat angles C4'-P-C4' energy: -83.138 flat angles P-C4'-P energy: -53.114 tors. eta vs tors. theta energy: -109.836 Dist. restrs. and SS energy: 1.202 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1735.397585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.397585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.836085 (E_RNA) where: Base-Base interactions energy: -1260.526 where: short stacking energy: -530.862 Base-Backbone interact. energy: -2.068 local terms energy: -510.242202 where: bonds (distance) C4'-P energy: -91.881 bonds (distance) P-C4' energy: -90.073 flat angles C4'-P-C4' energy: -106.623 flat angles P-C4'-P energy: -69.202 tors. eta vs tors. theta energy: -152.463 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1690.597431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.597431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.997491 (E_RNA) where: Base-Base interactions energy: -1215.281 where: short stacking energy: -513.995 Base-Backbone interact. energy: -0.409 local terms energy: -512.307172 where: bonds (distance) C4'-P energy: -92.200 bonds (distance) P-C4' energy: -94.271 flat angles C4'-P-C4' energy: -105.023 flat angles P-C4'-P energy: -72.581 tors. eta vs tors. theta energy: -148.233 Dist. restrs. and SS energy: 0.650 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1608.893077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.893077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.742148 (E_RNA) where: Base-Base interactions energy: -1172.869 where: short stacking energy: -479.453 Base-Backbone interact. energy: -0.816 local terms energy: -473.057428 where: bonds (distance) C4'-P energy: -89.352 bonds (distance) P-C4' energy: -78.392 flat angles C4'-P-C4' energy: -104.829 flat angles P-C4'-P energy: -64.603 tors. eta vs tors. theta energy: -135.881 Dist. restrs. and SS energy: 1.099 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1592.883540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.883540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.136894 (E_RNA) where: Base-Base interactions energy: -1145.904 where: short stacking energy: -486.078 Base-Backbone interact. energy: -0.591 local terms energy: -484.641924 where: bonds (distance) C4'-P energy: -87.361 bonds (distance) P-C4' energy: -84.404 flat angles C4'-P-C4' energy: -93.276 flat angles P-C4'-P energy: -74.820 tors. eta vs tors. theta energy: -144.780 Dist. restrs. and SS energy: 1.503 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1499.841941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.841941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.250613 (E_RNA) where: Base-Base interactions energy: -1069.813 where: short stacking energy: -450.042 Base-Backbone interact. energy: -0.414 local terms energy: -470.023889 where: bonds (distance) C4'-P energy: -79.630 bonds (distance) P-C4' energy: -95.370 flat angles C4'-P-C4' energy: -99.946 flat angles P-C4'-P energy: -71.808 tors. eta vs tors. theta energy: -123.270 Dist. restrs. and SS energy: 3.659 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1518.077643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.077643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.018768 (E_RNA) where: Base-Base interactions energy: -1106.813 where: short stacking energy: -456.523 Base-Backbone interact. energy: -1.246 local terms energy: -447.959290 where: bonds (distance) C4'-P energy: -84.495 bonds (distance) P-C4' energy: -83.464 flat angles C4'-P-C4' energy: -88.377 flat angles P-C4'-P energy: -65.550 tors. eta vs tors. theta energy: -126.073 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1445.520297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.520297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.304686 (E_RNA) where: Base-Base interactions energy: -1065.000 where: short stacking energy: -439.828 Base-Backbone interact. energy: -0.222 local terms energy: -418.082804 where: bonds (distance) C4'-P energy: -67.584 bonds (distance) P-C4' energy: -74.414 flat angles C4'-P-C4' energy: -79.679 flat angles P-C4'-P energy: -66.891 tors. eta vs tors. theta energy: -129.516 Dist. restrs. and SS energy: 1.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1420.457779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.457779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.398398 (E_RNA) where: Base-Base interactions energy: -1055.807 where: short stacking energy: -425.598 Base-Backbone interact. energy: -1.399 local terms energy: -401.192983 where: bonds (distance) C4'-P energy: -74.385 bonds (distance) P-C4' energy: -68.924 flat angles C4'-P-C4' energy: -92.602 flat angles P-C4'-P energy: -54.140 tors. eta vs tors. theta energy: -111.143 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1373.688686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.688686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.623704 (E_RNA) where: Base-Base interactions energy: -1004.905 where: short stacking energy: -423.384 Base-Backbone interact. energy: 0.102 local terms energy: -409.821361 where: bonds (distance) C4'-P energy: -71.229 bonds (distance) P-C4' energy: -75.797 flat angles C4'-P-C4' energy: -79.693 flat angles P-C4'-P energy: -67.699 tors. eta vs tors. theta energy: -115.404 Dist. restrs. and SS energy: 4.185 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1336.105400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.105400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.187782 (E_RNA) where: Base-Base interactions energy: -994.428 where: short stacking energy: -405.979 Base-Backbone interact. energy: -1.442 local terms energy: -378.317199 where: bonds (distance) C4'-P energy: -62.761 bonds (distance) P-C4' energy: -73.657 flat angles C4'-P-C4' energy: -79.371 flat angles P-C4'-P energy: -58.106 tors. eta vs tors. theta energy: -104.423 Dist. restrs. and SS energy: 1.332 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1756.287772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1756.287772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1794.093565 (E_RNA) where: Base-Base interactions energy: -1280.246 where: short stacking energy: -538.268 Base-Backbone interact. energy: -0.996 local terms energy: -512.851637 where: bonds (distance) C4'-P energy: -88.364 bonds (distance) P-C4' energy: -93.822 flat angles C4'-P-C4' energy: -105.305 flat angles P-C4'-P energy: -65.203 tors. eta vs tors. theta energy: -160.157 Dist. restrs. and SS energy: 1.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1698.485259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.485259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.511376 (E_RNA) where: Base-Base interactions energy: -1243.298 where: short stacking energy: -512.358 Base-Backbone interact. energy: -1.504 local terms energy: -491.709192 where: bonds (distance) C4'-P energy: -88.632 bonds (distance) P-C4' energy: -85.265 flat angles C4'-P-C4' energy: -111.254 flat angles P-C4'-P energy: -66.812 tors. eta vs tors. theta energy: -139.746 Dist. restrs. and SS energy: 1.276 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1626.657107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.657107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.039468 (E_RNA) where: Base-Base interactions energy: -1161.466 where: short stacking energy: -487.628 Base-Backbone interact. energy: -2.388 local terms energy: -500.185645 where: bonds (distance) C4'-P energy: -78.486 bonds (distance) P-C4' energy: -94.745 flat angles C4'-P-C4' energy: -108.037 flat angles P-C4'-P energy: -67.038 tors. eta vs tors. theta energy: -151.880 Dist. restrs. and SS energy: 0.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1594.393263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.393263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.347682 (E_RNA) where: Base-Base interactions energy: -1156.298 where: short stacking energy: -485.831 Base-Backbone interact. energy: -2.598 local terms energy: -473.451379 where: bonds (distance) C4'-P energy: -87.179 bonds (distance) P-C4' energy: -92.358 flat angles C4'-P-C4' energy: -99.563 flat angles P-C4'-P energy: -59.475 tors. eta vs tors. theta energy: -134.876 Dist. restrs. and SS energy: 1.204 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1519.571312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.571312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.202429 (E_RNA) where: Base-Base interactions energy: -1118.870 where: short stacking energy: -466.237 Base-Backbone interact. energy: -0.214 local terms energy: -439.118425 where: bonds (distance) C4'-P energy: -74.072 bonds (distance) P-C4' energy: -89.745 flat angles C4'-P-C4' energy: -91.044 flat angles P-C4'-P energy: -56.720 tors. eta vs tors. theta energy: -127.537 Dist. restrs. and SS energy: 1.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1465.099872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.099872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1503.046255 (E_RNA) where: Base-Base interactions energy: -1056.288 where: short stacking energy: -435.335 Base-Backbone interact. energy: -1.628 local terms energy: -445.130038 where: bonds (distance) C4'-P energy: -75.274 bonds (distance) P-C4' energy: -84.838 flat angles C4'-P-C4' energy: -91.924 flat angles P-C4'-P energy: -67.335 tors. eta vs tors. theta energy: -125.760 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1423.933422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.933422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.815077 (E_RNA) where: Base-Base interactions energy: -1038.336 where: short stacking energy: -414.415 Base-Backbone interact. energy: 2.961 local terms energy: -427.439164 where: bonds (distance) C4'-P energy: -89.975 bonds (distance) P-C4' energy: -69.506 flat angles C4'-P-C4' energy: -92.522 flat angles P-C4'-P energy: -58.590 tors. eta vs tors. theta energy: -116.847 Dist. restrs. and SS energy: 2.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1405.511655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.511655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.215985 (E_RNA) where: Base-Base interactions energy: -1032.263 where: short stacking energy: -431.805 Base-Backbone interact. energy: -0.829 local terms energy: -410.124557 where: bonds (distance) C4'-P energy: -69.708 bonds (distance) P-C4' energy: -82.131 flat angles C4'-P-C4' energy: -86.111 flat angles P-C4'-P energy: -56.804 tors. eta vs tors. theta energy: -115.370 Dist. restrs. and SS energy: 0.954 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1363.661012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.661012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.704527 (E_RNA) where: Base-Base interactions energy: -1012.101 where: short stacking energy: -432.771 Base-Backbone interact. energy: -1.217 local terms energy: -389.385908 where: bonds (distance) C4'-P energy: -59.472 bonds (distance) P-C4' energy: -70.132 flat angles C4'-P-C4' energy: -85.107 flat angles P-C4'-P energy: -56.830 tors. eta vs tors. theta energy: -117.845 Dist. restrs. and SS energy: 2.294 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1355.968974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.968974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.938464 (E_RNA) where: Base-Base interactions energy: -1005.373 where: short stacking energy: -412.307 Base-Backbone interact. energy: 0.648 local terms energy: -389.213633 where: bonds (distance) C4'-P energy: -61.322 bonds (distance) P-C4' energy: -78.848 flat angles C4'-P-C4' energy: -75.885 flat angles P-C4'-P energy: -59.086 tors. eta vs tors. theta energy: -114.072 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1745.928985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.928985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.023620 (E_RNA) where: Base-Base interactions energy: -1279.923 where: short stacking energy: -524.063 Base-Backbone interact. energy: -1.231 local terms energy: -502.869840 where: bonds (distance) C4'-P energy: -89.634 bonds (distance) P-C4' energy: -90.388 flat angles C4'-P-C4' energy: -107.918 flat angles P-C4'-P energy: -67.431 tors. eta vs tors. theta energy: -147.499 Dist. restrs. and SS energy: 1.345 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1718.426971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.426971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.655349 (E_RNA) where: Base-Base interactions energy: -1274.733 where: short stacking energy: -513.816 Base-Backbone interact. energy: -3.413 local terms energy: -477.509919 where: bonds (distance) C4'-P energy: -78.545 bonds (distance) P-C4' energy: -84.116 flat angles C4'-P-C4' energy: -103.769 flat angles P-C4'-P energy: -69.949 tors. eta vs tors. theta energy: -141.131 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1601.986820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.986820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.366558 (E_RNA) where: Base-Base interactions energy: -1151.417 where: short stacking energy: -492.314 Base-Backbone interact. energy: -0.387 local terms energy: -487.562528 where: bonds (distance) C4'-P energy: -94.621 bonds (distance) P-C4' energy: -93.811 flat angles C4'-P-C4' energy: -98.004 flat angles P-C4'-P energy: -56.808 tors. eta vs tors. theta energy: -144.319 Dist. restrs. and SS energy: 0.630 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1591.165871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.165871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.902847 (E_RNA) where: Base-Base interactions energy: -1137.939 where: short stacking energy: -479.431 Base-Backbone interact. energy: -1.531 local terms energy: -489.432233 where: bonds (distance) C4'-P energy: -77.768 bonds (distance) P-C4' energy: -96.404 flat angles C4'-P-C4' energy: -102.703 flat angles P-C4'-P energy: -76.745 tors. eta vs tors. theta energy: -135.813 Dist. restrs. and SS energy: 0.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1525.157025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.157025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.452787 (E_RNA) where: Base-Base interactions energy: -1117.376 where: short stacking energy: -447.979 Base-Backbone interact. energy: -1.629 local terms energy: -444.448706 where: bonds (distance) C4'-P energy: -88.222 bonds (distance) P-C4' energy: -84.982 flat angles C4'-P-C4' energy: -99.692 flat angles P-C4'-P energy: -50.081 tors. eta vs tors. theta energy: -121.473 Dist. restrs. and SS energy: 1.546 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1426.245526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.245526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.060123 (E_RNA) where: Base-Base interactions energy: -1026.755 where: short stacking energy: -428.893 Base-Backbone interact. energy: -1.063 local terms energy: -436.242878 where: bonds (distance) C4'-P energy: -77.112 bonds (distance) P-C4' energy: -94.941 flat angles C4'-P-C4' energy: -92.538 flat angles P-C4'-P energy: -56.993 tors. eta vs tors. theta energy: -114.660 Dist. restrs. and SS energy: 1.065 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1470.127350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.127350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.062898 (E_RNA) where: Base-Base interactions energy: -1089.568 where: short stacking energy: -450.421 Base-Backbone interact. energy: -1.234 local terms energy: -417.261034 where: bonds (distance) C4'-P energy: -65.181 bonds (distance) P-C4' energy: -71.537 flat angles C4'-P-C4' energy: -101.434 flat angles P-C4'-P energy: -55.024 tors. eta vs tors. theta energy: -124.085 Dist. restrs. and SS energy: 1.186 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1394.159041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.159041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.038825 (E_RNA) where: Base-Base interactions energy: -994.047 where: short stacking energy: -391.195 Base-Backbone interact. energy: 2.627 local terms energy: -441.619389 where: bonds (distance) C4'-P energy: -83.224 bonds (distance) P-C4' energy: -84.622 flat angles C4'-P-C4' energy: -92.690 flat angles P-C4'-P energy: -65.408 tors. eta vs tors. theta energy: -115.675 Dist. restrs. and SS energy: 2.130 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1364.265927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.265927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.354258 (E_RNA) where: Base-Base interactions energy: -991.646 where: short stacking energy: -421.054 Base-Backbone interact. energy: -2.819 local terms energy: -408.889435 where: bonds (distance) C4'-P energy: -76.955 bonds (distance) P-C4' energy: -75.522 flat angles C4'-P-C4' energy: -82.389 flat angles P-C4'-P energy: -52.629 tors. eta vs tors. theta energy: -121.395 Dist. restrs. and SS energy: 2.338 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -1336.324990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.324990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.205115 (E_RNA) where: Base-Base interactions energy: -982.440 where: short stacking energy: -403.565 Base-Backbone interact. energy: 0.178 local terms energy: -392.943715 where: bonds (distance) C4'-P energy: -74.141 bonds (distance) P-C4' energy: -63.444 flat angles C4'-P-C4' energy: -82.884 flat angles P-C4'-P energy: -56.699 tors. eta vs tors. theta energy: -115.777 Dist. restrs. and SS energy: 2.130 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1766.762943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1766.762943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1805.029716 (E_RNA) where: Base-Base interactions energy: -1281.005 where: short stacking energy: -525.124 Base-Backbone interact. energy: -2.776 local terms energy: -521.248657 where: bonds (distance) C4'-P energy: -103.019 bonds (distance) P-C4' energy: -103.241 flat angles C4'-P-C4' energy: -102.561 flat angles P-C4'-P energy: -67.742 tors. eta vs tors. theta energy: -144.686 Dist. restrs. and SS energy: 1.517 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1714.959445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.959445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.329240 (E_RNA) where: Base-Base interactions energy: -1239.667 where: short stacking energy: -505.519 Base-Backbone interact. energy: -1.717 local terms energy: -511.945173 where: bonds (distance) C4'-P energy: -84.690 bonds (distance) P-C4' energy: -90.492 flat angles C4'-P-C4' energy: -113.311 flat angles P-C4'-P energy: -70.440 tors. eta vs tors. theta energy: -153.011 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1610.187192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.187192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.484698 (E_RNA) where: Base-Base interactions energy: -1160.590 where: short stacking energy: -489.277 Base-Backbone interact. energy: -2.153 local terms energy: -486.741348 where: bonds (distance) C4'-P energy: -87.514 bonds (distance) P-C4' energy: -85.393 flat angles C4'-P-C4' energy: -101.197 flat angles P-C4'-P energy: -68.823 tors. eta vs tors. theta energy: -143.814 Dist. restrs. and SS energy: 2.548 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1599.527115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.527115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.957674 (E_RNA) where: Base-Base interactions energy: -1151.699 where: short stacking energy: -506.720 Base-Backbone interact. energy: -2.394 local terms energy: -482.864480 where: bonds (distance) C4'-P energy: -89.241 bonds (distance) P-C4' energy: -91.721 flat angles C4'-P-C4' energy: -97.203 flat angles P-C4'-P energy: -72.358 tors. eta vs tors. theta energy: -132.341 Dist. restrs. and SS energy: 0.681 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1523.834744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.834744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.699497 (E_RNA) where: Base-Base interactions energy: -1100.845 where: short stacking energy: -436.844 Base-Backbone interact. energy: 0.224 local terms energy: -462.079320 where: bonds (distance) C4'-P energy: -86.694 bonds (distance) P-C4' energy: -88.100 flat angles C4'-P-C4' energy: -99.378 flat angles P-C4'-P energy: -60.819 tors. eta vs tors. theta energy: -127.087 Dist. restrs. and SS energy: 2.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1448.353063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.353063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.552341 (E_RNA) where: Base-Base interactions energy: -1070.067 where: short stacking energy: -436.273 Base-Backbone interact. energy: -0.324 local terms energy: -416.161443 where: bonds (distance) C4'-P energy: -76.447 bonds (distance) P-C4' energy: -82.487 flat angles C4'-P-C4' energy: -86.561 flat angles P-C4'-P energy: -58.661 tors. eta vs tors. theta energy: -112.006 Dist. restrs. and SS energy: 1.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1416.613586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.613586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.758899 (E_RNA) where: Base-Base interactions energy: -1035.805 where: short stacking energy: -404.669 Base-Backbone interact. energy: -2.860 local terms energy: -416.094208 where: bonds (distance) C4'-P energy: -70.147 bonds (distance) P-C4' energy: -77.145 flat angles C4'-P-C4' energy: -86.084 flat angles P-C4'-P energy: -62.482 tors. eta vs tors. theta energy: -120.237 Dist. restrs. and SS energy: 1.395 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1403.415108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.415108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.329748 (E_RNA) where: Base-Base interactions energy: -1012.534 where: short stacking energy: -417.857 Base-Backbone interact. energy: -1.377 local terms energy: -427.417972 where: bonds (distance) C4'-P energy: -76.511 bonds (distance) P-C4' energy: -89.136 flat angles C4'-P-C4' energy: -85.205 flat angles P-C4'-P energy: -57.363 tors. eta vs tors. theta energy: -119.202 Dist. restrs. and SS energy: 1.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1411.289204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.289204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.551699 (E_RNA) where: Base-Base interactions energy: -1010.458 where: short stacking energy: -412.235 Base-Backbone interact. energy: -0.537 local terms energy: -439.556827 where: bonds (distance) C4'-P energy: -80.716 bonds (distance) P-C4' energy: -86.249 flat angles C4'-P-C4' energy: -97.749 flat angles P-C4'-P energy: -58.223 tors. eta vs tors. theta energy: -116.619 Dist. restrs. and SS energy: 2.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1330.727018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.727018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.120508 (E_RNA) where: Base-Base interactions energy: -1002.188 where: short stacking energy: -387.665 Base-Backbone interact. energy: 0.728 local terms energy: -367.660947 where: bonds (distance) C4'-P energy: -61.670 bonds (distance) P-C4' energy: -68.854 flat angles C4'-P-C4' energy: -82.052 flat angles P-C4'-P energy: -51.218 tors. eta vs tors. theta energy: -103.866 Dist. restrs. and SS energy: 1.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1775.514535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1775.514535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.487989 (E_RNA) where: Base-Base interactions energy: -1286.286 where: short stacking energy: -540.750 Base-Backbone interact. energy: -0.877 local terms energy: -526.325194 where: bonds (distance) C4'-P energy: -93.826 bonds (distance) P-C4' energy: -97.687 flat angles C4'-P-C4' energy: -105.911 flat angles P-C4'-P energy: -70.883 tors. eta vs tors. theta energy: -158.018 Dist. restrs. and SS energy: 1.223 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1706.608087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.608087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1745.779739 (E_RNA) where: Base-Base interactions energy: -1250.051 where: short stacking energy: -520.050 Base-Backbone interact. energy: -1.431 local terms energy: -494.297513 where: bonds (distance) C4'-P energy: -97.498 bonds (distance) P-C4' energy: -82.176 flat angles C4'-P-C4' energy: -98.496 flat angles P-C4'-P energy: -70.436 tors. eta vs tors. theta energy: -145.692 Dist. restrs. and SS energy: 2.422 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1621.309928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.309928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.626027 (E_RNA) where: Base-Base interactions energy: -1175.066 where: short stacking energy: -485.554 Base-Backbone interact. energy: -1.588 local terms energy: -482.971865 where: bonds (distance) C4'-P energy: -78.213 bonds (distance) P-C4' energy: -93.080 flat angles C4'-P-C4' energy: -98.585 flat angles P-C4'-P energy: -79.479 tors. eta vs tors. theta energy: -133.616 Dist. restrs. and SS energy: 1.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1581.663083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.663083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.786943 (E_RNA) where: Base-Base interactions energy: -1139.536 where: short stacking energy: -476.430 Base-Backbone interact. energy: -1.473 local terms energy: -478.777258 where: bonds (distance) C4'-P energy: -78.116 bonds (distance) P-C4' energy: -79.581 flat angles C4'-P-C4' energy: -109.672 flat angles P-C4'-P energy: -68.925 tors. eta vs tors. theta energy: -142.483 Dist. restrs. and SS energy: 1.374 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1538.722220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.722220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.268799 (E_RNA) where: Base-Base interactions energy: -1123.894 where: short stacking energy: -464.822 Base-Backbone interact. energy: -3.063 local terms energy: -449.311578 where: bonds (distance) C4'-P energy: -72.712 bonds (distance) P-C4' energy: -80.651 flat angles C4'-P-C4' energy: -93.394 flat angles P-C4'-P energy: -72.285 tors. eta vs tors. theta energy: -130.269 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1443.313647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.313647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.392534 (E_RNA) where: Base-Base interactions energy: -1065.703 where: short stacking energy: -435.859 Base-Backbone interact. energy: 4.855 local terms energy: -420.544825 where: bonds (distance) C4'-P energy: -84.405 bonds (distance) P-C4' energy: -71.916 flat angles C4'-P-C4' energy: -92.848 flat angles P-C4'-P energy: -51.390 tors. eta vs tors. theta energy: -119.986 Dist. restrs. and SS energy: 1.329 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1432.810960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.810960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.745212 (E_RNA) where: Base-Base interactions energy: -1037.181 where: short stacking energy: -430.223 Base-Backbone interact. energy: -0.692 local terms energy: -433.871794 where: bonds (distance) C4'-P energy: -83.666 bonds (distance) P-C4' energy: -73.319 flat angles C4'-P-C4' energy: -100.725 flat angles P-C4'-P energy: -62.326 tors. eta vs tors. theta energy: -113.836 Dist. restrs. and SS energy: 2.184 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1402.226204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.226204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.180975 (E_RNA) where: Base-Base interactions energy: -1031.979 where: short stacking energy: -427.234 Base-Backbone interact. energy: 2.788 local terms energy: -411.990023 where: bonds (distance) C4'-P energy: -66.315 bonds (distance) P-C4' energy: -81.564 flat angles C4'-P-C4' energy: -79.169 flat angles P-C4'-P energy: -70.467 tors. eta vs tors. theta energy: -114.475 Dist. restrs. and SS energy: 2.205 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1350.269581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.269581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.989293 (E_RNA) where: Base-Base interactions energy: -996.270 where: short stacking energy: -407.732 Base-Backbone interact. energy: -1.323 local terms energy: -391.396262 where: bonds (distance) C4'-P energy: -71.333 bonds (distance) P-C4' energy: -84.673 flat angles C4'-P-C4' energy: -80.512 flat angles P-C4'-P energy: -40.774 tors. eta vs tors. theta energy: -114.105 Dist. restrs. and SS energy: 1.970 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -1332.836294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.836294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.933047 (E_RNA) where: Base-Base interactions energy: -989.876 where: short stacking energy: -401.404 Base-Backbone interact. energy: 1.776 local terms energy: -383.832609 where: bonds (distance) C4'-P energy: -72.172 bonds (distance) P-C4' energy: -74.888 flat angles C4'-P-C4' energy: -82.076 flat angles P-C4'-P energy: -45.065 tors. eta vs tors. theta energy: -109.632 Dist. restrs. and SS energy: 2.347 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1721.449450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.449450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.808845 (E_RNA) where: Base-Base interactions energy: -1243.950 where: short stacking energy: -515.745 Base-Backbone interact. energy: -2.129 local terms energy: -513.730638 where: bonds (distance) C4'-P energy: -92.967 bonds (distance) P-C4' energy: -90.617 flat angles C4'-P-C4' energy: -113.513 flat angles P-C4'-P energy: -64.457 tors. eta vs tors. theta energy: -152.176 Dist. restrs. and SS energy: 1.609 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1694.281480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.281480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.742217 (E_RNA) where: Base-Base interactions energy: -1258.900 where: short stacking energy: -516.904 Base-Backbone interact. energy: -4.515 local terms energy: -468.327553 where: bonds (distance) C4'-P energy: -75.351 bonds (distance) P-C4' energy: -89.255 flat angles C4'-P-C4' energy: -100.144 flat angles P-C4'-P energy: -66.913 tors. eta vs tors. theta energy: -136.665 Dist. restrs. and SS energy: 0.711 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1619.696883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.696883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.426781 (E_RNA) where: Base-Base interactions energy: -1171.130 where: short stacking energy: -492.541 Base-Backbone interact. energy: -2.600 local terms energy: -483.697306 where: bonds (distance) C4'-P energy: -80.828 bonds (distance) P-C4' energy: -84.366 flat angles C4'-P-C4' energy: -112.210 flat angles P-C4'-P energy: -66.934 tors. eta vs tors. theta energy: -139.359 Dist. restrs. and SS energy: 0.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1547.642119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.642119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.272822 (E_RNA) where: Base-Base interactions energy: -1117.938 where: short stacking energy: -479.943 Base-Backbone interact. energy: -0.522 local terms energy: -466.812670 where: bonds (distance) C4'-P energy: -83.846 bonds (distance) P-C4' energy: -86.253 flat angles C4'-P-C4' energy: -101.420 flat angles P-C4'-P energy: -58.639 tors. eta vs tors. theta energy: -136.654 Dist. restrs. and SS energy: 0.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1563.470361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.470361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.062871 (E_RNA) where: Base-Base interactions energy: -1131.720 where: short stacking energy: -467.876 Base-Backbone interact. energy: 2.463 local terms energy: -472.806418 where: bonds (distance) C4'-P energy: -90.078 bonds (distance) P-C4' energy: -84.938 flat angles C4'-P-C4' energy: -107.932 flat angles P-C4'-P energy: -65.678 tors. eta vs tors. theta energy: -124.180 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1529.892497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.892497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.038884 (E_RNA) where: Base-Base interactions energy: -1115.998 where: short stacking energy: -471.680 Base-Backbone interact. energy: -1.241 local terms energy: -450.799368 where: bonds (distance) C4'-P energy: -91.951 bonds (distance) P-C4' energy: -86.698 flat angles C4'-P-C4' energy: -82.695 flat angles P-C4'-P energy: -63.722 tors. eta vs tors. theta energy: -125.734 Dist. restrs. and SS energy: 1.396 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1438.690816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.690816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.679636 (E_RNA) where: Base-Base interactions energy: -1053.715 where: short stacking energy: -434.731 Base-Backbone interact. energy: -0.256 local terms energy: -422.708359 where: bonds (distance) C4'-P energy: -61.134 bonds (distance) P-C4' energy: -85.187 flat angles C4'-P-C4' energy: -99.126 flat angles P-C4'-P energy: -58.558 tors. eta vs tors. theta energy: -118.703 Dist. restrs. and SS energy: 1.239 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1404.198873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.198873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.221128 (E_RNA) where: Base-Base interactions energy: -1052.614 where: short stacking energy: -445.216 Base-Backbone interact. energy: -1.408 local terms energy: -388.199497 where: bonds (distance) C4'-P energy: -51.324 bonds (distance) P-C4' energy: -78.358 flat angles C4'-P-C4' energy: -98.216 flat angles P-C4'-P energy: -36.209 tors. eta vs tors. theta energy: -124.091 Dist. restrs. and SS energy: 1.272 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1376.034560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.034560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.716687 (E_RNA) where: Base-Base interactions energy: -1025.544 where: short stacking energy: -433.372 Base-Backbone interact. energy: -0.303 local terms energy: -387.869957 where: bonds (distance) C4'-P energy: -62.138 bonds (distance) P-C4' energy: -70.898 flat angles C4'-P-C4' energy: -80.359 flat angles P-C4'-P energy: -57.352 tors. eta vs tors. theta energy: -117.122 Dist. restrs. and SS energy: 0.932 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -1383.624359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.624359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.577638 (E_RNA) where: Base-Base interactions energy: -1002.225 where: short stacking energy: -414.751 Base-Backbone interact. energy: -0.197 local terms energy: -419.155112 where: bonds (distance) C4'-P energy: -65.499 bonds (distance) P-C4' energy: -77.898 flat angles C4'-P-C4' energy: -90.737 flat angles P-C4'-P energy: -58.605 tors. eta vs tors. theta energy: -126.417 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1742.317908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1742.317908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.018354 (E_RNA) where: Base-Base interactions energy: -1260.640 where: short stacking energy: -540.955 Base-Backbone interact. energy: -1.326 local terms energy: -518.052875 where: bonds (distance) C4'-P energy: -89.303 bonds (distance) P-C4' energy: -102.106 flat angles C4'-P-C4' energy: -108.094 flat angles P-C4'-P energy: -68.938 tors. eta vs tors. theta energy: -149.613 Dist. restrs. and SS energy: 0.950 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1700.241444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.241444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.383258 (E_RNA) where: Base-Base interactions energy: -1247.291 where: short stacking energy: -503.449 Base-Backbone interact. energy: -2.759 local terms energy: -487.333687 where: bonds (distance) C4'-P energy: -94.279 bonds (distance) P-C4' energy: -76.034 flat angles C4'-P-C4' energy: -102.445 flat angles P-C4'-P energy: -73.865 tors. eta vs tors. theta energy: -140.710 Dist. restrs. and SS energy: 0.392 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1632.394446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.394446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.128811 (E_RNA) where: Base-Base interactions energy: -1220.908 where: short stacking energy: -485.911 Base-Backbone interact. energy: -1.208 local terms energy: -449.013083 where: bonds (distance) C4'-P energy: -81.441 bonds (distance) P-C4' energy: -78.862 flat angles C4'-P-C4' energy: -90.666 flat angles P-C4'-P energy: -68.099 tors. eta vs tors. theta energy: -129.945 Dist. restrs. and SS energy: 1.984 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1613.768014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.768014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.085230 (E_RNA) where: Base-Base interactions energy: -1166.642 where: short stacking energy: -493.114 Base-Backbone interact. energy: -0.954 local terms energy: -485.489056 where: bonds (distance) C4'-P energy: -81.440 bonds (distance) P-C4' energy: -88.736 flat angles C4'-P-C4' energy: -108.821 flat angles P-C4'-P energy: -70.236 tors. eta vs tors. theta energy: -136.256 Dist. restrs. and SS energy: 2.567 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1519.325508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.325508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.990780 (E_RNA) where: Base-Base interactions energy: -1130.920 where: short stacking energy: -451.177 Base-Backbone interact. energy: -0.587 local terms energy: -425.483422 where: bonds (distance) C4'-P energy: -75.016 bonds (distance) P-C4' energy: -64.217 flat angles C4'-P-C4' energy: -100.902 flat angles P-C4'-P energy: -71.684 tors. eta vs tors. theta energy: -113.665 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1471.412188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.412188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.418448 (E_RNA) where: Base-Base interactions energy: -1075.062 where: short stacking energy: -429.128 Base-Backbone interact. energy: 0.205 local terms energy: -435.561293 where: bonds (distance) C4'-P energy: -85.925 bonds (distance) P-C4' energy: -83.759 flat angles C4'-P-C4' energy: -91.219 flat angles P-C4'-P energy: -57.531 tors. eta vs tors. theta energy: -117.127 Dist. restrs. and SS energy: 2.256 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1435.907405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.907405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.857034 (E_RNA) where: Base-Base interactions energy: -1057.304 where: short stacking energy: -427.219 Base-Backbone interact. energy: 0.345 local terms energy: -416.897719 where: bonds (distance) C4'-P energy: -69.456 bonds (distance) P-C4' energy: -80.720 flat angles C4'-P-C4' energy: -96.592 flat angles P-C4'-P energy: -61.176 tors. eta vs tors. theta energy: -108.953 Dist. restrs. and SS energy: 1.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1371.691068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.691068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.799470 (E_RNA) where: Base-Base interactions energy: -994.488 where: short stacking energy: -377.242 Base-Backbone interact. energy: -1.280 local terms energy: -415.030723 where: bonds (distance) C4'-P energy: -72.027 bonds (distance) P-C4' energy: -78.942 flat angles C4'-P-C4' energy: -101.776 flat angles P-C4'-P energy: -49.746 tors. eta vs tors. theta energy: -112.540 Dist. restrs. and SS energy: 2.358 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1355.469799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.469799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.756451 (E_RNA) where: Base-Base interactions energy: -979.641 where: short stacking energy: -393.816 Base-Backbone interact. energy: -0.611 local terms energy: -413.504425 where: bonds (distance) C4'-P energy: -61.169 bonds (distance) P-C4' energy: -83.901 flat angles C4'-P-C4' energy: -90.628 flat angles P-C4'-P energy: -66.909 tors. eta vs tors. theta energy: -110.897 Dist. restrs. and SS energy: 1.537 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -1330.335971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.335971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.588643 (E_RNA) where: Base-Base interactions energy: -999.031 where: short stacking energy: -424.614 Base-Backbone interact. energy: -1.165 local terms energy: -369.392775 where: bonds (distance) C4'-P energy: -70.590 bonds (distance) P-C4' energy: -70.803 flat angles C4'-P-C4' energy: -84.448 flat angles P-C4'-P energy: -37.706 tors. eta vs tors. theta energy: -105.845 Dist. restrs. and SS energy: 2.503 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1725.229457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1725.229457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.914968 (E_RNA) where: Base-Base interactions energy: -1281.609 where: short stacking energy: -527.717 Base-Backbone interact. energy: -2.289 local terms energy: -479.017249 where: bonds (distance) C4'-P energy: -81.721 bonds (distance) P-C4' energy: -88.538 flat angles C4'-P-C4' energy: -94.390 flat angles P-C4'-P energy: -69.432 tors. eta vs tors. theta energy: -144.937 Dist. restrs. and SS energy: 0.936 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1721.958401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.958401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.184759 (E_RNA) where: Base-Base interactions energy: -1262.115 where: short stacking energy: -525.718 Base-Backbone interact. energy: -0.828 local terms energy: -496.242430 where: bonds (distance) C4'-P energy: -97.658 bonds (distance) P-C4' energy: -86.185 flat angles C4'-P-C4' energy: -104.025 flat angles P-C4'-P energy: -66.231 tors. eta vs tors. theta energy: -142.142 Dist. restrs. and SS energy: 0.476 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1639.724017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.724017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.428989 (E_RNA) where: Base-Base interactions energy: -1179.718 where: short stacking energy: -506.897 Base-Backbone interact. energy: 0.160 local terms energy: -498.870717 where: bonds (distance) C4'-P energy: -95.117 bonds (distance) P-C4' energy: -99.315 flat angles C4'-P-C4' energy: -99.923 flat angles P-C4'-P energy: -65.750 tors. eta vs tors. theta energy: -138.766 Dist. restrs. and SS energy: 1.955 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1628.872996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.872996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.064714 (E_RNA) where: Base-Base interactions energy: -1167.512 where: short stacking energy: -491.642 Base-Backbone interact. energy: -0.600 local terms energy: -498.952743 where: bonds (distance) C4'-P energy: -94.243 bonds (distance) P-C4' energy: -86.741 flat angles C4'-P-C4' energy: -104.265 flat angles P-C4'-P energy: -74.741 tors. eta vs tors. theta energy: -138.964 Dist. restrs. and SS energy: 1.442 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1520.876446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.876446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.929958 (E_RNA) where: Base-Base interactions energy: -1117.718 where: short stacking energy: -451.795 Base-Backbone interact. energy: -2.256 local terms energy: -438.956342 where: bonds (distance) C4'-P energy: -74.909 bonds (distance) P-C4' energy: -85.733 flat angles C4'-P-C4' energy: -92.412 flat angles P-C4'-P energy: -58.712 tors. eta vs tors. theta energy: -127.190 Dist. restrs. and SS energy: 1.304 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1473.966215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.966215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.124455 (E_RNA) where: Base-Base interactions energy: -1073.135 where: short stacking energy: -432.036 Base-Backbone interact. energy: -3.567 local terms energy: -435.422918 where: bonds (distance) C4'-P energy: -80.811 bonds (distance) P-C4' energy: -77.727 flat angles C4'-P-C4' energy: -98.383 flat angles P-C4'-P energy: -57.820 tors. eta vs tors. theta energy: -120.682 Dist. restrs. and SS energy: 1.408 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1437.424128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.424128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.118925 (E_RNA) where: Base-Base interactions energy: -1041.446 where: short stacking energy: -421.975 Base-Backbone interact. energy: 4.799 local terms energy: -439.472147 where: bonds (distance) C4'-P energy: -95.122 bonds (distance) P-C4' energy: -68.009 flat angles C4'-P-C4' energy: -92.333 flat angles P-C4'-P energy: -65.596 tors. eta vs tors. theta energy: -118.412 Dist. restrs. and SS energy: 1.945 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1374.990612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.990612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.175776 (E_RNA) where: Base-Base interactions energy: -1035.806 where: short stacking energy: -412.710 Base-Backbone interact. energy: -0.070 local terms energy: -377.299698 where: bonds (distance) C4'-P energy: -74.680 bonds (distance) P-C4' energy: -58.977 flat angles C4'-P-C4' energy: -87.349 flat angles P-C4'-P energy: -51.302 tors. eta vs tors. theta energy: -104.993 Dist. restrs. and SS energy: 1.435 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1356.137178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.137178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.349877 (E_RNA) where: Base-Base interactions energy: -963.355 where: short stacking energy: -390.135 Base-Backbone interact. energy: -1.236 local terms energy: -429.758782 where: bonds (distance) C4'-P energy: -83.790 bonds (distance) P-C4' energy: -90.998 flat angles C4'-P-C4' energy: -89.228 flat angles P-C4'-P energy: -61.385 tors. eta vs tors. theta energy: -104.357 Dist. restrs. and SS energy: 1.463 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -1335.612215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.612215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.271002 (E_RNA) where: Base-Base interactions energy: -975.130 where: short stacking energy: -398.295 Base-Backbone interact. energy: 0.117 local terms energy: -398.257891 where: bonds (distance) C4'-P energy: -61.063 bonds (distance) P-C4' energy: -83.934 flat angles C4'-P-C4' energy: -95.980 flat angles P-C4'-P energy: -52.402 tors. eta vs tors. theta energy: -104.879 Dist. restrs. and SS energy: 0.909 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1732.800863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.800863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.257913 (E_RNA) where: Base-Base interactions energy: -1264.934 where: short stacking energy: -513.595 Base-Backbone interact. energy: -1.104 local terms energy: -504.219805 where: bonds (distance) C4'-P energy: -88.909 bonds (distance) P-C4' energy: -83.674 flat angles C4'-P-C4' energy: -109.718 flat angles P-C4'-P energy: -73.320 tors. eta vs tors. theta energy: -148.599 Dist. restrs. and SS energy: 0.707 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1700.930694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.930694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.336183 (E_RNA) where: Base-Base interactions energy: -1238.199 where: short stacking energy: -520.112 Base-Backbone interact. energy: -4.249 local terms energy: -495.888331 where: bonds (distance) C4'-P energy: -88.427 bonds (distance) P-C4' energy: -92.851 flat angles C4'-P-C4' energy: -109.300 flat angles P-C4'-P energy: -64.296 tors. eta vs tors. theta energy: -141.013 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1651.237878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.237878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.902390 (E_RNA) where: Base-Base interactions energy: -1183.889 where: short stacking energy: -489.489 Base-Backbone interact. energy: -1.456 local terms energy: -503.556766 where: bonds (distance) C4'-P energy: -103.367 bonds (distance) P-C4' energy: -87.840 flat angles C4'-P-C4' energy: -101.620 flat angles P-C4'-P energy: -73.093 tors. eta vs tors. theta energy: -137.637 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1592.085571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.085571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.007842 (E_RNA) where: Base-Base interactions energy: -1161.930 where: short stacking energy: -501.478 Base-Backbone interact. energy: -0.983 local terms energy: -467.095381 where: bonds (distance) C4'-P energy: -76.559 bonds (distance) P-C4' energy: -78.748 flat angles C4'-P-C4' energy: -98.985 flat angles P-C4'-P energy: -75.757 tors. eta vs tors. theta energy: -137.046 Dist. restrs. and SS energy: 1.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1531.020332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.020332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.307859 (E_RNA) where: Base-Base interactions energy: -1096.326 where: short stacking energy: -438.221 Base-Backbone interact. energy: -0.775 local terms energy: -471.207343 where: bonds (distance) C4'-P energy: -83.444 bonds (distance) P-C4' energy: -100.744 flat angles C4'-P-C4' energy: -98.853 flat angles P-C4'-P energy: -57.686 tors. eta vs tors. theta energy: -130.480 Dist. restrs. and SS energy: 0.538 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1493.579876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.579876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.745391 (E_RNA) where: Base-Base interactions energy: -1082.250 where: short stacking energy: -453.812 Base-Backbone interact. energy: -1.174 local terms energy: -449.321680 where: bonds (distance) C4'-P energy: -78.629 bonds (distance) P-C4' energy: -94.353 flat angles C4'-P-C4' energy: -96.545 flat angles P-C4'-P energy: -54.564 tors. eta vs tors. theta energy: -125.231 Dist. restrs. and SS energy: 2.416 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1461.622476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.622476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.627389 (E_RNA) where: Base-Base interactions energy: -1042.554 where: short stacking energy: -441.540 Base-Backbone interact. energy: -1.052 local terms energy: -456.020994 where: bonds (distance) C4'-P energy: -79.364 bonds (distance) P-C4' energy: -78.413 flat angles C4'-P-C4' energy: -101.703 flat angles P-C4'-P energy: -71.766 tors. eta vs tors. theta energy: -124.775 Dist. restrs. and SS energy: 1.255 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1423.925578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.925578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.588506 (E_RNA) where: Base-Base interactions energy: -1041.824 where: short stacking energy: -430.145 Base-Backbone interact. energy: 1.396 local terms energy: -421.160163 where: bonds (distance) C4'-P energy: -72.344 bonds (distance) P-C4' energy: -68.960 flat angles C4'-P-C4' energy: -86.516 flat angles P-C4'-P energy: -63.011 tors. eta vs tors. theta energy: -130.329 Dist. restrs. and SS energy: 0.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1318.870901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1318.870901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.379185 (E_RNA) where: Base-Base interactions energy: -973.771 where: short stacking energy: -398.717 Base-Backbone interact. energy: -0.592 local terms energy: -384.016773 where: bonds (distance) C4'-P energy: -71.924 bonds (distance) P-C4' energy: -73.340 flat angles C4'-P-C4' energy: -84.212 flat angles P-C4'-P energy: -50.021 tors. eta vs tors. theta energy: -104.519 Dist. restrs. and SS energy: 2.758 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -1354.242242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.242242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.811702 (E_RNA) where: Base-Base interactions energy: -989.902 where: short stacking energy: -390.333 Base-Backbone interact. energy: 1.247 local terms energy: -403.157379 where: bonds (distance) C4'-P energy: -80.773 bonds (distance) P-C4' energy: -87.223 flat angles C4'-P-C4' energy: -79.705 flat angles P-C4'-P energy: -51.926 tors. eta vs tors. theta energy: -103.530 Dist. restrs. and SS energy: 0.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1736.782511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1736.782511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1775.205512 (E_RNA) where: Base-Base interactions energy: -1258.849 where: short stacking energy: -526.651 Base-Backbone interact. energy: -2.186 local terms energy: -514.170473 where: bonds (distance) C4'-P energy: -96.339 bonds (distance) P-C4' energy: -101.848 flat angles C4'-P-C4' energy: -102.161 flat angles P-C4'-P energy: -70.738 tors. eta vs tors. theta energy: -143.084 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1724.154907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.154907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.234170 (E_RNA) where: Base-Base interactions energy: -1249.860 where: short stacking energy: -527.892 Base-Backbone interact. energy: -1.089 local terms energy: -511.284819 where: bonds (distance) C4'-P energy: -99.275 bonds (distance) P-C4' energy: -85.956 flat angles C4'-P-C4' energy: -102.159 flat angles P-C4'-P energy: -68.580 tors. eta vs tors. theta energy: -155.315 Dist. restrs. and SS energy: 1.329 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1609.237701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.237701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.838965 (E_RNA) where: Base-Base interactions energy: -1156.924 where: short stacking energy: -484.151 Base-Backbone interact. energy: -2.507 local terms energy: -487.407623 where: bonds (distance) C4'-P energy: -94.586 bonds (distance) P-C4' energy: -79.079 flat angles C4'-P-C4' energy: -104.571 flat angles P-C4'-P energy: -72.334 tors. eta vs tors. theta energy: -136.838 Dist. restrs. and SS energy: 0.851 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1604.381941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.381941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.942081 (E_RNA) where: Base-Base interactions energy: -1164.356 where: short stacking energy: -495.291 Base-Backbone interact. energy: -1.241 local terms energy: -476.344473 where: bonds (distance) C4'-P energy: -79.074 bonds (distance) P-C4' energy: -84.594 flat angles C4'-P-C4' energy: -97.653 flat angles P-C4'-P energy: -69.751 tors. eta vs tors. theta energy: -145.272 Dist. restrs. and SS energy: 0.810 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1551.838386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.838386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.423318 (E_RNA) where: Base-Base interactions energy: -1144.298 where: short stacking energy: -447.442 Base-Backbone interact. energy: 1.045 local terms energy: -446.169969 where: bonds (distance) C4'-P energy: -78.859 bonds (distance) P-C4' energy: -79.965 flat angles C4'-P-C4' energy: -99.057 flat angles P-C4'-P energy: -57.056 tors. eta vs tors. theta energy: -131.233 Dist. restrs. and SS energy: 0.835 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1452.968183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.968183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.060457 (E_RNA) where: Base-Base interactions energy: -1084.531 where: short stacking energy: -435.694 Base-Backbone interact. energy: 1.235 local terms energy: -407.764316 where: bonds (distance) C4'-P energy: -69.372 bonds (distance) P-C4' energy: -75.648 flat angles C4'-P-C4' energy: -95.249 flat angles P-C4'-P energy: -47.805 tors. eta vs tors. theta energy: -119.690 Dist. restrs. and SS energy: 1.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1458.120566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.120566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.935491 (E_RNA) where: Base-Base interactions energy: -1054.607 where: short stacking energy: -438.590 Base-Backbone interact. energy: -0.269 local terms energy: -442.059091 where: bonds (distance) C4'-P energy: -78.705 bonds (distance) P-C4' energy: -81.889 flat angles C4'-P-C4' energy: -97.319 flat angles P-C4'-P energy: -60.179 tors. eta vs tors. theta energy: -123.967 Dist. restrs. and SS energy: 2.065 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1433.366220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.366220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.758188 (E_RNA) where: Base-Base interactions energy: -1037.134 where: short stacking energy: -435.824 Base-Backbone interact. energy: -2.331 local terms energy: -432.292443 where: bonds (distance) C4'-P energy: -77.091 bonds (distance) P-C4' energy: -78.168 flat angles C4'-P-C4' energy: -90.837 flat angles P-C4'-P energy: -60.058 tors. eta vs tors. theta energy: -126.138 Dist. restrs. and SS energy: 1.642 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1345.669124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.669124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.458933 (E_RNA) where: Base-Base interactions energy: -970.721 where: short stacking energy: -384.352 Base-Backbone interact. energy: -0.289 local terms energy: -412.449136 where: bonds (distance) C4'-P energy: -76.003 bonds (distance) P-C4' energy: -82.907 flat angles C4'-P-C4' energy: -83.633 flat angles P-C4'-P energy: -57.328 tors. eta vs tors. theta energy: -112.578 Dist. restrs. and SS energy: 1.040 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -1314.196404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.196404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.034919 (E_RNA) where: Base-Base interactions energy: -949.298 where: short stacking energy: -362.236 Base-Backbone interact. energy: -3.352 local terms energy: -400.384770 where: bonds (distance) C4'-P energy: -77.638 bonds (distance) P-C4' energy: -80.778 flat angles C4'-P-C4' energy: -80.913 flat angles P-C4'-P energy: -51.953 tors. eta vs tors. theta energy: -109.102 Dist. restrs. and SS energy: 2.089 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1753.389822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1753.389822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1790.840247 (E_RNA) where: Base-Base interactions energy: -1287.175 where: short stacking energy: -521.687 Base-Backbone interact. energy: -0.986 local terms energy: -502.678528 where: bonds (distance) C4'-P energy: -87.893 bonds (distance) P-C4' energy: -86.160 flat angles C4'-P-C4' energy: -112.551 flat angles P-C4'-P energy: -70.230 tors. eta vs tors. theta energy: -145.844 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1721.218967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.218967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.358446 (E_RNA) where: Base-Base interactions energy: -1236.561 where: short stacking energy: -527.325 Base-Backbone interact. energy: -2.210 local terms energy: -520.587197 where: bonds (distance) C4'-P energy: -95.908 bonds (distance) P-C4' energy: -95.800 flat angles C4'-P-C4' energy: -107.778 flat angles P-C4'-P energy: -64.381 tors. eta vs tors. theta energy: -156.720 Dist. restrs. and SS energy: 1.389 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1640.807236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.807236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.307749 (E_RNA) where: Base-Base interactions energy: -1205.841 where: short stacking energy: -491.898 Base-Backbone interact. energy: -1.139 local terms energy: -471.328128 where: bonds (distance) C4'-P energy: -77.399 bonds (distance) P-C4' energy: -87.046 flat angles C4'-P-C4' energy: -103.883 flat angles P-C4'-P energy: -69.876 tors. eta vs tors. theta energy: -133.124 Dist. restrs. and SS energy: 0.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1586.165531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.165531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.548218 (E_RNA) where: Base-Base interactions energy: -1158.938 where: short stacking energy: -459.057 Base-Backbone interact. energy: -3.292 local terms energy: -461.318882 where: bonds (distance) C4'-P energy: -85.186 bonds (distance) P-C4' energy: -73.785 flat angles C4'-P-C4' energy: -104.498 flat angles P-C4'-P energy: -67.497 tors. eta vs tors. theta energy: -130.352 Dist. restrs. and SS energy: 0.633 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1555.676416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.676416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.393113 (E_RNA) where: Base-Base interactions energy: -1143.517 where: short stacking energy: -474.255 Base-Backbone interact. energy: -0.153 local terms energy: -449.722567 where: bonds (distance) C4'-P energy: -79.518 bonds (distance) P-C4' energy: -89.474 flat angles C4'-P-C4' energy: -95.424 flat angles P-C4'-P energy: -58.801 tors. eta vs tors. theta energy: -126.506 Dist. restrs. and SS energy: 0.967 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1477.369876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.369876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.743725 (E_RNA) where: Base-Base interactions energy: -1073.890 where: short stacking energy: -443.096 Base-Backbone interact. energy: -0.361 local terms energy: -441.492121 where: bonds (distance) C4'-P energy: -72.412 bonds (distance) P-C4' energy: -93.612 flat angles C4'-P-C4' energy: -89.956 flat angles P-C4'-P energy: -66.540 tors. eta vs tors. theta energy: -118.972 Dist. restrs. and SS energy: 1.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1442.442962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.442962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.038294 (E_RNA) where: Base-Base interactions energy: -1052.106 where: short stacking energy: -434.198 Base-Backbone interact. energy: -0.150 local terms energy: -427.782203 where: bonds (distance) C4'-P energy: -76.312 bonds (distance) P-C4' energy: -77.027 flat angles C4'-P-C4' energy: -88.834 flat angles P-C4'-P energy: -64.959 tors. eta vs tors. theta energy: -120.651 Dist. restrs. and SS energy: 0.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1433.930104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.930104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.697695 (E_RNA) where: Base-Base interactions energy: -1056.210 where: short stacking energy: -437.836 Base-Backbone interact. energy: -2.447 local terms energy: -413.041663 where: bonds (distance) C4'-P energy: -64.960 bonds (distance) P-C4' energy: -57.832 flat angles C4'-P-C4' energy: -104.007 flat angles P-C4'-P energy: -63.916 tors. eta vs tors. theta energy: -122.326 Dist. restrs. and SS energy: 1.018 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1354.292133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.292133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.703923 (E_RNA) where: Base-Base interactions energy: -986.739 where: short stacking energy: -393.207 Base-Backbone interact. energy: -0.823 local terms energy: -405.142147 where: bonds (distance) C4'-P energy: -75.446 bonds (distance) P-C4' energy: -78.114 flat angles C4'-P-C4' energy: -74.272 flat angles P-C4'-P energy: -66.448 tors. eta vs tors. theta energy: -110.861 Dist. restrs. and SS energy: 1.662 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -1303.827814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.827814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.551608 (E_RNA) where: Base-Base interactions energy: -938.736 where: short stacking energy: -386.125 Base-Backbone interact. energy: -1.326 local terms energy: -406.489492 where: bonds (distance) C4'-P energy: -61.326 bonds (distance) P-C4' energy: -92.998 flat angles C4'-P-C4' energy: -95.658 flat angles P-C4'-P energy: -53.088 tors. eta vs tors. theta energy: -103.420 Dist. restrs. and SS energy: 5.974 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1746.245047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.245047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.805329 (E_RNA) where: Base-Base interactions energy: -1265.995 where: short stacking energy: -531.652 Base-Backbone interact. energy: -2.014 local terms energy: -515.795425 where: bonds (distance) C4'-P energy: -90.367 bonds (distance) P-C4' energy: -95.075 flat angles C4'-P-C4' energy: -114.202 flat angles P-C4'-P energy: -74.632 tors. eta vs tors. theta energy: -141.520 Dist. restrs. and SS energy: 0.810 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1732.596767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.596767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.388396 (E_RNA) where: Base-Base interactions energy: -1249.437 where: short stacking energy: -527.283 Base-Backbone interact. energy: -2.481 local terms energy: -518.470392 where: bonds (distance) C4'-P energy: -96.237 bonds (distance) P-C4' energy: -95.403 flat angles C4'-P-C4' energy: -112.932 flat angles P-C4'-P energy: -61.972 tors. eta vs tors. theta energy: -151.926 Dist. restrs. and SS energy: 1.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1619.866105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.866105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.959342 (E_RNA) where: Base-Base interactions energy: -1186.836 where: short stacking energy: -496.990 Base-Backbone interact. energy: 1.400 local terms energy: -472.523416 where: bonds (distance) C4'-P energy: -79.119 bonds (distance) P-C4' energy: -86.454 flat angles C4'-P-C4' energy: -89.305 flat angles P-C4'-P energy: -76.884 tors. eta vs tors. theta energy: -140.762 Dist. restrs. and SS energy: 1.343 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1601.975919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.975919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.874411 (E_RNA) where: Base-Base interactions energy: -1171.504 where: short stacking energy: -485.858 Base-Backbone interact. energy: 0.301 local terms energy: -468.670667 where: bonds (distance) C4'-P energy: -86.771 bonds (distance) P-C4' energy: -83.865 flat angles C4'-P-C4' energy: -100.034 flat angles P-C4'-P energy: -58.325 tors. eta vs tors. theta energy: -139.675 Dist. restrs. and SS energy: 1.148 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1501.479123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.479123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.869787 (E_RNA) where: Base-Base interactions energy: -1076.197 where: short stacking energy: -429.120 Base-Backbone interact. energy: -0.728 local terms energy: -462.944883 where: bonds (distance) C4'-P energy: -82.865 bonds (distance) P-C4' energy: -90.323 flat angles C4'-P-C4' energy: -96.992 flat angles P-C4'-P energy: -73.203 tors. eta vs tors. theta energy: -119.562 Dist. restrs. and SS energy: 1.641 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1484.958415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.958415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.826259 (E_RNA) where: Base-Base interactions energy: -1080.534 where: short stacking energy: -434.188 Base-Backbone interact. energy: -2.805 local terms energy: -439.487452 where: bonds (distance) C4'-P energy: -79.164 bonds (distance) P-C4' energy: -93.313 flat angles C4'-P-C4' energy: -83.167 flat angles P-C4'-P energy: -61.621 tors. eta vs tors. theta energy: -122.222 Dist. restrs. and SS energy: 1.118 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1466.881106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.881106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.850211 (E_RNA) where: Base-Base interactions energy: -1060.738 where: short stacking energy: -440.475 Base-Backbone interact. energy: -0.788 local terms energy: -443.323612 where: bonds (distance) C4'-P energy: -77.222 bonds (distance) P-C4' energy: -73.319 flat angles C4'-P-C4' energy: -95.753 flat angles P-C4'-P energy: -70.674 tors. eta vs tors. theta energy: -126.356 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1435.234574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.234574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.978919 (E_RNA) where: Base-Base interactions energy: -1043.610 where: short stacking energy: -414.961 Base-Backbone interact. energy: -0.149 local terms energy: -429.219703 where: bonds (distance) C4'-P energy: -72.158 bonds (distance) P-C4' energy: -88.689 flat angles C4'-P-C4' energy: -96.940 flat angles P-C4'-P energy: -52.148 tors. eta vs tors. theta energy: -119.285 Dist. restrs. and SS energy: 0.994 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1359.768958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.768958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.634311 (E_RNA) where: Base-Base interactions energy: -977.594 where: short stacking energy: -377.503 Base-Backbone interact. energy: -2.775 local terms energy: -418.265354 where: bonds (distance) C4'-P energy: -80.731 bonds (distance) P-C4' energy: -80.717 flat angles C4'-P-C4' energy: -92.825 flat angles P-C4'-P energy: -52.861 tors. eta vs tors. theta energy: -111.131 Dist. restrs. and SS energy: 2.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -1329.871183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.871183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.250085 (E_RNA) where: Base-Base interactions energy: -992.183 where: short stacking energy: -405.246 Base-Backbone interact. energy: -1.261 local terms energy: -376.806146 where: bonds (distance) C4'-P energy: -60.037 bonds (distance) P-C4' energy: -62.802 flat angles C4'-P-C4' energy: -86.291 flat angles P-C4'-P energy: -48.897 tors. eta vs tors. theta energy: -118.779 Dist. restrs. and SS energy: 3.629 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1753.893915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1753.893915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1791.322037 (E_RNA) where: Base-Base interactions energy: -1281.504 where: short stacking energy: -536.729 Base-Backbone interact. energy: -2.137 local terms energy: -507.681096 where: bonds (distance) C4'-P energy: -91.169 bonds (distance) P-C4' energy: -94.000 flat angles C4'-P-C4' energy: -106.410 flat angles P-C4'-P energy: -70.093 tors. eta vs tors. theta energy: -146.009 Dist. restrs. and SS energy: 0.678 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1721.042884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.042884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.011260 (E_RNA) where: Base-Base interactions energy: -1241.926 where: short stacking energy: -524.557 Base-Backbone interact. energy: -4.525 local terms energy: -512.560469 where: bonds (distance) C4'-P energy: -92.931 bonds (distance) P-C4' energy: -90.939 flat angles C4'-P-C4' energy: -104.969 flat angles P-C4'-P energy: -71.420 tors. eta vs tors. theta energy: -152.301 Dist. restrs. and SS energy: 1.218 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1616.613333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.613333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.876213 (E_RNA) where: Base-Base interactions energy: -1175.273 where: short stacking energy: -491.873 Base-Backbone interact. energy: -1.157 local terms energy: -477.445784 where: bonds (distance) C4'-P energy: -70.955 bonds (distance) P-C4' energy: -95.502 flat angles C4'-P-C4' energy: -98.960 flat angles P-C4'-P energy: -71.957 tors. eta vs tors. theta energy: -140.071 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1585.545851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.545851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.596033 (E_RNA) where: Base-Base interactions energy: -1149.719 where: short stacking energy: -475.518 Base-Backbone interact. energy: -1.127 local terms energy: -472.750136 where: bonds (distance) C4'-P energy: -90.631 bonds (distance) P-C4' energy: -80.709 flat angles C4'-P-C4' energy: -99.026 flat angles P-C4'-P energy: -65.797 tors. eta vs tors. theta energy: -136.587 Dist. restrs. and SS energy: 1.300 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1523.740751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.740751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.517515 (E_RNA) where: Base-Base interactions energy: -1122.101 where: short stacking energy: -472.018 Base-Backbone interact. energy: -2.306 local terms energy: -438.110881 where: bonds (distance) C4'-P energy: -75.678 bonds (distance) P-C4' energy: -73.073 flat angles C4'-P-C4' energy: -90.207 flat angles P-C4'-P energy: -67.485 tors. eta vs tors. theta energy: -131.667 Dist. restrs. and SS energy: 2.027 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1472.700927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.700927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.675883 (E_RNA) where: Base-Base interactions energy: -1061.185 where: short stacking energy: -435.941 Base-Backbone interact. energy: -2.084 local terms energy: -447.407555 where: bonds (distance) C4'-P energy: -76.217 bonds (distance) P-C4' energy: -92.844 flat angles C4'-P-C4' energy: -93.297 flat angles P-C4'-P energy: -59.970 tors. eta vs tors. theta energy: -125.079 Dist. restrs. and SS energy: 1.225 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1424.874579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.874579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.543476 (E_RNA) where: Base-Base interactions energy: -1033.061 where: short stacking energy: -413.907 Base-Backbone interact. energy: -0.460 local terms energy: -430.022152 where: bonds (distance) C4'-P energy: -69.526 bonds (distance) P-C4' energy: -82.982 flat angles C4'-P-C4' energy: -95.709 flat angles P-C4'-P energy: -67.969 tors. eta vs tors. theta energy: -113.837 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1388.642451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.642451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.217427 (E_RNA) where: Base-Base interactions energy: -1012.291 where: short stacking energy: -397.870 Base-Backbone interact. energy: -0.803 local terms energy: -414.123729 where: bonds (distance) C4'-P energy: -80.470 bonds (distance) P-C4' energy: -64.135 flat angles C4'-P-C4' energy: -101.005 flat angles P-C4'-P energy: -60.753 tors. eta vs tors. theta energy: -107.761 Dist. restrs. and SS energy: 1.825 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1356.998255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.998255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.210563 (E_RNA) where: Base-Base interactions energy: -977.292 where: short stacking energy: -404.162 Base-Backbone interact. energy: 0.832 local terms energy: -420.750425 where: bonds (distance) C4'-P energy: -85.662 bonds (distance) P-C4' energy: -77.385 flat angles C4'-P-C4' energy: -91.444 flat angles P-C4'-P energy: -60.413 tors. eta vs tors. theta energy: -105.846 Dist. restrs. and SS energy: 3.462 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -1332.825949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.825949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.941368 (E_RNA) where: Base-Base interactions energy: -989.142 where: short stacking energy: -398.690 Base-Backbone interact. energy: 0.090 local terms energy: -383.888863 where: bonds (distance) C4'-P energy: -65.120 bonds (distance) P-C4' energy: -71.988 flat angles C4'-P-C4' energy: -77.593 flat angles P-C4'-P energy: -51.520 tors. eta vs tors. theta energy: -117.669 Dist. restrs. and SS energy: 3.365 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1755.519121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1755.519121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.974042 (E_RNA) where: Base-Base interactions energy: -1267.527 where: short stacking energy: -526.071 Base-Backbone interact. energy: -3.366 local terms energy: -522.081041 where: bonds (distance) C4'-P energy: -90.367 bonds (distance) P-C4' energy: -101.241 flat angles C4'-P-C4' energy: -105.439 flat angles P-C4'-P energy: -72.522 tors. eta vs tors. theta energy: -152.512 Dist. restrs. and SS energy: 0.705 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1697.040143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.040143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.818258 (E_RNA) where: Base-Base interactions energy: -1235.467 where: short stacking energy: -520.392 Base-Backbone interact. energy: -1.362 local terms energy: -497.989171 where: bonds (distance) C4'-P energy: -87.672 bonds (distance) P-C4' energy: -82.906 flat angles C4'-P-C4' energy: -108.622 flat angles P-C4'-P energy: -71.005 tors. eta vs tors. theta energy: -147.784 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1601.604252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.604252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.118489 (E_RNA) where: Base-Base interactions energy: -1150.309 where: short stacking energy: -481.876 Base-Backbone interact. energy: -1.835 local terms energy: -486.975142 where: bonds (distance) C4'-P energy: -83.536 bonds (distance) P-C4' energy: -88.436 flat angles C4'-P-C4' energy: -104.863 flat angles P-C4'-P energy: -63.954 tors. eta vs tors. theta energy: -146.186 Dist. restrs. and SS energy: 0.764 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1606.163547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.163547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.193395 (E_RNA) where: Base-Base interactions energy: -1190.555 where: short stacking energy: -500.912 Base-Backbone interact. energy: -0.458 local terms energy: -453.181038 where: bonds (distance) C4'-P energy: -73.515 bonds (distance) P-C4' energy: -78.924 flat angles C4'-P-C4' energy: -100.831 flat angles P-C4'-P energy: -65.463 tors. eta vs tors. theta energy: -134.447 Dist. restrs. and SS energy: 1.280 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1508.263808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.263808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1545.899696 (E_RNA) where: Base-Base interactions energy: -1101.159 where: short stacking energy: -448.690 Base-Backbone interact. energy: -2.696 local terms energy: -442.044113 where: bonds (distance) C4'-P energy: -86.156 bonds (distance) P-C4' energy: -91.033 flat angles C4'-P-C4' energy: -86.800 flat angles P-C4'-P energy: -50.203 tors. eta vs tors. theta energy: -127.851 Dist. restrs. and SS energy: 0.886 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1485.796943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.796943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.712746 (E_RNA) where: Base-Base interactions energy: -1095.893 where: short stacking energy: -457.895 Base-Backbone interact. energy: 1.346 local terms energy: -429.165868 where: bonds (distance) C4'-P energy: -73.689 bonds (distance) P-C4' energy: -92.685 flat angles C4'-P-C4' energy: -85.140 flat angles P-C4'-P energy: -57.262 tors. eta vs tors. theta energy: -120.390 Dist. restrs. and SS energy: 1.166 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1458.782276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.782276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.656810 (E_RNA) where: Base-Base interactions energy: -1052.054 where: short stacking energy: -439.448 Base-Backbone interact. energy: -0.273 local terms energy: -445.329125 where: bonds (distance) C4'-P energy: -82.829 bonds (distance) P-C4' energy: -77.161 flat angles C4'-P-C4' energy: -98.653 flat angles P-C4'-P energy: -66.147 tors. eta vs tors. theta energy: -120.540 Dist. restrs. and SS energy: 2.125 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1391.325179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.325179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.562337 (E_RNA) where: Base-Base interactions energy: -1023.099 where: short stacking energy: -414.733 Base-Backbone interact. energy: -0.510 local terms energy: -405.954211 where: bonds (distance) C4'-P energy: -93.079 bonds (distance) P-C4' energy: -69.647 flat angles C4'-P-C4' energy: -81.054 flat angles P-C4'-P energy: -55.627 tors. eta vs tors. theta energy: -106.549 Dist. restrs. and SS energy: 1.487 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1349.447681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.447681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.038146 (E_RNA) where: Base-Base interactions energy: -988.359 where: short stacking energy: -398.324 Base-Backbone interact. energy: -1.747 local terms energy: -397.932008 where: bonds (distance) C4'-P energy: -74.947 bonds (distance) P-C4' energy: -73.011 flat angles C4'-P-C4' energy: -84.266 flat angles P-C4'-P energy: -59.662 tors. eta vs tors. theta energy: -106.046 Dist. restrs. and SS energy: 1.840 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -1333.934414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.934414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.699054 (E_RNA) where: Base-Base interactions energy: -974.327 where: short stacking energy: -400.073 Base-Backbone interact. energy: 1.812 local terms energy: -401.184447 where: bonds (distance) C4'-P energy: -74.466 bonds (distance) P-C4' energy: -79.934 flat angles C4'-P-C4' energy: -86.309 flat angles P-C4'-P energy: -48.850 tors. eta vs tors. theta energy: -111.626 Dist. restrs. and SS energy: 3.015 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)